DOCSLIB.ORG

Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013 SFRP2 related protein 2 // 4q31.3 // 6423 /// 0.625595 0.078456 0.339615 1.42E-30 6.96 NM_015374 // SUN2 // Sad1 and UNC84 8076137 NM_015374 SUN2 domain containing 2 // 22q13.1 // 25777 /// 0.74974 0.011049 0.67162 1.40E-29 -1.82 NM_002084 // GPX3 // glutathione peroxidase 3 (plasma) // 5q23 // 2878 /// 8109333 NM_002084 GPX3 ENST0 0.430133 0.002053 0.643244 1.22E-28 -2.74 NM_002563 // P2RY1 // purinergic receptor 8083447 NM_002563 P2RY1 P2Y, G-protein coupled, 1 // 3q25.2 // 0.615801 0.950295 0.365474 6.16E-27 -2.86 NM_001793 // CDH3 // cadherin 3, type 1, P- 7996819 NM_001793 CDH3 cadherin (placental) // 16q22.1 // 10 0.009559 0.448395 0.411104 3.75E-26 3.58 NM_022351 // NECAB1 // N-terminal EF- 8147244 NM_022351 NECAB1 hand calcium binding protein 1 // 8q21.3 // 0.685413 0.332522 0.739776 7.05E-25 -3.59 NM_001012334 // MDK // midkine (neurite 7939665 NM_001012334 MDK growth-promoting factor 2) // 11p11.2 // 0.27205 0.650887 0.781016 7.21E-25 1.93 NM_002340 // LSS // lanosterol synthase 8070961 NM_002340 LSS (2,3-oxidosqualene-lanosterol cyclase) / 0.737654 0.182236 0.844486 1.36E-24 -1.94 NM_021110 // COL14A1 // collagen, type 8148070 NM_021110 COL14A1 XIV, alpha 1 // 8q23 // 7373 /// ENST0000 0.354378 0.460841 0.952138 1.77E-24 4.09 NM_000680 // ADRA1A // adrenergic, alpha- 8149885 NM_000680 ADRA1A 1A-, receptor // 8p21.2 // 148 /// NM_0 0.014366 0.115339 0.623063 2.75E-24 -2.22 NM_004668 // MGAM // maltase- glucoamylase (alpha-glucosidase) // 7q34 // 8136662 NM_004668 MGAM 8972 // 0.163269 0.921797 0.789496 3.02E-24 -4.16 NM_198516 // GALNTL4 // UDP-N-acetyl- alpha-D-galactosamine:polypeptide N- 7946641 NM_198516 GALNTL4 acetylg 0.260153 0.750474 0.90351 3.66E-24 -2.18 NM_021135 // RPS6KA2 // ribosomal protein S6 kinase, 90kDa, polypeptide 2 // 8130739 NM_021135 RPS6KA2 6q2 0.462264 0.094697 0.938204 1.41E-23 -1.82 NM_014839 // LPPR4 // lipid phosphate 7903214 NM_014839 LPPR4 phosphatase-related protein type 4 // 1p21 0.526718 0.622418 0.134065 6.25E-23 2.45 NM_017680 // ASPN // asporin // 9q22 // 8162394 NM_017680 ASPN 54829 /// NM_001193335 // ASPN // aspori 0.008958 0.91816 0.0741792 6.94E-23 5.16 NM_004672 // MAP3K6 // mitogen- activated protein kinase kinase kinase 6 // 7914042 NM_004672 MAP3K6 1p36. 0.343731 0.916583 0.821909 1.40E-22 -1.88 NM_015310 // PSD3 // pleckstrin and Sec7 8149555 NM_015310 PSD3 domain containing 3 // 8p21.3 // 23362 0.132732 0.580459 0.238988 1.42E-22 1.93 NM_032532 // FNDC1 // fibronectin type III 8123104 NM_032532 FNDC1 domain containing 1 // 6q25 // 84624 0.824688 0.538236 0.390894 2.08E-22 2.96 NM_020440 // PTGFRN // prostaglandin F2 7904293 NM_020440 PTGFRN receptor negative regulator // 1p13.1 // 0.712214 0.131824 0.2651 7.52E-22 2.14 NM_006288 // THY1 // Thy-1 cell surface 7952268 NM_006288 THY1 antigen // 11q23.3 // 7070 /// ENST00000 0.177 0.186278 0.398847 3.78E-21 3.55 NM_013989 // DIO2 // deiodinase, iodothyronine, type II // 14q24.2-q24.3 // 7980485 NM_013989 DIO2 1734 0.41374 