DOCSLIB.ORG

Mig-6 Controls EGFR Trafficking and Suppresses Gliomagenesis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mig-6 Controls EGFR Trafficking and Suppresses Gliomagenesis Mig-6 controls EGFR trafficking and suppresses gliomagenesis Haoqiang Yinga,1, Hongwu Zhenga,1, Kenneth Scotta, Ruprecht Wiedemeyera, Haiyan Yana, Carol Lima, Joseph Huanga, Sabin Dhakala, Elena Ivanovab, Yonghong Xiaob,HaileiZhangb,JianHua, Jayne M. Stommela, Michelle A. Leea, An-Jou Chena, Ji-Hye Paika,OresteSegattoc, Cameron Brennand,e, Lisa A. Elferinkf,Y.AlanWanga,b, Lynda China,b,g, and Ronald A. DePinhoa,b,h,2 aDepartment of Medical Oncology, bBelfer Institute for Applied Cancer Science, Belfer Foundation Institute for Innovative Cancer Science, Dana-Farber Cancer Institute and Harvard Medical School, Boston, MA 02115; cLaboratory of Immunology, Istituto Regina Elena, Rome 00158, Italy; dHuman Oncology and Pathogenesis Program and eDepartment of Neurosurgery, Memorial Sloan-Kettering Cancer Center, New York, NY 10065; fDepartment of Neuroscience and Cell Biology, University of Texas Medical Branch, Galveston, TX 77555; gDepartment of Dermatology, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115; and hDepartment of Medicine and Genetics, Harvard Medical School, Boston, MA 02115 Edited* by Webster K. Cavenee, Ludwig Institute, University of California, La Jolla, CA, and approved March 8, 2010 (received for review December 23, 2009) Glioblastoma multiforme (GBM) is the most common and lethal structural aberrations that serve as a key pathological driving primary brain cancer that is driven by aberrant signaling of growth force for tumor progression and many of them remain to be factor receptors, particularly the epidermal growth factor receptor characterized (6, 7). GBM possesses a highly rearranged genome (EGFR). EGFR signaling is tightly regulated by receptor endocytosis and high-resolution genome analysis has uncovered myriad and lysosome-mediated degradation, although the molecular somatic alterations on the genomic and epigenetic levels (2, 3). mechanisms governing such regulation, particularly in the context Here, using an integrated genomic and functional analysis, we of cancer, remain poorly delineated. Here, high-resolution ge- have identified Mig-6 as a candidate tumor suppressor that nomic profiles of GBM identified a highly recurrent focal 1p36 regulates EGFR trafficking and turnover in GBM cells. Mig-6 deletion encompassing the putative tumor suppressor gene, Mig- was originally identified as a mitogen-inducible gene and has 6. We show that Mig-6 quells the malignant potential of GBM cells been implicated in the feedback regulation of a variety of sig- and dampens EGFR signaling by driving EGFR into late endosomes naling processes, including the EGFR pathway (8–11). Ablation and lysosome-mediated degradation upon ligand stimulation. of Mig-6 was shown to induce tumor formation in various tissues, Mechanistically, this effect is mediated by the binding of Mig-6 supporting the tumor suppressor function of Mig-6 (12–14). to a SNARE protein STX8, a protein known to be required for late However, the role of Mig-6 during gliomagenesis is largely endosome trafficking. Thus, Mig-6 functions to ensure recruitment unknown. We report that Mig-6 functions to suppress the of internalized receptor to late endosomes and subsequently the malignant potential of GBM cells by enhancing EGFR traffick- lysosomal degradation compartment through its ability to specif- ing into late endosomes/lysosomes and promoting its degrada- fi ically link EGFR and STX8 during ligand-stimulated EGFR traf ck- tion. Further molecular and cell biology studies identified STX8, ing. In GBM, the highly frequent loss of Mig-6 would therefore a SNARE protein required for late-endosome fusion (15–17), as serve to sustain aberrant EGFR-mediated oncogenic signaling. a Mig-6-binding protein to form a complex with EGFR during Together, these data uncover a unique tumor suppression mecha- receptor trafficking. The strong interaction between Mig-6 and fi nism involving