DOCSLIB.ORG

+ 808 T/G Polymorphism Confers Protective Effect on Diabetic Nephropathy in a Korean Population

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
+ 808 T/G Polymorphism Confers Protective Effect on Diabetic Nephropathy in a Korean Population Disease Markers 34 (2013) 113–120 113 DOI 10.3233/DMA-120949 IOS Press Novel ERBB receptor feedback inhibitor 1 (ERRFI1) + 808 T/G polymorphism confers protective effect on diabetic nephropathy in a Korean population Ihn Suk Leea,JuHeeLeeb, Hyun Jin Kimb, Jae Min Leec, Seong Kyu Leec,HyeSooKima, Jong Min Leea, Kang Seo Parkc and Bon Jeong Kub,d,∗ aDepartment of Internal Medicine, The Catholic University College of Medicine, Daejeon, Korea bDepartment of Internal Medicine, Chungnam National University School of Medicine, Daejeon, Korea cDepartment of Internal Medicine, Eulji University School of Medicine, Daejeon, Korea dResearch Institute for Medical Sciences, Chungnam National University School of Medicine, Daejeon, Korea Abstract. BACKGROUND: The identification and characterization of the gene, ERRFI1, in diabetes has not been reported. In this study, we evaluated the relationship between ERRFI1 polymorphism and characteristics of type 2 diabetes mellitus (T2DM) in Korea. SUBJECTS AND METHODS: We conduct a case-control study involving T2DM patients (n = 342) and controls (n = 473). RESULTS: A novel single nucleotide ERRFI1 gene polymorphism at +807(T/G) was found. G genotype frequency was 40.1% in the diabetic group and 42.7% in the control group; the difference was not significant (p = 0.45). In the diabetic group, the urine albumin to creatinine ratio (ACR) was lower in the G genotype than in the T genotype (P = 0.004). In males with T2DM, those with the G genotype displayed lower systolic blood pressure (P = 0.01) and higher glomerular filtration rate (P = 0.048) compare to those with the T genotype. In females with T2DM, urine ACR was low in those with the G genotype than in those with the T genotype (P = 0.02). In the diabetic group, patients who harboring T allele had a 1.81 times higher risk of diabetic nephropathy than the G allele (95% CI 1.11–2.96, P = 0.02). In females with T2DM, patients who harboring T allele had a 2.12 times higher risk of diabetic nephropathy (95% CI 1.07–4.1, P = 0.03). CONCLUSIONS: We identify new loci associated with glycemic traits in diabetes and this finding indicates the potential of ERRFI1 as a novel therapeutic target of diabetic nephropathy. Keywords: Diabetic nephropathy, ERRFI1, polymorphism, type 2 diabetes 1. Introduction physical activity. T2DM is a complex disease charac- terized by insulin resistance and β-cell failure due to a Type 2 diabetes mellitus (T2DM) is becoming more combination of genetic and environmental factors that common every year in developing and western coun- adversely influence glucose metabolism. Our studies tries due to excessive caloric intake and decreasing conducted over a number of years have revealed the important roles played by genetic factors in the devel- opment and progression of diabetes. Genome-wide as- ∗ Corresponding author: Bon Jeong Ku, Department of Internal sociation studies in Europe have identified diabetes as- Medicine, Chungnam National University School of Medicine, 282 Munhwa-ro, Jung-gu, Daejeon 301-721, Korea. Tel.: +82 42 280 sociated genes that include transcription factor 7-like 7149; Fax: +82 42 280 7995; E-mail: [email protected]. 2 (TCF7L2), pancreatic beta-cell KATP channel sub- ISSN 0278-0240/13/$27.50 c 2013 – IOS Press and the authors. All rights reserved 114 I.S. Lee et al. / ERRFI1 gene polymorphism in diabetic patients units Kir6.2 (KCNJ11), potassium voltage-gated chan- lar dialysis, known malignant disease, acute infection, nels, protein tyrosine phosphatase, receptor type D alcohol abuse, and/or thyroid disease were excluded. (PTPRD),andserine racemase (SRR) [1–3]. Many T2DM patients were receiving life style modification genes such as angiotensin-converting enzyme, erythro- therapy (19.6%), oral hypoglycemic agents (31.9%), poietin,andosteoprotegerin are associated with dia- insulin alone (24%) and insulin plus oral drug combi- betic microvascular complication [4–6]. A number of nation therapy (24.5%). In 342 patients with T2DM, genome-wide association studies on T2DM have been 106 patients (31%) were receiving statins (29.2%) and conducted on individuals of European ancestry. The fibrates (1.8%). Written informed consent was given contributions of these genetic variants in other ethnic by all of participants after a complete and clear expla- groups are less clear. nation of the nature and purpose of the study and the ERBB receptor feedback inhibitor 1 (ERRFI1) is experimental protocol was provided. The study was ap- an adaptor protein containing the epidermal growth proved by the Institutional Review Board of Chung- factor (EGF) receptor, Cdc42 (cell division control nam National University Hospital. protein 42)/Rac interaction and binging (CRIB), Src- homology-3 (SH3), and 14-3-3 binding domain [7]. 2.2. Biochemical measurements ERRFI1 is a negative regulator of EGF signaling and an immediate early response gene that is rapidly in- The subjects underwent a standardized physical ex- duced by heterologous arrays of mitogenic and stress- amination and laboratory tests. Weight (without shoes ful stimuli [7,8]. ERRFI1 is induced by insulin and and wearing light outdoor clothing) and height were measured by trained personnel and body mass in- plays an important role in insulin signaling [9,10]. 2 High level expression of ERRFI1 is thought to trig- dex (BMI, kg/m ) was calculated. Systolic blood pressure (SBP) and diastolic blood pressure (DBP) ger cells to initiate hypertrophy in chronic pathologi- were measured in the sitting position after a 5-min cal conditions such as diabetes and hypertension [11– rest. All subjects were assessed in the morning fol- 13]. Recently, low level of ERRFI1 expression asso- lowing an overnight fast. Venous blood was drawn ciated with intrahepatic lipid accumulation and hyper- for measurements of fasting plasma glucose, gly- cholesterolemia [14]. But, the identification and char- cated hemoglobin (HbA1c), aspartate transaminase acterization of the ERRFI1 gene in diabetes has not (AST), alanine transaminase (ALT), total cholesterol been reported. In this study, we investigated relation- (TC), low-density lipoprotein (LDL) cholesterol, high- ship between ERRFI1 gene polymorphism and T2DM density lipoprotein (HDL) cholesterol, triglyceride, in a Korean population. blood urea nitrogen (BUN), and serum creatinine (Cr). Triglyceride, TC, and HDL cholesterol were measured enzymatically using a chemistry analyzer (Hitachi 747, 2. Subjects and methods Tokyo, Japan). Fasting plasma glucose was measured by the glucose oxidase method. Insulin was measured 2.1. Study subjects by immunoradiometric assay (Diabetes Primary Care, Los Angeles, CA, USA). Insulin sensitivity was mea- The hospital-based, case-control study including sured as fasting serum insulin (mU/L), the HOMA-IR 815 Korean subjects comprised 342 T2DM patients and the QUICKI. HOMA-IR was calculated as [fasting and 473 controls. The T2DM group was comprised insulin (mU/L) × fasting glucose (mmol/L)] ÷ 22.5. of patients who visited Chungnam National Univer- QUICKI was calculated as 1 ÷ (log fasting insulin + sity Hospital from February 2010 to November 2010. log fasting glucose), with log fasting insulin expressed The controls were acquired from a health examina- as mU/L and fasting glucose expressed as mg/dL. In- tion population in the hospital’s out-patient clinic. Sub- sulin secretion function was measured by HOMA-β, jects were considered diabetic and were included in calculated as (20 × fasting plasma insulin) ÷ (fasting the T2DM group if any of the following criteria were plasma glucose −3.5) [15], with the fasting parameters met: (1) history of T2DM, (2) plasma levels of fast- expressed as above. ing glucose ≥ 126 mg/dL, or (3) plasma levels of 2-h postprandial glucose ≥ 200 mg/dL. Non-diabetic 2.3. Genotyping of ERRFI1 sequence variations control subjects had no past history of diabetes and displayed a fasting plasma glucose concentration < Genomic DNA was extracted