DOCSLIB.ORG

(12) Patent Application Publication (10) Pub. No.: US 2015/0072349 A1 Diamandis Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(12) Patent Application Publication (10) Pub. No.: US 2015/0072349 A1 Diamandis Et Al US 201500 72349A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2015/0072349 A1 Diamandis et al. (43) Pub. Date: Mar. 12, 2015 (54) CANCER BOMARKERS AND METHODS OF (52) U.S. Cl. USE CPC. G0IN33/57484 (2013.01); G0IN 2333/705 (2013.01) (71) Applicant: University Health Network, Toronto USPC ......................................... 435/6.12: 435/7.94 (CA) (57) ABSTRACT A method of evaluating a probability a Subject has a cancer, (72) Inventors: Eleftherios P. Diamandis, Toronto diagnosing a cancer and/or monitoring cancer progression (CA); Ioannis Prassas, Toronto (CA); comprising: a. measuring an amount of a biomarker selected Shalini Makawita, Toronto (CA); from the group consisting of CUZD1 and/or LAMC2 and/or Caitlin Chrystoja, Toronto (CA); Hari the group CUZD1, LAMC2, AQP8, CELA2B, CELA3B, M. Kosanam, Maple (CA) CTRB1, CTRB2, GCG, IAPP, INS, KLK1, PNLIPRP1, PNLIPRP2, PPY, PRSS3, REG3G, SLC30A8, KLK3, NPY, (21) Appl. No.: 14/385,449 PSCA, RLN1, SLC45A3, DSP GP73, DSG2, CEACAM7, CLCA1, GPA33, LEFTY1, ZG16, IRX5, LAMP3, MFAP4, (22) PCT Fled: Mar. 15, 2013 SCGB1A1, SFTPC, TMEM100, NPY, PSCA RLN1 and/or SLC45A3 in a test sample from a subject with cancer; (86) PCT NO.: PCT/CA2O13/OOO248 wherein the cancer is pancreas cancer if CUZD1, LAMC2, S371 (c)(1), AQP8, CELA2B, CELA3B, CTRB1, CTRB2, GCG, LAPP (2) Date: Sep. 23, 2014 INS, KLK1, PNLIPRP1, PNLIPRP2, PPY, PRSS3, REG3G, SLC30A8, DSP GP73 and/or DSG2 is selected; the cancer is colon cancer if CEACAM7, CLCA1, GPA33, LEFTY 1 and/ Related U.S. Application Data or ZG16 is selected, the cancer is lung cancer if IRX5, (60) Provisional application No. 61/611,955, filed on Mar. LAMP3, MFAP4, SCGB1A1, SFTPC and/or TMEM100 is 16, 2012. selected; or the cancer is prostate cancer if NPY. PSCA, RLN1 and/or SLC45A3 is selected; b. comparing the mea Sured amount to a control and detecting an increase in the Publication Classification amount of the biomarker compared to control; and c. identi fying the Subject as having or having an increased probability (51) Int. C. of having the cancer when an increase in the biomarker com GOIN33/574 (2006.01) pared to control is detected. Patent Application Publication US 2015/0072349 A1 |Jop??eroes |pe??uep?sule,old eueSÐÁJe/\ ººqeueÐlunºH?911 auas)un‘HE?IL'II-o:SLSH• |3.Infil Patent Application Publication Mar. 12, 2015 Sheet 2 of 18 US 2015/0072349 A1 O G o GP C s N v- S. C c e-n n oq SS O O SR O U C : 5 D .9- C D o R. h-s Qd (My O O O O OO O O VH (%) AllAsues O S. o CP O N N OY S. g 8O C - 5 S st & u- Ces 9 <C 5 CU2 3 OS Ol Q9 M O O ?y O OO O O OOL O8 O9 Ot/ O O (%) AllAsues Patent Application Publication Mar. 12, 2015 Sheet 3 of 18 US 2015/0072349 A1 FIGURE 4 CUZD1 PCOOOO1 4. O CA19-9 P<0.0001 0 8500 6000 :1 OOO w . 