the regulation of receptor traf cking. STX8 upon ligand activation therefore ensures recruitment of internalized EGFR to late endosomes and subsequently the glioblastoma | vesicle | STX8 lysosomal degradation compartment. lioblastoma multiforme (GBM) is the most aggressive form Results Gof malignant glioma and stands as one of the most lethal Genomic analysis of GBM has revealed myriad alterations with cancers with median survival of ≈12–15 months (1). Extensive uncertain pathogenetic significance. Recurrent deletion of molecular and genomic studies of human glioma have identified chromosome 1p36 is among the most common genomic events in numerous genetic and genomic alterations resulting in activation multiple tumor types (18–23), although the structural complexity of multiple receptor tyrosine kinases, most notably epidermal of these deletions and the uncertain definition of the commonly growth factor (EGFR), which is found to be amplified and targeted region have hampered definitive identification of overexpressed in ∼45% of primary GBMs, although much less potential tumor suppressor(s) (24). In recent high-resolution frequently in low-grade gliomas (2, 3). Clinically, overexpression array comparative genomic hybridization (CGH) analysis of of EGFR has been correlated with poor prognosis in GBM GBM (18 tumors, 20 cell lines) that showed recurrent 1p36 patients (4), and the precise wiring of the EGFR network and deletion (Fig. 1A, 5/38; 13.2%), we delineated a unique 270-kb the regulation of its signaling pathway in GBM have always been minimal common region (MCR) of deletion containing only two an area of active investigation. It is well known that multiple known genes, PARK7 and Mig-6 (ERRFI1) (Fig. 1A), and mechanisms are engaged in the activation of the EGFR pathway during tumor initiation and progression, including receptor amplification and activating receptor mutations (5). Intriguingly, Author contributions: H. Ying, H. Zheng, L.C., and R.A.D. designed research; H. Ying, H. Zheng, K.S., H. Yan, C.L., J. Huang, S.D., E.I., J.M.S., A.-J.C., and J.-H.P. performed EGFR mutations occurring in GBM often involve the deletions research; R.W., O.S., and L.A.E. contributed new reagents/analytic tools; H. Ying, H. Zheng, in the extracellular domain or cytoplasmic tails, such as the R.W., E.I., Y.X., H. Zhang, J. Hu, and C.B. analyzed data; and H. Ying, H. Zheng, M.L., J.-H.P., EGFRvIII mutant missing the extracellular ligand binding L.A.E., Y.A.W., L.C., and R.A.D. wrote the paper. domain (5), whereas EGFR kinase domain mutations commonly The authors declare no conflict of interest. found in nonsmall cell lung cancer (NSCLC) are rare in GBM, *This Direct Submission article had a prearranged editor. suggesting distinctive oncogenic EGFR networks in different 1H. Ying and H. Zheng contributed equally to this work. tumor types. 2To whom correspondence should be addressed. E-mail: [email protected]. A hallmark feature of malignant glioma is its rampant genomic This article contains supporting information online at www.pnas.org/cgi/content/full/ instability accompanied by numerous recurrent chromosomal 0914930107/DCSupplemental. 6912–6917 | PNAS | April 13, 2010 | vol. 107 | no. 15 www.pnas.org/cgi/doi/10.1073/pnas.0914930107 Downloaded by guest on September 27, 2021 Fig. 1. Mig-6 is deleted in GBM cell lines and tumor samples. (A) Array-CGH heat map detailing Mig-6 deletion at chromosome 1p36 in primary GBM tumor specimens. Regions of amplification and deletion are denoted in red and blue, respectively. (B) mRNA expression levels of PARK7 and Mig-6 in normal human astrocytes (NHA) and LN319 cells. (C) FISH analysis of Mig-6 deletion in the GBM cell line, LN319. The green signals (arrows) indicate Fig. 2. Mig-6 functions as a tumor suppressor. Reconstiting Mig-6 expression hybridization using a Mig-6-specific BAC probe, whereas the red signals in (A) LN319 or (B) LN464 cells inhibits cell proliferation. Vec, empty vector indicate hybridization using a chromosome 1-specific centrosome reference control. (C) Knockdown of Mig-6 expression