Western University Scholarship@Western
Electronic Thesis and Dissertation Repository
8-2-2018 1:30 PM
Genetic determinants underlying rare diseases identified using next-generation sequencing technologies
Rosettia Ho The University of Western Ontario
Supervisor Hegele, Robert A. The University of Western Ontario
Graduate Program in Biochemistry A thesis submitted in partial fulfillment of the equirr ements for the degree in Master of Science © Rosettia Ho 2018
Follow this and additional works at: https://ir.lib.uwo.ca/etd
Part of the Medical Genetics Commons
Recommended Citation Ho, Rosettia, "Genetic determinants underlying rare diseases identified using next-generation sequencing technologies" (2018). Electronic Thesis and Dissertation Repository. 5497. https://ir.lib.uwo.ca/etd/5497
This Dissertation/Thesis is brought to you for free and open access by Scholarship@Western. It has been accepted for inclusion in Electronic Thesis and Dissertation Repository by an authorized administrator of Scholarship@Western. For more information, please contact [email protected].
Abstract
Rare disorders affect less than one in 2000 individuals, placing a huge burden on individuals, families and the health care system. Gene discovery is the starting point in understanding the molecular mechanisms underlying these diseases. The advent of next- generation sequencing has accelerated discovery of disease-causing genetic variants and is showing numerous benefits for research and medicine. I describe the application of next-generation sequencing, namely LipidSeq™ ‒ a targeted resequencing panel for the identification of dyslipidemia-associated variants ‒ and whole-exome sequencing, to identify genetic determinants of several rare diseases. Utilization of next-generation sequencing plus associated bioinformatics led to the discovery of disease-associated variants for 71 patients with lipodystrophy, two with early-onset obesity, and families with brachydactyly, cerebral atrophy, microcephaly-ichthyosis, and widow’s peak syndrome. Understanding these variants and their contribution to disease can increase understanding of disease mechanisms and help with the development of therapeutic interventions in the future.
i
Keywords
Next-generation sequencing; targeted sequencing; whole-exome sequencing; Mendelian disease; genetic disease; rare disease; metabolic disease; lipodystrophy; extreme early- onset obesity; brachydactyly; cerebral atrophy; CARE for RARE; FORGE Canada; autosomal recessive; autosomal dominant; variant discovery; copy-number variation
ii
Co-Authorship Statement
Dr. Robert A. Hegele provided all the supervision and funding, and his input for the conceptualization, design and protocols of this Thesis project. Dr. Hegele also provided all lipodystrophy, two extreme early-onset obesity, and cerebral atrophy samples.
Chapters 1, 3 and 4 contain modified text from a submitted manuscript entitled, “Whole- exome sequencing identifies a novel IHH insertion in an Ontario family with brachydactyly type A1”, co-authored by Adam D. McIntyre, Brooke A. Kennedy, and Dr. Robert A. Hegele.
Dr. Hegele, Dr. Kathleen A. Hill and Dr. C. Anthony Rupar provided critical revision for all Chapters.
Dr. Victoria M. Siu provided three of the extreme early-onset obesity samples discussed in the Thesis, and the CARE for RARE and FORGE Canada consortiums provided samples for the CARE for RARE/FORGE Canada projects. Dr. Siu, Dr. Rupar and Dr. Rana Chakrabarti provided clinical information, additional samples and support.
Dr. Jian Wang, Dr. Henian Cao, and Adam D. McIntyre each contributed their technical expertise to the design of this Thesis project. More specifically, Dr. Wang helped with primer design and conceptualization, and greatly assisted with the validation of copy- number variation events, Dr. Cao performed all LipidSeq™ targeted sequencing, and Adam C. McIntyre provided clinical information and technical support. John F. Robinson provided assistance and support for each CARE for RARE and FORGE Canada project. Brooke A. Kennedy provided clinical information for the brachydactyly case.
In addition to the co-authors listed above, several students were involved in the CARE for RARE and FORGE Canada projects. Calwing Liao provided expertise and technical support for the microcephaly-ichthyosis, heterotaxy, and widow’s peak cases; Cory Soininen worked on the dystonia case; Gagandeep Singh worked on sequence analysis for the craniorachischisis case; Jing (Tony) Yao worked on the craniosynostosis case; and Xingyu (Robin) Liu helped with the sequencing analysis of the cryptophthalmos case.
iii
Dedication
In loving memory of my Grandma – thank you for supporting me, loving me unconditionally and raising me to be the person I am today. I love and miss you more than words can say.
iv
Acknowledgements
The past few years in the Hegele lab have been some of the most enriching years of my life. I have learned more than I thought possible from extraordinary individuals and created great friendships with my exceptional colleagues. Here, I would like to acknowledge the fantastic individuals that made my Thesis such a rewarding experience.
First and foremost, I would like to thank my supervisor, Dr. Rob Hegele, for his supervision, support and mentorship. You have been a guiding light throughout my entire Masters, and I will be forever grateful for the time I spent under your supervision. In addition to your knowledge, thank you for bringing me laughter on Friday afternoons, and sharing your love of dogs. Speaking on behalf of all the graduate students past-and- present and myself, we are so thankful for everything you do. Thank you for taking a chance on me in third year. It has been a privilege to be your student.
To my advisory committee, Dr. Kathleen Hill and Dr. Tony Rupar, thank you for your outstanding mentorship. I am so appreciative of all the feedback and support you have provided, not only during committee meetings but elsewhere as well.
An additional thank you to Dr. Hill for being so supportive these past few years. It has been an absolute honour to have you as an advisor for both my undergraduate and graduate Thesis projects.
Thank you to Dr. Victoria Siu for being a mentor to me. It has been a pleasure to work with you on this Thesis project, and to volunteer in the clinic with you. Your wisdom and graciousness are inspiring.