850 600 g 350 1 OO Healthy Benign Cancer Patent Application Publication Mar. 12, 2015 Sheet 4 of 18 US 2015/0072349 A1 FIGURE 5A ROC (Healthy vs Cancer) 3 8 8 S. - CUZD1 (AUC=0.826) S - - CA19.9 (AUC=0.816) 100 80 60 40 2O O Specificity (%) Patent Application Publication Mar. 12, 2015 Sheet 5 of 18 US 2015/0072349 A1 FIGURE 5B 83 ROC (Benign vs Cancer) S. - CUZD1 (AUC=0.849) S - - CA19.9 (AUC=0.827) 100 80 60 40 20 O Specificity (%) Patent Application Publication Mar. 12, 2015 Sheet 6 of 18 US 2015/0072349 A1 FIGURE 5C AUC (95% CI) - a CA 9-9 O84 (0.76-092) - CUZD1+CA19-9 094 (089-099) g- T -- -- O-4 O6 8. -O 1 - Specificaty Patent Application Publication Mar. 12, 2015 Sheet 7 of 18 US 2015/0072349 A1 FIGURE 6 CA9-9 LAMC2 PCOOOO1 - X 8 - A. P-OOOO X w y t Healthy Benign Cancer DSG2 p=0.023 Patent Application Publication Mar. 12, 2015 Sheet 8 of 18 US 2015/0072349 A1 FIGURE 7A ROC (Healthy vs Cancer) C 9 d OO C &S to 2. > C C) O) o w - DSG2 (AUC=O.801) S LAMC2 (AUC=0.866) - - CA199 (AUC=0.816) C 100 80 60 40 20 O Specificity (%) Patent Application Publication Mar. 12, 2015 Sheet 9 of 18 US 2015/0072349 A1 FIGURE 7B ROC (Benign vs Cancer) o 9 d o d SS to > i CO c w - DSG2 (AUC=0.645) o LAMC2 (AUC=0.787) N - - CA199 (AUC=0.827) o 100 8O 60 40 2O O Specificity (%) Patent Application Publication Mar. 12, 2015 Sheet 10 of 18 US 2015/0072349 A1 FGURE 8A i) p40 0001 ii) p40 0001 --p=0.3098 rp20-4553 86 - 88- r- 10000 - 66 4. pk0 0001 46 w 6 --- 2 s 2000 * - Se is 9. 20 this set syst wns st 3 4 5 FIGURE 8B; 0.8 2 t s 0.4 0.2- - CUZOl ACs0.79 (0.71-86) - - - A199 AUc=0.82 (0.75-0.38) cuzo-CA19.9, AUC=0.86 (0.80-092) Q0 ---------------- 0.0 0.2 0.4 0.8 0.8 0. - Specificity Patent Application Publication Mar. 12, 2015 Sheet 11 of 18 US 2015/0072349 A1 FIGURE 9A i) ii) p:00009 p=0.065 s re 90 O pro SS s si----- is 70 50 600 s: a 30 ... -- wa So 2000 s s gs 6 3 2 Healthy Benign Stage B Stage V Healthy Benign Stage 18 Stage IV OAC PAC FIGURE 9B. 10 0.8 0.6 04 0.2 a- CA99, AUC=O,81 (0.70-0.92) - - - CUAD, AUC=O.79 (0.67-0.90) CUZD1+CA99, AUC=0.84 (0.75-0.94 0.0 ----- 0.0 0.2 0.4 0.6 0.8 1- Specificity Patent Application Publication Mar. 12, 2015 Sheet 12 of 18 US 2015/0072349 A1 FIGURE 10 suuuu A. r-Trn- s p=0.002 pK.900" p<0.0001 - PTrl p:0.007 70 - p40.0001 8S - g 50 1,6 60 s0.08 - 45 . " r 23 -it- 25 s S is a 2. O. p<0.0001 - - t- - - - E -TR) -- F 2002 p=0.004 p:00 =0C2 ps:0.002 pro.2 P p=0.8 :a. 13:o 1 , . - 50 w v. Patent Application Publication Mar. 12, 2015 Sheet 15 of 18 US 2015/0072349 A1 FIGURE 11E 1.O. 0.8 0.6 e e 2 8 0.4 0.2 - CA19-9, AUC=0.76 (0.68-084) --- CUZD1 AUC=0.77 (0.69-084) LAMC2, AUC=0.71 (0.62-0.79) 0.0 00 0.2 0.4 0.6 0.8 10 1 - Specificity FIGURE 11F 10 0.8 0.6 % 0.4 0.2 - CA19-9, AUC=0.76 (0.68-084) -a-- CA19-9+CUZOl, AUC=0.84 (0.77-090) CA19.9+LAMC2, AUC=0.8l (0.74–0.88) CA199+CUZOl+LAMC2, AUC=0.87 (0.81-093) 0. 0.0 0.2 0.4 0.6 0.8 O 1 - Specificity Patent Application Publication Mar. 12, 2015 Sheet 16 of 18 US 2015/0072349 A1 FIGURE 11G 1.0 0.8 0.6 2 W O.4 0.2 - CA19-9, AUC=0.81 (0.77–086) : --- CUZD1, AJC=0.74 (0.69-0.80) on LAMC2, AJC=0.75 (0.69-080) 0.0 - ----- O.O 0.2 0.4 0.6 0.8 10 1 - Specificity FIGURE 11H 10 O.8 s 0.6 t s i. g '. V : O4 0.2 a- CA19-9, AUC=0.8l (0.77-0.86) -- a CA199+CUZD, AUC= 0.87 (0.84-0.91) CA199+LAMC2, AUC=0.86 (0.83-0.90) 0.0 0.2 0.4 0.6 0.8 O 1 - Specificity Patent Application Publication Mar. 12, 2015 Sheet 17 of 18 US 2015/0072349 A1 FIGURE 12A Specificity Sensitivity CA19-9., CUZD1 - - - - - - - ... * * (37IU/ml). (2.2ng/ml). ng/ml). - Benign (N=130) 83% (108/130) Resectable Cancers (N=51) 49% (25/51) 53% (27/51) Maybe Resectable Cancers (N=150) 74% (111/150) 54% (81/150) 59% (88/150) Non-Resectable Cancers (N=49) 80% (39/49) 80% (39/59) 55% (27/49). Cutoffs: Ca19.9- 37 IU/m CUZD1 = 2.2 ng/ml LAMC2= 176 ng/ml FIGURE 12B Specificity/Sensitivit CA19.9 (37 CA19.9 - CUZD1 + ... IU/ml) CA19.9 +CUZD1 CA19.9 + LAMC2 LAMC2 Benign (N=130) 83% (108/130) 75% (97/130) 77% (100/130) 72% (93/130) Resectable Cancers (N=51) 49% (25/51) 69% (35/51) 61% (31/511), 76% (39/51) Maybe Resectable Cancers (N=150) 74% (111/150) 83% (125/150) 83% (124/150) 89% (133/150) Non-Resectable Cancers (N=49) 80% (39/49). 94% (47/59) 82% (40/49) 94% (46/49) Cutoffs: Ca19.9- 37 U/ml CUZD1 = 3 ng/ml LAMC2= 293 ng/ml An example of optimized cutoffs for combination of markers: Cutoffs: Ca19.9= 58 IU/m CUZD1 = 3.6 ng/ml LAMC2= 410 ng/ml Patent Application Publication Mar. 12, 2015 Sheet 18 of 18 US 2015/0072349 A1 FIGURE 3: CA199 & CUZD1 (at same specificity) | soivri -: ufu OZho US 2015/0072349 A1 Mar. 12, 2015 CANCER BOMARKERS AND METHODS OF cancer, wherein the cancer is pancreas cancerif CUZD1, USE LAMC2, AQP8, CELA2B, CELA3B, CTRB1, CTRB2, GCG, IAPP, INS, KLK1, PNLIPRP1, PNLIPRP2, PPY, RELATED APPLICATIONS PRSS3, REG3G, SLC30A8, DSP GP73 and/or DSG2 is 0001.