0.001194 0.136475 3.81E-21 2.54 NM_024551 // ADIPOR2 // adiponectin receptor 2 // 12p13.31 // 79602 /// 7953021 NM_024551 ADIPOR2 ENST0000 0.615955 0.085916 0.372758 3.82E-21 -1.82 NM_016286 // DCXR // dicarbonyl/L-xylulose 8019357 NM_016286 DCXR reductase // 17q25.3 // 51181 /// NM_ 0.0145 0.432558 0.847005 4.55E-21 -1.67 NM_033495 // KLHL13 // kelch-like 13 (Drosophila) // Xq23-q24 // 90293 /// 8174654 NM_033495 KLHL13 NM_00 0.39826 0.263702 0.991129 5.64E-21 2.51 NM_031935 // HMCN1 // hemicentin 1 // 1q25.3-q31.1 // 83872 /// 7908204 NM_031935 HMCN1 ENST00000271588 0.007176 0.964079 0.763295 7.13E-21 2.42 NM_206927 // SYTL2 // synaptotagmin-like 7950810 NM_206927 SYTL2 2 // 11q14 // 54843 /// NM_206928 // SY 0.037707 0.342637 0.783203 8.41E-21 1.97 NM_003749 // IRS2 // insulin receptor 7972745 NM_003749 IRS2 substrate 2 // 13q34 // 8660 /// ENST00000 0.952433 0.097443 0.249027 9.40E-21 -1.88 NM_181711 // GRASP // GRP1 (general 7955578 NM_181711 GRASP receptor for phosphoinositides 1)-associated 0.309603 0.262771 0.634118 9.96E-21 -2.50 NM_005621 // S100A12 // S100 calcium 7920238 NM_005621 S100A12 binding protein A12 // 1q21 // 6283 /// ENS 0.050753 0.718753 0.402793 1.08E-20 -3.83 NM_003637 // ITGA10 // integrin, alpha 10 7904761 NM_003637 ITGA10 // 1q21 // 8515 /// ENST00000369304 // 0.396106 0.127081 0.212834 1.25E-20 -2.37 NM_016206 // VGLL3 // vestigial like 3 8088979 NM_016206 VGLL3 (Drosophila) // 3p12.1 // 389136 /// ENST 0.002928 0.010553 0.256786 1.35E-20 -2.10 NM_013427 // ARHGAP6 // Rho GTPase 8171313 NM_013427 ARHGAP6 activating protein 6 // Xp22.3 // 395 /// NM_ 0.001126 0.701491 0.870062 2.06E-20 -2.01 NM_004887 // CXCL14 // chemokine (C-X-C 8114249 NM_004887 CXCL14 motif) ligand 14 // 5q31 // 9547 /// ENS 0.115706 0.827791 0.463199 2.37E-20 2.45 NM_024693 // ECHDC3 // enoyl CoA hydratase domain containing 3 // 10p14 // 7926152 NM_024693 ECHDC3 79746 0.723514 0.130592 0.694849 2.75E-20 -1.73 NM_032160 // DSEL // dermatan sulfate 8023727 NM_032160 DSEL epimerase-like // 18q22.1 // 92126 /// ENS 0.024499 0.100221 0.564341 2.99E-20 -1.92 NM_001080393 // GXYLT2 // glucoside 8080964 NM_001080393 GXYLT2 xylosyltransferase 2 // 3p13 // 727936 /// E 0.890374 0.505058 0.549978 3.11E-20 2.49 NM_000906 // NPR1 // natriuretic peptide 7905606 NM_000906 NPR1 receptor A/guanylate cyclase A (atriona 0.221305 0.043182 0.712389 3.50E-20 -2.44 NM_024850 // BTNL8 // butyrophilin-like 8 8116537 NM_024850 BTNL8 // 5q35.3 // 79908 /// NM_001040462 // 0.43025 0.197733 0.405111 4.14E-20 -1.71 NM_018398 // CACNA2D3 // calcium channel, voltage-dependent, alpha 2/delta 8080578 NM_018398 CACNA2D3 subun 0.060511 0.243001 0.0082213 4.59E-20 -1.67 NM_052917 // GALNT13 // UDP-N-acetyl- alpha-D-galactosamine:polypeptide N- 8045776 NM_052917 GALNT13 acetylg 0.017951 0.09348 0.157563 6.66E-20 -2.15 NM_144687 // NLRP12 // NLR family, pyrin 8039096 NM_144687 NLRP12 domain containing 12 // 19q13.42 // 916 0.057388 0.661991 0.929529 8.52E-20 -1.76 NM_181353 // ID1 // inhibitor of DNA 8061564 NM_181353 ID1 