DOCSLIB.ORG

A Yeast Phenomic Model for the Gene Interaction Network Modulating

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Yeast Phenomic Model for the Gene Interaction Network Modulating Louie et al. Genome Medicine 2012, 4:103 http://genomemedicine.com/content/4/12/103 RESEARCH Open Access A yeast phenomic model for the gene interaction network modulating CFTR-ΔF508 protein biogenesis Raymond J Louie3†, Jingyu Guo1,2†, John W Rodgers1, Rick White4, Najaf A Shah1, Silvere Pagant3, Peter Kim3, Michael Livstone5, Kara Dolinski5, Brett A McKinney6, Jeong Hong2, Eric J Sorscher2, Jennifer Bryan4, Elizabeth A Miller3* and John L Hartman IV1,2* Abstract Background: The overall influence of gene interaction in human disease is unknown. In cystic fibrosis (CF) a single allele of the cystic fibrosis transmembrane conductance regulator (CFTR-ΔF508) accounts for most of the disease. In cell models, CFTR-ΔF508 exhibits defective protein biogenesis and degradation rather than proper trafficking to the plasma membrane where CFTR normally functions. Numerous genes function in the biogenesis of CFTR and influence the fate of CFTR-ΔF508. However it is not known whether genetic variation in such genes contributes to disease severity in patients. Nor is there an easy way to study how numerous gene interactions involving CFTR-ΔF would manifest phenotypically. Methods: To gain insight into the function and evolutionary conservation of a gene interaction network that regulates biogenesis of a misfolded ABC transporter, we employed yeast genetics to develop a ‘phenomic’ model, in which the CFTR-ΔF508-equivalent residue of a yeast homolog is mutated (Yor1-ΔF670), and where the genome is scanned quantitatively for interaction. We first confirmed that Yor1-ΔF undergoes protein misfolding and has reduced half-life, analogous to CFTR-ΔF. Gene interaction was then assessed quantitatively by growth curves for approximately 5,000 double mutants, based on alteration in the dose response to growth inhibition by oligomycin, a toxin extruded from the cell at the plasma membrane by Yor1. Results: From a comparative genomic perspective, yeast gene interactions influencing Yor1-ΔF biogenesis were representative of human homologs previously found to modulate processing of CFTR-ΔF in mammalian cells. Additional evolutionarily conserved pathways were implicated by the study, and a ΔF-specific pro-biogenesis function of the recently discovered ER membrane complex (EMC) was evident from the yeast screen. This novel function was validated biochemically by siRNA of an EMC ortholog in a human cell line expressing CFTR-ΔF508. The precision and accuracy of quantitative high throughput cell array phenotyping (Q-HTCP), which captures tens of thousands of growth curves simultaneously, provided powerful resolution to measure gene interaction on a phenomic scale, based on discrete cell proliferation parameters. Conclusion: We propose phenomic analysis of Yor1-ΔF as a model for investigating gene interaction networks that can modulate cystic fibrosis disease severity. Although the clinical relevance of the Yor1-ΔF gene interaction network for cystic fibrosis remains to be defined, the model appears to be informative with respect to human cell models of CFTR-ΔF. Moreover, the general strategy of yeast phenomics can be employed in a systematic manner * Correspondence: [email protected]; [email protected] † Contributed equally 1Department of Genetics, University of Alabama at Birmingham, 730 Hugh Kaul Human Genetics Building, 720 20th Street South, Birmingham, AL 35294 USA 3Department of Biology, Columbia University, 1212 Amsterdam Ave. MC2456, New York, NY 10027 USA Full list of author information is available at the end of the article © 2013 Mckinney et al.; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Louie et al. Genome Medicine 2012, 4:103 Page 2 of 20 http://genomemedicine.com/content/4/12/103 to model gene interaction for other diseases relating to pathologies that result from protein misfolding or potentially any disease involving evolutionarily conserved genetic pathways. Keywords: Gene interaction, Genetic buffering, Genotype-phenotype complexity, Phenomics, Quantitative high throughput cell array phenotyping (Q-HTCP), Cystic fibrosis transmembrane conductance regulator (CFTR), ER mem- brane complex (EMC), ATP binding cassette (ABC) transporter, Membrane protein biogenesis, Yeast model of human disease, Comparative