Load more

Recommended publications
  • Chromosomal Aberrations in Head and Neck Squamous Cell Carcinomas in Norwegian and Sudanese Populations by Array Comparative Genomic Hybridization
    825-843 12/9/08 15:31 Page 825 ONCOLOGY REPORTS 20: 825-843, 2008 825 Chromosomal aberrations in head and neck squamous cell carcinomas in Norwegian and Sudanese populations by array comparative genomic hybridization ERIC ROMAN1,2, LEONARDO A. MEZA-ZEPEDA3, STINE H. KRESSE3, OLA MYKLEBOST3,4, ENDRE N. VASSTRAND2 and SALAH O. IBRAHIM1,2 1Department of Biomedicine, Faculty of Medicine and Dentistry, University of Bergen, Jonas Lies vei 91; 2Department of Oral Sciences - Periodontology, Faculty of Medicine and Dentistry, University of Bergen, Årstadveien 17, 5009 Bergen; 3Department of Tumor Biology, Institute for Cancer Research, Rikshospitalet-Radiumhospitalet Medical Center, Montebello, 0310 Oslo; 4Department of Molecular Biosciences, University of Oslo, Blindernveien 31, 0371 Oslo, Norway Received January 30, 2008; Accepted April 29, 2008 DOI: 10.3892/or_00000080 Abstract. We used microarray-based comparative genomic logical parameters showed little correlation, suggesting an hybridization to explore genome-wide profiles of chromosomal occurrence of gains/losses regardless of ethnic differences and aberrations in 26 samples of head and neck cancers compared clinicopathological status between the patients from the two to their pair-wise normal controls. The samples were obtained countries. Our findings indicate the existence of common from Sudanese (n=11) and Norwegian (n=15) patients. The gene-specific amplifications/deletions in these tumors, findings were correlated with clinicopathological variables. regardless of the source of the samples or attributed We identified the amplification of 41 common chromosomal carcinogenic risk factors. regions (harboring 149 candidate genes) and the deletion of 22 (28 candidate genes). Predominant chromosomal alterations Introduction that were observed included high-level amplification at 1q21 (harboring the S100A gene family) and 11q22 (including Head and neck squamous cell carcinoma (HNSCC), including several MMP family members).
    [Show full text]
  • Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
    Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo
    [Show full text]
  • Supplementary Information Integrative Analyses of Splicing in the Aging Brain: Role in Susceptibility to Alzheimer’S Disease
    Supplementary Information Integrative analyses of splicing in the aging brain: role in susceptibility to Alzheimer’s Disease Contents 1. Supplementary Notes 1.1. Religious Orders Study and Memory and Aging Project 1.2. Mount Sinai Brain Bank Alzheimer’s Disease 1.3. CommonMind Consortium 1.4. Data Availability 2. Supplementary Tables 3. Supplementary Figures Note: Supplementary Tables are provided as separate Excel files. 1. Supplementary Notes 1.1. Religious Orders Study and Memory and Aging Project Gene expression data1. Gene expression data were generated using RNA- sequencing from Dorsolateral Prefrontal Cortex (DLPFC) of 540 individuals, at an average sequence depth of 90M reads. Detailed description of data generation and processing was previously described2 (Mostafavi, Gaiteri et al., under review). Samples were submitted to the Broad Institute’s Genomics Platform for transcriptome analysis following the dUTP protocol with Poly(A) selection developed by Levin and colleagues3. All samples were chosen to pass two initial quality filters: RNA integrity (RIN) score >5 and quantity threshold of 5 ug (and were selected from a larger set of 724 samples). Sequencing was performed on the Illumina HiSeq with 101bp paired-end reads and achieved coverage of 150M reads of the first 12 samples. These 12 samples will serve as a deep coverage reference and included 2 males and 2 females of nonimpaired, mild cognitive impaired, and Alzheimer's cases. The remaining samples were sequenced with target coverage of 50M reads; the mean coverage for the samples passing QC is 95 million reads (median 90 million reads). The libraries were constructed and pooled according to the RIN scores such that similar RIN scores would be pooled together.