in U87 cells (Inset) accelerates probe. (D) mRNA level of Mig-6 in NHA and GBM cell lines. (E) Mig-6 protein cellular proliferation. shSC, hairpin control. (D)(Left) Reconstitution of Mig-6 level analyzed by Western blot in NHA and GBM cell lines. expression in LN319 or LN464 cells attenuates anchorage-independent growth in soft agar. (Right) Histogram quantification. Error bars indicate ±SD [**, P = 0.002 (LN319) and 0.008 (LN464), n = 3]. (E)(Upper) Knockdown of showing corresponding decrease in the expression of these genes Mig-6 expression in U87 cells promotes anchorage-independent growth in in samples with genomic deletion (Fig. 1B). Consistent with our soft agar. (Lower) Histogram quantification. Error bars indicate ±SD (**, P = data, The Cancer Genome Atlas (TCGA) dataset confirmed 0.001, n = 3). (F) Knockdown of Mig-6 expression in U87 cells promoted cell fi invasion in a Boyden chamber assay. (Upper) Representative images show the recurrent deletion of this region (62/339; 18.3%) that de ned an invasion of U87 cells expressing control (shSC and shMig-6-2) and targeting MCR containing seven known genes including PARK7 and Mig-6 shRNA (shMig-6-1) after 16-h induction with 10% FBS followed by crystal (Fig. S1). Most notably, Mig-6 expression is down-regulated at violet (0.2%) staining. (Lower) Histogram quantification. Error bars indicate ± both mRNA and protein levels in ∼50% of primary tumor samples SD (**, P = 0.003, n = 3). (G) shRNA targeting Mig-6 has no effect on soft and GBM cell lines, some of which do not show genomic deletion agar growth of LN319 cells. (H) Reconstitution of Mig-6 expression inhibits of Mig-6, indicating that additional mechanisms ensure Mig-6 soft agar growth of U87 cells expressing Mig-6 targeting shRNA (shMig-6-1). down-regulation in human GBM (Fig. 1 D and E). Whereas Error bars indicate ±SD (*, P = 0.03; **, P = 0.01; n =3). PARK7 is an oncogene that inhibits the PTEN tumor suppressor (25–27), Mig-6 shows many properties consistent with a tumor suppressor role including cancer-prone phenotypes in knockout (Fig.
Load more

Recommended publications
  • A Yeast Phenomic Model for the Gene Interaction Network Modulating
    Louie et al. Genome Medicine 2012, 4:103 http://genomemedicine.com/content/4/12/103 RESEARCH Open Access A yeast phenomic model for the gene interaction network modulating CFTR-ΔF508 protein biogenesis Raymond J Louie3†, Jingyu Guo1,2†, John W Rodgers1, Rick White4, Najaf A Shah1, Silvere Pagant3, Peter Kim3, Michael Livstone5, Kara Dolinski5, Brett A McKinney6, Jeong Hong2, Eric J Sorscher2, Jennifer Bryan4, Elizabeth A Miller3* and John L Hartman IV1,2* Abstract Background: The overall influence of gene interaction in human disease is unknown. In cystic fibrosis (CF) a single allele of the cystic fibrosis transmembrane conductance regulator (CFTR-ΔF508) accounts for most of the disease. In cell models, CFTR-ΔF508 exhibits defective protein biogenesis and degradation rather than proper trafficking to the plasma membrane where CFTR normally functions. Numerous genes function in the biogenesis of CFTR and influence the fate of CFTR-ΔF508. However it is not known whether genetic variation in such genes contributes to disease severity in patients. Nor is there an easy way to study how numerous gene interactions involving CFTR-ΔF would manifest phenotypically. Methods: To gain insight into the function and evolutionary conservation of a gene interaction network that regulates biogenesis of a misfolded ABC transporter, we employed yeast genetics to develop a ‘phenomic’ model, in which the CFTR-ΔF508-equivalent residue of a yeast homolog is mutated (Yor1-ΔF670), and where the genome is scanned quantitatively for interaction. We first confirmed that Yor1-ΔF undergoes protein misfolding and has reduced half-life, analogous to CFTR-ΔF. Gene interaction was then assessed quantitatively by growth curves for approximately 5,000 double mutants, based on alteration in the dose response to growth inhibition by oligomycin, a toxin extruded from the cell at the plasma membrane by Yor1.