To the entirety of the Hegele lab, thank you so much for being such excellent colleagues and listening to me rant throughout my years in the lab. Thank you to Adam McIntyre for all your support throughout my Thesis – from helping me find charts, office supplies or DNA samples – you have been so helpful throughout it all. Thank you to John for your help along the way. Also, thank you so much to Dr. Henian Cao for all your technical assistance and mentorship. Furthermore, thank you, Dr. Jian Wang, not only for your
v
mentorship but also for recommending the best Chinese restaurants and being such a great colleague – I hope that one day we finally get our trio sequenced.
To the Department of Biochemistry, thank you for providing administrative and research support. Thank you to Barb Green for being a friendly face in the department and providing administrative assistance.
Thank you to the friends I have made along the way – Emily, Cal, Amy, Nadya, Freda – you are the best. Thank you so also to the brilliant Sali for your mentorship, kindness, and guidance.
To my main pals – Alli, Jacqueline and Michael – thank you so much for being such remarkable human beings and for all the memories. I would not be where I am without you and your humour, laughter, and support of my eccentric personality. I look forward to staying in contact and watching you all succeed in the future. More specifically, Alli – thank you for being my twin. We are the same person and I would not have it any other way. I could not imagine having a better, more beautiful or generous neighbour than you. Jacqueline – you are an angel on earth. Thank you for your kindness and thoughtfulness; you inspire me every day. Thank you for being the light in the darkest of times. Michael – thank you for being such a great friend. You and I are two peas in a pod; if I had to choose anyone to be incarcerated with, it would be you.
To my family – I love you with all my heart. Thank you to my Mom and Dad for your encouragement, support and unconditional love. I know how much you have sacrificed for Neuton and me. I could not imagine better, more generous, caring parents than you. To my sidekick Neuton (hey, brother!), you are not just my sibling but also my best friend. To Shirley, you are a sister to me, and I am so grateful for our lifelong relationship. Thank you, Neu and Shin, for keeping me young and fun and being there to talk to about anything. To my Grandma, I will cherish our memories forever. To Jayvee, thank you for opening my heart and coming into my life when I needed you the most. Lastly, to my partner Alex, thank you for indulging in Junior Chickens with me, going to every restaurant, letting me vent, and being there for the last six-and-a-half years and counting. You are the definition of a partner-in-crime, and I am so grateful for you.
vi
Table of Contents Abstract ...... i Keywords ...... ii Co-Authorship Statement ...... iii Dedication ...... iv Acknowledgements ...... v Table of Contents ...... vii List of Figures ...... xiii List of Tables ...... xiv List of Appendices ...... xv List of Abbreviations ...... xvi Chapter 1 – Introduction ...... 1 1.1 Rare disease burden in Canada...... 1 1.1.1 Many rare diseases are of genetic origin...... 2 1.1.2 Research problem and motivation ...... 2 1.2 Rare human genetic diseases ...... 3 1.2.1 Inherited lipodystrophies ...... 3 1.2.1.1 Congenital generalized lipodystrophy ...... 3 1.2.1.2 Familial partial lipodystrophy ...... 4 1.2.2 Extreme early-onset obesity ...... 5 1.2.3 Isolated brachydactyly ...... 6 1.2.4 Cerebral atrophy...... 8 1.2.5 FORGE Canada and CARE for RARE ...... 8 1.2.5.1 Project overview ...... 8 1.2.5.2 Project significance ...... 9 1.2.5.3 FORGE Canada and CARE for RARE cases...... 9 1.3 The human genome sequence ...... 13 1.3.1 Variation within the human genome ...... 13 1.3.1.1 Single nucleotide variation ...... 14 1.3.1.1.1 Splicing variation ...... 15 1.3.1.1.2 Insertions and deletions ...... 15 1.3.1.2 Repetitive elements ...... 16
vii
1.3.1.3 Structural variation ...... 16 1.3.1.3.1 Copy-number variation ...... 17 1.3.2 Germline versus somatic variation ...... 17 1.3.3 Inherited versus de novo variation ...... 17 1.4 Human genetic diseases ...... 18 1.4.1 Heritability of genetic diseases ...... 18 1.4.1.1 Monogenic diseases...... 19 1.4.1.2 Digenic diseases ...... 20 1.4.1.3 Polygenic diseases ...... 21 1.4.1.4 Disease penetrance and expressivity ...... 21 1.5 Genetic variation and rare diseases ...... 22 1.5.1 The genetics of lipodystrophy ...... 22 1.5.1.1 Congenital generalized lipodystrophy ...... 23 1.5.1.2 Familial partial lipodystrophy ...... 24 1.5.1.3 Unexplained cases of lipodystrophy ...... 25 1.5.2 The genetics of obesity ...... 25 1.5.2.1 Unexplained cases of early-onset obesity ...... 27 1.5.3 The genetics of brachydactyly ...... 27 1.5.3.1 Brachydactyly type A ...... 29 1.5.3.1.1 Brachydactyly type A1 (BDA1) ...... 29 1.5.3.1.2 Brachydactyly type A1, B (BDA1B) ...... 29 1.5.3.1.3 Brachydactyly type A1, C (BDA1C) ...... 30 1.5.3.1.4 Brachydactyly type A1, D (BDA1D) ...... 30 1.5.3.1.5 Brachydactyly type A2 (BDA2) ...... 30 1.5.3.1.6 Brachydactyly type A3 (BDA3) ...... 31 1.5.3.1.7 Brachydactyly type A4 (BDA4) ...... 31 1.5.3.1.8 Unexplained cases of brachydactyly ...... 31 1.5.4 The genetics of autosomal recessive cerebral atrophy ...... 34 1.5.4.1 Unexplained cerebral atrophy ...... 34 1.5.5 Genetically unexplained consortium cases ...... 36 1.6 Next-generation sequencing and rare diseases ...... 36 1.6.1 Targeted resequencing ...... 37