functional genomics Background strains [10-12], and used Q-HTCP [13,14] to measure Since release of the human genome sequence, genome- the influence of gene-gene interactions on cell prolifera- wide association studies (GWAS) and other advances in tion in the presence of oligomycin, a toxin extruded from genomic technology have challenged simplistic notions of cells by Yor1. From a drug discovery perspective, protein the genetic basis of human disease. Even Mendelian dis- regulators of CFTR-ΔF biogenesis represent novel tar- ease phenotypes are now thought to be driven by complex gets, and cell culture experiments indicate such targets genetic relationships [1]. For example, modifier genes can are numerous [15,16]. Many of these regulators are evo- influence the severity of cystic fibrosis [2]. However, the lutionarily conserved, thus a quantitative systems level influence on disease contributed by multi-locus, combina- model of a gene interaction network model derived from tion-specific pairs of allelic variants remains largely yeast could complement human and animal studies [17]. unmapped and uncharacterized biologically. Moreover, From a systems biology perspective, the quantitative most disease traits are non-Mendelian (that is, ‘complex’ description of a gene network that modulates biogenesis traits), where expression of the phenotype involves multi- of a misfolded ABC transporter could provide useful ple different gene activities, none of which is individually insight for understanding the phenotypic complexity of required or accounts for a large fraction of heritability cystic fibrosis in association with human genetic data, [3,4]. Thus Mendelian and complex traits can be seen as and might similarly aid study of other diseases related to different ends of the same continuum in which multiple protein misfolding. If successful for cystic fibrosis, the genetic and environmental effects impact disease risk and/ same general strategy of yeast phenomic modeling should or severity in a combination-dependent manner. It is pre- be applicable to derive understanding about disease com- sumed that in some genetic or environmental contexts plexity involving any conserved cellular pathway. particular variant alleles are phenotypically expressed, and in other contexts they are buffered. However, whether Methods principles for disease variation can be deduced through Yeast strains systematic analysis of gene-gene interaction remains Deletion mutants were from the MATa collection, cre- unknown [5]. In this study we developed a yeast model of ated by the Saccharomyces Genome Deletion Project gene interaction for a clinically relevant disease mutation, [18], and obtained from Open Biosystems. The query CFTR-ΔF508, to investigate whether it can potentially strain background for double mutant construction was serve as a useful tool to better understand the genetic 15578-1.2b [10]. The R1116T mutation (Figure 1) was complexity underlying the human disease, cystic fibrosis introduced into pSM2056 (yor1-ΔF670-HA-GFP::URA3 [6]. Saccharomyces cerevisiae is a workhorse for funda- integrating vector) [19] by Quik Change mutagenesis mental biology, but the extent to which experimental (Stratagene) to create plasmid pRL026. This vector was models of gene-gene interaction employing an endogen- used as a template to amplify a PCR fragment corre- ous yeast cellular context could provide disease-relevant sponding to yor1-ΔF670/R1116T-HA-GFP-3’UTR which insight via gene homology is unknown [5]. To investigate was combined with another PCR fragment encoding the this question, we applied the Q-HTCP method to systema- NATMX cassette flanked by further YOR1 3’UTR tically query the yeast genome for modifiers of a specific sequence by splice overlap PCR. The full product (yor1- phenotype resulting from Yor1-ΔF670, and provide evi- ΔF670/R1116T-HA-GFP-3’UTR-NATMX-3’UTR)was dence validating this yeast phenomic (genome-wide analy- transformed into yeast and selected for on media con- sis of phenotypic modification due to gene interaction) taining nourseothricin (’ClonNat’, Werner BioAgents); model for CFTR-ΔF508, the most prevalent human allele thepresenceofthegenomicΔF670/R1116T mutation causing cystic fibrosis [7]. was confirmed by sequence analysis, creating strain RL4. To model the evolutionarily conserved network of gene The endogenous YOR1 promoter was replaced with a interaction involving CFTR-ΔF508, we introduced the Tet-OFF regulatable element by insertion of pJH023, as homologous yeast ABC transporter, Yor1-ΔF670 [8,9], previously described [20], at the YOR1 locus to create into the library of non-essential yeast gene deletion strain RL8. RL8 was mated to the MATa deletion strain Louie et al. Genome Medicine 2012, 4:103 Page 3 of 20 http://genomemedicine.com/content/4/12/103 A B YPEG + 0.2Rg/ml oligomycin T+-T+-T+- pRS316 F-HA YOR1 yor1-)F670 F-Sec22 yor1-)F670/R1116T Yor1 Yor1-)F/ Yor1-)F R1116T C Trypsin D X-linker: (Rg/mL) 0 5 10 20 0 5 10 20 0 5 10 20 kDa 180 Agg. 115 82 X-linked 64 kDa 49 170- Native 37 130-