    [Show full text]
  • UVRAG Is Required for Virus Entry Through Combinatorial Interaction with the Class C-Vps Complex and Snares
    UVRAG is required for virus entry through combinatorial interaction with the class C-Vps complex and SNAREs Sara Dolatshahi Pirooza, Shanshan Hea, Tian Zhanga, Xiaowei Zhanga, Zhen Zhaoa, Soohwan Oha, Douglas O’Connella, Payam Khalilzadeha, Samad Amini-Bavil-Olyaeea, Michael Farzanb, and Chengyu Lianga,1 aDepartment of Molecular Microbiology and Immunology, Keck School of Medicine, University of Southern California, Los Angeles, CA 90033; and bDepartment of Infectious Diseases, The Scripps Research Institute, Jupiter, FL 33458 Edited by Peter Palese, Icahn School of Medicine at Mount Sinai, New York, NY, and approved January 15, 2014 (received for review November 4, 2013) Enveloped viruses exploit the endomembrane system to enter host (R)-SNAREs embedded in the other (3). Specifically, syntaxin 7 cells. Through a cascade of membrane-trafficking events, virus-bearing (STX7; Qa), Vti1b (Qb), and STX8 (Qc) on the LE, when paired vesicles fuse with acidic endosomes and/or lysosomes mediated by with VAMP7 (R), mediate the LE fusion with the lysosome, but SNAREs triggering viral fusion. However, the molecular mechanisms when paired with VAMP8 (R), regulate homotypic fusion of the underlying this process remain elusive. Here, we found that UV- LEs (4). The upstream process regulating LE-associated SNARE radiation resistance-associated gene (UVRAG), an autophagic tumor pairing relies on the class C vacuolar protein sorting (Vps) complex suppressor, is required for the entry of the prototypic negative- (hereafter referred to as C-Vps), composed of Vps11, Vps16, strand RNA virus, including influenza A virus and vesicular stoma- Vps18, and Vps33 as core subunits (5, 6). A recent study indicated titis virus, by a mechanism independent of IFN and autophagy.
    [Show full text]
  • Functions of Syntaxin 8 in Human Cytotoxic T Lymphocytes
    Aus dem Bereich Biophysik Theoretische und Klinische Medizin der Medizinischen Fakultät der Universität des Saarlandes, Homburg/Saar Functions of Syntaxin 8 in human cytotoxic T lymphocytes Dissertation zur Erlangung des Grades eines Doktors der Naturwissenschaften der Medizinischen Fakultät der UNIVERSITÄT DES SAARLANDES 2013 vorgelegt von: Shruthi. S. Bhat geb.am: 27.03.1985 in Manipal, India Tag des Promotionskolloquiums: __________________________________ Dekan: __________________________________ Vorsitzender: __________________________________ Berichterstatter: __________________________________ __________________________________ __________________________________ __________________________________ To my beloved parents and teachers Index INDEX I ABBREVIATIONS VI ZUSAMMENFASSUNG VII 1. INTRODUCTION 1 1.1. Immune system 1 1.2. Cell mediated and humoral immunity 2 1.3. Cytotoxic T Lymphocytes (CTLs) 4 1.3.1. T Cell Receptor complex 5 1.3.2. Immunological Synapse 6 1.3.3. Lytic granules, the secretory lysosomes in immune cells 7 1.3.3.1. Perforin 8 1.3.3.2. Granzymes, lytic granule serine proteases 9 1.3.4. Fas and Fas ligand pathway 11 1.4. Sorting, delivery and maturation of proteins and vesicles through endosomal pathway 12 1.5. SNARE proteins 15 1.6. SNARE and related proteins in immune cells 17 1.7. Syntaxin 8: the protein of interest 20 1.8. Aims of this study 21 2. MATERIALS AND METHODS 23 2.1. Antibodies and Reagents 23 2.2. Peripheral blood mononuclear cell (PBMC) isolation 23 2.3. Stimulation of PBLs with Staphylococcal enterotoxin A 24 2.4. Positive isolation of CD8+ T lymphocytes 25 2.5. Negative isolation of CD8+ T lymphocytes 26 2.6. siRNA transfection of CTLs 27 I Index 2.7.