binding 1, dominant negative helix-loop-hel 0.516844 0.227374 0.163939 9.08E-20 -2.52 NM_152996 // ST6GALNAC3 // ST6 (alpha-N- 7902425 NM_152996 ST6GALNAC3acetyl-neuraminyl-2,3-beta-galactosyl-1, 0.15897 0.288073 0.832047 9.43E-20 -2.05 NM_005086 // SSPN // sarcospan (Kras oncogene-associated gene) // 12p11.2 // 7954481 NM_005086 SSPN 808 0.010514 0.743244 0.565015 9.75E-20 1.78 NM_015310 // PSD3 // pleckstrin and Sec7 8149551 NM_015310 PSD3 domain containing 3 // 8p21.3 // 23362 0.013523 0.927144 0.156792 1.18E-19 2.15 NM_001135181 // SLC5A9 // solute carrier 7901316 NM_001135181 SLC5A9 family 5 (sodium/glucose cotransporter) 0.011155 0.424205 0.0183648 1.38E-19 -2.01 NM_005824 // LRRC17 // leucine rich repeat 8135218 NM_005824 LRRC17 containing 17 // 7q22.1 // 10234 /// 0.79711 0.013604 0.737823 1.40E-19 2.79 NM_156039 // CSF3R // colony stimulating 7914950 NM_156039 CSF3R factor 3 receptor (granulocyte) // 1p35 0.118326 0.288053 0.690138 1.55E-19 -2.49 NM_019086 // VSIG10 // V-set and immunoglobulin domain containing 10 // 7966839 NM_019086 VSIG10 12q24.23 0.041268 0.010701 0.733545 1.69E-19 -1.61 NM_018945 // PDE7B // phosphodiesterase 8122222 NM_018945 PDE7B 7B // 6q23-q24 // 27115 /// ENST00000308 0.491208 0.809038 0.311159 1.79E-19 2.18 NM_016354 // SLCO4A1 // solute carrier 8063923 NM_016354 SLCO4A1 organic anion transporter family, member 0.169865 0.646993 0.136994 2.26E-19 -3.33 NM_203371 // FIBIN // fin bud initiation 7939052 NM_203371 FIBIN factor homolog (zebrafish) // 11p14.2 / 0.010942 0.001672 0.176034 2.36E-19 -2.75 NM_015419 // MXRA5 // matrix-remodelling 8171172 NM_015419 MXRA5 associated 5 // Xp22.33 // 25878 /// EN 0.870662 0.666444 0.375889 2.38E-19 2.50 NM_004779 // CNOT8 // CCR4-NOT transcription complex, subunit 8 // 5q31-q33 8109462 NM_004779 CNOT8 // 9 0.89724 0.05076 0.570686 2.56E-19 -1.56 NM_004734 // DCLK1 // doublecortin-like 7970954 NM_004734 DCLK1 kinase 1 // 13q13 // 9201 /// NM_0011954 0.668455 0.2099 0.93869 3.19E-19 2.82 NM_022470 // ZMAT3 //
Load more

Recommended publications
  • Acetyl Group Coordinated Progression Through the Catalytic Cycle of an Arylalkylamine N-Acetyltransferase
    RESEARCH ARTICLE Acetyl group coordinated progression through the catalytic cycle of an arylalkylamine N-acetyltransferase Adam A. Aboalroub, Ashleigh B. Bachman, Ziming Zhang, Dimitra Keramisanou, David J. Merkler, Ioannis Gelis* Department of Chemistry, University of South Florida, Tampa, Florida, United States of America * [email protected] a1111111111 a1111111111 a1111111111 Abstract a1111111111 a1111111111 The transfer of an acetyl group from acetyl-CoA to an acceptor amine is a ubiquitous bio- chemical transformation catalyzed by Gcn5-related N-acetyltransferases (GNATs). Although it is established that the reaction proceeds through a sequential ordered mecha- nism, the role of the acetyl group in driving the ordered formation of binary and ternary com- OPEN ACCESS plexes remains elusive. Herein, we show that CoA and acetyl-CoA alter the conformation of the substrate