DOCSLIB.ORG

Modulation of NF-Κb Signalling by Microbial Pathogens

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Modulation of NF-Κb Signalling by Microbial Pathogens REVIEWS Modulation of NF‑κB signalling by microbial pathogens Masmudur M. Rahman and Grant McFadden Abstract | The nuclear factor-κB (NF‑κB) family of transcription factors plays a central part in the host response to infection by microbial pathogens, by orchestrating the innate and acquired host immune responses. The NF‑κB proteins are activated by diverse signalling pathways that originate from many different cellular receptors and sensors. Many successful pathogens have acquired sophisticated mechanisms to regulate the NF‑κB signalling pathways by deploying subversive proteins or hijacking the host signalling molecules. Here, we describe the mechanisms by which viruses and bacteria micromanage the host NF‑κB signalling circuitry to favour the continued survival of the pathogen. The nuclear factor-κB (NF-κB) family of transcription Signalling targets upstream of NF‑κB factors regulates the expression of hundreds of genes that NF-κB proteins are tightly regulated in both the cyto- are associated with diverse cellular processes, such as pro- plasm and the nucleus6. Under normal physiological liferation, differentiation and death, as well as innate and conditions, NF‑κB complexes remain inactive in the adaptive immune responses. The mammalian NF‑κB cytoplasm through a direct interaction with proteins proteins are members of the Rel domain-containing pro- of the inhibitor of NF-κB (IκB) family, including IκBα, tein family: RELA (also known as p65), RELB, c‑REL, IκBβ and IκBε (also known as NF-κBIα, NF-κBIβ and the NF-κB p105 subunit (also known as NF‑κB1; which NF-κBIε, respectively); IκB proteins mask the nuclear is cleaved into the p50 subunit) and the NF-κB p100 localization domains in the NF‑κB complex, thus subunit (also known as NF‑κB2; which is cleaved into retaining the transcription complex in the cytoplasm. the p52 subunit); these proteins can homodimerize or In response to diverse stimuli, various cellular immune heterodimerize through their conserved Rel homology receptors (such as Toll-like receptors (TLRs)) and domain to mediate gene transcription1,2. NF‑κB pro- cytokine receptors (such as the interleukin‑1 receptors teins are activated by a variety of diverse extracellular (IL‑1Rs), TNF receptors (TNFRs) and other TNFR-like or intracellular stimuli, including microbial pathogens receptors) can rapidly activate the NF‑κB complex fol- and pathogen-associated molecular patterns (PAMPs)3. lowing the appropriate pro-inflammatory stimulation. The NF‑κB signalling pathway is an attractive target for This activation is mediated by a signalling cascade that exploitation by microbial pathogens in order to mod- uses multiple adaptors (including TNFR-associated fac- ulate host cell events, as activation of NF‑κB is such a tors (TRAFs), myeloid differentiation primary response rapid response. Cytoplasmic NF‑κB complexes are trans- protein 88 (MYD88) and TIR domain-containing adap- ferred to the nucleus within minutes after exposure to tor protein (TIRAP)), as well as intermediate transduc- a pathogen or PAMPs, even in the absence of de novo ing molecules and kinases (including IL‑1R‑associated protein synthesis, and induce the expression of a broad kinases (IRAKs), receptor-interacting proteins (RIPs; spectrum of antimicrobial pro-inflammatory cellular also known as RIPKs) and NF-κB-inducing kinase (NIK; Department of Molecular response genes4,5. The central role of these transcription also known as MAP3K14)), to eventually lead to degra- Genetics and Microbiology, College of Medicine, factors in pathogen defence is highlighted by the fact dation of the inhibitory protein IκBα, thus liberating the University of Florida, that the NF‑κB signalling cascade is probably the most NF‑κB complexes for transport to the nucleus, where 1600 SW Archer Road, frequently targeted intracellular pathway for subver- they undergo further layers of regulation7 (FIG. 1). PO Box 100266, sion by anti-immune modulators that are encoded by a The receptor-mediated signalling events converge Gainesville, Florida, USA. wide spectrum of microbial pathogens4. In this Review, on the same core components of the NF‑κB activation Correspondence to G.M. e‑mail: [email protected] we describe some of the recent advances in our under- apparatus: the IκB