DOCSLIB.ORG

{'Ess': 0, 'Noness': 3} True 70007 AAGATCTAAAACTTTACACTAG []

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
{'Ess': 0, 'Noness': 3} True 70007 AAGATCTAAAACTTTACACTAG [] uag2uaa_1_13_window gene gene_ogee gene_essentiality site_index cbe_targets abe_targets 0 1 OR4F5 {'ess': 0, 'noness': 3} True 70007 AAGATCTAAAACTTTACACTAG [] 1 1 PERM1 unavailable False 976171 TGGCTCCTAGGAGCTGGGGCTG [] 2 1 RNF223 unavailable False 1071816 TGGCCCTAATTATCAGTCAGAG [] 3 1 TTLL10 {'ess': 0, 'noness': 7} True 1185524 CCTTAGCTAGGGAGAGTCCGGG [] 4 1 TTLL10 {'ess': 0, 'noness': 7} True 1197846 TGGCTGCCCCTAGGGCCTCGCG[] 5 1 TNFRSF18 {'ess': 0, 'noness': 7} True 1203590 TCCTAAGACCCCACCCCATCAG [] 6 1 ACAP3 {'ess': 0, 'noness': 7} True 1293563 CCGGCCCTAGCTCTCTTCCAGG [] 7 1 CPTP unavailable False 1327762 CCCGCCCCTAGGGCAGGTCCAG[] 8 1 MXRA8 {'ess': 0, 'noness': 7} True 1353603 CCTATTTGCAGTTCTCCTTCCG [] 9 1 MRPL20 {'ess': 6, 'noness': 2} False 1402568 TGGCCTAGGGTAACCCTTTAAG [] 10 1 ATAD3B {'ess': 0, 'noness': 7} True 1495816 CCAGTGCCTACAACAGGGGGTG [] 11 1 MMP23B {'ess': 0, 'noness': 7} True 1634328 TCACTACACTTTCCCTTTCTTG [] 12 1 NADK {'ess': 4, 'noness': 5} False 1752903 -1 -1 13 1 CALML6 {'ess': 1, 'noness': 7} True 1917192 CTGCACCTACTGGATCAGCTTG [] 14 1 PRKCZ {'ess': 1, 'noness': 7} True 2157294 GGGACGCCCTAGTAGCTGGCTG [] 15 1 SKI {'ess': 2, 'noness': 6} False 2306764 GGAATCTACGGCTCCAGCTCCG [] 16 1 MORN1 {'ess': 0, 'noness': 7} True 2355447 CGTCTGATCCTAGAAGAGTGAG [] 17 1 RER1 {'ess': 1, 'noness': 5} False 2403123 TCCCGCTTCTAGCTGGCGAAGG [] 18 1 PRXL2B unavailable False 2589478 AGCACACCTAGGGCAGCAGACG [] 19 1 MMEL1 {'ess': 1, 'noness': 7} True 2590989 TTGGCTACCACACGCGGCATCG [] 20 1 ARHGEF16 {'ess': 0, 'noness': 7} True 3480586 GCTACACGTCCGTCTCCACCCG [] 21 1 MEGF6 {'ess': 1, 'noness': 7} True 3490527 GCCTCTACTAGTGCCTCGCTGG [] 22 1 TPRG1L {'ess': 0, 'noness': 7} True 3628602 CAGCGGCTAAAAGCCTATTTTG [] 23 1 WRAP73 unavailable False 3630974 GCTGCTACGTGTGGCCGCCCAG [] 24 1 CCDC27 {'ess': 0, 'noness': 7} True 3768596 ACTACGGCTGGATCCCAAACTG [] 25 1 CCDC27 {'ess': 0, 'noness': 7} True 3771522 CCTGGCTGGGCCTACTTGGAGG [] 26 1 C1orf174 {'ess': 0, 'noness': 7} True 3889959 CCCCTACATTTCTGCATCATCG [] 27 1 CHD5 {'ess': 1, 'noness': 6} True 6106279 GCTAGATATCTGTCAAAAAAAG [] 28 1 RNF207 {'ess': 0, 'noness': 7} True 6219406 GTCCCATTTGCTAAGTCGGGTG [] 29 1 GPR153 {'ess': 0, 'noness': 7} True 6249337 GGTCCTAGGACGCGGAGCCCAG [] 30 1 ACOT7 {'ess': 0, 'noness': 7} True 6264596 GGAGTCTAGGGCTGAGGCTCCG [] 31 1 HES2 {'ess': 0, 'noness': 7} True 6418872 GAGGGGCTACCACGGCCGCCAG[] 32 1 ESPN {'ess': 1, 'noness': 6} True 6446423 CAGCCCTGCTAGTGCCTGCTCG ['CTTCCCCCCACCCTCCTTCCAG', 'GTGCCTGCTCACCTTCCCCCCG'] 