from blood treated 100 mg/dL. Subjects with renal failure requiring regu- with ethylenediaminetetraacetic acid (EDTA) antico- I.S. Lee et al. / ERRFI1 gene polymorphism in diabetic patients 115 Table 1 Primers for amplification and sequencing of ERRFI1 gene Primer Sequence (5’ to 3’) Tm (◦C) PCR forward primer CTACCTCCCAGGGAATGAAAGCTA- 72 PCR reverse primer TAAGGGATTTTTCTCTGCACTTCA 66 Genotyping primer CTACCTCCCAGGGAATGAAAGCTA 72 Genotyping primer GGTGCTCTCTCCCTCACACA 60 Genotyping primer GATCTCAGC TATGTGTCTG 56 Fig. 1. Schematic representation of the localization of gene-genome specific primer pairs for ERRFI1. Gray boxes correspond to exon regions. The arrows indicate the annealing sites and the direction of the primers. agulant using a standard phenol/chloroform proce- T2DM and control groups was compared using the dure. A Genomic DNA preparation kit (SolGent, Dae- chi-square test. Continuous data are reported as mean jeon, Korea) was used according to the manufacturer’s ± SD. Categorical data are reported as number of instructions and the obtained genomic DNA stored subjects and percentage of individuals affected. The at −70◦C until use. Genotypes were analyzed using independent-samples t test was used to compare geno- polymerase chain reaction (PCR) and direct sequenc- type groups in terms of clinical and laboratory charac- ing, as described below, performed without knowl- teristics. P value < 0.05 was considered to be signifi- edge of case-control status of the patients. ERRFI1 cant. gene primers were designed using the National Cen- ter for Biotechnology Information (NCBI) reference sequence NT_021937.19 and are summarized in Ta- 3. Results ble 1 and Fig. 1. The reaction conditions were as fol- lows: 95◦C denaturation temperature for 2 min fol- 3.1. Clinical characteristics lowed by 30 cycles consisting of 95◦C for 20 sec, 60◦C for 40 sec and 72◦C for 2.5 min, and followed by a fi- Results of the analyses of clinical characteristics of nal extension step of 5 min at 72◦C on a PTC-100 ap- the diabetic and control groups are presented in Ta- paratus (Bio-Rad Laboratories, Hercules, CA, USA).
Load more

Recommended publications
  • Mig-6 Controls EGFR Trafficking and Suppresses Gliomagenesis
    Mig-6 controls EGFR trafficking and suppresses gliomagenesis Haoqiang Yinga,1, Hongwu Zhenga,1, Kenneth Scotta, Ruprecht Wiedemeyera, Haiyan Yana, Carol Lima, Joseph Huanga, Sabin Dhakala, Elena Ivanovab, Yonghong Xiaob,HaileiZhangb,JianHua, Jayne M. Stommela, Michelle A. Leea, An-Jou Chena, Ji-Hye Paika,OresteSegattoc, Cameron Brennand,e, Lisa A. Elferinkf,Y.AlanWanga,b, Lynda China,b,g, and Ronald A. DePinhoa,b,h,2 aDepartment of Medical Oncology, bBelfer Institute for Applied Cancer Science, Belfer Foundation Institute for Innovative Cancer Science, Dana-Farber Cancer Institute and Harvard Medical School, Boston, MA 02115; cLaboratory of Immunology, Istituto Regina Elena, Rome 00158, Italy; dHuman Oncology and Pathogenesis Program and eDepartment of Neurosurgery, Memorial Sloan-Kettering Cancer Center, New York, NY 10065; fDepartment of Neuroscience and Cell Biology, University of Texas Medical Branch, Galveston, TX 77555; gDepartment of Dermatology, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115; and hDepartment of Medicine and Genetics, Harvard Medical School, Boston, MA 02115 Edited* by Webster K. Cavenee, Ludwig Institute, University of California, La Jolla, CA, and approved March 8, 2010 (received for review December 23, 2009) Glioblastoma multiforme (GBM) is the most common and lethal structural aberrations that serve as a key pathological driving primary brain cancer that is driven by aberrant signaling of growth force for tumor progression and many of them remain to be factor receptors, particularly the epidermal growth factor receptor characterized (6, 7). GBM possesses a highly rearranged genome (EGFR). EGFR signaling is tightly regulated by receptor endocytosis and high-resolution genome analysis has uncovered myriad and lysosome-mediated degradation, although the molecular somatic alterations on the genomic and epigenetic levels (2, 3).