kinase (IKK) complex, which is com- doi:10.1038/nrmicro2539 standing of the various mechanisms used by pathogens posed of two catalytic subunits, IKKα and IKKβ, and a Published online 8 March 2011 to modulate NF‑κB signalling. regulatory subunit, NEMO (NF-κB essential modulator; NATURE REVIEWS | MICROBIOLOGY VOLUME 9 | APRIL 2011 | 291 © 2011 Macmillan Publishers Limited. All rights reserved REVIEWS Classical pathway Alternative pathway kinases — including IKKi (inducible IKK; also known Diverse as IKKε) and TBK1 (TANK-binding kinase 1) — can TNFRs Antigen microbial TLRs Immune cytokine receptors and IL-1Rs receptors activate the NF‑κB pathway in response to microbial inducers infection11. TBK1 interacts with TANK, a TRAF-binding protein that activates NF‑κB by modulating the func- tion of TRAF2 and that also interacts with IKKi. TBK1 Adaptors enhances the enzymatic activity of IKKβ by direct phos- NIK phorylation, and thus contributes to NF‑κB activation12. Activation of the Activation Because of the essential role of IKKs and IκBα in the IKK complex of IKKα activation and regulation of NF‑κB signalling, these pro- NEMO IKKα IKKα teins (or their post-translational modifications) are often P P targeted directly by microbial pathogens to control the IKKα IKKβ IκBα Phosphorylation host immune responses. p105 RELA Phosphorylation of of p100 The NF‑κB pathway is classified as either classi- the IκBα and p105 cal (canonical) or alternative (non-canonical) on the P P IκBα p100 p100 basis of the IKK subunits that get activated by upstream P kinases13,14 (FIG. 1). In the classical pathway (for exam- p105 RELA ple, triggered by TNFR1 signalling), IKKβ and NEMO RELB Degradation of IκBα Processing of p100 become activated by adaptors (such as TRAFs) and then Processing of p105 phosphorylate p105 and IκBα to release the prototypi- cal heterodimer p50–RELA. In the alternative pathway p50 RELA p52 RELB (for example, triggered by lymphotoxin‑β receptor), Nuclear translocation Nuclear translocation IKKα is activated by NIK and then phosphorylates p100, which is subsequently cleaved to form p52. p52 then forms a heterodimer with RELB and translocates to the nucleus. This alternative pathway is triggered by a Nucleus p50 RELA p52 RELB subset of tumour necrosis factor (TNF) family members, including CD40, lymphotoxin‑β, B cell-activating factor (BAFF), receptor activator of NF‑κB ligand (RANKL) Activation of NF-κB-responsive genes and TNF-related weak inducer of apoptosis (TWEAK). By contrast, inflammatory cytokines, genotoxic stress, • Inflammation antigens and TLR stimulation tend to activate the clas- • Cell survival • Cytokines • Cell proliferation sical pathway. Both the classical and alternative pathways • Chemokines • Cell differentiation are modulated by microbial pathogens, as the two path- • Enzymes • Cell cycle arrest ways induce coordinated immune responses following • Adhesion molecules • Innate immune responses diverse infections. • Adaptive immune responses Outcome of NF‑κB activation Activation of NF‑κB is considered to be the central Figure 1 | The classical and alternative NF‑ B signalling pathways use a wide κ initiating cellular event of host responses to invasion variety of signals to control a diverse set of cellular responses.Nature Re viewsProtein | Micr levelsobiology and activity of signalling molecules can be regulated through post-translational by microbial pathogens. The presence of a functional modifications such as phosphorylation, ubiquitylation and acetylation. The activation of NF‑κB signalling cascade in the horseshoe crab, a species nuclear factor-κB (NF-κB) ultimately results in the transcription of genes that encode that is known as a ‘living fossil’, suggests that the pro- pro-inflammatory factors and factors that influence cell proliferation. IκBα, NF-κB teins involved are the evolutionarily conserved immune inhibitor-α (also known as NF-κBIα); IKK, IκB kinase; IL‑1R, interleukin‑1 receptor; NEMO, defence molecules15, and highlights the central role of NF-κB essential modulator (also known as IKKγ); NIK, NF-κB-inducing kinase (also known NF‑κB in upregulating the expression of genes encod- as MAP3K14); TLR, Toll-like receptor; TNFR, TNF receptor. ing chemokines, cytokines, adhesion molecules (such as intercellular adhesion molecule 1 (ICAM1)), enzymes that produce secondary inflammatory mediators, and inhibi- also known as IKKγ)8,9. Activation of the IKK complex tors of