binding site of an arylalkylamine N-acetyltransferase (AANAT) to facilitate Citation: Aboalroub AA, Bachman AB, Zhang Z, Keramisanou D, Merkler DJ, Gelis I (2017) Acetyl interaction with acceptor substrates. However, it is the presence of the acetyl group within group coordinated progression through the the catalytic funnel that triggers high affinity binding. Acetyl group occupancy is relayed catalytic cycle of an arylalkylamine N- through a conserved salt bridge between the P-loop and the acceptor binding site, and is acetyltransferase. PLoS ONE 12(5): e0177270. manifested as differential dynamics in the CoA and acetyl-CoA-bound states. The capacity https://doi.org/10.1371/journal.pone.0177270 of the acetyl group carried by an acceptor to promote its tight binding even in the absence of Editor: Viswanathan V. Krishnan, California State CoA, but also its mutually exclusive position to the acetyl group of acetyl-CoA underscore its University Fresno, UNITED STATES importance in coordinating the progression of the catalytic cycle.
    [Show full text]
  • ZNF354C Is a Transcriptional Repressor That Inhibits Endothelial Angiogenic Sprouting James A
    www.nature.com/scientificreports OPEN ZNF354C is a transcriptional repressor that inhibits endothelial angiogenic sprouting James A. Oo1,3, Barnabas Irmer1, Stefan Günther2, Timothy Warwick1, Katalin Pálf1, Judit Izquierdo Ponce1, Tom Teichmann1, Beatrice Pfüger‑Müller1,3, Ralf Gilsbach1,3, Ralf P. Brandes1,3 & Matthias S. Leisegang1,3* Zinc fnger proteins (ZNF) are a large group of transcription factors with diverse functions. We recently discovered that endothelial cells harbour a specifc mechanism to limit the action of ZNF354C, whose function in endothelial cells is unknown. Given that ZNF354C has so far only been studied in bone and tumour, its function was determined in endothelial cells. ZNF354C is expressed in vascular cells and localises to the nucleus and cytoplasm. Overexpression of ZNF354C in human endothelial cells results in a marked inhibition of endothelial sprouting. RNA‑sequencing of human microvascular endothelial cells with and without overexpression of ZNF354C revealed that the protein is a potent transcriptional repressor. ZNF354C contains an active KRAB domain which mediates this suppression as shown by mutagenesis analysis. ZNF354C interacts with dsDNA, TRIM28 and histones, as observed by proximity ligation and immunoprecipitation. Moreover, chromatin immunoprecipitation revealed that the ZNF binds to specifc endothelial‑relevant target‑gene promoters. ZNF354C suppresses these genes as shown by CRISPR/Cas knockout and RNAi. Inhibition of endothelial sprouting by ZNF354C is dependent on the amino acids DV and MLE of the KRAB domain. These results demonstrate that ZNF354C is a repressive transcription factor which acts through a KRAB domain to inhibit endothelial angiogenic sprouting. Te vascular system is controlled by numerous signaling pathways and growth factors which all contribute to the regulation of gene expression.