33 1 ESPN {'ess': 1, 'noness': 6} True 6460145 CGGCCTCTAGTACTTAGCGATG [] 34 1 ZBTB48 {'ess': 0, 'noness': 7} True 6589211 GGGCTATGTGTCACAGTCCTCG [] 35 1 KLHL21 {'ess': 0, 'noness': 7} True 6593364 CTGGGGCTAGTGCAGCTCATCG [] 36 1 PARK7 {'ess': 0, 'noness': 7} True 7985053 TGCTCTAGTCTTTAAGAACAAG [] 37 1 ERRFI1 {'ess': 0, 'noness': 7} True 8013209 GGTCTAAGGAGAAACCACATAG [] 38 1 SLC2A7 {'ess': 0, 'noness': 7} True 9003299 CCACTAAAAGGAAGTTTCCTTG [] 39 1 SLC2A7 {'ess': 0, 'noness': 7} True 9007486 GAGCTGCACCTAGATGTCTGGG [] 40 1 SLC2A5 {'ess': 0, 'noness': 7} True 9041620 TGGCCTGCTATGTTGGCTCGGG [] 41 1 PIK3CD {'ess': 4, 'noness': 3} False 9727045 CCACTACTGCCTGTTGTCTTTG [] 42 1 CTNNBIP1 {'ess': 0, 'noness': 7} True 9850717 GCTTTGCAGCTACTGCCTCCGG [] 43 1 NMNAT1 {'ess': 0, 'noness': 1} False 9982700 AATTCCTATGTCTTAGCTTCTG [] 44 1 UBE4B {'ess': 4, 'noness': 4} False 10171136 CAAGCTCCTAGGAAATCACAGG [] 45 1 DFFA {'ess': 0, 'noness': 7} True 10461489 GCTGCTGCTATGTGGGATCCTG [] 46 1 PEX14 {'ess': 2, 'noness': 5} False 10629986 GCCCTAGTCCCGCTCACTCTCG [] 47 1 CASZ1 {'ess': 0, 'noness': 7} True 10638941 CGCCGCTAGGGCGAGGAGGCTG[] 48 1 TARDBP {'ess': 2, 'noness': 5} False 11022653 ACTGTCTACATTCCCCAGCCAG [] 49 1 MASP2 {'ess': 0, 'noness': 7} True 11044939 GGAGGCTAGAGGCTCTGCTCTG [] 50 1 EXOSC10 {'ess': 9, 'noness': 2} False 11066717 CCAGGACTATCTCTGTGGCCAG [] 51 1 MTOR {'ess': 8, 'noness': 1} False 11185573 GCACTCTAGCCTGAACAGAGTG [] 52 1 DISP3 unavailable False 11536685 CCGGGCTATAGGGAGGCCCCTG [] 53 1 DRAXIN unavailable False 11719695 GGGCCGCTAGACGTTGATGAAG [] 54 1 AGTRAP {'ess': 0, 'noness': 7} True 11750103 TAGGCACTACGGTCCTGAGAAG [] 55 1 C1orf167 {'ess': 0, 'noness': 1} False 11789458 ATTCTATGAGAACAAGTCACAG [] 56 1 MTHFR {'ess': 0, 'noness': 7} True 11790539 CCAGTCTAGCTGCCATTGTCAG [] 57 1 MFN2 {'ess': 6, 'noness': 2} False 12011564 GTGCCCACTATCTGCTGGGCTG [] 58 1 TNFRSF1B {'ess': 2, 'noness': 6} False 12195193 CAGGCCCTACTTTATAAAACAG [] 59 1 DHRS3 {'ess': 0, 'noness': 7} True 12568339 CTGTCTCTATGTCCGCCCTTTG [] 60 1 PRAMEF1 {'ess': 0, 'noness': 7} True 12795995 CCTTCCCTAGCAGCAAAGATGG [] 61 1 PRAMEF2 {'ess': 0, 'noness': 7} True 12861778 CCTTCCCTAGCAGCAAAGATGG [] 62 1 PRAMEF10 {'ess': 0, 'noness': 7} True 12892915 CCTTCCCTAGGAGCAAAGATGG [] 63 1 PRAMEF13 {'ess': 0, 'noness': 3} True 13196822 CCTTCCCTAGCAGCAAAGATGG [] 64 1 PRAMEF18 {'ess': 0, 'noness': 4} True 13223331 CTAGGCAGGCCTTCCCCACAAG [] 65 1 PRAMEF33 unavailable False 13308886 CCTTCCCTAGGAGCAAAGATGG [] 66 1 PRAMEF14 {'ess': 0, 'noness': 3} True 13342527 CCTTCCCTAGCAGCAAAGATGG [] 67 1 PRAMEF19 unavailable False 13369066 CCCACTAGGCAGGCCTTCCCCG [] 68 1 PRAMEF17 {'ess': 1, 'noness': 6} True 13392501 