    [Show full text]
  • Autism Multiplex Family with 16P11.2P12.2 Microduplication Syndrome in Monozygotic Twins and Distal 16P11.2 Deletion in Their Brother
    European Journal of Human Genetics (2012) 20, 540–546 & 2012 Macmillan Publishers Limited All rights reserved 1018-4813/12 www.nature.com/ejhg ARTICLE Autism multiplex family with 16p11.2p12.2 microduplication syndrome in monozygotic twins and distal 16p11.2 deletion in their brother Anne-Claude Tabet1,2,3,4, Marion Pilorge2,3,4, Richard Delorme5,6,Fre´de´rique Amsellem5,6, Jean-Marc Pinard7, Marion Leboyer6,8,9, Alain Verloes10, Brigitte Benzacken1,11,12 and Catalina Betancur*,2,3,4 The pericentromeric region of chromosome 16p is rich in segmental duplications that predispose to rearrangements through non-allelic homologous recombination. Several recurrent copy number variations have been described recently in chromosome 16p. 16p11.2 rearrangements (29.5–30.1 Mb) are associated with autism, intellectual disability (ID) and other neurodevelopmental disorders. Another recognizable but less common microdeletion syndrome in 16p11.2p12.2 (21.4 to 28.5–30.1 Mb) has been described in six individuals with ID, whereas apparently reciprocal duplications, studied by standard cytogenetic and fluorescence in situ hybridization techniques, have been reported in three patients with autism spectrum disorders. Here, we report a multiplex family with three boys affected with autism, including two monozygotic twins carrying a de novo 16p11.2p12.2 duplication of 8.95 Mb (21.28–30.23 Mb) characterized by single-nucleotide polymorphism array, encompassing both the 16p11.2 and 16p11.2p12.2 regions. The twins exhibited autism, severe ID, and dysmorphic features, including a triangular face, deep-set eyes, large and prominent nasal bridge, and tall, slender build. The eldest brother presented with autism, mild ID, early-onset obesity and normal craniofacial features, and carried a smaller, overlapping 16p11.2 microdeletion of 847 kb (28.40–29.25 Mb), inherited from his apparently healthy father.
    [Show full text]
  • Mouse CELA3B ORF Mammalian Expression Plasmid, C-His Tag
    Mouse CELA3B ORF mammalian expression plasmid, C-His tag Catalog Number: MG53134-CH General Information Plasmid Resuspension protocol Gene : chymotrypsin-like elastase family, 1. Centrifuge at 5,000×g for 5 min. member 3B 2. Carefully open the tube and add 100 l of sterile water to Official Symbol : CELA3B dissolve the DNA. Synonym : Ela3; Ela3b; AI504000; 0910001F22Rik; 2310074F01Rik 3. Close the tube and incubate for 10 minutes at room Source : Mouse temperature. cDNA Size: 810bp 4. Briefly vortex the tube and then do a quick spin to RefSeq : NM_026419.2 concentrate the liquid at the bottom. Speed is less than Description 5000×g. Lot : Please refer to the label on the tube 5. Store the plasmid at -20 ℃. Vector : pCMV3-C-His Shipping carrier : The plasmid is ready for: Each tube contains approximately 10 μg of lyophilized plasmid. • Restriction enzyme digestion Storage : • PCR amplification The lyophilized plasmid can be stored at ambient temperature for three months. • E. coli transformation Quality control : • DNA sequencing The plasmid is confirmed by full-length sequencing with primers in the sequencing primer list. E.coli strains for transformation (recommended Sequencing primer list : but not limited) pCMV3-F： 5’ CAGGTGTCCACTCCCAGGTCCAAG 3’ Most commercially available competent cells are appropriate for pcDNA3-R ： 5’ GGCAACTAGAAGGCACAGTCGAGG 3’ the plasmid, e.g. TOP10, DH5α and TOP10F´. Or Forward T7 ： 5’ TAATACGACTCACTATAGGG 3’ ReverseBGH ： 5’ TAGAAGGCACAGTCGAGG 3’ pCMV3-F and pcDNA3-R are designed by Sino Biological Inc. Customers can order the primer pair from any oligonucleotide supplier. Manufactured By Sino Biological Inc., FOR RESEARCH USE ONLY. NOT FOR USE IN HUMANS.