    [Show full text]
  • Analysis of the Indacaterol-Regulated Transcriptome in Human Airway
    Supplemental material to this article can be found at: http://jpet.aspetjournals.org/content/suppl/2018/04/13/jpet.118.249292.DC1 1521-0103/366/1/220–236$35.00 https://doi.org/10.1124/jpet.118.249292 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS J Pharmacol Exp Ther 366:220–236, July 2018 Copyright ª 2018 by The American Society for Pharmacology and Experimental Therapeutics Analysis of the Indacaterol-Regulated Transcriptome in Human Airway Epithelial Cells Implicates Gene Expression Changes in the s Adverse and Therapeutic Effects of b2-Adrenoceptor Agonists Dong Yan, Omar Hamed, Taruna Joshi,1 Mahmoud M. Mostafa, Kyla C. Jamieson, Radhika Joshi, Robert Newton, and Mark A. Giembycz Departments of Physiology and Pharmacology (D.Y., O.H., T.J., K.C.J., R.J., M.A.G.) and Cell Biology and Anatomy (M.M.M., R.N.), Snyder Institute for Chronic Diseases, Cumming School of Medicine, University of Calgary, Calgary, Alberta, Canada Received March 22, 2018; accepted April 11, 2018 Downloaded from ABSTRACT The contribution of gene expression changes to the adverse and activity, and positive regulation of neutrophil chemotaxis. The therapeutic effects of b2-adrenoceptor agonists in asthma was general enriched GO term extracellular space was also associ- investigated using human airway epithelial cells as a therapeu- ated with indacaterol-induced genes, and many of those, in- tically relevant target. Operational model-fitting established that cluding CRISPLD2, DMBT1, GAS1, and SOCS3, have putative jpet.aspetjournals.org the long-acting b2-adrenoceptor agonists (LABA) indacaterol, anti-inflammatory, antibacterial, and/or antiviral activity. Numer- salmeterol, formoterol, and picumeterol were full agonists on ous indacaterol-regulated genes were also induced or repressed BEAS-2B cells transfected with a cAMP-response element in BEAS-2B cells and human primary bronchial epithelial cells by reporter but differed in efficacy (indacaterol $ formoterol .
    [Show full text]
  • Curcumin Alters Gene Expression-Associated DNA Damage, Cell Cycle, Cell Survival and Cell Migration and Invasion in NCI-H460 Human Lung Cancer Cells in Vitro
    ONCOLOGY REPORTS 34: 1853-1874, 2015 Curcumin alters gene expression-associated DNA damage, cell cycle, cell survival and cell migration and invasion in NCI-H460 human lung cancer cells in vitro I-TSANG CHIANG1,2, WEI-SHU WANG3, HSIN-CHUNG LIU4, SU-TSO YANG5, NOU-YING TANG6 and JING-GUNG CHUNG4,7 1Department of Radiation Oncology, National Yang‑Ming University Hospital, Yilan 260; 2Department of Radiological Technology, Central Taiwan University of Science and Technology, Taichung 40601; 3Department of Internal Medicine, National Yang‑Ming University Hospital, Yilan 260; 4Department of Biological Science and Technology, China Medical University, Taichung 404; 5Department of Radiology, China Medical University Hospital, Taichung 404; 6Graduate Institute of Chinese Medicine, China Medical University, Taichung 404; 7Department of Biotechnology, Asia University, Taichung 404, Taiwan, R.O.C. Received March 31, 2015; Accepted June 26, 2015 DOI: 10.3892/or.2015.4159 Abstract. Lung cancer is the most common cause of cancer CARD6, ID1 and ID2 genes, associated with cell survival and mortality and new cases are on the increase worldwide. the BRMS1L, associated with cell migration and invasion. However, the treatment of lung cancer remains unsatisfactory. Additionally, 59 downregulated genes exhibited a >4-fold Curcumin has been shown to induce cell death in many human change, including the DDIT3 gene, associated with DNA cancer cells, including human lung cancer cells. However, the damage; while 97 genes had a >3- to 4-fold change including the effects of curcumin on genetic mechanisms associated with DDIT4 gene, associated with DNA damage; the CCPG1 gene, these actions remain unclear. Curcumin (2 µM) was added associated with cell cycle and 321 genes with a >2- to 3-fold to NCI-H460 human lung cancer cells and the cells were including the GADD45A and CGREF1 genes, associated with incubated for 24 h.