apoptosis. These molecules are key components induces phosphorylation of IκBα, followed by ubiquityl­ of the innate immune response to invading microorgan- ation by a specific cullin-RING ubiquitin ligase (CRL) isms and are required for the migration of inflammatory family SCFβTRCP complex, which contains SKP1 (S phase and phagocytic cells to the site of infection, where NF‑κB kinase-associated protein 1), cullin 1 and the F-box has been activated. The activated phagocytic cells kill, protein βTRCP as substrate adaptor; this SCFβTRCP ingest and degrade microbial pathogens and eventually complex specifically recognizes and degrades IκBα present the antigens to T cells after they re-migrate to that is phosphorylated on Ser32 and Ser36. As well as secondary lymphoid organs. The secreted cytokines, processing IκBα, the ubiquitylation–proteasome
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Acute Lymphoblastic Leukemia Patient with Variant ATF7IP
    ISSN 1941-5923 © Am J Case Rep, 2017; 18: 1204-1208 DOI: 10.12659/AJCR.906300 Received: 2017.07.20 Accepted: 2017.08.07 Acute Lymphoblastic Leukemia Patient with Published: 2017.11.14 Variant ATF7IP/PDGFRB Fusion and Favorable Response to Tyrosine Kinase Inhibitor Treatment: A Case Report Authors’ Contribution: BCDF 1,2 Ge Zhang* 1 Department of Pediatrics, Key Laboratory of Birth Defects and Related Diseases Study Design A BCD 1 Yanle Zhang* of Women and Children, Ministry of Health, West China Second University Data Collection B Hospital, Sichuan University, Chengdu, Sichuan, P.R. China Statistical Analysis C BD 1 Jianrong Wu 2 Department of Laboratory Medicine, West China Second University Hospital, Data Interpretation D AE 3 Yan Chen Sichuan University, Chengdu, Sichuan, P.R. China Manuscript Preparation E AE 1 Zhigui Ma 3 Department of Pediatrics, Affiliated Hospital of Zunyi Medical College, Zunyi, Literature Search F Guizhou, P.R. China Funds Collection G * Ge Zhang and Yanle Zhang contributed equally to this work Corresponding Authors: Zhigui Ma, e-mail: [email protected]; Yan Chen, e-mail: [email protected] Conflict of interest: None declared Patient: Female, 14-month-old Final Diagnosis: Acute lymphoblastic leukemia Symptoms: Fever Medication: — Clinical Procedure: — Specialty: Hematology Objective: Rare disease Background: Chromosomal translocations involving the PDGFRB gene have been reported in a broad spectrum of hemato- logical malignancies. An ATF7IP/PDGFRB fusion was recently identified in a Philadelphia chromosome-like (Ph- like) B-progenitor acute lymphoblastic leukemia (B-ALL) patient. Here we report on a special case of a Ph-like ALL patient who had a variant ATF7IP/PDGFRB fusion.
    [Show full text]
  • Calcium and Covid-19 1 Conflicts Over Calcium and the Treatment of Covid
    Calcium and Covid-19 1 Conflicts over calcium and the treatment of Covid-19 Bernard Crespi 1 and Joe Alcock 2 1 Department of Biological Sciences, 8888 University Drive, Simon Fraser University, Burnaby V5A1S6, British Columbia, Canada 2 Department of Emergency Medicine, University of New Mexico, Albuquerque, New Mexico 87131, USA Word counts: Abstract 147, Main Text 2966 © The Author(s) 2020. Published by Oxford University Press on behalf of the Foundation for Evolution, Medicine, and Public Health. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. Calcium and Covid-19 2 Abstract Several recent studies have provided evidence that use of calcium channel blockers, especially amlodipine and nifedipine, can reduce mortality from Covid-19. Moreover, hypocalcemia (a reduced level of serum ionized calcium) has been shown to be strongly positively associated with Covid-19 severity. Both effectiveness of CCBs as antiviral therapy, and positive associations of hypocalcemia with mortality, have been demonstrated for many other viruses as well. We evaluate these findings in the contexts of virus-host evolutionary conflicts over calcium metabolism, and hypocalcemia as either pathology, viral manipulation, or host defence against pathogens. Considerable evidence supports the hypothesis that hypocalcemia represents a host defence. Indeed, hypocalcemia may exert antiviral effects in a similar manner as do CCBs, through interference with calcium metabolism in virus-infected cells. Prospective clinical studies that address the efficacy of CCBs and hypocalcemia should provide novel insights into the pathogenicity and treatment of Covid-19 and other viruses.
