View / Download 3.3 Mb
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
PARSANA-DISSERTATION-2020.Pdf
DECIPHERING TRANSCRIPTIONAL PATTERNS OF GENE REGULATION: A COMPUTATIONAL APPROACH by Princy Parsana A dissertation submitted to The Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland July, 2020 © 2020 Princy Parsana All rights reserved Abstract With rapid advancements in sequencing technology, we now have the ability to sequence the entire human genome, and to quantify expression of tens of thousands of genes from hundreds of individuals. This provides an extraordinary opportunity to learn phenotype relevant genomic patterns that can improve our understanding of molecular and cellular processes underlying a trait. The high dimensional nature of genomic data presents a range of computational and statistical challenges. This dissertation presents a compilation of projects that were driven by the motivation to efficiently capture gene regulatory patterns in the human transcriptome, while addressing statistical and computational challenges that accompany this data. We attempt to address two major difficulties in this domain: a) artifacts and noise in transcriptomic data, andb) limited statistical power. First, we present our work on investigating the effect of artifactual variation in gene expression data and its impact on trans-eQTL discovery. Here we performed an in-depth analysis of diverse pre-recorded covariates and latent confounders to understand their contribution to heterogeneity in gene expression measurements. Next, we discovered 673 trans-eQTLs across 16 human tissues using v6 data from the Genotype Tissue Expression (GTEx) project. Finally, we characterized two trait-associated trans-eQTLs; one in Skeletal Muscle and another in Thyroid. Second, we present a principal component based residualization method to correct gene expression measurements prior to reconstruction of co-expression networks. -
A Yeast Phenomic Model for the Gene Interaction Network Modulating
Louie et al. Genome Medicine 2012, 4:103 http://genomemedicine.com/content/4/12/103 RESEARCH Open Access A yeast phenomic model for the gene interaction network modulating CFTR-ΔF508 protein biogenesis Raymond J Louie3†, Jingyu Guo1,2†, John W Rodgers1, Rick White4, Najaf A Shah1, Silvere Pagant3, Peter Kim3, Michael Livstone5, Kara Dolinski5, Brett A McKinney6, Jeong Hong2, Eric J Sorscher2, Jennifer Bryan4, Elizabeth A Miller3* and John L Hartman IV1,2* Abstract Background: The overall influence of gene interaction in human disease is unknown. In cystic fibrosis (CF) a single allele of the cystic fibrosis transmembrane conductance regulator (CFTR-ΔF508) accounts for most of the disease. In cell models, CFTR-ΔF508 exhibits defective protein biogenesis and degradation rather than proper trafficking to the plasma membrane where CFTR normally functions. Numerous genes function in the biogenesis of CFTR and influence the fate of CFTR-ΔF508. However it is not known whether genetic variation in such genes contributes to disease severity in patients. Nor is there an easy way to study how numerous gene interactions involving CFTR-ΔF would manifest phenotypically. Methods: To gain insight into the function and evolutionary conservation of a gene interaction network that regulates biogenesis of a misfolded ABC transporter, we employed yeast genetics to develop a ‘phenomic’ model, in which the CFTR-ΔF508-equivalent residue of a yeast homolog is mutated (Yor1-ΔF670), and where the genome is scanned quantitatively for interaction. We first confirmed that Yor1-ΔF undergoes protein misfolding and has reduced half-life, analogous to CFTR-ΔF. Gene interaction was then assessed quantitatively by growth curves for approximately 5,000 double mutants, based on alteration in the dose response to growth inhibition by oligomycin, a toxin extruded from the cell at the plasma membrane by Yor1. -
Supp Table 1.Pdf