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • Supp Material.Pdf
    Supplementary Information Estrogen-mediated Epigenetic Repression of Large Chromosomal Regions through DNA Looping Pei-Yin Hsu, Hang-Kai Hsu, Gregory A. C. Singer, Pearlly S. Yan, Benjamin A. T. Rodriguez, Joseph C. Liu, Yu-I Weng, Daniel E. Deatherage, Zhong Chen, Julia S. Pereira, Ricardo Lopez, Jose Russo, Qianben Wang, Coral A. Lamartiniere, Kenneth P. Nephew, and Tim H.-M. Huang S1 Method Immunofluorescence staining Approximately 2,000 mammosphere-derived epithelial cells (MDECs) cells seeded collagen I-coated coverslips were fixed with methanol/acetone for 10 min. After blocking with 2.5% bovine serum albumin (Sigma) for 1 hr, these cells were incubated with anti-ESR1 antibody (Santa Cruz) overnight at 4˚C. The corresponding secondary FITC-conjugated antibody was applied followed by DAPI staining (Molecular Probes) for the nuclei. Photographs were captured by Zeiss fluorescence microscopy (Zeiss). The percentages of ESR1 subcellular localization were calculated in ten different optical fields (~10 cells per field) by two independent researchers. References Carroll, J.S., Meyer, C.A., Song, J., Li, W., Geistlinger, T.R., Eeckhoute, J., Brodsky, A.S., Keeton, E.K., Fertuck, K.C., Hall, G.F., et al. 2006. Genome-wide analysis of estrogen receptor binding sites. Nat. Genet. 38: 1289-1297. Neve, R.M., Chin, K., Fridlyand, J., Yeh, J., Baehner, F.L., Fevr, T., Clark, L., Bayani, N., Coppe, J.P., Tong, F., et al. 2006. A collection of breast cancer cell lines for the study of functionally distinct cancer subtypes. Cancer Cell 10: 515-527. S2 Hsu et al. Supplementary Information A Figure S1. Integrative mapping of large genomic regions subjected to ERα-mediated epigenetic repression.
    [Show full text]
  • Analysis of the Indacaterol-Regulated Transcriptome in Human Airway
    Supplemental material to this article can be found at: http://jpet.aspetjournals.org/content/suppl/2018/04/13/jpet.118.249292.DC1 1521-0103/366/1/220–236$35.00 https://doi.org/10.1124/jpet.118.249292 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS J Pharmacol Exp Ther 366:220–236, July 2018 Copyright ª 2018 by The American Society for Pharmacology and Experimental Therapeutics Analysis of the Indacaterol-Regulated Transcriptome in Human Airway Epithelial Cells Implicates Gene Expression Changes in the s Adverse and Therapeutic Effects of b2-Adrenoceptor Agonists Dong Yan, Omar Hamed, Taruna Joshi,1 Mahmoud M. Mostafa, Kyla C. Jamieson, Radhika Joshi, Robert Newton, and Mark A. Giembycz Departments of Physiology and Pharmacology (D.Y., O.H., T.J., K.C.J., R.J., M.A.G.) and Cell Biology and Anatomy (M.M.M., R.N.), Snyder Institute for Chronic Diseases, Cumming School of Medicine, University of Calgary, Calgary, Alberta, Canada Received March 22, 2018; accepted April 11, 2018 Downloaded from ABSTRACT The contribution of gene expression changes to the adverse and activity, and positive regulation of neutrophil chemotaxis. The therapeutic effects of b2-adrenoceptor agonists in asthma was general enriched GO term extracellular space was also associ- investigated using human airway epithelial cells as a therapeu- ated with indacaterol-induced genes, and many of those, in- tically relevant target. Operational model-fitting established that cluding CRISPLD2, DMBT1, GAS1, and SOCS3, have putative jpet.aspetjournals.org the long-acting b2-adrenoceptor agonists (LABA) indacaterol, anti-inflammatory, antibacterial, and/or antiviral activity. Numer- salmeterol, formoterol, and picumeterol were full agonists on ous indacaterol-regulated genes were also induced or repressed BEAS-2B cells transfected with a cAMP-response element in BEAS-2B cells and human primary bronchial epithelial cells by reporter but differed in efficacy (indacaterol $ formoterol .