    [Show full text]
  • An Integrated Analysis of Public Genomic Data Unveils a Possible
    Kubota and Suyama BMC Medical Genomics (2020) 13:8 https://doi.org/10.1186/s12920-020-0662-9 RESEARCH ARTICLE Open Access An integrated analysis of public genomic data unveils a possible functional mechanism of psoriasis risk via a long- range ERRFI1 enhancer Naoto Kubota1,2 and Mikita Suyama1* Abstract Background: Psoriasis is a chronic inflammatory skin disease, for which genome-wide association studies (GWAS) have identified many genetic variants as risk markers. However, the details of underlying molecular mechanisms, especially which variants are functional, are poorly understood. Methods: We utilized a computational approach to survey psoriasis-associated functional variants that might affect protein functions or gene expression levels. We developed a pipeline by integrating publicly available datasets provided by GWAS Catalog, FANTOM5, GTEx, SNP2TFBS, and DeepBlue. To identify functional variants on exons or splice sites, we used a web-based annotation tool in the Ensembl database. To search for noncoding functional variants within promoters or enhancers, we used eQTL data calculated by GTEx. The data of variants lying on transcription factor binding sites provided by SNP2TFBS were used to predict detailed functions of the variants. Results: We discovered 22 functional variant candidates, of which 8 were in noncoding regions. We focused on the enhancer variant rs72635708 (T > C) in the 1p36.23 region; this variant is within the enhancer region of the ERRFI1 gene, which regulates lipid metabolism in the liver and skin morphogenesis via EGF signaling. Further analysis showed that the ERRFI1 promoter spatially contacts with the enhancer, despite the 170 kb distance between them. We found that this variant lies on the AP-1 complex binding motif and may modulate binding levels.
    [Show full text]
  • Structure and Mechanism of Activity-Based Inhibition of the EGF-Receptor by Mig6
    Structure and mechanism of activity-based inhibition of the EGF-Receptor by Mig6 The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Park, E., N. Kim, S. B. Ficarro, Y. Zhang, B. I. Lee, A. Cho, K. Kim, et al. 2016. “Structure and mechanism of activity-based inhibition of the EGF-Receptor by Mig6.” Nature structural & molecular biology 22 (9): 703-711. doi:10.1038/nsmb.3074. http://dx.doi.org/10.1038/ nsmb.3074. Published Version doi:10.1038/nsmb.3074 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:26318688 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA HHS Public Access Author manuscript Author Manuscript Author ManuscriptNat Struct Author Manuscript Mol Biol. Author Author Manuscript manuscript; available in PMC 2016 March 14. Published in final edited form as: Nat Struct Mol Biol. 2015 September ; 22(9): 703–711. doi:10.1038/nsmb.3074. Structure and mechanism of activity-based inhibition of the EGF-Receptor by Mig6 Eunyoung Park#1,2, Nayoung Kim#3,4, Scott B. Ficarro1,5, Yi Zhang1,5, Byung Il Lee1,6, Ahye Cho3,4, Kihong Kim4, Angela K.J. Park3,4, Woong-Yang Park3,4, Bradley Murray7, Matthew Meyerson7,8,9, Rameen Beroukhim1,7,8,10, Jarrod A. Marto1,2,5, Jeonghee Cho3,4, and Michael J.