    [Show full text]
  • Trastuzumab Modulates the Protein Cargo of Extracellular Vesicles Released by ERBB2+ Breast Can‐ Cer Cells
    Supplementary Material: Trastuzumab Modulates the Protein Cargo of Extracellular Vesicles Released by ERBB2+ Breast Can‐ cer Cells Silvia Marconi, Sara Santamaria, Martina Bartolucci, Sara Stigliani, Cinzia Aiello, Maria Cristina Gagliani, Grazia Bellese, Andrea Petretto, Katia Cortese and Patrizio Castagnola Table S1. Antibodies used in the study. Antibody Catalog number Manufacturer Anti‐ALIX sc‐271975 Santa Cruz1 Anti‐CD9 PA5‐85955 Thermofisher Scientific2 Anti‐CD63 sc‐15363 Santa Cruz Anti‐ErbB2 (9G6) sc‐08 Santa Cruz Anti‐GAPDH 14C10 Cell signaling3 Anti‐HSP90 sc‐13119 Santa Cruz 1 Dallas, TX, USA; 2 Waltham, MA, USA; 3 Danvers, MA, USA. Table S2. Differentially regulated proteins by trastuzumab Tz treatment in extracellular vesicles EVs purified from SKBR‐ 3 cells with a statistically significant p‐value resulted from Studentʹs T‐test. The gene symbols coding for proteins downregulated by Tz (and hence upregulated in IgG treated cells) are highlighted in red while proteins upregulated by Tz are highlighted in blue. Official Gene Symbol 1 Gene product (Protein name) ACVR1B Activin A receptor type 1B ANO1 Anoctamin 1 ARFGEF2 ADP Ribosylation Factor Guanine Nucleotide Exchange Factor 2 BTN2A1 Butyrophilin subfamily 2 member A1 CIAPIN1 Cytokine Induced Apoptosis Inhibitor 1 CIT Citron Rho‐Interacting Serine/Threonine Kinase CPPED1 Calcineurin Like Phosphoesterase Domain Containing 1 DNAH7 Dynein Axonemal Heavy Chain 7 EIF3F Eukaryotic translation initiation factor 3 subunit F ESD Esterase D ESYT2 Extended Synaptotagmin 2 F2RL1 F2R Like Trypsin Receptor 1 RIPOR3 RIPOR Family Member 3 FZD6 Frizzled‐6 GAN Gigaxonin GTPBP2 GTP‐binding protein 2 GUCD1 Guanylyl Cyclase Domain Containing 1 HNRNPM Heterogeneous nuclear ribonucleoprotein M LMAN2 Lectin, Mannose Binding 2 LRRC8A Volume‐regulated anion channel subunit LRRC8A NOTCH4 Notch Receptor 4 NT5C2 5ʹ‐Nucleotidase, Cytosolic II PCID2 PCI domain‐containing 2 PDCD5 Programmed cell death 5 PHLDB3 Pleckstrin homology like domain family B member 3 PLAA Phospholipase A2 activating protein Membranes 2021, 11, 199.