Load more

Recommended publications
  • Analysis of Gene Expression Data for Gene Ontology
    ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION A Thesis Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of the Requirements for the Degree Master of Science Robert Daniel Macholan May 2011 ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION Robert Daniel Macholan Thesis Approved: Accepted: _______________________________ _______________________________ Advisor Department Chair Dr. Zhong-Hui Duan Dr. Chien-Chung Chan _______________________________ _______________________________ Committee Member Dean of the College Dr. Chien-Chung Chan Dr. Chand K. Midha _______________________________ _______________________________ Committee Member Dean of the Graduate School Dr. Yingcai Xiao Dr. George R. Newkome _______________________________ Date ii ABSTRACT A tremendous increase in genomic data has encouraged biologists to turn to bioinformatics in order to assist in its interpretation and processing. One of the present challenges that need to be overcome in order to understand this data more completely is the development of a reliable method to accurately predict the function of a protein from its genomic information. This study focuses on developing an effective algorithm for protein function prediction. The algorithm is based on proteins that have similar expression patterns. The similarity of the expression data is determined using a novel measure, the slope matrix. The slope matrix introduces a normalized method for the comparison of expression levels throughout a proteome. The algorithm is tested using real microarray gene expression data. Their functions are characterized using gene ontology annotations. The results of the case study indicate the protein function prediction algorithm developed is comparable to the prediction algorithms that are based on the annotations of homologous proteins.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • A Molecular and Genetic Analysis of Otosclerosis
    A molecular and genetic analysis of otosclerosis Joanna Lauren Ziff Submitted for the degree of PhD University College London January 2014 1 Declaration I, Joanna Ziff, confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. Where work has been conducted by other members of our laboratory, this has been indicated by an appropriate reference. 2 Abstract Otosclerosis is a common form of conductive hearing loss. It is characterised by abnormal bone remodelling within the otic capsule, leading to formation of sclerotic lesions of the temporal bone. Encroachment of these lesions on to the footplate of the stapes in the middle ear leads to stapes fixation and subsequent conductive hearing loss. The hereditary nature of otosclerosis has long been recognised due to its recurrence within families, but its genetic aetiology is yet to be characterised. Although many familial linkage studies and candidate gene association studies to investigate the genetic nature of otosclerosis have been performed in recent years, progress in identifying disease causing genes has been slow. This is largely due to the highly heterogeneous nature of this condition. The research presented in this thesis examines the molecular and genetic basis of otosclerosis using two next generation sequencing technologies; RNA-sequencing and Whole Exome Sequencing. RNA–sequencing has provided human stapes transcriptomes for healthy and diseased stapes, and in combination with pathway analysis has helped identify genes and molecular processes dysregulated in otosclerotic tissue. Whole Exome Sequencing has been employed to investigate rare variants that segregate with otosclerosis in affected families, and has been followed by a variant filtering strategy, which has prioritised genes found to be dysregulated during RNA-sequencing.