    [Show full text]
  • Comparative Transcriptomics Reveals Similarities and Differences
    Seifert et al. BMC Cancer (2015) 15:952 DOI 10.1186/s12885-015-1939-9 RESEARCH ARTICLE Open Access Comparative transcriptomics reveals similarities and differences between astrocytoma grades Michael Seifert1,2,5*, Martin Garbe1, Betty Friedrich1,3, Michel Mittelbronn4 and Barbara Klink5,6,7 Abstract Background: Astrocytomas are the most common primary brain tumors distinguished into four histological grades. Molecular analyses of individual astrocytoma grades have revealed detailed insights into genetic, transcriptomic and epigenetic alterations. This provides an excellent basis to identify similarities and differences between astrocytoma grades. Methods: We utilized public omics data of all four astrocytoma grades focusing on pilocytic astrocytomas (PA I), diffuse astrocytomas (AS II), anaplastic astrocytomas (AS III) and glioblastomas (GBM IV) to identify similarities and differences using well-established bioinformatics and systems biology approaches. We further validated the expression and localization of Ang2 involved in angiogenesis using immunohistochemistry. Results: Our analyses show similarities and differences between astrocytoma grades at the level of individual genes, signaling pathways and regulatory networks. We identified many differentially expressed genes that were either exclusively observed in a specific astrocytoma grade or commonly affected in specific subsets of astrocytoma grades in comparison to normal brain. Further, the number of differentially expressed genes generally increased with the astrocytoma grade with one major exception. The cytokine receptor pathway showed nearly the same number of differentially expressed genes in PA I and GBM IV and was further characterized by a significant overlap of commonly altered genes and an exclusive enrichment of overexpressed cancer genes in GBM IV. Additional analyses revealed a strong exclusive overexpression of CX3CL1 (fractalkine) and its receptor CX3CR1 in PA I possibly contributing to the absence of invasive growth.
    [Show full text]
  • Cell Culture-Based Profiling Across Mammals Reveals DNA Repair And
    1 Cell culture-based profiling across mammals reveals 2 DNA repair and metabolism as determinants of 3 species longevity 4 5 Siming Ma1, Akhil Upneja1, Andrzej Galecki2,3, Yi-Miau Tsai2, Charles F. Burant4, Sasha 6 Raskind4, Quanwei Zhang5, Zhengdong D. Zhang5, Andrei Seluanov6, Vera Gorbunova6, 7 Clary B. Clish7, Richard A. Miller2, Vadim N. Gladyshev1* 8 9 1 Division of Genetics, Department of Medicine, Brigham and Women’s Hospital, Harvard 10 Medical School, Boston, MA, 02115, USA 11 2 Department of Pathology and Geriatrics Center, University of Michigan Medical School, 12 Ann Arbor, MI 48109, USA 13 3 Department of Biostatistics, School of Public Health, University of Michigan, Ann Arbor, 14 MI 48109, USA 15 4 Department of Internal Medicine, University of Michigan Medical School, Ann Arbor, MI 16 48109, USA 17 5 Department of Genetics, Albert Einstein College of Medicine, Bronx, NY 10128, USA 18 6 Department of Biology, University of Rochester, Rochester, NY 14627, USA 19 7 Broad Institute, Cambridge, MA 02142, US 20 21 * corresponding author: Vadim N. Gladyshev ([email protected]) 22 ABSTRACT 23 Mammalian lifespan differs by >100-fold, but the mechanisms associated with such 24 longevity differences are not understood. Here, we conducted a study on primary skin 25 fibroblasts isolated from 16 species of mammals and maintained under identical cell culture 26 conditions. We developed a pipeline for obtaining species-specific ortholog sequences, 27 profiled gene expression by RNA-seq and small molecules by metabolite profiling, and 28 identified genes and metabolites correlating with species longevity. Cells from longer-lived 29 species up-regulated genes involved in DNA repair and glucose metabolism, down-regulated 30 proteolysis and protein transport, and showed high levels of amino acids but low levels of 31 lysophosphatidylcholine and lysophosphatidylethanolamine.