    [Show full text]
  • Supplemental Table S1
    Entrez Gene Symbol Gene Name Affymetrix EST Glomchip SAGE Stanford Literature HPA confirmed Gene ID Profiling profiling Profiling Profiling array profiling confirmed 1 2 A2M alpha-2-macroglobulin 0 0 0 1 0 2 10347 ABCA7 ATP-binding cassette, sub-family A (ABC1), member 7 1 0 0 0 0 3 10350 ABCA9 ATP-binding cassette, sub-family A (ABC1), member 9 1 0 0 0 0 4 10057 ABCC5 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 1 0 0 0 0 5 10060 ABCC9 ATP-binding cassette, sub-family C (CFTR/MRP), member 9 1 0 0 0 0 6 79575 ABHD8 abhydrolase domain containing 8 1 0 0 0 0 7 51225 ABI3 ABI gene family, member 3 1 0 1 0 0 8 29 ABR active BCR-related gene 1 0 0 0 0 9 25841 ABTB2 ankyrin repeat and BTB (POZ) domain containing 2 1 0 1 0 0 10 30 ACAA1 acetyl-Coenzyme A acyltransferase 1 (peroxisomal 3-oxoacyl-Coenzyme A thiol 0 1 0 0 0 11 43 ACHE acetylcholinesterase (Yt blood group) 1 0 0 0 0 12 58 ACTA1 actin, alpha 1, skeletal muscle 0 1 0 0 0 13 60 ACTB actin, beta 01000 1 14 71 ACTG1 actin, gamma 1 0 1 0 0 0 15 81 ACTN4 actinin, alpha 4 0 0 1 1 1 10700177 16 10096 ACTR3 ARP3 actin-related protein 3 homolog (yeast) 0 1 0 0 0 17 94 ACVRL1 activin A receptor type II-like 1 1 0 1 0 0 18 8038 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 1 0 0 0 0 19 8751 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 1 0 0 0 0 20 8728 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 1 0 0 0 0 21 81792 ADAMTS12 ADAM metallopeptidase with thrombospondin type 1 motif, 12 1 0 0 0 0 22 9507 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • FAM83A and FAM83B As Prognostic Biomarkers and Potential New Therapeutic Targets in NSCLC
    cancers Article FAM83A and FAM83B as Prognostic Biomarkers and Potential New Therapeutic Targets in NSCLC Sarah Richtmann 1,2 , Dennis Wilkens 3, Arne Warth 4, Felix Lasitschka 4, Hauke Winter 2,5, Petros Christopoulos 2,6 , Felix J. F. Herth 2,7, Thomas Muley 1,2, Michael Meister 1,2 and Marc A. Schneider 1,2,* 1 Translational Research Unit, Thoraxklinik at Heidelberg University Hospital, D-69126 Heidelberg, Germany; [email protected] (S.R.); [email protected] (T.M.); [email protected] (M.M.) 2 Translational Lung Research Center Heidelberg (TLRC), Member of the German Center for Lung Research (DZL), D-69120 Heidelberg, Germany; [email protected] (H.W.); [email protected] (P.C.); [email protected] (F.J.F.H.) 3 Microbial Energy Conversion and Biotechnology, Department of Biology, Technische Universität Darmstadt, D-64287 Darmstadt, Germany; [email protected] 4 Institute of Pathology, Heidelberg University Hospital, D-69120 Heidelberg, Germany; [email protected] (A.W.); [email protected] (F.L.) 5 Department of Surgery, Thoraxklinik at Heidelberg University Hospital, D-69126 Heidelberg, Germany 6 Department of Thoracic Oncology, Thoraxklinik at Heidelberg University Hospital, D-69126 Heidelberg, Germany 7 Department of Pneumology and Critical Care Medicine, Thoraxklinik at Heidelberg University Hospital, D-69126 Heidelberg, Germany * Correspondence: [email protected] Received: 27 March 2019; Accepted: 9 May 2019; Published: 11 May 2019 Abstract: Although targeted therapy has improved the survival rates in the last decade, non-small-cell lung cancer (NSCLC) is still the most common cause of cancer-related death.
    [Show full text]
  • FAM83 Family Oncogenes Are Broadly Involved in Human Cancers: an Integrative Multi-Omics Approach Antoine M
    FAM83 family oncogenes are broadly involved in human cancers: an integrative multi-omics approach Antoine M. Snijders1, Sun-Young Lee1, Bo Hang1, Wenshan Hao2, Mina J. Bissell1 and Jian-Hua Mao1 1 Biological Systems and Engineering Division, Lawrence Berkeley National Laboratory, CA, USA 2 Nanjing Biotech and Pharmaceutical Valley Development Center, China Keywords The development of novel targeted therapies for cancer treatment requires copy number variation; FAM83 family; gene identification of reliable targets. FAM83 (‘family with sequence similarity mutation; multi-omics approach; oncogenes 83’) family members A, B, and D were shown recently to have oncogenic potential. However, the overall oncogenic abilities of FAM83 family genes Correspondence J.-H. Mao, A. M. Snijders and M. J. Bissell, remain largely unknown. Here, we used a systematic and integrative geno- Biological Systems and Engineering mics approach to investigate oncogenic properties of the entire FAM83 fam- Division, Lawrence Berkeley National ily members. We assessed transcriptional expression patterns of eight Laboratory, 1 Cyclotron Road, Berkeley, CA FAM83 family genes (FAM83A-H) across tumor types, the relationship 94720, USA between their expression and changes in DNA copy number, and the associa- E-mails: [email protected]; tion with patient survival. By comparing the gene expression levels of [email protected] and [email protected] FAM83 family members in cancers from 17 different tumor types with those (Received 5 August 2016, revised 16 in their corresponding normal tissues, we identified consistent upregulation September 2016, accepted 21 October of FAM83D and FAM83H across the majority of tumor types, which is lar- 2016, available online 9 January 2017) gely driven by increased DNA copy number.