    [Show full text]
  • Mig-6 Controls EGFR Trafficking and Suppresses Gliomagenesis
    Mig-6 controls EGFR trafficking and suppresses gliomagenesis Haoqiang Yinga,1, Hongwu Zhenga,1, Kenneth Scotta, Ruprecht Wiedemeyera, Haiyan Yana, Carol Lima, Joseph Huanga, Sabin Dhakala, Elena Ivanovab, Yonghong Xiaob,HaileiZhangb,JianHua, Jayne M. Stommela, Michelle A. Leea, An-Jou Chena, Ji-Hye Paika,OresteSegattoc, Cameron Brennand,e, Lisa A. Elferinkf,Y.AlanWanga,b, Lynda China,b,g, and Ronald A. DePinhoa,b,h,2 aDepartment of Medical Oncology, bBelfer Institute for Applied Cancer Science, Belfer Foundation Institute for Innovative Cancer Science, Dana-Farber Cancer Institute and Harvard Medical School, Boston, MA 02115; cLaboratory of Immunology, Istituto Regina Elena, Rome 00158, Italy; dHuman Oncology and Pathogenesis Program and eDepartment of Neurosurgery, Memorial Sloan-Kettering Cancer Center, New York, NY 10065; fDepartment of Neuroscience and Cell Biology, University of Texas Medical Branch, Galveston, TX 77555; gDepartment of Dermatology, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115; and hDepartment of Medicine and Genetics, Harvard Medical School, Boston, MA 02115 Edited* by Webster K. Cavenee, Ludwig Institute, University of California, La Jolla, CA, and approved March 8, 2010 (received for review December 23, 2009) Glioblastoma multiforme (GBM) is the most common and lethal structural aberrations that serve as a key pathological driving primary brain cancer that is driven by aberrant signaling of growth force for tumor progression and many of them remain to be factor receptors, particularly the epidermal growth factor receptor characterized (6, 7). GBM possesses a highly rearranged genome (EGFR). EGFR signaling is tightly regulated by receptor endocytosis and high-resolution genome analysis has uncovered myriad and lysosome-mediated degradation, although the molecular somatic alterations on the genomic and epigenetic levels (2, 3).
    [Show full text]
  • Discovery and the Genic Map of the Human Genome
    Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press RESEARCH The Genexpress Index: A Resource for Gene Discovery and the Genic Map of the Human Genome R6mi Houlgatte, 1'2'3' R6gine Mariage-Samson, 1'2'3 Simone Duprat, 2 Anne Tessier, 2 Simone Bentolila, 1'2 Bernard Lamy, 2 and Charles Auffray 1'2'4 1Genexpress, Centre National de la Recherche Scientifique (CNRS) UPR420, 94801 Villejuif CEDEX, France; 2Genexpress, G4n6thon, 91002 Evry CEDEX, France Detailed analysis of a set of 18,698 sequences derived from both ends of 10,979 human skeletal muscle and brain cDNA clones defined 6676 functional families, characterized by their sequence signatures over 5750 distinct human gene transcripts. About half of these genes have been assigned to specific chromosomes utilizing 2733 eSTS markers, the polymerase chain reaction, and DNA from human-rodent somatic cell hybrids. Sequence and clone clustering and a functional classification together with comprehensive data base searches and annotations made it possible to develop extensive sequence and map cross-indexes, define electronic expression profiles, identify a new set of overlapping genes, and provide numerous new candidate genes for human pathologies. During the last 20 years, since the first descrip- 1993; Park et al. 1993; Takeda et al. 1993; Affara tions of eucaryotic cDNA cloning (Rougeon et al. et al. 1994; Davies et al. 1994; Kerr et al. 1994; 1975; Efstratiadis et al. 1976), cDNA studies have Konishi et al. 1994; Kurata et al. 1994; Liew et al. played a central role in molecular genetics. Early 1994; Murakawa et al.
