Disease Markers 34 (2013) 113–120 113 DOI 10.3233/DMA-120949 IOS Press Novel ERBB receptor feedback inhibitor 1 (ERRFI1) + 808 T/G polymorphism confers protective effect on diabetic nephropathy in a Korean population Ihn Suk Leea,JuHeeLeeb, Hyun Jin Kimb, Jae Min Leec, Seong Kyu Leec,HyeSooKima, Jong Min Leea, Kang Seo Parkc and Bon Jeong Kub,d,∗ aDepartment of Internal Medicine, The Catholic University College of Medicine, Daejeon, Korea bDepartment of Internal Medicine, Chungnam National University School of Medicine, Daejeon, Korea cDepartment of Internal Medicine, Eulji University School of Medicine, Daejeon, Korea dResearch Institute for Medical Sciences, Chungnam National University School of Medicine, Daejeon, Korea Abstract. BACKGROUND: The identification and characterization of the gene, ERRFI1, in diabetes has not been reported. In this study, we evaluated the relationship between ERRFI1 polymorphism and characteristics of type 2 diabetes mellitus (T2DM) in Korea. SUBJECTS AND METHODS: We conduct a case-control study involving T2DM patients (n = 342) and controls (n = 473). RESULTS: A novel single nucleotide ERRFI1 gene polymorphism at +807(T/G) was found. G genotype frequency was 40.1% in the diabetic group and 42.7% in the control group; the difference was not significant (p = 0.45). In the diabetic group, the urine albumin to creatinine ratio (ACR) was lower in the G genotype than in the T genotype (P = 0.004). In males with T2DM, those with the G genotype displayed lower systolic blood pressure (P = 0.01) and higher glomerular filtration rate (P = 0.048) compare to those with the T genotype. In females with T2DM, urine ACR was low in those with the G genotype than in those with the T genotype (P = 0.02). In the diabetic group, patients who harboring T allele had a 1.81 times higher risk of diabetic nephropathy than the G allele (95% CI 1.11–2.96, P = 0.02). In females with T2DM, patients who harboring T allele had a 2.12 times higher risk of diabetic nephropathy (95% CI 1.07–4.1, P = 0.03). CONCLUSIONS: We identify new loci associated with glycemic traits in diabetes and this finding indicates the potential of ERRFI1 as a novel therapeutic target of diabetic nephropathy. Keywords: Diabetic nephropathy, ERRFI1, polymorphism, type 2 diabetes 1. Introduction physical activity. T2DM is a complex disease charac- terized by insulin resistance and β-cell failure due to a Type 2 diabetes mellitus (T2DM) is becoming more combination of genetic and environmental factors that common every year in developing and western coun- adversely influence glucose metabolism. Our studies tries due to excessive caloric intake and decreasing conducted over a number of years have revealed the important roles played by genetic factors in the devel- opment and progression of diabetes. Genome-wide as- ∗ Corresponding author: Bon Jeong Ku, Department of Internal sociation studies in Europe have identified diabetes as- Medicine, Chungnam National University School of Medicine, 282 Munhwa-ro, Jung-gu, Daejeon 301-721, Korea. Tel.: +82 42 280 sociated genes that include transcription factor 7-like 7149; Fax: +82 42 280 7995; E-mail: [email protected]. 2 (TCF7L2), pancreatic beta-cell KATP channel sub- ISSN 0278-0240/13/$27.50 c 2013 – IOS Press and the authors. All rights reserved 114 I.S. Lee et al. / ERRFI1 gene polymorphism in diabetic patients units Kir6.2 (KCNJ11), potassium voltage-gated chan- lar dialysis, known malignant disease, acute infection, nels, protein tyrosine phosphatase, receptor type D alcohol abuse, and/or thyroid disease were excluded. (PTPRD),andserine racemase (SRR) [1–3]. Many T2DM patients were receiving life style modification genes such as angiotensin-converting enzyme, erythro- therapy (19.6%), oral hypoglycemic agents (31.9%), poietin,andosteoprotegerin are associated with dia- insulin alone (24%) and insulin plus oral drug combi- betic microvascular complication [4–6]. A number of nation therapy (24.5%). In 342 patients with T2DM, genome-wide association studies on T2DM have been 106 patients (31%) were receiving statins (29.2%) and conducted on individuals of European ancestry. The fibrates (1.8%). Written informed consent was given contributions of these genetic variants in other ethnic by all of participants after a complete and clear expla- groups are less clear. nation of the nature and purpose of the study and the ERBB receptor feedback inhibitor 1 (ERRFI1) is experimental protocol was provided. The study was ap- an adaptor protein containing the epidermal growth proved by the Institutional Review Board of Chung- factor (EGF) receptor, Cdc42 (cell division control nam National University Hospital. protein 42)/Rac interaction and binging (CRIB), Src- homology-3 (SH3), and 14-3-3 binding domain [7]. 2.2. Biochemical measurements ERRFI1 is a negative regulator of EGF signaling and an immediate early response gene that is rapidly in- The subjects underwent a standardized physical ex- duced by heterologous arrays of mitogenic and stress- amination and laboratory tests. Weight (without shoes ful stimuli [7,8]. ERRFI1 is induced by insulin and and wearing light outdoor clothing) and height were measured by trained personnel and body mass in- plays an important role in insulin signaling [9,10]. 