    [Show full text]
  • Analysis of Mir-34A-5P Over-Expression by Qrt-PCR
    Supplementary material files Supplementary Figure 1: Analysis of miR-34a-5p over-expression by qRT-PCR. Primary CD4+ T cells were transfected either with allstars negative control (ANC) or miR-34a-5p mimic. 48 h post transfection the total RNA was isolated and analyzed by qRT-PCR using a specific hsa-miR-34a-5p primer. Supplementary Figure 2: FACS Controls CD4+ T cells were stained for CD4 and co-stained for CD11A or the respective isotype controls for 30 min at 4°C. Cells were analyzed by flow cytometry. Gated CD4+ T cells (A) were analyzed for CD11A expression (B, dark grey) in comparison to isotype controls (light grey). CD8+ T cells were stained for CD8 and co-stained for CD11A or the respective isotype controls for 30 min at 4°C. Cells were analyzed by flow cytometry. Gated CD8+ T cells (C) were analyzed for CD11A expression (D, dark grey) in comparison to isotype controls (light grey). Supplementary Table 1 target cloning sequence ID gene primers (restriction sites are underlined) 5'-VAMP2-SpeI ggactagtccatcatcctcatcatcatc VAMP2 NM_014232.2 3'-VAMP2-NaeI gccggccctcaatcagttcacccaatgag 5'-IKBKE-SpeI ggactagtcacatgaggcatcctgaag IKBKE NM_014002.3 3'-IKBKE-SacI cgagctcgcatagaaagaacaggaggctc 5'-MYH9-SpeI ggactagtcgaagaggtagatggcaaagc MYH9 NM_002473.5 3'-MYH9-SacI cgagctccctttgtgacagcaactggg 5'-MARCH8-SpeI ggactagtgtgtgcgggttgtcattttc MARCH8 NM_001282866.1 3'-MARCH8-SacI cgagctccagaatgcactgagagtggg 5'-KLRK1-SpeI ggactagtgagactgtgcactctatgcctc KLRK1 NM_007360.3 3'-KLRK1-SacI cgagctcccttcttaactgtgaacctgtg 5'-CD11A-SpeI ggactagtgagaaggactctgagagtgg
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Analysis of the Indacaterol-Regulated Transcriptome in Human Airway
    Supplemental material to this article can be found at: http://jpet.aspetjournals.org/content/suppl/2018/04/13/jpet.118.249292.DC1 1521-0103/366/1/220–236$35.00 https://doi.org/10.1124/jpet.118.249292 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS J Pharmacol Exp Ther 366:220–236, July 2018 Copyright ª 2018 by The American Society for Pharmacology and Experimental Therapeutics Analysis of the Indacaterol-Regulated Transcriptome in Human Airway Epithelial Cells Implicates Gene Expression Changes in the s Adverse and Therapeutic Effects of b2-Adrenoceptor Agonists Dong Yan, Omar Hamed, Taruna Joshi,1 Mahmoud M. Mostafa, Kyla C. Jamieson, Radhika Joshi, Robert Newton, and Mark A. Giembycz Departments of Physiology and Pharmacology (D.Y., O.H., T.J., K.C.J., R.J., M.A.G.) and Cell Biology and Anatomy (M.M.M., R.N.), Snyder Institute for Chronic Diseases, Cumming School of Medicine, University of Calgary, Calgary, Alberta, Canada Received March 22, 2018; accepted April 11, 2018 Downloaded from ABSTRACT The contribution of gene expression changes to the adverse and activity, and positive regulation of neutrophil chemotaxis. The therapeutic effects of b2-adrenoceptor agonists in asthma was general enriched GO term extracellular space was also associ- investigated using human airway epithelial cells as a therapeu- ated with indacaterol-induced genes, and many of those, in- tically relevant target. Operational model-fitting established that cluding CRISPLD2, DMBT1, GAS1, and SOCS3, have putative jpet.aspetjournals.org the long-acting b2-adrenoceptor agonists (LABA) indacaterol, anti-inflammatory, antibacterial, and/or antiviral activity. Numer- salmeterol, formoterol, and picumeterol were full agonists on ous indacaterol-regulated genes were also induced or repressed BEAS-2B cells transfected with a cAMP-response element in BEAS-2B cells and human primary bronchial epithelial cells by reporter but differed in efficacy (indacaterol $ formoterol .