    [Show full text]
  • UVRAG Is Required for Virus Entry Through Combinatorial Interaction with the Class C-Vps Complex and Snares
    UVRAG is required for virus entry through combinatorial interaction with the class C-Vps complex and SNAREs Sara Dolatshahi Pirooza, Shanshan Hea, Tian Zhanga, Xiaowei Zhanga, Zhen Zhaoa, Soohwan Oha, Douglas O’Connella, Payam Khalilzadeha, Samad Amini-Bavil-Olyaeea, Michael Farzanb, and Chengyu Lianga,1 aDepartment of Molecular Microbiology and Immunology, Keck School of Medicine, University of Southern California, Los Angeles, CA 90033; and bDepartment of Infectious Diseases, The Scripps Research Institute, Jupiter, FL 33458 Edited by Peter Palese, Icahn School of Medicine at Mount Sinai, New York, NY, and approved January 15, 2014 (received for review November 4, 2013) Enveloped viruses exploit the endomembrane system to enter host (R)-SNAREs embedded in the other (3). Specifically, syntaxin 7 cells. Through a cascade of membrane-trafficking events, virus-bearing (STX7; Qa), Vti1b (Qb), and STX8 (Qc) on the LE, when paired vesicles fuse with acidic endosomes and/or lysosomes mediated by with VAMP7 (R), mediate the LE fusion with the lysosome, but SNAREs triggering viral fusion. However, the molecular mechanisms when paired with VAMP8 (R), regulate homotypic fusion of the underlying this process remain elusive. Here, we found that UV- LEs (4). The upstream process regulating LE-associated SNARE radiation resistance-associated gene (UVRAG), an autophagic tumor pairing relies on the class C vacuolar protein sorting (Vps) complex suppressor, is required for the entry of the prototypic negative- (hereafter referred to as C-Vps), composed of Vps11, Vps16, strand RNA virus, including influenza A virus and vesicular stoma- Vps18, and Vps33 as core subunits (5, 6). A recent study indicated titis virus, by a mechanism independent of IFN and autophagy.
    [Show full text]
  • Yeast Genome Gazetteer P35-65
    gazetteer Metabolism 35 tRNA modification mitochondrial transport amino-acid metabolism other tRNA-transcription activities vesicular transport (Golgi network, etc.) nitrogen and sulphur metabolism mRNA synthesis peroxisomal transport nucleotide metabolism mRNA processing (splicing) vacuolar transport phosphate metabolism mRNA processing (5’-end, 3’-end processing extracellular transport carbohydrate metabolism and mRNA degradation) cellular import lipid, fatty-acid and sterol metabolism other mRNA-transcription activities other intracellular-transport activities biosynthesis of vitamins, cofactors and RNA transport prosthetic groups other transcription activities Cellular organization and biogenesis 54 ionic homeostasis organization and biogenesis of cell wall and Protein synthesis 48 plasma membrane Energy 40 ribosomal proteins organization and biogenesis of glycolysis translation (initiation,elongation and cytoskeleton gluconeogenesis termination) organization and biogenesis of endoplasmic pentose-phosphate pathway translational control reticulum and Golgi tricarboxylic-acid pathway tRNA synthetases organization and biogenesis of chromosome respiration other protein-synthesis activities structure fermentation mitochondrial organization and biogenesis metabolism of energy reserves (glycogen Protein destination 49 peroxisomal organization and biogenesis and trehalose) protein folding and stabilization endosomal organization and biogenesis other energy-generation activities protein targeting, sorting and translocation vacuolar and lysosomal
    [Show full text]
  • Co-Expression Module Analysis Reveals Biological Processes
    Shi et al. BMC Systems Biology 2010, 4:74 http://www.biomedcentral.com/1752-0509/4/74 RESEARCH ARTICLE Open Access Co-expressionResearch article module analysis reveals biological processes, genomic gain, and regulatory mechanisms associated with breast cancer progression Zhiao Shi1,2, Catherine K Derow3 and Bing Zhang*3 Abstract Background: Gene expression signatures are typically identified by correlating gene expression patterns to a disease phenotype of interest. However, individual gene-based signatures usually suffer from low reproducibility and interpretability. Results: We have developed a novel algorithm Iterative Clique Enumeration (ICE) for identifying relatively independent maximal cliques as co-expression modules and a module-based approach to the analysis of gene expression data. Applying this approach on a public breast cancer dataset identified 19 modules whose expression levels were significantly correlated with tumor grade. The correlations were reproducible for 17 modules in an independent breast cancer dataset, and the reproducibility was considerably higher than that based on individual genes or modules identified by other algorithms. Sixteen out of the 17 modules showed significant enrichment in certain Gene Ontology (GO) categories. Specifically, modules related to cell proliferation and immune response were up-regulated in high- grade tumors while those related to cell adhesion was down-regulated. Further analyses showed that transcription factors NYFB, E2F1/E2F3, NRF1, and ELK1 were responsible for the up-regulation of the cell proliferation modules. IRF family and ETS family proteins were responsible for the up-regulation of the immune response modules. Moreover, inhibition of the PPARA signaling pathway may also play an important role in tumor progression.