2 High level expression of ERRFI1 is thought to trig- dex (BMI, kg/m ) was calculated. Systolic blood pressure (SBP) and diastolic blood pressure (DBP) ger cells to initiate hypertrophy in chronic pathologi- were measured in the sitting position after a 5-min cal conditions such as diabetes and hypertension [11– rest. All subjects were assessed in the morning fol- 13]. Recently, low level of ERRFI1 expression asso- lowing an overnight fast. Venous blood was drawn ciated with intrahepatic lipid accumulation and hyper- for measurements of fasting plasma glucose, gly- cholesterolemia [14]. But, the identification and char- cated hemoglobin (HbA1c), aspartate transaminase acterization of the ERRFI1 gene in diabetes has not (AST), alanine transaminase (ALT), total cholesterol been reported. In this study, we investigated relation- (TC), low-density lipoprotein (LDL) cholesterol, high- ship between ERRFI1 gene polymorphism and T2DM density lipoprotein (HDL) cholesterol, triglyceride, in a Korean population. blood urea nitrogen (BUN), and serum creatinine (Cr). Triglyceride, TC, and HDL cholesterol were measured enzymatically using a chemistry analyzer (Hitachi 747, 2. Subjects and methods Tokyo, Japan). Fasting plasma glucose was measured by the glucose oxidase method. Insulin was measured 2.1. Study subjects by immunoradiometric assay (Diabetes Primary Care, Los Angeles, CA, USA). Insulin sensitivity was mea- The hospital-based, case-control study including sured as fasting serum insulin (mU/L), the HOMA-IR 815 Korean subjects comprised 342 T2DM patients and the QUICKI. HOMA-IR was calculated as [fasting and 473 controls. The T2DM group was comprised insulin (mU/L) × fasting glucose (mmol/L)] ÷ 22.5. of patients who visited Chungnam National Univer- QUICKI was calculated as 1 ÷ (log fasting insulin + sity Hospital from February 2010 to November 2010. log fasting glucose), with log fasting insulin expressed The controls were acquired from a health examina- as mU/L and fasting glucose expressed as mg/dL. In- tion population in the hospital’s out-patient clinic. Sub- sulin secretion function was measured by HOMA-β, jects were considered diabetic and were included in calculated as (20 × fasting plasma insulin) ÷ (fasting the T2DM group if any of the following criteria were plasma glucose −3.5) [15], with the fasting parameters met: (1) history of T2DM, (2) plasma levels of fast- expressed as above. ing glucose ≥ 126 mg/dL, or (3) plasma levels of 2-h postprandial glucose ≥ 200 mg/dL. Non-diabetic 2.3. Genotyping of ERRFI1 sequence variations control subjects had no past history of diabetes and displayed a fasting plasma glucose concentration < Genomic DNA was extracted from blood treated 100 mg/dL. Subjects with renal failure requiring regu- with ethylenediaminetetraacetic acid (EDTA) antico- I.S. Lee et al. / ERRFI1 gene polymorphism in diabetic patients 115 Table 1 Primers for amplification and sequencing of ERRFI1 gene Primer Sequence (5’ to 3’) Tm (◦C) PCR forward primer CTACCTCCCAGGGAATGAAAGCTA- 72 PCR reverse primer TAAGGGATTTTTCTCTGCACTTCA 66 Genotyping primer CTACCTCCCAGGGAATGAAAGCTA 72 Genotyping primer GGTGCTCTCTCCCTCACACA 60 Genotyping primer GATCTCAGC TATGTGTCTG 56 Fig. 1. Schematic representation of the localization of gene-genome specific primer pairs for ERRFI1. Gray boxes correspond to exon regions. The arrows indicate the annealing sites and the direction of the primers. agulant using a standard phenol/chloroform proce- T2DM and control groups was compared using the dure. A Genomic DNA preparation kit (SolGent, Dae- chi-square test. Continuous data are reported as mean jeon, Korea) was used according to the manufacturer’s ± SD. Categorical data are reported as number of instructions and the obtained genomic DNA stored subjects and percentage of individuals affected. The at −70◦C until use. Genotypes were analyzed using independent-samples t test was used to compare geno- polymerase chain reaction (PCR) and direct sequenc- type groups in terms of clinical and laboratory charac- ing, as described below, performed without knowl- teristics. P value < 0.05 was considered to be signifi- edge of case-control status of the patients. ERRFI1 cant. gene primers were designed using the National Cen- ter for Biotechnology Information (NCBI) reference sequence NT_021937.19 and are summarized in Ta- 3. Results ble 1 and Fig. 1. The reaction conditions were as fol- lows: 95◦C denaturation temperature for 2 min fol- 3.1. Clinical characteristics lowed by 30 cycles consisting of 95◦C for 20 sec, 60◦C for 40 sec and 72◦C for 2.5 min, and followed by a fi- Results of the analyses of clinical characteristics of nal extension step of 5 min at 72◦C on a PTC-100 ap- the diabetic and control groups are presented in Ta- paratus (Bio-Rad Laboratories, Hercules, CA, USA).