    [Show full text]
  • Gene 33/Mig6/ERRFI1, an Adapter Protein with Complex Functions in Cell Biology and Human Diseases
    cells Review Gene 33/Mig6/ERRFI1, an Adapter Protein with Complex Functions in Cell Biology and Human Diseases Dazhong Xu * and Cen Li Department of Pathology, Microbiology and Immunology, New York Medical College School of Medicine, Valhalla, NY 10595, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-914-594-3793; Fax: +1-914-594-4163 Abstract: Gene 33 (also named Mig6, RALT, and ERRFI1) is an adapter/scaffold protein with a calculated molecular weight of about 50 kD. It contains multiple domains known to mediate protein– protein interaction, suggesting that it has the potential to interact with many cellular partners and have multiple cellular functions. The research over the last two decades has confirmed that it indeed regulates multiple cell signaling pathways and is involved in many pathophysiological processes. Gene 33 has long been viewed as an exclusively cytosolic protein. However, recent evidence suggests that it also has nuclear and chromatin-associated functions. These new findings highlight a significantly broader functional spectrum of this protein. In this review, we will discuss the function and regulation of Gene 33, as well as its association with human pathophysiological conditions in light of the recent research progress on this protein. Keywords: gene 33; ERRFI1; adapter protein; DNA damage; EGFR; cancer; signal transduction Citation: Xu, D.; Li, C. Gene 1. Introduction 33/Mig6/ERRFI1, an Adapter Gene 33 (also named Mig6, RALT, and ERRFI1) was discovered as a glucocorticoid- Protein with Complex Functions in induced transcript from the rat liver using the differential hybridization technique in Cell Biology and Human Diseases. 1985 [1].
    [Show full text]
  • Integrative Genomic Analysis of Mouse and Human Hepatocellular Carcinoma
    Integrative genomic analysis of mouse and human hepatocellular carcinoma Michelle Dowa,b,c, Rachel M. Pykea,b, Brian Y. Tsuia,b, Ludmil B. Alexandrovd,e,f, Hayato Nakagawag, Koji Taniguchih,i,j,k, Ekihiro Sekil,m, Olivier Harismendyc,f,m, Shabnam Shalapourh,i,j, Michael Karinh,i,j,1, Hannah Cartera,f,n,1, and Joan Font-Burgadao,1 aDivision of Medical Genetics, Department of Medicine, University of California, San Diego, La Jolla, CA 92093; bBioinformatics and Systems Biology Graduate Program, University of California, San Diego, La Jolla, CA 92093; cHealth Science, Department of Biomedical Informatics, School of Medicine, University of California, San Diego, La Jolla, CA 92093; dDepartment of Cellular and Molecular Medicine, University of California, San Diego, La Jolla, CA 92093; eDepartment of Bioengineering, University of California, San Diego, La Jolla, CA 92093; fMoores Cancer Center, University of California, San Diego, La Jolla, CA 92093; gDepartment of Gastroenterology, Graduate School of Medicine, The University of Tokyo, 113-8655 Tokyo, Japan; hLaboratory of Gene Regulation and Signal Transduction, School of Medicine, University of California, San Diego, La Jolla, CA 92093; iDepartment of Pharmacology, School of Medicine, University of California, San Diego, La Jolla, CA 92093; jDepartment of Pathology, School of Medicine, University of California, San Diego, La Jolla, CA 92093; kDepartment of Microbiology and Immunology, Keio University School of Medicine, Tokyo 160-8582, Japan; lDepartment of Medicine, Cedars- Sinai Medical Center, Los Angeles, CA 90048; mDepartment of Medicine, School of Medicine, University of California, San Diego, La Jolla, CA 92093; nCancer Cell Map Initiative, University of California, San Diego, La Jolla, CA 92093; and oCancer Biology Program, Fox Chase Cancer Center, Philadelphia, PA 19111 Contributed by Michael Karin, August 30, 2018 (sent for review June 28, 2018; reviewed by Kenneth W.