Upregulated genes in Hdac8 null cranial neural crest cells fold change Gene Symbol Gene Title 134.39 Stmn4 stathmin-like 4 46.05 Lhx1 LIM homeobox protein 1 31.45 Lect2 leukocyte cell-derived chemotaxin 2 31.09 Zfp108 zinc finger protein 108 27.74 0710007G10Rik RIKEN cDNA 0710007G10 gene 26.31 1700019O17Rik RIKEN cDNA 1700019O17 gene 25.72 Cyb561 Cytochrome b-561 25.35 Tsc22d1 TSC22 domain family, member 1 25.27 4921513I08Rik RIKEN cDNA 4921513I08 gene 24.58 Ofa oncofetal antigen 24.47 B230112I24Rik RIKEN cDNA B230112I24 gene 23.86 Uty ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome 22.84 D8Ertd268e DNA segment, Chr 8, ERATO Doi 268, expressed 19.78 Dag1 Dystroglycan 1 19.74 Pkn1 protein kinase N1 18.64 Cts8 cathepsin 8 18.23 1500012D20Rik RIKEN cDNA 1500012D20 gene 18.09 Slc43a2 solute carrier family 43, member 2 17.17 Pcm1 Pericentriolar material 1 17.17 Prg2 proteoglycan 2, bone marrow 17.11 LOC671579 hypothetical protein LOC671579 17.11 Slco1a5 solute carrier organic anion transporter family, member 1a5 17.02 Fbxl7 F-box and leucine-rich repeat protein 7 17.02 Kcns2 K+ voltage-gated channel, subfamily S, 2 16.93 AW493845 Expressed sequence AW493845 16.12 1600014K23Rik RIKEN cDNA 1600014K23 gene 15.71 Cst8 cystatin 8 (cystatin-related epididymal spermatogenic) 15.68 4922502D21Rik RIKEN cDNA 4922502D21 gene 15.32 2810011L19Rik RIKEN cDNA 2810011L19 gene 15.08 Btbd9 BTB (POZ) domain containing 9 14.77 Hoxa11os homeo box A11, opposite strand transcript 14.74 Obp1a odorant binding protein Ia 14.72 ORF28 open reading -
Co-Expression Module Analysis Reveals Biological Processes
Shi et al. BMC Systems Biology 2010, 4:74 http://www.biomedcentral.com/1752-0509/4/74 RESEARCH ARTICLE Open Access Co-expressionResearch article module analysis reveals biological processes, genomic gain, and regulatory mechanisms associated with breast cancer progression Zhiao Shi1,2, Catherine K Derow3 and Bing Zhang*3 Abstract Background: Gene expression signatures are typically identified by correlating gene expression patterns to a disease phenotype of interest. However, individual gene-based signatures usually suffer from low reproducibility and interpretability. Results: We have developed a novel algorithm Iterative Clique Enumeration (ICE) for identifying relatively independent maximal cliques as co-expression modules and a module-based approach to the analysis of gene expression data. Applying this approach on a public breast cancer dataset identified 19 modules whose expression levels were significantly correlated with tumor grade. The correlations were reproducible for 17 modules in an independent breast cancer dataset, and the reproducibility was considerably higher than that based on individual genes or modules identified by other algorithms. Sixteen out of the 17 modules showed significant enrichment in certain Gene Ontology (GO) categories. Specifically, modules related to cell proliferation and immune response were up-regulated in high- grade tumors while those related to cell adhesion was down-regulated. Further analyses showed that transcription factors NYFB, E2F1/E2F3, NRF1, and ELK1 were responsible for the up-regulation of the cell proliferation modules. IRF family and ETS family proteins were responsible for the up-regulation of the immune response modules. Moreover, inhibition of the PPARA signaling pathway may also play an important role in tumor progression. -
A B-Cell Receptor-Related Gene Signature Predicts Survival in Mantle