    [Show full text]
  • Prioritization and Comprehensive Analysis of Genes Associated with Melanoma
    ONCOLOGY LETTERS 18: 127-136, 2019 Prioritization and comprehensive analysis of genes associated with melanoma CHENG FENG, MING BAI, HAILIN ZHANG, ANG ZENG and WENCHAO ZHANG Department of Plastic Surgery, Peking Union Medical College Hospital, Beijing 100730, P.R. China Received August 13, 2018; Accepted February 28, 2019 DOI: 10.3892/ol.2019.10284 Abstract. Melanoma is a malignant tumor derived from accuracy and appropriate treatment due to medical advances, melanocytes, which occurs mostly in the skin. A major chal- its pathogenesis and natural course remain unclear. lenge in cancer research is the biological interpretation of the Melanoma is a malignant type of tumor, which may be complexity of cancer somatic mutation profiles. The aim of the composed of epidermal melanocytes, nevocytes or dermal present study was to obtain a comprehensive understanding of melanocytes. Epidemiology studies revealed that melanoma the formation and development of melanoma and to identify its is likely to be caused by hereditary factors and environmental associated genes. In the present study, a pipeline was proposed risk factors, including sex, age, ethnicity and geographic loca- for investigating key genes associated with melanoma based tion (6,7). This is in line with the most vital and potentially on the Online Mendelian Inheritance in Man and Search Tool reversible risk factor of malignant melanoma arising from for the Retrieval of Interacting Genes/Proteins databases an interaction between environmental exposure and genetic through a random walk model. Additionally, functional enrich- susceptibility. Gandini et al (8) revealed the association ment analysis was performed for key genes associated with between melanoma and ultraviolet (UV)-irradiation, and melanoma.
    [Show full text]
  • Guide for Common Viral Diseases of Animals in Louisiana
    Sampling and Testing Guide for Common Viral Diseases of Animals in Louisiana Please click on the species of interest: Cattle Deer and Small Ruminants The Louisiana Animal Swine Disease Diagnostic Horses Laboratory Dogs A service unit of the LSU School of Veterinary Medicine Adapted from Murphy, F.A., et al, Veterinary Virology, 3rd ed. Cats Academic Press, 1999. Compiled by Rob Poston Multi-species: Rabiesvirus DCN LADDL Guide for Common Viral Diseases v. B2 1 Cattle Please click on the principle system involvement Generalized viral diseases Respiratory viral diseases Enteric viral diseases Reproductive/neonatal viral diseases Viral infections affecting the skin Back to the Beginning DCN LADDL Guide for Common Viral Diseases v. B2 2 Deer and Small Ruminants Please click on the principle system involvement Generalized viral disease Respiratory viral disease Enteric viral diseases Reproductive/neonatal viral diseases Viral infections affecting the skin Back to the Beginning DCN LADDL Guide for Common Viral Diseases v. B2 3 Swine Please click on the principle system involvement Generalized viral diseases Respiratory viral diseases Enteric viral diseases Reproductive/neonatal viral diseases Viral infections affecting the skin Back to the Beginning DCN LADDL Guide for Common Viral Diseases v. B2 4 Horses Please click on the principle system involvement Generalized viral diseases Neurological viral diseases Respiratory viral diseases Enteric viral diseases Abortifacient/neonatal viral diseases Viral infections affecting the skin Back to the Beginning DCN LADDL Guide for Common Viral Diseases v. B2 5 Dogs Please click on the principle system involvement Generalized viral diseases Respiratory viral diseases Enteric viral diseases Reproductive/neonatal viral diseases Back to the Beginning DCN LADDL Guide for Common Viral Diseases v.
    [Show full text]
  • Significant Shortest Paths for the Detection of Putative Disease Modules
    bioRxiv preprint doi: https://doi.org/10.1101/2020.04.01.019844; this version posted April 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. SIGNIFICANT SHORTEST PATHS FOR THE DETECTION OF PUTATIVE DISEASE MODULES Daniele Pepe1 1Department of Oncology, KU Leuven, LKI–Leuven Cancer Institute, Leuven, Belgium Email address: DP: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.04.01.019844; this version posted April 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Keywords Structural equation modeling, significant shortest paths, pathway analysis, disease modules. Abstract Background The characterization of diseases in terms of perturbated gene modules was recently introduced for the analysis of gene expression data. Some approaches were proposed in literature, but many times they are inductive approaches. This means that starting directly from data, they try to infer key gene networks potentially associated to the biological phenomenon studied. However they ignore the biological information already available to characterize the gene modules. Here we propose the detection of perturbed gene modules using the combination of data driven and hypothesis-driven approaches relying on biological metabolic pathways and significant shortest paths tested by structural equation modeling.