CCTTCACTAAGAGCAAAGATGG [] 69 1 PRDM2 {'ess': 0, 'noness': 7} True 13786526 CTTTTCTACAGGAAGTTCCTAG [] 70 1 PRDM2 {'ess': 0, 'noness': 7} True 13816546 AGTGTCTACTCTTTGAAGAATG [] 71 1 FHAD1 {'ess': 0, 'noness': 3} True 15383157 TCCCATCTACTAATGAGGAAAG [] 72 1 FHAD1 {'ess': 0, 'noness': 3} True 15397412 GTTTCTCTAGTACTTTCCACTG [] 73 1 EFHD2 {'ess': 0, 'noness': 7} True 15428723 CCCGCTACTTAAAGGTGGACTG [] 74 1 CTRC {'ess': 1, 'noness': 7} True 15446770 ACCTGTCTAATGCAGGGTGGGG [] 75 1 SLC25A34 {'ess': 0, 'noness': 7} True 15739405 CCGTCGTCTAGGTGCCCTTGTG [] 76 1 SRARP unavailable False 16006345 CAGCTAATCGGCCTGCCCACAG [] 77 1 MST1L unavailable False 16757231 CTGGGCCTAACCCAGTCTCATG [] 78 1 MFAP2 {'ess': 0, 'noness': 7} True 16974919 ACCACCCTAGCAGCTCCCACAG [] 79 1 ATP13A2 {'ess': 0, 'noness': 7} True 16985984 TTATTTGCTACACTGACAGCAG [] 80 1 ATP13A2 {'ess': 0, 'noness': 7} True 16986220 CCTGCACTACCTCAGGGGGCCG [] 81 1 PADI6 unavailable False 17401437 GGGTCTAAGGTACCATCTTCCG ['CTTCCACCATTTGAAGGCAAAG'] 82 1 ARHGEF10L{'ess': 0, 'noness': 7} True 17697379 GGAGGCGCTATAGCATCAAGGG [] 83 1 KLHDC7A {'ess': 0, 'noness': 7} True 18483314 GACTGCTAGACCCTGGTCTGAG [] 84 1 PAX7 {'ess': 0, 'noness': 7} True 18744928 GGGCCCTAGTAGGCCTGGCCAG [] 85 1 TAS1R2 {'ess': 0, 'noness': 7} True 18839598 ATGGCACTAGTCCCTCCTCATG [] 86 1 AKR7A3 {'ess': 0, 'noness': 7} True 19282730 ATGGGCCTAGCGGAAGTAGTTG [] 87 1 AKR7A2 {'ess': 0, 'noness': 7} True 19304224 ATGGGCCTAGCGGAAGTAGTTG [] 88 1 TMCO4 {'ess': 0, 'noness': 7} True 19745463 AAAAACCTAGCCCAGGGTCTGG [] 89 1 OTUD3 {'ess': 0, 'noness': 7} True 19907663 TGTGGCTACCTCTGCTCTCCAG [] 90 1 PLA2G5 {'ess': 0, 'noness': 7} True 20090691 GGAGGCCTAGGAGCAGAGGATG [] 91 1 PLA2G2D {'ess': 0, 'noness': 7} True 20114113 GCTTCTAGCACCCAGGGGTCTG [] 92 1 PLA2G2F {'ess': 0, 'noness': 7} True 20148400 GAGGCTCTAGGGAGGGGCGGGG[] 93 1 PLA2G2C {'ess': 0, 'noness': 3} True 20163259 CAGGCTAGCCCAGGCTTTTTTG [] 94 1 PLA2G2C {'ess': 0, 'noness': 3} True 20163990 GTCCCTAGCACCAGGGCTTATG [] 95 1 VWA5B1 {'ess': 0, 'noness': 3} True 20354262 ACTCAACTACACATAATTCGGG [] 96 1 RAP1GAP {'ess': 1, 'noness': 6} True 21597719 GGCCCGGCTAACAGCCCTGCAG [] 97 1 USP48 {'ess': 3, 'noness': 5} False 21705869 TATACCTAATTACTGCATGACG [] 98 1 HSPG2 {'ess': 0, 'noness': 5} True 21823315 AGGTGCCTACGAGGGGCAGGGG [] 99 1 CELA3B {'ess': 0, 'noness': 7} True 21989278 TTGGTTCTAGTGGCTTGCTATG [] 100 1 CELA3A {'ess': 0, 'noness': 7} True 22012466 TTGGTTCTAGTGGCTTGCTATG [] 101 1 EPHA8 {'ess': 0, 'noness': 7} True 22589378 CTTTTCTAAAGGCAATGAAGAG [] 102 1 C1QC {'ess': 0, 'noness': 7} True 22647782 GCCCGCCCTAGTCGGGGAAGAG [] 103 1 HTR1D {'ess': 1, 'noness': 5} False 23193085 ATAAGACTAGGAGGCCTTCCGG [] 104 1 HNRNPR {'ess': 0, 