viii
1.6.1.1 LipidSeq™ ...... 37 1.6.2 Whole-exome sequencing ...... 45 1.6.2.1 Whole-exome sequencing successes ...... 45 1.6.3 Whole-genome sequencing ...... 45 1.7 Thesis project outline ...... 46 1.7.1 Project overview ...... 46 1.7.2 Project hypothesis ...... 47 1.7.3 Project goal and aims ...... 47 Chapter 2 – Materials and Methods...... 48 2 Overview ...... 48 2.1 Ethics approval ...... 48 2.2 Study subjects ...... 50 2.2.1 Clinical information ...... 50 2.3 DNA extraction and quality control ...... 50 2.4 SNP genotyping and autozygosity mapping ...... 50 2.5 Next-generation sequencing ...... 51 2.5.1 Patient selection for LipidSeq™ ...... 51 2.5.1.1 LipidSeq™ targeted sequencing ...... 51 2.5.2 Patient selection for whole-exome sequencing ...... 52 2.5.2.1 Whole-exome sequencing ...... 53 2.6 Bioinformatics processing ...... 54 2.7 Variant annotation ...... 56 2.8 Variant prioritization ...... 56 2.8.1 Zygosity ...... 58 2.8.2 Read depth ...... 58 2.8.3 Sequence ontology ...... 58 2.8.4 Minor allele frequency ...... 59 2.8.5 In silico analyses ...... 59 2.8.6 Gene and protein analysis and literature review ...... 59 2.8.7 Association with the disease phenotype ...... 59 2.9 Copy-number variation detection ...... 60 2.9.1 Copy-number variation prioritization ...... 61
ix
2.10 Variant validation and co-segregation analysis ...... 61 2.10.1 PCR ...... 61 2.10.2 PCR imaging and purification ...... 61 2.10.3 Sanger sequencing and analysis ...... 62 2.11 Validation of copy-number variation events ...... 62 2.12 Gene enrichment analysis...... 63 2.13 Statistical analysis: Brachydactyly case ...... 63 2.14 Box plot generation: Brachydactyly case ...... 63 Chapter 3 – Results ...... 64 3 Overview ...... 64 3.1 Study subjects and clinical features ...... 64 3.2 LipidSeq™ variant detection ...... 64 3.3 Sanger sequencing of TMPRSS4 ...... 66 3.4 Whole-exome sequencing ...... 66 3.4.1 Lipodystrophy ...... 69 3.4.2 Extreme early-onset obesity ...... 69 3.4.3 Brachydactyly ...... 72 3.4.4 Cerebral atrophy-like ...... 72 3.4.5 CARE for RARE and FORGE Canada ...... 73 3.5 Shared sequence variation ...... 75 3.6 Copy-number variation discovery ...... 78 3.6.1 LipidSeq™ copy-number variation detection ...... 78 3.6.2 Exome copy-number variation detection ...... 80 3.7 Validation of candidate variants and copy-number variations ...... 80 3.7.1 IHH validation (brachydactyly) ...... 80 3.7.2 VPS52 validation (microcephaly-ichthyosis) ...... 83 3.7.3 KDM6A validation (widow’s peak) ...... 83 3.7.4 AR validation (lipodystrophy and obesity) ...... 83 3.7.5 Copy-number variation validation ...... 86 3.7.5.1 Patient 1099: PLIN1 exon 2 deletion ...... 86 3.7.5.2 Patient 1120: CREB3L3 duplication ...... 88 3.8 Gene enrichment analysis...... 90
x
3.9 Statistical analysis: Brachydactyly case ...... 90 Chapter 4 – Discussion ...... 92 4 Summary of findings...... 92 4.1 LipidSeq™ ...... 93 4.1.1 Unexpected variation in POLD1 ...... 93 4.1.2 Copy-number variation findings ...... 94 4.1.2.1 Patient 1099 ...... 94 4.1.2.2 Patient 2108 ...... 95 4.1.2.3 Patient 15529 ...... 95 4.1.2.4 Patient 4192 ...... 95 4.1.2.5 Patient 14557 ...... 96 4.1.2.6 Patient 15678 ...... 97 4.1.2.7 Patient 1120 ...... 97 4.1.3 Benefits of LipidSeq™ ...... 98 4.1.4 Limitations of LipidSeq™ ...... 98 4.2 Whole-exome sequencing of patients with rare metabolic diseases ...... 99 4.2.1 Lipodystrophy ...... 100 4.2.1.1 Patient 1804 ...... 100 4.2.1.2 Patient 8615 ...... 100 4.2.1.3 Patient 1088 ...... 101 4.2.1.4 Patient 3458 ...... 102 4.2.1.5 Patient 3969 ...... 102 4.2.1.6 Patient 4116 ...... 103 4.2.1.7 Patient 4665 ...... 103 4.2.1.8 Patient 5662 ...... 104 4.2.1.9 Patient 2025 ...... 105 4.2.1.10 Patient 3011 ...... 105 4.2.1.11 Patient 14318 ...... 106 4.2.1.12 Patient 4194 ...... 107 4.2.1.13 Patient 1120 ...... 108 4.2.2 Extreme early-onset obesity ...... 109 4.2.2.1 Patient 15544 ...... 109
xi
4.2.2.2 Patient 15858 ...... 109 4.2.3 Lipodystrophy-obesity connection ...... 110 4.3 Whole-exome sequencing of rare disease families ...... 112 4.3.1 Brachydactyly type A1 ...... 112 4.3.2 Cerebral atrophy-like ...... 114 4.3.2.1 CASC5 and primary microcephaly-4 ...... 114 4.4 Whole-exome sequencing for CARE4RARE and FORGE Canada projects .. 116 4.4.1 Microcephaly-ichthyosis in the Old Order Amish ...... 116 4.4.2 Widow’s peak syndrome ...... 117 4.4.3 CARE for RARE and FORGE summary ...... 118 4.5 Gene enrichment analysis...... 118 4.6 Clinical utility of LipidSeq™ and whole-exome sequencing ...... 120 4.6.1 Comparison of LipidSeq™ and whole-exome sequencing to whole-genome sequencing ...... 120 4.7 Limitations of the project ...... 121 4.7.1 Study considerations ...... 121 4.7.2 General methodological limitations ...... 122 4.8 Future directions ...... 123 4.9 Conclusions ...... 129 4.10 Project significance ...... 130 References ...... 132 Appendices ...... 150 Curriculum Vitae ...... 160