    [Show full text]
  • Investigation of Candidate Genes and Mechanisms Underlying Obesity
    Prashanth et al. BMC Endocrine Disorders (2021) 21:80 https://doi.org/10.1186/s12902-021-00718-5 RESEARCH ARTICLE Open Access Investigation of candidate genes and mechanisms underlying obesity associated type 2 diabetes mellitus using bioinformatics analysis and screening of small drug molecules G. Prashanth1 , Basavaraj Vastrad2 , Anandkumar Tengli3 , Chanabasayya Vastrad4* and Iranna Kotturshetti5 Abstract Background: Obesity associated type 2 diabetes mellitus is a metabolic disorder ; however, the etiology of obesity associated type 2 diabetes mellitus remains largely unknown. There is an urgent need to further broaden the understanding of the molecular mechanism associated in obesity associated type 2 diabetes mellitus. Methods: To screen the differentially expressed genes (DEGs) that might play essential roles in obesity associated type 2 diabetes mellitus, the publicly available expression profiling by high throughput sequencing data (GSE143319) was downloaded and screened for DEGs. Then, Gene Ontology (GO) and REACTOME pathway enrichment analysis were performed. The protein - protein interaction network, miRNA - target genes regulatory network and TF-target gene regulatory network were constructed and analyzed for identification of hub and target genes. The hub genes were validated by receiver operating characteristic (ROC) curve analysis and RT- PCR analysis. Finally, a molecular docking study was performed on over expressed proteins to predict the target small drug molecules. Results: A total of 820 DEGs were identified between
    [Show full text]
  • Longitudinal Peripheral Blood Transcriptional Analysis of COVID-19 Patients
    medRxiv preprint doi: https://doi.org/10.1101/2020.05.05.20091355; this version posted May 8, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. 1 Longitudinal peripheral blood transcriptional analysis of COVID-19 patients 2 captures disease progression and reveals potential biomarkers 3 Qihong Yan1,5,†, Pingchao Li1,†, Xianmiao Ye1,†, Xiaohan Huang1,5,†, Xiaoneng Mo2, 4 Qian Wang1, Yudi Zhang1, Kun Luo1, Zhaoming Chen1, Jia Luo1, Xuefeng Niu3, Ying 5 Feng3, Tianxing Ji3, Bo Feng3, Jinlin Wang2, Feng Li2, Fuchun Zhang2, Fang Li2, 6 Jianhua Wang1, Liqiang Feng1, Zhilong Chen4,*, Chunliang Lei2,*, Linbing Qu1,*, Ling 7 Chen1,2,3,4,* 8 1Guangzhou Regenerative Medicine and Health-Guangdong Laboratory 9 (GRMH-GDL), Guangdong Laboratory of Computational Biomedicine, Guangzhou 10 Institutes of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou, 11 China 12 2Guangzhou Institute of Infectious Disease, Guangzhou Eighth People’s Hospital, 13 Guangzhou Medical University, Guangzhou, China 14 3State Key Laboratory of Respiratory Disease, National Clinical Research Center for 15 Respiratory Disease, Guangzhou Institute of Respiratory Health, the First Affiliated 16 Hospital of Guangzhou Medical University, Guangzhou, China 17 4School of Medicine, Huaqiao University, Xiamen, China 18 5University of Chinese Academy of Science, Beijing, China 19 †These authors contributed equally to this work. 20 *To whom correspondence should be addressed: Ling Chen ([email protected]), 21 Linbing Qu ([email protected]), Chunliang Lei ([email protected]), Zhilong 22 Chen ([email protected]) NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice.