'noness': 7} True 23310453 TACTTGTCTACTTCCACTGTTG [] 105 1 TCEA3 {'ess': 0, 'noness': 7} True 23381474 GCAGAACTACAAAACCAGAAAG [] 106 1 ASAP3 {'ess': 0, 'noness': 7} True 23429855 CAAGGAGCTAGTCTTGCAAAAG [] 107 1 STPG1 unavailable False 24358542 GTGACATCCCTACAGAACCGGG [] 108 1 NIPAL3 {'ess': 0, 'noness': 7} True 24454096 GAGAGCTAAGATTGTACCACTG [] 109 1 SRRM1 {'ess': 7, 'noness': 1} False 24672285 ATTTCCCCCTAAGACTGTGGGG [] 110 1 MACO1 unavailable False 25491356 TCGATGTCTATAAATTAGCCTG [] 111 1 LDLRAP1 {'ess': 0, 'noness': 7} True 25565415 TTTCTAACAGCTCTGGACAACG [] 112 1 SELENON unavailable False 25815717 GGCACTCTAGGGCTGGAGGAGG [] 113 1 STMN1 {'ess': 1, 'noness': 6} True 25885722 AAGTACCTAGTGATGGTGAGAG [] 114 1 PAFAH2 {'ess': 0, 'noness': 7} True 25961988 GTTGTGCCTACAGGCTGGACAG [] 115 1 EXTL1 {'ess': 2, 'noness': 5} False 26035346 GCCCCCCTAGGGCTTCTCCAGG [] 116 1 TRIM63 {'ess': 0, 'noness': 7} True 26053803 ATTGCCAATGTCTAACACAGTG [] 117 1 C1orf232 unavailable False 26164160 GCCTGCTAGTCACCCTTGGGCG [] 118 1 GPN2 {'ess': 7, 'noness': 1} False 26879676 CCTTGTTGCTACAGCTGCATGG [] 119 1 NUDC {'ess': 7, 'noness': 1} False 26946180 AACAGGGGCTAGTTGAATTTAG [] 120 1 WDTC1 {'ess': 1, 'noness': 7} True 27306382 GGGTCTAGCTGGGCCGGCACTG [] 121 1 SYTL1 {'ess': 0, 'noness': 6} True 27353851 GGGGCTACGTCCTGGGGGCCAG[] 122 1 FCN3 {'ess': 0, 'noness': 7} True 27369235 TGCCCTATCGAAGCATCATCCG [] 123 1 GPR3 {'ess': 0, 'noness': 7} True 27394790 ACTCAGCTAGACATCACTGGGG [] 124 1 AHDC1 {'ess': 0, 'noness': 5} True 27547303 TTGGCACTACAGGGATGTGACG [] 125 1 FGR {'ess': 1, 'noness': 6} True 27612913 GACAGGCTATGTCTGATCCCCG [] 126 1 IFI6 {'ess': 1, 'noness': 7} True 27666380 TGGCTACTCCTCATCCTCCTCG ['CTCCTCACTATCGAGATACTTG'] 127 1 FAM76A
Load more

Recommended publications
  • Supplemental Note Hominoid Fission of Chromosome 14/15 and Role Of
    Supplemental Note Supplemental Note Hominoid fission of chromosome 14/15 and role of segmental duplications Giuliana Giannuzzi, Michele Pazienza, John Huddleston, Francesca Antonacci, Maika Malig, Laura Vives, Evan E. Eichler and Mario Ventura 1. Analysis of the macaque contig spanning the hominoid 14/15 fission site We grouped contig clones based on their FISH pattern on human and macaque chromosomes (Groups F1, F2, F3, G1, G2, G3, and G4). Group F2 clones (Hsa15b- and Hsa15c-positive) showed a single signal on macaque 7q and three signal clusters on human chromosome 15: at the orthologous 15q26, as expected, as well as at 15q11–14 and 15q24–25, which correspond to the actual and ancestral pericentromeric regions, respectively (Ventura et al. 2003). Indeed, this locus contains an LCR15 copy (Pujana et al. 2001) in both the macaque and human