xii
List of Figures
Figure 1.5.3.1.8 Pedigree of a Canadian autosomal dominant brachydactyly-affected family ...... 33
Figure 1.5.4.1 Pedigree of a family with cerebral atrophy ...... 35
Figure 2. Flowchart of steps taken in order to identify the genetic bases of rare disorders ...... 49
Figure 2.6. Next-generation sequencing bioinformatics workflow ...... 55
Figure 3.2. Variant breakdown for patients with lipodystrophy sequenced using the LipidSeq™ targeted gene panel ...... 65
Figure 3.5. Androgen receptor gene and protein structure ...... 77
Figure 3.7.1A Pedigree and IHH genotype information for a Canadian autosomal dominant brachydactyly type A1-affected family...... 81
Figure 3.7.1B Chromosome location, gene structure, sequence analysis and protein structure of Indian Hedgehog ...... 82
Figure 3.7.2 Sanger sequencing confirmation of the VPS52 gene variant in a family with a history of microcephaly-ichthyosis ...... 84
Figure 3.7.3 Sanger sequencing confirmation of the KDM6A gene variant in a family with a history of widow’s peak syndrome ...... 85
Figure 3.7.5.1 Validation of a PLIN1 exon 2 deletion in a patient with familial partial lipodystrophy ...... 87
Figure 3.7.5.2 Detection of a duplication event from LipidSeq™ versus whole-exome sequencing data ...... 89
Figure 3.9 Comparison of anthropometric measures between those positive for the IHH mutation and those negative for the IHH mutation ...... 91
xiii
List of Tables
Table 1.2.3 Clinical features of isolated brachydactyly ...... 7
Table 1.2.5.3 Clinical description and pedigrees for all CARE for RARE and FORGE Canada cases ...... 10
Table 1.5.2 Genes involved in the pathophysiology of obesity ...... 26
Table 1.5.3 The genetics of isolated brachydactyly ...... 28
Table 1.6.1.1 Details regarding the genes targeted by the LipidSeq™ gene panel relating to lipodystrophy and associated metabolic comorbidities ...... 38
Table 2.8 Criteria used to prioritize candidate variants and infer them as disease causing ...... 57
Table 3.4A Features of all patients with lipodystrophy in which whole-exome sequencing was performed ...... 67
Table 3.4B Features of all patients with extreme early-onset obesity in which whole- exome sequencing was performed ...... 68
Table 3.4.1 Candidate variants identified in patients with lipodystrophy using whole- exome sequencing ...... 70
Table 3.4.2. Candidate variants identified in patients with extreme early-onset obesity using whole-exome sequencing ...... 71
Table 3.4.5 Status of all CARE for RARE and FORGE Canada cases ...... 74
Table 3.5 Candidate variants identified in the androgen receptor gene ...... 76
Table 3.6.1 Candidate copy-number variants identified in patients with lipodystrophy using the LipidSeq™ targeted gene panel ...... 79
xiv
List of Appendices
Appendix I: Ethics Approval ...... 150
Appendix II: Consent Form ...... 151
Appendix III: Primer List ...... 156
Appendix IV: PANTHER gene lists ...... 157
xv
List of Abbreviations
A, additive effects
ABCA1, ATP-binding cassette A1
ABCA4, ATP binding casette A4
ABCG1, ATP binding cassette subfamily G member 1
ABCG8, sterolin 2
ABI, Applied Biosystems
ACMG, The American College of Medical Genetics and Genomics
AGPAT2, 1-acylglycerol-3-phosphate O-acyltransferase 2
AKT2, AKT serine/threonine kinase 2
ALD, acquired lipodystrophy
ANGPTL3, angiopoietin like 3
ANKRD24, ankyrin repeat domain 24
ANLN, anillin
ANNOVAR, Annotate Variation
APOA1, apolipoprotein A1
APOA5, apolipoprotein A-V
APOB, apolipoprotein B
APOC2, apolipoprotein C-II
xvi
APOC3, apolipoprotein C-III
AR, androgen receptor
ASPM, Abnormal Spindle Microtubule Assembly
BAT, brown adipose tissue
BBS10, Bardet-Biedl Syndrome 10
BCYM4, brachyolmia type 4
BDA, brachydactyly type A
BDNF, brain-derived neurotrophic factor bHLH, basic helix-loop-helix
BLK, B-lymphocyte specific kinase bp, base pair
BRCA1, breast cancer, DNA repair associated 1
BRCA2, breast cancer, DNA repair associated 2
BSCL2, seipin lipid droplet biogenesis associated
BUBR1, mitotic spindle checkpoint protein BUBR1
CADD, Combined Annotation Dependent Depletion
CARE4RARE, CARE for RARE
CASC5, kinetochore scaffold 1
xvii
CAV1, caveolin 1
CDK5RAP2, CDK5 Regulatory Subunit Associated Protein cDNA, complementary deoxyribonucleic acid
CEL, carboxyl-ester lipase
CEP, centrosomal protein
CFTR, cystic fibrosis transmembrane conductance regulator
CGL, congenital generalized lipodystrophy
ChAS, Chromosome Analysis Suite
CIDEC, cell death inducing DFFA like effector C
CIAP, calf intestinal alkaline phosphatase cm, centimeter
CMT, Charcot-Marie Tooth
CNV, copy-number variation co-IP, co-immunoprecipitation
CRE, cyclic AMP response element
CREB3L3, cAMP responsive element-binding protein 3-like 3
DGKD, Diacylglycerol Kinase Delta
DHAP, dihydroxyacetone phosphate
DIDA, Digenic Diseases Database
xviii
DNA, deoxyribonucleic acid
DVL3, Dishevelled Segment Polarity Protein 3
E, environment
ER, endoplasmic reticulum
ESP, Exome Sequencing Project
ExAC, Exome Aggregation Consortium
F8, coagulation factor VIII
FBN1, fibrillin 1
Fe-S, iron-sulfur clusters