    [Show full text]
  • Hemagglutinin Stalk- and Neuraminidase-Specific
    crossmark Hemagglutinin Stalk- and Neuraminidase-Specific Monoclonal Antibodies Protect against Lethal H10N8 Influenza Virus Infection in Mice Teddy John Wohlbold,a,b Veronika Chromikova,a Gene S. Tan,a Philip Meade,a,b Fatima Amanat,a Phillip Comella,a,b Ariana Hirsh,a Florian Krammera Department of Microbiology, Icahn School of Medicine at Mount Sinai, New York, New York, USAa; Graduate School of Biomedical Sciences, Icahn School of Medicine at Mount Sinai, New York, New York, USAb ABSTRACT Downloaded from Between November 2013 and February 2014, China reported three human cases of H10N8 influenza virus infection in the Jiangxi province, two of which were fatal. Using hybridoma technology, we isolated a panel of H10- and N8-directed monoclonal anti- bodies (MAbs) and further characterized the binding reactivity of these antibodies (via enzyme-linked immunosorbent assay) to a range of purified virus and recombinant protein substrates. The H10-directed MAbs displayed functional hemagglutination inhibition (HI) and neutralization activity, and the N8-directed antibodies displayed functional neuraminidase inhibition (NI) activity against H10N8. Surprisingly, the HI-reactive H10 antibodies, as well as a previously generated, group 2 hemagglutinin (HA) stalk-reactive antibody, demonstrated NI activity against H10N8 and an H10N7 strain; this phenomenon was absent when virus was treated with detergent, suggesting the anti-HA antibodies inhibited neuraminidase enzymatic activity through steric hindrance. We tested the prophylactic efficacy of one representative H10-reactive, N8-reactive, and group 2 HA stalk-reactive http://jvi.asm.org/ antibody in vivo using a BALB/c challenge model. All three antibodies were protective at a high dose (5 mg/kg).
    [Show full text]
  • 1 Tumor Suppressor PLK2 May Serve As a Biomarker in Triple-Negative Breast Cancer for Improved Response to PLK1 Therapeutics
    bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448722; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Tumor suppressor PLK2 may serve as a biomarker in triple-negative breast cancer for improved response to PLK1 therapeutics Yang Gao1, 2, 3, Elena B. Kabotyanski1, 2, Elizabeth Villegas7, Jonathan H. Shepherd8, Deanna Acosta1, 2, Clark Hamor1, 2, Tingting Sun2,4,5, Celina Montmeyor-Garcia9, Xiaping He8, Lacey E. Dobrolecki1, 2, 3, Thomas F. Westbrook2, 4, 5, Michael T. Lewis1, 2, 3, Susan G. Hilsenbeck2, 3, Xiang H.-F. Zhang1, 2, 3, 6, Charles M. Perou8 and Jeffrey M. Rosen1, 2 1Department of Molecular and Cellular Biology 2Dan L. Duncan Cancer Center 3Lester and Sue Smith Breast Center 4Department of Molecular and Human Genetics 5Verna & Marrs McLean Department of Biochemistry and Molecular Biology 6McNair Medical Institute Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA 7University of Houston-Downtown, Houston, TX 77002, USA 8The University of North Carolina at Chapel Hill, Chapel Hill, NC 27599, USA 9 Canadian Blood Services, Toronto, ON M5G 2M1, Canada Correspondence to Jeffrey M. Rosen (Mail Stop: BCM130, Room: BCM-M638a, Baylor College of Medicine, 1 Baylor Plaza, Houston, TX 77030. Office: 713-798-6210. Fax: 713-898-8012. Email: [email protected]) 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448722; this version posted June 16, 2021.