genomes. Most BAC clones were one-end anchored in the human genome (chr15:100,028–100,071 kb). In macaque this region experienced a 64 kb duplicative insertion from chromosome 17 (orthologous to human chromosome 13) (Figure 2), with the human configuration (absence of insertion) likely being the ancestral state because it is identical in orangutan and marmoset. Four Hsa15b- positive clones mapped on macaque and human chromosome 19, but neither human nor macaque assemblies report the STS Hsa15b duplicated at this locus. The presence of assembly gaps in macaque may explain why the STS is not annotated in this region. We aligned the sequence of macaque CH250-70H12 (AC187495.2) versus its human orthologous sequence (hg18 chr15:100,039k-100,170k) and found a 12 kb human expansion through tandem duplication of a ~100 bp unit corresponding to a portion of exon 20 of DNM1 (Figure S3).
    [Show full text]
  • Genetic Variation Across the Human Olfactory Receptor Repertoire Alters Odor Perception
    bioRxiv preprint doi: https://doi.org/10.1101/212431; this version posted November 1, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Genetic variation across the human olfactory receptor repertoire alters odor perception Casey Trimmer1,*, Andreas Keller2, Nicolle R. Murphy1, Lindsey L. Snyder1, Jason R. Willer3, Maira Nagai4,5, Nicholas Katsanis3, Leslie B. Vosshall2,6,7, Hiroaki Matsunami4,8, and Joel D. Mainland1,9 1Monell Chemical Senses Center, Philadelphia, Pennsylvania, USA 2Laboratory of Neurogenetics and Behavior, The Rockefeller University, New York, New York, USA 3Center for Human Disease Modeling, Duke University Medical Center, Durham, North Carolina, USA 4Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina, USA 5Department of Biochemistry, University of Sao Paulo, Sao Paulo, Brazil 6Howard Hughes Medical Institute, New York, New York, USA 7Kavli Neural Systems Institute, New York, New York, USA 8Department of Neurobiology and Duke Institute for Brain Sciences, Duke University Medical Center, Durham, North Carolina, USA 9Department of Neuroscience, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania, USA *[email protected] ABSTRACT The human olfactory receptor repertoire is characterized by an abundance of genetic variation that affects receptor response, but the perceptual effects of this variation are unclear. To address this issue, we sequenced the OR repertoire in 332 individuals and examined the relationship between genetic variation and 276 olfactory phenotypes, including the perceived intensity and pleasantness of 68 odorants at two concentrations, detection thresholds of three odorants, and general olfactory acuity.