FH, familial hypercholesterolemia
FHL1, four and a half LIM domains 1
FLNC, gamma filamin
FORGE Canada, Finding of Rare Disease Genes in Canada
FPLD, familial partial lipodystrophy
G, genotype
G3P, glycerol-3-phosphate
GALC, galacosylceramidase
GALNT2, polypeptide N-acetylgalactosaminyltransferase 2
GARP, Golgi associated retrograde protein
xix
GCK, glucokinase
GCKR, glucokinase receptor gDNA, genomic DNA gnomAD, Genome Aggregation Database
GPD1, glycerol-3-phosphate dehydrogenase 1
GPIHBP1, glycosylphosphatidylinositol anchored high-density lipoprotein binding protein 1
GSDV, glycogen storage disease type V
GWAS, genome-wide association study
HAART, highly active antiretroviral therapy
HDL, high-density lipoprotein
HEXA, hexosaminidase A
HGMD, Human Gene Mutation Database
HIV, human immunodeficiency virus
HLA, human leukocyte antigen
HNF1A, hepatocyte nuclear factor-1-alpha
HNF1B, hepatocyte nuclear factor-1-beta
HNF4A, hepatocyte nuclear factor-4-alpha
HSPG2, heparin sulfate proteoglycan 2
xx
HTG, hypertriglyceridemia
IFRD1, Interferon Related Developmental Regulator 1
IHH, indian hedgehog
INS, insulin
ISCU, iron-sulfur cluster assembly enzyme kb, kilobase
KDM6A, lysine-specific demethylase 6A
KEGG, Kyoto Encyclopedia of Genes and Genomes
KLF11, Kruppel-like factor 11
KMT2C, lysine-specific methyltransferase 2C
LCAT, lecithin-cholesterol acyltransferase
LDL, low-density lipoprotein
LDLR, low-density lipoprotein receptor
LEP, leptin
LEPR, leptin receptor
LFNG, LFNG O-Fucosylpeptide 3-Beta-N-Acetylglucosaminyltransferase
LIPE, lipoprotein E
LMF1, lipase maturation factor 1
LMNA, lamin A
xxi
LMNB2, lamin B
LOD, logarithm of the odds
LPL, lipoprotein lipase
LRGC, London Regional Genomics Centre
MADB, mandibuloacral dysplasia with type B lipodystrophy
MAF, minor allele frequency
MAP2K2, mitogen-activated protein kinase kinase 2
MC4R, melanocortin 4 receptor
MCPH, microcephaly, primary hereditary
MDPL, mandibular hypoplasia, deafness, progeriod features and lipodystrophy
MFN2, mitofusin 2
MLXIPL, MLX interacting protein like
MME, MatchMaker Exchange
MODY, mature-onset diabetes of the young mRNA, messenger ribonucleic acid
MSL, multiple symmetric lipomatosis
MVA, Mosaic Variegated Aneuploidy
NADH, nicotine adenine dinucleotide
NASH, non-alcoholic steatohepatitis
xxii
NCBI, National Centre for Biotechnology Information
NEUROD1, neurogenic differentiation 1
NGS, next-generation sequencing
NHEJ, non-homologous end joining
NTD, N-terminal domain
NTRK2, neurotrophic tyrosine kinase receptor type 2
NUDCD2, NudC Domain Containing 2
OMIM, Online Mendelian Inheritance in Man
P, phenotype
PANTHER, protein annotation through evolutionary relationship
PAPSS2, 3'-phosphoadenosine 5'-phosphosulfate synthase 2
PAX4, paired box gene 4
PCNA, proliferating nuclear cell antigen
PCOS, polycystic ovary syndrome
PCR, polymerase chain reaction
PCSK1, prohormone convertase 1
PCSK9, prohormone convertase 9
PDRM16, PR domain containing 16
PDX1, pancreatic and duodenal homeobox 1
xxiii
PIAS4, protein inhibitor of activated STAT 4
PLIN1, perilipin 1
POLD1, polymerase (DNA-directed) d1
PolyPhen-2, Polymorphism Phenotyping, v2
POMC, proopiomelanocortin
PPARɣ, peroxisome proliferator-activated receptor gamma
PTH, parathyroid hormone
PTRF, polymerase I and transcript release factor
PYGM, glycogen phosphorylase, muscle associated
RBM, reducing-body myopathy
RDS, peripherin 2
RFC, replication factor C
ROM1, retinal outer segment membrane protein 1 rRNA, ribosomal ribonucleic acid
RT-PCR, reverse transcription polymerase chain reaction
RT-qPCR, reverse transcription quantitative polymerase chain reaction
SETD8, SET domain containing (lysine methyltransferase) 8
SIFT, Sorting Intolerant From Tolerant
SIRT6, sirtuin-6
xxiv
SNP, single nucleotide polymorphism
SNV, single nucleotide variation
SPANR, Splicing Based Analysis of Variants
SULT, sulfotransferase
SV, structural variation
T2D, type 2 diabetes
TE, transposable element
TEAD4, TEA Domain Transcription Factor 4
TG, triglycerides
TMPRSS4, transmembrane protease, serine 4
TRAF7, TNF Receptor Associated Factor 7
TRE, triplet repeat expansion
TRIB1, Tribbles Pseudokinase 1
UTR, untranslated region
VAF, variant allele frequency
VCF, variant calling format
VG, genetic variation
VLDL, very low-density lipoprotein
VNTR, variable number tandem repeat
xxv
VP, phenotypic variation
VPS52, vaculolar protein sorting-52
WES, whole-exome sequencing
WGS, whole-genome sequencing
WRN, Werner
ZBTB33, zinc finger and BTB domain containing 33
ZBTB7A, zinc finger and BTB domain containing 7A
ZMPSTE24, zinc metalloproteinase STE24
xxvi 1
Chapter 1 – Introduction 1.1 Rare disease burden in Canada
In Canada, rare diseases are defined as conditions affecting less than one in every 2000 individuals1. Rare disorders place a significant burden on individuals, their families and the health care system, as there is often a lack of specialized services, social awareness, and clinical recognition. Furthermore, Canadian families with rare diseases face extraordinary challenges, including countless futile medical tests, unnecessary surgeries, financial hardships, social isolation, shortages in treatment options, and early mortality.