    [Show full text]
  • Laboratory Mouse Models for the Human Genome-Wide Associations
    Laboratory Mouse Models for the Human Genome-Wide Associations The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Kitsios, Georgios D., Navdeep Tangri, Peter J. Castaldi, and John P. A. Ioannidis. 2010. Laboratory mouse models for the human genome-wide associations. PLoS ONE 5(11): e13782. Published Version doi:10.1371/journal.pone.0013782 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:8592157 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Laboratory Mouse Models for the Human Genome-Wide Associations Georgios D. Kitsios1,4, Navdeep Tangri1,6, Peter J. Castaldi1,2,4,5, John P. A. Ioannidis1,2,3,4,5,7,8* 1 Institute for Clinical Research and Health Policy Studies, Tufts Medical Center, Boston, Massachusetts, United States of America, 2 Tufts University School of Medicine, Boston, Massachusetts, United States of America, 3 Department of Hygiene and Epidemiology, University of Ioannina School of Medicine and Biomedical Research Institute, Foundation for Research and Technology-Hellas, Ioannina, Greece, 4 Tufts Clinical and Translational Science Institute, Tufts Medical Center, Boston, Massachusetts, United States of America, 5 Department of Medicine, Center for Genetic Epidemiology and Modeling, Tufts Medical Center, Tufts University
    [Show full text]
  • MAPK1/MAPK3 Monoclonal Antibody, Clone Sb46b
    MAPK1/MAPK3 monoclonal antibody, clone SB46b Catalog # : MAB3337 規格 : [ 500 ug ] List All Specification Application Image Product Mouse monoclonal antibody raised against recombinant Western Blot Description: MAPK1/MAPK3. Immunogen: Recombinant protein corresponding to human MAPK1/MAPK3. Host: Mouse enlarge Reactivity: Human Immunoprecipitation Specificity: human Erk 1 and human Erk2. Form: Liquid Isotype: IgG2a Recommend Western Blot (1-2 ug/mL) Usage: Immunoprecipitation (10-15ug) The optimal working dilution should be determined by the end user. Storage Buffer: In 100 mM BBS, pH 8.0 Storage Store at 4°C. Instruction: Datasheet: Download Publication Reference 1. Hydrophobic as well as charged residues in both MEK1 and ERK2 are important for their proper docking. Xu Be, Stippec S, Robinson FL, Cobb MH.J Biol Chem. 2001 Jul 13;276(28):26509-15. Epub 2001 May 14. 2. Mitogen-activated protein (MAP) kinase pathways: regulation and physiological functions. Pearson G, Robinson F, Beers Gibson T, Xu BE, Karandikar M, Berman K, Cobb MH.Endocr Rev. 2001 Apr;22(2):153-83. 3. Molecular cloning, expression, and characterization of the human mitogen-activated protein kinase p44erk1. Charest DL, Mordret G, Harder KW, Jirik F, Pelech SL.Mol Cell Biol. 1993 Aug;13(8):4679-90. Applications Western Blot Page 1 of 3 2021/6/20 Human PBMC (Lane 1) and spleen lysate (Lane 2) was stained with MAPK1/3 monoclonal antibody, clone SB46b (Cat # MAB3337). Goat anti-Mouse IgG2a was used to develop. Immunoprecipitation MAPK1 MAPK3 Gene Information Entrez GeneID: 5595 Gene Name: MAPK3 Gene Alias: ERK1,HS44KDAP,HUMKER1A,MGC20180,P44ERK1,P44MAPK,PRKM3 Gene mitogen-activated protein kinase 3 Description: Omim ID: 601795 Gene Ontology: Hyperlink Gene Summary: The protein encoded by this gene is a member of the MAP kinase family.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Genome-Wide Association Study to Identify Genomic Regions And
    www.nature.com/scientificreports OPEN Genome‑wide association study to identify genomic regions and positional candidate genes associated with male fertility in beef cattle H. Sweett1, P. A. S. Fonseca1, A. Suárez‑Vega1, A. Livernois1,2, F. Miglior1 & A. Cánovas1* Fertility plays a key role in the success of calf production, but there is evidence that reproductive efciency in beef cattle has decreased during the past half‑century worldwide. Therefore, identifying animals with superior fertility could signifcantly impact cow‑calf production efciency. The objective of this research was to identify candidate regions afecting bull fertility in beef cattle and positional candidate genes annotated within these regions. A GWAS using a weighted single‑step genomic BLUP approach was performed on 265 crossbred beef bulls to identify markers associated with scrotal circumference (SC) and sperm motility (SM). Eight windows containing 32 positional candidate genes and fve windows containing 28 positional candidate genes explained more than 1% of the genetic variance for SC and SM, respectively. These windows were selected to perform gene annotation, QTL enrichment, and functional analyses. Functional candidate gene prioritization analysis revealed 14 prioritized candidate genes for SC of which MAP3K1 and VIP were previously found to play roles in male fertility. A diferent set of 14 prioritized genes were identifed for SM and fve were previously identifed as regulators of male fertility (SOD2, TCP1, PACRG, SPEF2, PRLR). Signifcant enrichment results were identifed for fertility and body conformation QTLs within the candidate windows. Gene ontology enrichment analysis including biological processes, molecular functions, and cellular components revealed signifcant GO terms associated with male fertility.
    [Show full text]