    [Show full text]
  • Assembly and Annotation of an Ashkenazi Human Reference Genome
    bioRxiv preprint doi: https://doi.org/10.1101/2020.03.18.997395; this version posted March 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Assembly and Annotation of an Ashkenazi Human Reference Genome Alaina Shumate1,2,† Aleksey V. Zimin1,2,† Rachel M. Sherman1,3 Daniela Puiu1,3 Justin M. Wagner4 Nathan D. Olson4 Mihaela Pertea1,2 Marc L. Salit5 Justin M. Zook4 Steven L. Salzberg1,2,3,6* 1Center for Computational Biology, Johns Hopkins University, Baltimore, MD 2Department of Biomedical Engineering, Johns Hopkins University, Baltimore, MD 3Department of Computer Science, Johns Hopkins University, Baltimore, MD 4National Institute of Standards and Technology, Gaithersburg, MD 5Joint Initiative for Metrology in Biology, Stanford University, Stanford, CA 6Department of Biostatistics, Johns Hopkins University, Baltimore, MD †These authors contributed equally to this work. *Corresponding author. Email: [email protected] Abstract Here we describe the assembly and annotation of the genome of an Ashkenazi individual and the creation of a new, population-specific human reference genome. This genome is more contiguous and more complete than GRCh38, the latest version of the human reference genome, and is annotated with highly similar gene content. The Ashkenazi reference genome, Ash1, contains 2,973,118,650 nucleotides as compared to 2,937,639,212 in GRCh38. Annotation identified 20,157 protein-coding genes, of which 19,563 are >99% identical to their counterparts on GRCh38. Most of the remaining genes have small differences.
    [Show full text]
  • Table 2. Significant
    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Regulation of Xenobiotic and Bile Acid Metabolism by the Anti-Aging Intervention Calorie Restriction in Mice
    REGULATION OF XENOBIOTIC AND BILE ACID METABOLISM BY THE ANTI-AGING INTERVENTION CALORIE RESTRICTION IN MICE By Zidong Fu Submitted to the Graduate Degree Program in Pharmacology, Toxicology, and Therapeutics and the Graduate Faculty of the University of Kansas in partial fulfillment of the requirements for the degree of Doctor of Philosophy. Dissertation Committee ________________________________ Chairperson: Curtis Klaassen, Ph.D. ________________________________ Udayan Apte, Ph.D. ________________________________ Wen-Xing Ding, Ph.D. ________________________________ Thomas Pazdernik, Ph.D. ________________________________ Hao Zhu, Ph.D. Date Defended: 04-11-2013 The Dissertation Committee for Zidong Fu certifies that this is the approved version of the following dissertation: REGULATION OF XENOBIOTIC AND BILE ACID METABOLISM BY THE ANTI-AGING INTERVENTION CALORIE RESTRICTION IN MICE ________________________________ Chairperson: Curtis Klaassen, Ph.D. Date approved: 04-11-2013 ii ABSTRACT Calorie restriction (CR), defined as reduced calorie intake without causing malnutrition, is the best-known intervention to increase life span and slow aging-related diseases in various species. However, current knowledge on the exact mechanisms of aging and how CR exerts its anti-aging effects is still inadequate. The detoxification theory of aging proposes that the up-regulation of xenobiotic processing genes (XPGs) involved in phase-I and phase-II xenobiotic metabolism as well as transport, which renders a wide spectrum of detoxification, is a longevity mechanism. Interestingly, bile acids (BAs), the metabolites of cholesterol, have recently been connected with longevity. Thus, this dissertation aimed to determine the regulation of xenobiotic and BA metabolism by the well-known anti-aging intervention CR. First, the mRNA expression of XPGs in liver during aging was investigated.
    [Show full text]
  • Studies on the Proteome of Human Hair - Identifcation of Histones and Deamidated Keratins Received: 15 August 2017 Sunil S
    www.nature.com/scientificreports OPEN Studies on the Proteome of Human Hair - Identifcation of Histones and Deamidated Keratins Received: 15 August 2017 Sunil S. Adav 1, Roopa S. Subbaiaih2, Swat Kim Kerk 2, Amelia Yilin Lee 2,3, Hui Ying Lai3,4, Accepted: 12 January 2018 Kee Woei Ng3,4,7, Siu Kwan Sze 1 & Artur Schmidtchen2,5,6 Published: xx xx xxxx Human hair is laminar-fbrous tissue and an evolutionarily old keratinization product of follicle trichocytes. Studies on the hair proteome can give new insights into hair function and lead to the development of novel biomarkers for hair in health and disease. Human hair proteins were extracted by detergent and detergent-free techniques. We adopted a shotgun proteomics approach, which demonstrated a large extractability and variety of hair proteins after detergent extraction. We found an enrichment of keratin, keratin-associated proteins (KAPs), and intermediate flament proteins, which were part of protein networks associated with response to stress, innate immunity, epidermis development, and the hair cycle. Our analysis also revealed a signifcant deamidation of keratin type I and II, and KAPs. The hair shafts were found to contain several types of histones, which are well known to exert antimicrobial activity. Analysis of the hair proteome, particularly its composition, protein abundances, deamidated hair proteins, and modifcation sites, may ofer a novel approach to explore potential biomarkers of hair health quality, hair diseases, and aging. Hair is an important and evolutionarily conserved structure. It originates from hair follicles deep within the der- mis and is mainly composed of hair keratins and KAPs, which form a complex network that contributes to the rigidity and mechanical properties.