    [Show full text]
  • Mouse Errfi1 Conditional Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Errfi1 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Errfi1 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Errfi1 gene (NCBI Reference Sequence: NM_133753 ; Ensembl: ENSMUSG00000028967 ) is located on Mouse chromosome 4. 4 exons are identified, with the ATG start codon in exon 2 and the TAA stop codon in exon 4 (Transcript: ENSMUST00000030811). Exon 2~4 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Errfi1 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-110K6 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Homozygous inactivation of this gene may lead to premature death, delayed eyelid opening, epidermal hyperplasia, degenerative joint disease, skin or lung cancer, gastrointestinal tract tumors, increased susceptibility to chemically- induced tumors, and impaired lung development and vascularization. Exon 2~4 covers 100.0% of the coding region. Start codon is in exon 2, and stop codon is in exon 4. The size of intron 1 for 5'-loxP site insertion: 9803 bp. The size of effective cKO region: ~2625 bp. The cKO region does not have any other known gene. Page 1 of 7 https://www.alphaknockout.com Overview of the Targeting Strategy gRNA region Wildtype allele T A 5' gRNA region A 3' 1 2 3 4 Targeting vector T A A Targeted allele T A A Constitutive KO allele (After Cre recombination) Legends Exon of mouse Errfi1 Homology arm cKO region loxP site Page 2 of 7 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats.
    [Show full text]
  • Transcriptomic Response of Breast Cancer Cells to Anacardic Acid David J
    www.nature.com/scientificreports OPEN Transcriptomic response of breast cancer cells to anacardic acid David J. Schultz1, Abirami Krishna2, Stephany L. Vittitow2, Negin Alizadeh-Rad2, Penn Muluhngwi2, Eric C. Rouchka 3 & Carolyn M. Klinge 2 Received: 5 December 2017 Anacardic acid (AnAc), a potential dietary agent for preventing and treating breast cancer, inhibited Accepted: 10 May 2018 the proliferation of estrogen receptor α (ERα) positive MCF-7 and MDA-MB-231 triple negative Published: xx xx xxxx breast cancer cells. To characterize potential regulators of AnAc action, MCF-7 and MDA-MB-231 cells were treated for 6 h with purifed AnAc 24:1n5 congener followed by next generation transcriptomic sequencing (RNA-seq) and network analysis. We reported that AnAc-diferentially regulated miRNA transcriptomes in each cell line and now identify AnAc-regulated changes in mRNA and lncRNA transcript expression. In MCF-7 cells, 80 AnAc-responsive genes were identifed, including lncRNA MIR22HG. More AnAc-responsive genes (886) were identifed in MDA-MB-231 cells. Only six genes were commonly altered by AnAc in both cell lines: SCD, INSIG1, and TGM2 were decreased and PDK4, GPR176, and ZBT20 were increased. Modeling of AnAc-induced gene changes suggests that AnAc inhibits monounsaturated fatty acid biosynthesis in both cell lines and increases endoplasmic reticulum stress in MDA-MB-231 cells. Since modeling of downregulated genes implicated NFκB in MCF-7, we confrmed that AnAc inhibited TNFα-induced NFκB reporter activity in MCF-7 cells. These data identify new targets and pathways that may account for AnAc’s anti-proliferative and pro-apoptotic activity.
    [Show full text]
  • Gene Expression Patterns in Synchronized Islet Populations
    bioRxiv preprint doi: https://doi.org/10.1101/377317; this version posted July 25, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Gene expression patterns in synchronized islet populations Nikita Mukhitov1 and Michael G. Roper1* 1Department of Chemistry and Biochemistry, Florida State University, Tallahassee, FL. * Corresponding author E-mail: [email protected] Abstract In vivo levels of insulin are oscillatory with a period of ~5-10 minutes, implying that the numerous islets of Langerhans within the pancreas are synchronized. While the synchronizing factors are still under investigation, one result of this behavior is expected to be coordinated 2+ 2+ intracellular [Ca ] ([Ca ]i) oscillations throughout the islet population. The role that 2+ coordinated [Ca ]i oscillations have on controlling gene expression within pancreatic islets was examined by comparing gene expression levels in islets that were synchronized using a 2+ low amplitude glucose wave and an unsynchronized population. The [Ca ]i oscillations in the synchronized population were homogeneous and had a significantly lower drift in their oscillation period as compared to unsynchronized islets. This reduced drift in the synchronized population was verified by comparing the drift of in vivo and in vitro profiles from published reports. Microarray profiling indicated a number of Ca2+-dependent genes were differentially regulated between the two islet populations. Gene set enrichment analysis revealed that the synchronized population had reduced expression of gene sets related to protein translation, protein turnover, energy expenditure, and insulin synthesis, while those that were related to maintenance of cell morphology were increased.
    [Show full text]