Published Ahead of Print on February 22, 2018, as doi:10.3324/haematol.2017.184325. Copyright 2018 Ferrata Storti Foundation. A B-cell receptor-related gene signature predicts survival in mantle cell lymphoma: results from the “Fondazione Italiana Linfomi” MCL-0208 trial by Riccardo Bomben, Simone Ferrero, Tiziana D'Agaro, Michele Dal Bo, Alessandro Re, Andrea Evangelista, Angelo Michele Carella, Alberto Zamò, Umberto Vitolo, Paola Omedè, Chiara Rusconi, Luca Arcaini, Luigi Rigacci, Stefano Luminari, Andrea Piccin, Delong Liu, Adrien Wiestner, Gianluca Gaidano, Sergio Cortelazzo, Marco Ladetto, and Valter Gattei Haematologica 2018 [Epub ahead of print] Citation: Riccardo Bomben, Simone Ferrero, Tiziana D'Agaro, Michele Dal Bo, Alessandro Re, Andrea Evangelista, Angelo Michele Carella, Alberto Zamò, Umberto Vitolo, Paola Omedè, Chiara Rusconi, Luca Arcaini, Luigi Rigacci, Stefano Luminari, Andrea Piccin, Delong Liu, Adrien Wiestner, Gianluca Gaidano, Sergio Cortelazzo, Marco Ladetto, and Valter Gattei. A B-cell receptor-related gene signature predicts survival in mantle cell lymphoma: results from the “Fondazione Italiana Linfomi” MCL-0208 trial. Haematologica. 2018; 103:xxx doi:10.3324/haematol.2017.184325 Publisher's Disclaimer. E-publishing ahead of print is increasingly important for the rapid dissemination of science. Haematologica is, therefore, E-publishing PDF files of an early version of manuscripts that have completed a regular peer review and have been accepted for publication. E-publishing of this PDF file has been approved by the authors. After having E-published Ahead of Print, manuscripts will then undergo technical and English editing, typesetting, proof correction and be presented for the authors' final approval; the final version of the manuscript will then appear in print on a regular issue of the journal. -
Supplementary Table 1: Adhesion Genes Data Set
Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like, -
Conservation and Divergence of ADAM Family Proteins in the Xenopus Genome
Wei et al. BMC Evolutionary Biology 2010, 10:211 http://www.biomedcentral.com/1471-2148/10/211 RESEARCH ARTICLE Open Access ConservationResearch article and divergence of ADAM family proteins in the Xenopus genome Shuo Wei*1, Charles A Whittaker2, Guofeng Xu1, Lance C Bridges1,3, Anoop Shah1, Judith M White1 and Douglas W DeSimone1 Abstract Background: Members of the disintegrin metalloproteinase (ADAM) family play important roles in cellular and developmental processes through their functions as proteases and/or binding partners for other proteins. The amphibian Xenopus has long been used as a model for early vertebrate development, but genome-wide analyses for large gene families were not possible until the recent completion of the X. tropicalis genome sequence and the availability of large scale expression sequence tag (EST) databases. In this study we carried out a systematic analysis of the X. tropicalis genome and uncovered several interesting features of ADAM genes in this species. Results: Based on the X. tropicalis genome sequence and EST databases, we identified Xenopus orthologues of mammalian ADAMs and obtained full-length cDNA clones for these genes. The deduced protein sequences, synteny and exon-intron boundaries are conserved between most human and X. tropicalis orthologues. The alternative splicing patterns of certain Xenopus ADAM genes, such as adams 22 and 28, are similar to those of their mammalian orthologues. However, we were unable to identify an orthologue for ADAM7 or 8. The Xenopus orthologue of ADAM15, an active metalloproteinase in mammals, does not contain the conserved zinc-binding motif and is hence considered proteolytically inactive. We also found evidence for gain of ADAM genes in Xenopus as compared to other species. -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase -
Identifying Lineage Relationships in Human T Cell Populations
Identifying lineage relationships in human T cell populations by Celia Lara Menckeberg A thesis submitted to The University of Birmingham for the degree of DOCTOR OF PHILOSOPHY School of Immunity and Infection College of Medical and Dental Sciences The University of Birmingham December 2010 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. ii ABSTRACT CD4+ and CD8+ T cell populations can be divided into subpopulations based on expression of surface markers CCR7 and CD45RA. The resulting populations are referred to as naive, central memory, effector memory and effector memory RA+ (EMRA). The aim of this study was to identify potential lineage relationships between these subpopulations for both CD4+ and CD8+ T cells through microarray analysis. The genes found to distinguish between these subpopulations include many molecules with known functions in T cell differentiation, including CCR7, CD45RA, granzymes, L-selectin and TNF receptors. Several genes from the tetraspanin family of proteins were found to be differentially expressed at mRNA and protein level; suggesting a possible role for these genes in CD4+ and CD8+ T cell activation, migration and lysosomal function. -