In the case of rare diseases, the term “diagnostic odyssey” describes the burden of these diseases on the individual, familial and systemic levels. The diagnostic odyssey details the time between the first concerns of a rare disorder to the time when a diagnosis is made2. In the diagnostic odyssey, more than half of the affected individuals with rare diseases are children, with 30% not living to see their fifth birthday. Further, 40% of individuals with rare diseases will receive an incorrect diagnosis, 25% will wait 5‒25 years for a diagnosis, and 50% will never be diagnosed in the course of their lifetime3.
Ultra-rare diseases – those limited to a handful of individuals – are often referred to as “orphan diseases”. The term orphan disease describes an exceptionally rare disease historically neglected by the pharmaceutical industry, due to the assumed low financial incentive in devising proper treatments or cures. Because orphan diseases may affect only single individuals, families or communities, these individuals face even greater challenges than those with more prevalent rare diseases. Furthermore, these diseases are often chronically debilitating and life threatening4. With the hardships facing the individuals, their families and the health care system, and the lack of treatment options available, there is a pressing need to study rare diseases, and develop novel therapeutic interventions.
2
1.1.1 Many rare diseases are of genetic origin
To date, there are an estimated 7000 rare diseases. As most of these 7000 rare diseases are predicted to be of genetic origin due to severity and familial recurrence, gene discovery is the critical starting point for the understanding of the molecular mechanisms underlying these diseases, the development of targeted treatments, and the end of the diagnostic odyssey for these patients. Developing therapies is crucial, as fewer than five- percent of the 7000 rare diseases known-to-date offer effective therapeutic interventions5.
Previously, rare disease research was limited to standard genetic techniques including homozygosity mapping and candidate gene sequencing6. Although these were largely successful in identifying the molecular bases of >3500 rare disorders, limitations including time requirements and high costs have led to the advent of new and improved technologies, and the use of next-generation sequencing (NGS) – deoxyribonucleic acid (DNA) sequencing technologies capable of rapidly generating a massive amount of DNA sequence data – in rare disease studies7.
1.1.2 Research problem and motivation
Although the genetic basis of many rare diseases has been clarified using genetic techniques, many rare diseases, rare disease subtypes and orphan diseases remain genetically unexplained. With the success of NGS in elucidating the genetic basis of numerous rare diseases, I propose the use of NGS technologies in rare disease cases not previously subjected to NGS. By using these modern NGS technologies, my goal is to identify genetic determinants underlying several genetically unexplained rare diseases. Understanding these genetic variants and their contribution to disease can increase understanding of disease mechanisms and pave the way for the development of novel treatments in the future.
3
1.2 Rare human genetic diseases
There are many illustrative examples of rare human genetic diseases, notably lipodystrophy, extreme early-onset obesity, brachydactyly, and autosomal recessive cerebral atrophy. Further, research consortiums such as CARE for RARE (CARE4RARE) and Finding of Rare Disease Genes in Canada (FORGE Canada) collectively pursue research on the molecular basis of rare diseases.
1.2.1 Inherited lipodystrophies
Lipodystrophies are rare disorders characterized by selective and variable loss of adipose tissue, with excess accumulation of fat in otherwise unusual sites including the liver and muscle8. This results in a generalized muscular appearance with hypertrophy often arising in the extremities, more specifically, in the calves and arms. The genetic form of lipodystrophy is familial, and includes congenital generalized lipodystrophy (CGL) and familial partial lipodystrophy (FPLD). Affected individuals are predisposed to insulin resistance, which often progresses to other metabolic complications including diabetes, hypertension, metabolic syndrome and hypertriglyceridemia9. Furthermore, individuals with lipodystrophy are vulnerable to severe metabolic derangements including acute pancreatitis, hepatic cirrhosis and premature cardiovascular disease10. Women with severe lipodystrophy often acquire polycystic ovary disease and suffer from infertility, highlighting the aggressiveness of the disorder11. Although the global prevalence is less than one in a million, milder forms of lipodystrophy are commonly misdiagnosed as common central obesity or metabolic syndrome, suggesting that lipodystrophy is an underestimated condition12. This is concerning as a clear diagnosis of lipodystrophy can allow for earlier care, better management, and improved prognosis.
1.2.1.1 Congenital generalized lipodystrophy
First reported by Berardinelli and Seip in 1954 and 1959, CGL, also known as complete lipodystrophy or Berardinelli-Seip syndrome, is an extremely rare (less than one in 12 million people) disorder characterized by the absence of metabolically active adipose
4 tissue from birth13,14. Due to the absence of functioning adipocytes, lipids are stored in unusual sites in the body such as the liver and muscle, subsequently leading to a marked muscular appearance.