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]
  • Supplementary File 1
    Supplementary The Effect of Increasing Inclusion Levels of a Fucoidan Rich Extract Derived from Ascophyllum nodosum on Growth Performance and Aspects of Intestinal Health of Pigs Post-Weaning Ruth Rattigan 1, Stafford Vigors 1, Gaurav Rajauria 1, Torres Sweeney 2, Kevin Thornton 2 and John V O’Doherty 1,* Supplementary document 1. Alpha diversity & gene expression Figure S1. The effect of fucoidan supplementation at 250ppm on Observed, Shannon and Simpson measures of alpha diversity in caecal and colonic digesta. Table DS1. Effect of fucoidan on gene expression in the duodenum (Least-square means with their standard errors) Group Gene Basal Fucoidan SEM P value 250ppm Digestive SI 23195.53 21920.53 3734.92 0.813 enzymes CNDP1 220.76 195.56 57.42 0.761 FABP2 64101.33 63277.94 13214.97 0.966 SLC2A1 340.44 103.05 47.20 0.364 SLC2A2 3501.49 3760.72 603.38 0.766 SLC2A5 979.44 789.62 90.78 0.163 SLC2A7 508.99 496.96 88.62 0.925 SLC2A8 226.76 401.46 66.18 0.083 Nutrient SLC16A1 2246.59 2698.03 218.08 0.165 transporters SLC15A1 3936.03 4139.35 585.09 0.810 SLC5A1 11917.91 11381.36 1652.19 0.822 SLC16A10 649.47 581.32 71.64 0.512 SLC6A19 2623.95 2733.15 213.52 0.723 SLC7A1 157.24 181.69 12.93 0.202 SLC5A8 3214.00 4059.56 199.78 0.010 GLP2R 153.47 163.79 10.00 0.479 Appetite GCG 723.21 264.69 275.57 0.261 regulators CCK 825.90 813.21 98.49 0.929 CLDN3 2284.64 2545.28 135.22 0.194 CLDN5 65.53 55.71 3.18 0.047 Tight junctions OCLN 2290.33 2235.59 148.52 0.798 TJP1 1050.29 1051.15 28.50 0.983 NFKB1 561.69 598.47 16.04 0.127 IFNG 90.61 110.40 16.36
    [Show full text]
  • Kif9 Is an Active Kinesin Motor Required for Ciliary Beating and Proximodistal Patterning of Motile Axonemes
    bioRxiv preprint doi: https://doi.org/10.1101/2021.08.26.457815; this version posted August 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Kif9 is an active kinesin motor required for ciliary beating and proximodistal patterning of motile axonemes Mia J. Konjikusic1,2,3, Chanjae Lee1, Yang Yue4, Bikram D. Shrestha5, Ange M. Nguimtsop1, Amjad Horani6, Steven Brody7,8, Vivek N. Prakash5,9, Ryan S. Gray2,3, Kristen J. Verhey4, John B. Wallingford1* 1 Department of Molecular Biosciences, University of Texas at Austin, Austin, TX, USA. 2 Department of Pediatrics, Dell Pediatric Research Institute, 1400 Barbara Jordan Blvd, The University of Texas at Austin, Dell Medical School, Austin, TX, USA. 3 Department of Nutritional Sciences, 200 W 24th Street, The University of Texas at Austin, Austin, TX 78712, USA. 4 Department of Cell and Developmental Biology, University of Michigan Medical School, Ann Arbor, MI, 48109, USA. 5 Department of Physics, University of Miami, Coral Gables, FL, USA. 6 Department of Pediatrics, Washington University School of Medicine, St. Louis, MO, USA. 7 Department of Medicine, Washington University School of Medicine, St. Louis, MO, USA. 8 Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, MO, 63110 USA 9 Department of Biology and Department of Marine Biology and Ecology, University of Miami, Coral Gables, FL, USA. *Corresponding Author [email protected] Patterson Labs 2401 Speedway Austin, Tx 78712 bioRxiv preprint doi: https://doi.org/10.1101/2021.08.26.457815; this version posted August 27, 2021.