    [Show full text]
  • Curcumin Alters Gene Expression-Associated DNA Damage, Cell Cycle, Cell Survival and Cell Migration and Invasion in NCI-H460 Human Lung Cancer Cells in Vitro
    ONCOLOGY REPORTS 34: 1853-1874, 2015 Curcumin alters gene expression-associated DNA damage, cell cycle, cell survival and cell migration and invasion in NCI-H460 human lung cancer cells in vitro I-TSANG CHIANG1,2, WEI-SHU WANG3, HSIN-CHUNG LIU4, SU-TSO YANG5, NOU-YING TANG6 and JING-GUNG CHUNG4,7 1Department of Radiation Oncology, National Yang‑Ming University Hospital, Yilan 260; 2Department of Radiological Technology, Central Taiwan University of Science and Technology, Taichung 40601; 3Department of Internal Medicine, National Yang‑Ming University Hospital, Yilan 260; 4Department of Biological Science and Technology, China Medical University, Taichung 404; 5Department of Radiology, China Medical University Hospital, Taichung 404; 6Graduate Institute of Chinese Medicine, China Medical University, Taichung 404; 7Department of Biotechnology, Asia University, Taichung 404, Taiwan, R.O.C. Received March 31, 2015; Accepted June 26, 2015 DOI: 10.3892/or.2015.4159 Abstract. Lung cancer is the most common cause of cancer CARD6, ID1 and ID2 genes, associated with cell survival and mortality and new cases are on the increase worldwide. the BRMS1L, associated with cell migration and invasion. However, the treatment of lung cancer remains unsatisfactory. Additionally, 59 downregulated genes exhibited a >4-fold Curcumin has been shown to induce cell death in many human change, including the DDIT3 gene, associated with DNA cancer cells, including human lung cancer cells. However, the damage; while 97 genes had a >3- to 4-fold change including the effects of curcumin on genetic mechanisms associated with DDIT4 gene, associated with DNA damage; the CCPG1 gene, these actions remain unclear. Curcumin (2 µM) was added associated with cell cycle and 321 genes with a >2- to 3-fold to NCI-H460 human lung cancer cells and the cells were including the GADD45A and CGREF1 genes, associated with incubated for 24 h.