    [Show full text]
  • Congenital Disorders of Glycosylation from a Neurological Perspective
    brain sciences Review Congenital Disorders of Glycosylation from a Neurological Perspective Justyna Paprocka 1,* , Aleksandra Jezela-Stanek 2 , Anna Tylki-Szyma´nska 3 and Stephanie Grunewald 4 1 Department of Pediatric Neurology, Faculty of Medical Science in Katowice, Medical University of Silesia, 40-752 Katowice, Poland 2 Department of Genetics and Clinical Immunology, National Institute of Tuberculosis and Lung Diseases, 01-138 Warsaw, Poland; [email protected] 3 Department of Pediatrics, Nutrition and Metabolic Diseases, The Children’s Memorial Health Institute, W 04-730 Warsaw, Poland; [email protected] 4 NIHR Biomedical Research Center (BRC), Metabolic Unit, Great Ormond Street Hospital and Institute of Child Health, University College London, London SE1 9RT, UK; [email protected] * Correspondence: [email protected]; Tel.: +48-606-415-888 Abstract: Most plasma proteins, cell membrane proteins and other proteins are glycoproteins with sugar chains attached to the polypeptide-glycans. Glycosylation is the main element of the post- translational transformation of most human proteins. Since glycosylation processes are necessary for many different biological processes, patients present a diverse spectrum of phenotypes and severity of symptoms. The most frequently observed neurological symptoms in congenital disorders of glycosylation (CDG) are: epilepsy, intellectual disability, myopathies, neuropathies and stroke-like episodes. Epilepsy is seen in many CDG subtypes and particularly present in the case of mutations
    [Show full text]
  • Functions of Syntaxin 8 in Human Cytotoxic T Lymphocytes
    Aus dem Bereich Biophysik Theoretische und Klinische Medizin der Medizinischen Fakultät der Universität des Saarlandes, Homburg/Saar Functions of Syntaxin 8 in human cytotoxic T lymphocytes Dissertation zur Erlangung des Grades eines Doktors der Naturwissenschaften der Medizinischen Fakultät der UNIVERSITÄT DES SAARLANDES 2013 vorgelegt von: Shruthi. S. Bhat geb.am: 27.03.1985 in Manipal, India Tag des Promotionskolloquiums: __________________________________ Dekan: __________________________________ Vorsitzender: __________________________________ Berichterstatter: __________________________________ __________________________________ __________________________________ __________________________________ To my beloved parents and teachers Index INDEX I ABBREVIATIONS VI ZUSAMMENFASSUNG VII 1. INTRODUCTION 1 1.1. Immune system 1 1.2. Cell mediated and humoral immunity 2 1.3. Cytotoxic T Lymphocytes (CTLs) 4 1.3.1. T Cell Receptor complex 5 1.3.2. Immunological Synapse 6 1.3.3. Lytic granules, the secretory lysosomes in immune cells 7 1.3.3.1. Perforin 8 1.3.3.2. Granzymes, lytic granule serine proteases 9 1.3.4. Fas and Fas ligand pathway 11 1.4. Sorting, delivery and maturation of proteins and vesicles through endosomal pathway 12 1.5. SNARE proteins 15 1.6. SNARE and related proteins in immune cells 17 1.7. Syntaxin 8: the protein of interest 20 1.8. Aims of this study 21 2. MATERIALS AND METHODS 23 2.1. Antibodies and Reagents 23 2.2. Peripheral blood mononuclear cell (PBMC) isolation 23 2.3. Stimulation of PBLs with Staphylococcal enterotoxin A 24 2.4. Positive isolation of CD8+ T lymphocytes 25 2.5. Negative isolation of CD8+ T lymphocytes 26 2.6. siRNA transfection of CTLs 27 I Index 2.7.