    [Show full text]
  • Genetic Diagnosis and Respiratory Management Of
    UITNODIGING GENETIC DIAGNOSIS Voor het bijwonen van de openbare verdediging van AND RESPIRATORY het proefschrift Genetic diagnosis and respiratory management of primary ciliary dyskinesia dyskinesia ciliary of primary management respiratory and diagnosis Genetic GENETIC DIAGNOSIS MANAGEMENT OF AND RESPIRATORY MANAGEMENT OF PRIMARY CILIARY PRIMARY CILIARY DYSKINESIA DYSKINESIA Door Tamara Paff Tamara Paff dinsdag 7 november 2017 11:45 uur in de aula van de Vrije Universiteit de Boelelaan, 1105 TE Amsterdam Receptie aansluitend in Grand cafe The Basket op de VU campus Tamara Paff Johann Keplerstraat 8-1 hoog 1098 HL, Amsterdam +31645364292/ [email protected] Tamara Paff Tamara | Paranimfen Marian van der Meij [email protected] 06-15500488 Marc van der Schee [email protected] 06-40883602 14759 - Paff_R11,5_OMS_DEF.indd 1 25-09-17 10:25 UITNODIGING GENETIC DIAGNOSIS Voor het bijwonen van de openbare verdediging van AND RESPIRATORY het proefschrift Genetic diagnosis and respiratory management of primary ciliary dyskinesia dyskinesia ciliary of primary management respiratory and diagnosis Genetic GENETIC DIAGNOSIS MANAGEMENT OF AND RESPIRATORY MANAGEMENT OF PRIMARY CILIARY PRIMARY CILIARY DYSKINESIA DYSKINESIA Door Tamara Paff Tamara Paff Dag datum tijdstip in de aula van de Vrije Universiteit de Boelelaan, 1105 TE Amsterdam Receptie aansluitend in Grand cafe The Basket op de VU campus Tamara Paff Johann Keplerstraat 8-1 hoog 1098 HL, Amsterdam +31645364292/ [email protected] Tamara Paff Tamara Paranimfen Marian van der Meij | [email protected] 06-15500488 Marc van der Schee [email protected] 06-40883602 14759_TPaff_BW.indd 1 19-09-17 13:08 ProefschriftTamaraPaff_Cover+Bladwijzer.indd All Pages 15-08-17 12:47 The studies performed in this thesis were financially supported by the PCD support group (PCD belangengroep), Fonds NutsOhra, the “Dutch mudder” team and Chiesi.
    [Show full text]
  • The Correlation of Keratin Expression with In-Vitro Epithelial Cell Line Differentiation
    The correlation of keratin expression with in-vitro epithelial cell line differentiation Deeqo Aden Thesis submitted to the University of London for Degree of Master of Philosophy (MPhil) Supervisors: Professor Ian. C. Mackenzie Professor Farida Fortune Centre for Clinical and Diagnostic Oral Science Barts and The London School of Medicine and Dentistry Queen Mary, University of London 2009 Contents Content pages ……………………………………………………………………......2 Abstract………………………………………………………………………….........6 Acknowledgements and Declaration……………………………………………...…7 List of Figures…………………………………………………………………………8 List of Tables………………………………………………………………………...12 Abbreviations….………………………………………………………………..…...14 Chapter 1: Literature review 16 1.1 Structure and function of the Oral Mucosa……………..…………….…..............17 1.2 Maintenance of the oral cavity...……………………………………….................20 1.2.1 Environmental Factors which damage the Oral Mucosa………. ….…………..21 1.3 Structure and function of the Oral Mucosa ………………...….……….………...21 1.3.1 Skin Barrier Formation………………………………………………….……...22 1.4 Comparison of Oral Mucosa and Skin…………………………………….……...24 1.5 Developmental and Experimental Models used in Oral mucosa and Skin...……..28 1.6 Keratinocytes…………………………………………………….….....................29 1.6.1 Desmosomes…………………………………………….…...............................29 1.6.2 Hemidesmosomes……………………………………….…...............................30 1.6.3 Tight Junctions………………………….……………….…...............................32 1.6.4 Gap Junctions………………………….……………….….................................32
    [Show full text]