    [Show full text]
  • PMC6851141.Pdf
    ARTICLE https://doi.org/10.1038/s41467-019-12515-9 OPEN Genome-wide association study of eosinophilic granulomatosis with polyangiitis reveals genomic loci stratified by ANCA status Paul A Lyons et al.# Eosinophilic granulomatosis with polyangiitis (EGPA) is a rare inflammatory disease of unknown cause. 30% of patients have anti-neutrophil cytoplasmic antibodies (ANCA) spe- 1234567890():,; cific for myeloperoxidase (MPO). Here, we describe a genome-wide association study in 676 EGPA cases and 6809 controls, that identifies 4 EGPA-associated loci through conventional case-control analysis, and 4 additional associations through a conditional false discovery rate approach. Many variants are also associated with asthma and six are associated with eosi- nophil count in the general population. Through Mendelian randomisation, we show that a primary tendency to eosinophilia contributes to EGPA susceptibility. Stratification by ANCA reveals that EGPA comprises two genetically and clinically distinct syndromes. MPO+ ANCA EGPA is an eosinophilic autoimmune disease sharing certain clinical features and an HLA-DQ association with MPO+ ANCA-associated vasculitis, while ANCA-negative EGPA may instead have a mucosal/barrier dysfunction origin. Four candidate genes are targets of therapies in development, supporting their exploration in EGPA. *email: [email protected] #A full list of authors and their affiliations appears at the end of the paper. NATURE COMMUNICATIONS | (2019) 10:5120 | https://doi.org/10.1038/s41467-019-12515-9 | www.nature.com/naturecommunications 1 ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-019-12515-9 osinophilic granulomatosis with polyangiitis (EGPA), once 176 (33%) were positive for ANCA, and of the 164 who were Enamed Churg-Strauss syndrome, has a unique combination positive for specific ANCA by ELISA, 159 (97%) had MPO+ of clinical features that have some overlap with the other ANCA and five PR3 + ANCA.
    [Show full text]
  • Cellular Heterogeneity During Mouse Pancreatic Ductal Adenocarcinoma Progression at Single-Cell Resolution
    Cellular heterogeneity during mouse pancreatic ductal adenocarcinoma progression at single-cell resolution Abdel Nasser Hosein, … , Udit Verma, Rolf A. Brekken JCI Insight. 2019. https://doi.org/10.1172/jci.insight.129212. Research In-Press Preview Gastroenterology Oncology Pancreatic ductal adenocarcinoma (PDA) is a major cause of cancer-related death with limited therapeutic options available. This highlights the need for improved understanding of the biology of PDA progression, a highly complex and dynamic process featuring changes in cancer cells and stromal cells. A comprehensive characterization of PDA cancer cell and stromal cell heterogeneity during disease progression is lacking. In this study, we aimed to profile cell populations and understand their phenotypic changes during PDA progression. To that end, we employed single-cell RNA sequencing technology to agnostically profile cell heterogeneity during different stages of PDA progression in genetically engineered mouse models. Our data indicate that an epithelial-to-mesenchymal transition of cancer cells accompanies tumor progression in addition to distinct populations of macrophages with increasing inflammatory features. We also noted the existence of three distinct molecular subtypes of fibroblasts in the normal mouse pancreas, which ultimately gave rise to two distinct populations of fibroblasts in advanced PDA, supporting recent reports on intratumoral fibroblast heterogeneity. Our data also suggest that cancer cells and fibroblasts may be dynamically regulated by epigenetic