    [Show full text]
  • C3orf70 Is Involved in Neural and Neurobehavioral Development
    pharmaceuticals Article C3orf70 Is Involved in Neural and Neurobehavioral Development Yoshifumi Ashikawa 1, Takashi Shiromizu 1, Koki Miura 1, Yuka Adachi 1, Takaaki Matsui 2, Yasumasa Bessho 2, Toshio Tanaka 3 and Yuhei Nishimura 1,* 1 Department of Integrative Pharmacology, Mie University Graduate School of Medicine, Tsu, Mie 514-8507, Japan; [email protected] (Y.A.); [email protected] (T.S.); [email protected] (K.M.); [email protected] (Y.A.) 2 Gene Regulation Research, Graduate School of Biological Sciences, Nara Institute of Science and Technology, Takayama, Nara 630-0192, Japan; [email protected] (T.M.); [email protected] (Y.B.) 3 Department of Systems Pharmacology, Mie University Graduate School of Medicine, Tsu, Mie 514-8507, Japan; [email protected] * Correspondence: [email protected] Received: 10 October 2019; Accepted: 15 October 2019; Published: 16 October 2019 Abstract: Neurogenesis is the process by which undifferentiated progenitor cells develop into mature and functional neurons. Defects in neurogenesis are associated with neurodevelopmental and neuropsychiatric disorders; therefore, elucidating the molecular mechanisms underlying neurogenesis can advance our understanding of the pathophysiology of these disorders and facilitate the discovery of novel therapeutic targets. In this study, we performed a comparative transcriptomic analysis to identify common targets of the proneural transcription factors Neurog1/2 and Ascl1 during neurogenesis of human and mouse stem cells. We successfully identified C3orf70 as a novel common target gene of Neurog1/2 and Ascl1 during neurogenesis. Using in situ hybridization, we demonstrated that c3orf70a and c3orf70b, two orthologs of C3orf70, were expressed in the midbrain and hindbrain of zebrafish larvae.
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]
  • Expression Analysis and Functional Significance of Chondroitin Sulphate Proteoglycans and Heparan Sulphate Proteoglycans in Prostate Cancer
    EXPRESSION ANALYSIS AND FUNCTIONAL SIGNIFICANCE OF CHONDROITIN SULPHATE PROTEOGLYCANS AND HEPARAN SULPHATE PROTEOGLYCANS IN PROSTATE CANCER TENG HUI FANG, YVONNE (BSc, Hons) NATIONAL UNIVERSITY OF SINGAPORE A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF ANATOMY YONG LOO LIN SCHOOL OF MEDICINE NATIONAL UNIVERSITY OF SINGAPORE 2010 Acknowledgements ACKNOWLEDGEMENTS My PhD candidature would not have been easier, if not for the help, guidance and support from many mentors, family, friends and colleagues. My utmost gratitude goes to my mentor, Associate Professor George Yip Wai Cheong, for his unfailing guidance, patience and trust in me. Through him, I have learnt much, in terms of scientific skills and knowledge acquisition. In addition, I have benefitted from his many interesting stories that have also made my candidature a very enjoyable one indeed. The most important lesson that I have learnt from Dr George Yip would be the importance of thinking critically, a skill that is not only important in the scientific arena, but also one that applies to our everyday life. I would also like to thank my co-supervisor, Associate Professor Chia Sing Joo, for his support and advice. His comments have always added an interesting clinical perspective to the type of scientific research that I have been working on during my candidature. My deepest appreciation goes to Professor Bay Boon Huat for his timely advice and support. Professor Bay never fails to think for our welfare and has always shown genuine concern for us in all aspects of our life. He has taught us the importance of forming great relationships, one that supersedes any material wealth and status.
    [Show full text]