    [Show full text]
  • An Integrated Analysis of Public Genomic Data Unveils a Possible
    Kubota and Suyama BMC Medical Genomics (2020) 13:8 https://doi.org/10.1186/s12920-020-0662-9 RESEARCH ARTICLE Open Access An integrated analysis of public genomic data unveils a possible functional mechanism of psoriasis risk via a long- range ERRFI1 enhancer Naoto Kubota1,2 and Mikita Suyama1* Abstract Background: Psoriasis is a chronic inflammatory skin disease, for which genome-wide association studies (GWAS) have identified many genetic variants as risk markers. However, the details of underlying molecular mechanisms, especially which variants are functional, are poorly understood. Methods: We utilized a computational approach to survey psoriasis-associated functional variants that might affect protein functions or gene expression levels. We developed a pipeline by integrating publicly available datasets provided by GWAS Catalog, FANTOM5, GTEx, SNP2TFBS, and DeepBlue. To identify functional variants on exons or splice sites, we used a web-based annotation tool in the Ensembl database. To search for noncoding functional variants within promoters or enhancers, we used eQTL data calculated by GTEx. The data of variants lying on transcription factor binding sites provided by SNP2TFBS were used to predict detailed functions of the variants. Results: We discovered 22 functional variant candidates, of which 8 were in noncoding regions. We focused on the enhancer variant rs72635708 (T > C) in the 1p36.23 region; this variant is within the enhancer region of the ERRFI1 gene, which regulates lipid metabolism in the liver and skin morphogenesis via EGF signaling. Further analysis showed that the ERRFI1 promoter spatially contacts with the enhancer, despite the 170 kb distance between them. We found that this variant lies on the AP-1 complex binding motif and may modulate binding levels.
    [Show full text]
  • Structure and Mechanism of Activity-Based Inhibition of the EGF-Receptor by Mig6
    Structure and mechanism of activity-based inhibition of the EGF-Receptor by Mig6 The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Park, E., N. Kim, S. B. Ficarro, Y. Zhang, B. I. Lee, A. Cho, K. Kim, et al. 2016. “Structure and mechanism of activity-based inhibition of the EGF-Receptor by Mig6.” Nature structural & molecular biology 22 (9): 703-711. doi:10.1038/nsmb.3074. http://dx.doi.org/10.1038/ nsmb.3074. Published Version doi:10.1038/nsmb.3074 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:26318688 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA HHS Public Access Author manuscript Author Manuscript Author ManuscriptNat Struct Author Manuscript Mol Biol. Author Author Manuscript manuscript; available in PMC 2016 March 14. Published in final edited form as: Nat Struct Mol Biol. 2015 September ; 22(9): 703–711. doi:10.1038/nsmb.3074. Structure and mechanism of activity-based inhibition of the EGF-Receptor by Mig6 Eunyoung Park#1,2, Nayoung Kim#3,4, Scott B. Ficarro1,5, Yi Zhang1,5, Byung Il Lee1,6, Ahye Cho3,4, Kihong Kim4, Angela K.J. Park3,4, Woong-Yang Park3,4, Bradley Murray7, Matthew Meyerson7,8,9, Rameen Beroukhim1,7,8,10, Jarrod A. Marto1,2,5, Jeonghee Cho3,4, and Michael J.
    [Show full text]
  • CORVET, CHEVI and HOPS – Multisubunit Tethers of the Endo
    © 2019. Published by The Company of Biologists Ltd | Journal of Cell Science (2019) 132, jcs189134. doi:10.1242/jcs.189134 REVIEW SUBJECT COLLECTION: CELL BIOLOGY AND DISEASE CORVET, CHEVI and HOPS – multisubunit tethers of the endo-lysosomal system in health and disease Jan van der Beek‡, Caspar Jonker*,‡, Reini van der Welle, Nalan Liv and Judith Klumperman§ ABSTRACT contact between two opposing membranes and pull them close Multisubunit tethering complexes (MTCs) are multitasking hubs that together to allow interactions between SNARE proteins (Murray form a link between membrane fusion, organelle motility and signaling. et al., 2016). SNARE assembly then provides additional fusion CORVET, CHEVI and HOPS are MTCs of the endo-lysosomal system. specificity and drives the actual fusion process (Ohya et al., 2009; They regulate the major membrane flows required for endocytosis, Stroupe et al., 2009). In this Review, we focus on the role of tethering lysosome biogenesis, autophagy and phagocytosis. In addition, proteins in endo-lysosomal fusion events. individual subunits control complex-independent transport of specific Tethering proteins can be divided into two main groups: long cargoes and exert functions beyond tethering, such as attachment to coiled-coil proteins (Gillingham and Munro, 2003) and microtubules and SNARE activation. Mutations in CHEVI subunits multisubunit tethering complexes (MTCs). MTCs form a lead to arthrogryposis, renal dysfunction and cholestasis (ARC) heterogenic group of protein complexes that consist of up to ten ∼ syndrome, while defects in CORVET and, particularly, HOPS are subunits resulting in a general length of 50 nm (Brocker et al., associated with neurodegeneration, pigmentation disorders, liver 2012; Chou et al., 2016; Hsu et al., 1998; Lürick et al., 2018; Ren malfunction and various forms of cancer.