As the more severe form of the inherited lipodystrophies, individuals with complete lipodystrophy generally present with insulin resistance, rapid aging of bones, hepatic steatosis, hypertriglyceridemia, early-onset diabetes and high blood pressure, often developing into metabolic syndrome. In addition, individuals with CGL acquire hepatomegaly and skeletal muscle hypertrophy; hypertrophic cardiomyopathy is also reported in 25% of individuals and is a common cause of mortality8.
To date, there is no cure for CGL. Treatment is through cosmetic procedures, diet, hypoglycemic drugs and lipid-lowering drugs. With regards to medication, the management of CGL is through the medicated treatment of each symptom. Although there has been recent success in CGL treatment with Metreleptin – a leptin replacement that aids in the control of metabolic processes in the body, such as triglyceride and blood sugar management – this drug has yet to be approved in Canada.
1.2.1.2 Familial partial lipodystrophy
The second, milder form of lipodystrophy is FPLD, characterized by the selective loss of adipose tissue from the body (most often the limbs) during childhood or puberty. Although affected regions may include the face, neck and extremities, the body fat in the intra-abdominal or truncal region are often spared, and some individuals present with excess fat deposition in the face and neck15. Most individuals presenting with FPLD in the clinic are females, with the metabolic complications more severe in women. Most women remain fertile; however, some women present with hirsutism and polycystic ovary syndrome, leading to fertility issues. Additionally, some patients develop cardiomyopathy, myopathy, and features of multisystem dystrophy16,17.
Similar to CGL, the treatment for FPLD includes lifestyle modifications including diet changes and exercise. Again, the treatment revolves around treating each individual
5 symptom (i.e. Metformin for diabetes, statins for high cholesterol) rather than the disease as a whole18.
1.2.2 Extreme early-onset obesity
Extreme early-onset obesity, or excess adiposity, is defined as a body mass index [(weight in kilograms ÷ height in meters)2] greater than or equal to the 85th and 95th percentile for gender and age, respectively. In Canada, childhood-onset obesity is a pressing health concern with the rates having tripled over the last three decades. Currently, approximately one in seven children are obese, with rates depending on factors such as age, biological sex, location of residence, and socioeconomic status19. As obesity is a significant risk factor for coronary heart disease, high blood pressure, ischemic stroke and diabetes, it places a major toll on children and their families. This burden is especially apparent in the health care system, as early-onset obesity is associated with increased incidence of adult obesity, hepatic steatosis, and cardiovascular disease. For the first time in history, the complications associated with obesity are leading to a decrease in life expectancy of 2‒5 years20.
In the past, obesity was mainly attributed to environmental changes, specifically the intake of high-energy food in combination with a sedentary lifestyle. In recent years, the heritability of obesity has been established, with genetic factors explaining most differences between populations21. In fact, obesity risk in children is 10-fold greater when both parents are obese than when both parents are of a normal weight21. Aside from lifestyle alterations and medications for the management of associated co-morbidities (i.e. high blood pressure, diabetes), there is no direct treatment or cure for extreme early-onset obesity.
6
1.2.3 Isolated brachydactyly
Brachydactyly is an inherited malformation characterized by the shortening of the fingers and toes due to deficiencies in the development of the phalanges, metacarpals, and/or metatarsals. Although brachydactyly can be a common feature in complex malformation syndromes, there are many cases of congenital, isolated forms of brachydactyly. These isolated brachydactyly syndromes represent one of the ten categories of hand malformations as classified by Temtamy and McKusick22. The prevalence of isolated brachydactyly is rare, with the exception of types A3 and D, where prevalence varies between populations, reportedly averaging around 2%23. Aside from these exceptions, most forms of brachydactyly are limited to a few pedigrees. In addition to shortened fingers and toes, other features of brachydactyly include short stature, syndactyly (fused digits), polydactyly (extra digits), and symphalangism (stiff digits) depending on the subtype (Table 1.2.3). Although brachydactyly is best diagnosed using genetic testing, it can also be diagnosed using clinical, anthropometric and radiological means. Treatment for brachydactyly is strictly cosmetic, through elective surgeries.
7
Table 1.2.3. Clinical features of isolated brachydactyly.
8
1.2.4 Cerebral atrophy
Neurodegenerative diseases are diseases characterized by the progressive loss of neural cells from the brain. Although some neurogenerative diseases are more prevalent, such as Alzheimer disease, many neurodegenerative diseases are rare, such as the ataxias or spastic paraplegias24,25. Cerebral atrophy, the loss of neurons and neuronal connections in the brain, is a common feature of many rare neurodegenerative diseases. In 2013, my laboratory described a case of autosomal recessive cerebral atrophy, a novel neurodegenerative disorder in an Old Order Amish family. In this specific case of cerebral atrophy, the affected individuals featured additional symptoms including microcephaly, seizures and psychomotor retardation26. Cerebral atrophy is diagnosed through radiological imaging of the brain.
1.2.5 FORGE Canada and CARE for RARE
In Canada, two Consortiums study the genetic basis of over 200 rare diseases with pediatric onset. These coalitions, FORGE Canada and CARE4RARE, represent the first and second phases of a nationwide project led by Dr. Kym Boycott and Dr. Alex MacKenzie of the Children’s Hospital of Eastern Ontario Research Institute.
1.2.5.1 Project overview
The goal of the previous FORGE Canada and current CARE4RARE project was to study the genetic causes of over 200 rare diseases affecting children. In order to do this, the organizers formed a consortium composed of 21 research sites and hospitals, 80 physicians, and 50 scientists. The approach of the project was to use high power DNA sequencing in order to identify novel disease genes. The recruitment of this project, which ended in March 2017, included over 4000 patients with 950 different rare diseases27.