    [Show full text]
  • Analysis of Mir-34A-5P Over-Expression by Qrt-PCR
    Supplementary material files Supplementary Figure 1: Analysis of miR-34a-5p over-expression by qRT-PCR. Primary CD4+ T cells were transfected either with allstars negative control (ANC) or miR-34a-5p mimic. 48 h post transfection the total RNA was isolated and analyzed by qRT-PCR using a specific hsa-miR-34a-5p primer. Supplementary Figure 2: FACS Controls CD4+ T cells were stained for CD4 and co-stained for CD11A or the respective isotype controls for 30 min at 4°C. Cells were analyzed by flow cytometry. Gated CD4+ T cells (A) were analyzed for CD11A expression (B, dark grey) in comparison to isotype controls (light grey). CD8+ T cells were stained for CD8 and co-stained for CD11A or the respective isotype controls for 30 min at 4°C. Cells were analyzed by flow cytometry. Gated CD8+ T cells (C) were analyzed for CD11A expression (D, dark grey) in comparison to isotype controls (light grey). Supplementary Table 1 target cloning sequence ID gene primers (restriction sites are underlined) 5'-VAMP2-SpeI ggactagtccatcatcctcatcatcatc VAMP2 NM_014232.2 3'-VAMP2-NaeI gccggccctcaatcagttcacccaatgag 5'-IKBKE-SpeI ggactagtcacatgaggcatcctgaag IKBKE NM_014002.3 3'-IKBKE-SacI cgagctcgcatagaaagaacaggaggctc 5'-MYH9-SpeI ggactagtcgaagaggtagatggcaaagc MYH9 NM_002473.5 3'-MYH9-SacI cgagctccctttgtgacagcaactggg 5'-MARCH8-SpeI ggactagtgtgtgcgggttgtcattttc MARCH8 NM_001282866.1 3'-MARCH8-SacI cgagctccagaatgcactgagagtggg 5'-KLRK1-SpeI ggactagtgagactgtgcactctatgcctc KLRK1 NM_007360.3 3'-KLRK1-SacI cgagctcccttcttaactgtgaacctgtg 5'-CD11A-SpeI ggactagtgagaaggactctgagagtgg
    [Show full text]
  • The Loss of Photosynthetic Pathways in the Plastid and Nuclear Genomes of the Non- Photosynthetic Mycoheterotrophic Eudicot Monotropa Hypopitys Nikolai V
    The Author(s) BMC Plant Biology 2016, 16(Suppl 3):238 DOI 10.1186/s12870-016-0929-7 RESEARCH Open Access The loss of photosynthetic pathways in the plastid and nuclear genomes of the non- photosynthetic mycoheterotrophic eudicot Monotropa hypopitys Nikolai V. Ravin*, Eugeny V. Gruzdev, Alexey V. Beletsky, Alexander M. Mazur, Egor B. Prokhortchouk, Mikhail A. Filyushin, Elena Z. Kochieva, Vitaly V. Kadnikov, Andrey V. Mardanov and Konstantin G. Skryabin From The International Conference on Bioinformatics of Genome Regulation and Structure\Systems Biology (BGRS\SB-2016) Novosibirsk, Russia. 29 August-2 September 2016 Abstract Background: Chloroplasts of most plants are responsible for photosynthesis and contain a conserved set of about 110 genes that encode components of housekeeping gene expression machinery and photosynthesis-related functions. Heterotrophic plants obtaining nutrients from other organisms and their plastid genomes represent model systems in which to study the effects of relaxed selective pressure on photosynthetic function. The most evident is a reduction in the size and gene content of the plastome, which correlates with the loss of genes encoding photosynthetic machinery which become unnecessary. Transition to a non-photosynthetic lifestyle is expected also to relax the selective pressure on photosynthetic machinery in the nuclear genome, however, the corresponding changes are less known. Results: Here we report the complete sequence of the plastid genome of Monotropa hypopitys, an achlorophyllous obligately mycoheterotrophic plant belonging to the family Ericaceae. The plastome of M. hypopitys is greatly reduced in size (35,336 bp) and lacks the typical quadripartite structure with two single-copy regions and an inverted repeat.
    [Show full text]