    [Show full text]
  • Hippo and Sonic Hedgehog Signalling Pathway Modulation of Human Urothelial Tissue Homeostasis
    Hippo and Sonic Hedgehog signalling pathway modulation of human urothelial tissue homeostasis Thomas Crighton PhD University of York Department of Biology November 2020 Abstract The urinary tract is lined by a barrier-forming, mitotically-quiescent urothelium, which retains the ability to regenerate following injury. Regulation of tissue homeostasis by Hippo and Sonic Hedgehog signalling has previously been implicated in various mammalian epithelia, but limited evidence exists as to their role in adult human urothelial physiology. Focussing on the Hippo pathway, the aims of this thesis were to characterise expression of said pathways in urothelium, determine what role the pathways have in regulating urothelial phenotype, and investigate whether the pathways are implicated in muscle-invasive bladder cancer (MIBC). These aims were assessed using a cell culture paradigm of Normal Human Urothelial (NHU) cells that can be manipulated in vitro to represent different differentiated phenotypes, alongside MIBC cell lines and The Cancer Genome Atlas resource. Transcriptomic analysis of NHU cells identified a significant induction of VGLL1, a poorly understood regulator of Hippo signalling, in differentiated cells. Activation of upstream transcription factors PPARγ and GATA3 and/or blockade of active EGFR/RAS/RAF/MEK/ERK signalling were identified as mechanisms which induce VGLL1 expression in NHU cells. Ectopic overexpression of VGLL1 in undifferentiated NHU cells and MIBC cell line T24 resulted in significantly reduced proliferation. Conversely, knockdown of VGLL1 in differentiated NHU cells significantly reduced barrier tightness in an unwounded state, while inhibiting regeneration and increasing cell cycle activation in scratch-wounded cultures. A signalling pathway previously observed to be inhibited by VGLL1 function, YAP/TAZ, was unaffected by VGLL1 manipulation.
    [Show full text]
  • [CELA3B/1257] Cat
    CELA3B Antibody [CELA3B/1257] Cat. No.: 33-782 CELA3B Antibody [CELA3B/1257] IHC testing of FFPE mouse pancreas with Elastase 3B antibody (clone IHC testing of FFPE rat pancreas with Elastase 3B antibody (clone CELA3B/1257). Required HIER: boil CELA3B/1257). Required HIER: boil tissue sections in 10mM Tris with 1mM tissue sections in 10mM Tris with 1mM EDTA, pH 9, for 10-20 min followed by cooling at RT for 20 min. EDTA, pH 9, for 10-20 min followed by cooling at RT for 20 min. SDS-PAGE Analysis of Purified, BSA- Free Elastase 3B Antibody (clone CELA3B/1257). Confirmation of Integrity and Purity of the Antibody. Specifications HOST SPECIES: Mouse September 30, 2021 1 https://www.prosci-inc.com/cela3b-antibody-cela3b-1257-33-782.html SPECIES REACTIVITY: Human, Mouse, Rat A partial recombinant protein (aa 82-238) was used as the immunogen for the Elastase 3B IMMUNOGEN: antibody. TESTED APPLICATIONS: ELISA, Flow, IF, IHC-P, WB ELISA: 2-4 ug/ml; order BSA free format for coating Flow Cytometry: 0.5-1ug/10^6 cells in 0.1ml IF: 1-2 ug/ml APPLICATIONS: IHC-P: 1-2 ug/ml for 30 min at RT Optimal dilution of the Elastase 3B antibody should be determined by the researcher. 1. FFPE staining requires Properties PURIFICATION: Protein G CLONALITY: Monoclonal ISOTYPE: IgG1 CONJUGATE: Unconjugated PHYSICAL STATE: Liquid BUFFER: PBS with 0.1 mg/ml BSA and 0.05% sodium azide CONCENTRATION: 0.2 mg/mL STORAGE CONDITIONS: Aliquot and Store at 2-8˚C. Avoid freez-thaw cycles.
    [Show full text]