Supp Table 6.Pdf
Supplementary Table 6. Processes associated to the 2037 SCL candidate target genes ID Symbol Entrez Gene Name Process NM_178114 AMIGO2 adhesion molecule with Ig-like domain 2 adhesion NM_033474 ARVCF armadillo repeat gene deletes in velocardiofacial syndrome adhesion NM_027060 BTBD9 BTB (POZ) domain containing 9 adhesion NM_001039149 CD226 CD226 molecule adhesion NM_010581 CD47 CD47 molecule adhesion NM_023370 CDH23 cadherin-like 23 adhesion NM_207298 CERCAM cerebral endothelial cell adhesion molecule adhesion NM_021719 CLDN15 claudin 15 adhesion NM_009902 CLDN3 claudin 3 adhesion NM_008779 CNTN3 contactin 3 (plasmacytoma associated) adhesion NM_015734 COL5A1 collagen, type V, alpha 1 adhesion NM_007803 CTTN cortactin adhesion NM_009142 CX3CL1 chemokine (C-X3-C motif) ligand 1 adhesion NM_031174 DSCAM Down syndrome cell adhesion molecule adhesion NM_145158 EMILIN2 elastin microfibril interfacer 2 adhesion NM_001081286 FAT1 FAT tumor suppressor homolog 1 (Drosophila) adhesion NM_001080814 FAT3 FAT tumor suppressor homolog 3 (Drosophila) adhesion NM_153795 FERMT3 fermitin family homolog 3 (Drosophila) adhesion NM_010494 ICAM2 intercellular adhesion molecule 2 adhesion NM_023892 ICAM4 (includes EG:3386) intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)adhesion NM_001001979 MEGF10 multiple EGF-like-domains 10 adhesion NM_172522 MEGF11 multiple EGF-like-domains 11 adhesion NM_010739 MUC13 mucin 13, cell surface associated adhesion NM_013610 NINJ1 ninjurin 1 adhesion NM_016718 NINJ2 ninjurin 2 adhesion NM_172932 NLGN3 neuroligin -
Gene Expression Profiling to Identify Eggshell Proteins Involved In
Jonchère et al. BMC Genomics 2010, 11:57 http://www.biomedcentral.com/1471-2164/11/57 RESEARCH ARTICLE Open Access Gene expression profiling to identify eggshell proteins involved in physical defense of the chicken egg Vincent Jonchère1, Sophie Réhault-Godbert1, Christelle Hennequet-Antier1, Cédric Cabau1, Vonick Sibut1,3, Larry A Cogburn2, Yves Nys1, Joel Gautron1* Abstract Background: As uricoletic animals, chickens produce cleidoic eggs, which are self-contained bacteria-resistant biological packages for extra-uterine development of the chick embryo. The eggshell constitutes a natural physical barrier against bacterial penetration if it forms correctly and remains intact. The eggshell’s remarkable mechanical properties are due to interactions among mineral components and the organic matrix proteins. The purpose of our study was to identify novel eggshell proteins by examining the transcriptome of the uterus during calcification of the eggshell. An extensive bioinformatic analysis on genes over-expressed in the uterus allowed us to identify novel eggshell proteins that contribute to the egg’s natural defenses. Results: Our 14 K Del-Mar Chicken Integrated Systems microarray was used for transcriptional profiling in the hen’s uterus during eggshell deposition. A total of 605 transcripts were over-expressed in the uterus compared with the magnum or white isthmus across a wide range of abundance (1.1- to 79.4-fold difference). The 605 highly- expressed uterine transcripts correspond to 469 unique genes, which encode 437 different proteins. Gene Ontology (GO) analysis was used for interpretation of protein function. The most over-represented GO terms are related to genes encoding ion transport proteins, which provide eggshell mineral precursors.