    [Show full text]
  • Comparative Transcriptomics Reveals Similarities and Differences
    Seifert et al. BMC Cancer (2015) 15:952 DOI 10.1186/s12885-015-1939-9 RESEARCH ARTICLE Open Access Comparative transcriptomics reveals similarities and differences between astrocytoma grades Michael Seifert1,2,5*, Martin Garbe1, Betty Friedrich1,3, Michel Mittelbronn4 and Barbara Klink5,6,7 Abstract Background: Astrocytomas are the most common primary brain tumors distinguished into four histological grades. Molecular analyses of individual astrocytoma grades have revealed detailed insights into genetic, transcriptomic and epigenetic alterations. This provides an excellent basis to identify similarities and differences between astrocytoma grades. Methods: We utilized public omics data of all four astrocytoma grades focusing on pilocytic astrocytomas (PA I), diffuse astrocytomas (AS II), anaplastic astrocytomas (AS III) and glioblastomas (GBM IV) to identify similarities and differences using well-established bioinformatics and systems biology approaches. We further validated the expression and localization of Ang2 involved in angiogenesis using immunohistochemistry. Results: Our analyses show similarities and differences between astrocytoma grades at the level of individual genes, signaling pathways and regulatory networks. We identified many differentially expressed genes that were either exclusively observed in a specific astrocytoma grade or commonly affected in specific subsets of astrocytoma grades in comparison to normal brain. Further, the number of differentially expressed genes generally increased with the astrocytoma grade with one major exception. The cytokine receptor pathway showed nearly the same number of differentially expressed genes in PA I and GBM IV and was further characterized by a significant overlap of commonly altered genes and an exclusive enrichment of overexpressed cancer genes in GBM IV. Additional analyses revealed a strong exclusive overexpression of CX3CL1 (fractalkine) and its receptor CX3CR1 in PA I possibly contributing to the absence of invasive growth.
    [Show full text]
  • A Trafficome-Wide Rnai Screen Reveals Deployment of Early and Late Secretory Host Proteins and the Entire Late Endo-/Lysosomal V
    bioRxiv preprint doi: https://doi.org/10.1101/848549; this version posted November 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 A trafficome-wide RNAi screen reveals deployment of early and late 2 secretory host proteins and the entire late endo-/lysosomal vesicle fusion 3 machinery by intracellular Salmonella 4 5 Alexander Kehl1,4, Vera Göser1, Tatjana Reuter1, Viktoria Liss1, Maximilian Franke1, 6 Christopher John1, Christian P. Richter2, Jörg Deiwick1 and Michael Hensel1, 7 8 1Division of Microbiology, University of Osnabrück, Osnabrück, Germany; 2Division of Biophysics, University 9 of Osnabrück, Osnabrück, Germany, 3CellNanOs – Center for Cellular Nanoanalytics, Fachbereich 10 Biologie/Chemie, Universität Osnabrück, Osnabrück, Germany; 4current address: Institute for Hygiene, 11 University of Münster, Münster, Germany 12 13 Running title: Host factors for SIF formation 14 Keywords: siRNA knockdown, live cell imaging, Salmonella-containing vacuole, Salmonella- 15 induced filaments 16 17 Address for correspondence: 18 Alexander Kehl 19 Institute for Hygiene 20 University of Münster 21 Robert-Koch-Str. 4148149 Münster, Germany 22 Tel.: +49(0)251/83-55233 23 E-mail: [email protected] 24 25 or bioRxiv preprint doi: https://doi.org/10.1101/848549; this version posted November 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
    [Show full text]