9
Several criteria required satisfaction in order to qualify for either the FORGE Canada or CARE4RARE Projects. These criteria included the following:
1) Unrelated patients and/or families with the same disorder OR,
2) Single families with multiple affected family members (+/‒ consanguinity) AND,
3) Meet the following inclusion sub-criteria:
a. Onset is in childhood or adolescence
b. The disease is most likely due to a single gene (monogenic)
c. DNA is accessible for the proband and available family members
d. Clinical material is of high quality
1.2.5.2 Project significance
In sum, the FORGE Canada Project has identified mutations in disease genes for 105 of 362 families. Further, since 2011, the CARE4RARE Project has successfully resulted in the publication of 139 manuscripts on the discovery of 135 novel disease-causing genes27. These results have provided closure and ended the diagnostic odyssey for the individuals and the families through the provision of a diagnosis.
1.2.5.3 FORGE Canada and CARE for RARE cases
The Blackburn Cardiovascular Genetics Laboratory has been involved in several FORGE Canada and CARE4RARE Projects. There are currently 11 projects in progress, namely: FORGE 214 (Angelman-like syndrome), FORGE 122 (Dystonia, ataxia and intellectual disability), FORGE 11 (Osteopetrosis), FORGE 352 (Microcephaly-ichthyosis), C4R 572 (Autosomal dominant isolated cryptophthalmos), C4R 573 (Widow’s peak syndrome), C4R 575 (Amyoplasia), C4R 592 (Metaphyseal chondrodysplasia), C4R 664 (Craniosynostosis), C4R 907 (Heterotaxy disorder), and C4R 924 (Craniorachischisis). The details of each case are listed in Table 1.2.5.3.
10
Table 1.2.5.3. Clinical description and pedigrees for all CARE for RARE and FORGE Canada cases.
Case Clinical Description Pedigree
FORGE 214, Three children equally Angelman-like affected, parents are
syndrome healthy first cousins with Iraqi ancestry Features include: significant global developmental delay, delayed speech, repetitive behaviour and similar physical features such as triangular face, wide mouth, pointed chin and fifth finger clinodactyly
FORGE 122, Three affected siblings Dystonia, ataxia and with a progressive, intellectual childhood-onset ataxia disability* syndrome Not known to be consanguineous Features include: progressive gate ataxia beginning between ages 2-5, wheelchair-bound by early adolescence and dysarthria Two oldest siblings are non-verbal with limited responsiveness and minimal spontaneous movement
FORGE 11, Old Order Mennonite Osteopetrosis and Low-German
Speaking Mennonite families Features include: optic atrophy, macrocephaly, mid-facial hypoplasia, micrognathia, abnormal eruption of teeth, broad halluces and short stature
11
FORGE 352, Old Order Amish Microcephaly- families A ichthyosis* Additional features include: failure to thrive, feeding difficulties, developmental delay, lethality in the first year of life, enlarged ventricles and early delivery around 33 weeks gestation Recurrence in the family
C4R 572, Autosomal Female child born to dominant isolated term to non- cryptophthalmos consanguineous parents Female displays complete bilateral isolated cryptophthalmos, a condition resulting in the overgrowth of skin over the eye
C4R 573, Widow’s Non-consanguineous peak syndrome* family Widow’s peak syndrome features: a characteristic widow’s peak hairline, delayed development, inability to touch the shoulders, dysmorphic face and the inability to supinate the arms
C4R 575, Three unrelated families Amyoplasia with amyoplasia,
characterized by a generalized lack of muscular development and growth in newborns Both probands present with severe muscle hypoplasia
12
C4R 592, Metaphyseal Metaphyseal chondrodysplasia
chondrodysplasia features short stature with abnormally short arms and legs No abnormal facial features were present in the patients of interest
C4R 664, Non-consanguineous Craniosynostosis* family Craniosynostosis is a birth defect resulting in the abnormal development of the skull Digital anomalies also present
C4R 907, Heterotaxy Two affected children disorder born to consanguineous parents of Lebanese descent Disorder features: heterotaxy with holoprosencephaly, bilateral ectopic thymus, fused kidneys, annular pancreas, bi-lobed right lung, absent olfactory nerves, dysplastic optic nerves and chiasm and a single umbilical artery
C4R 924, Stillborn baby presented Craniorachischisis* with craniorachischisis, a severe neural tube defect
with anencephaly and spina bifida
For each pedigree, biological males are represented as squares and biological females as circles. Shaded shapes indicate the individual is affected with the disorder. Double lines indicate consanguineous relationships. In some pedigrees, hashed lines represent individuals in which sequencing has been performed. When shown, asterisks represent patients in which DNA is available. Abbreviations are as follows: FORGE, Finding of Rare Disease Genes Canada project. *The red asterisk represents the projects I was directly involved in or was working with undergraduate students on. The remaining cases without an asterisk are those in which I assume an administrative role. ANote: for the microcephaly-ichthyosis pedigree, the shaded shapes are individuals clinically diagnosed with microcephaly-ichthyosis, the shapes with vertical curved lines are those with histidyl-tRNA synthetase disorder, the horizontal curved lines are individuals with congenital hypoventilation syndrome, and the shape filled with the plus sign is an individual clinically diagnosed with cystinosis.
13
1.3 The human genome sequence
In the year 1990, the International Human Genome Sequencing Consortium, composed of public and private researchers, began the publically funded Human Genome Project, a 13-year project with the goal of determining the DNA sequence of the human genome. With the sequencing of over three billion base pairs and approximately 21,000 genes, the group of researchers began a revolution in the fight against human disease by introducing a trove of genetic information applicable for numerous fields including developmental biology, physiology, evolution and medicine28,29.
1.3.1 Variation within the human genome
Human genetic variation refers to the genetic differences within and among populations. A variant form of a gene is an allele, where humans inherit one allele from each parent at each genetic locus, or position. Each pair of alleles represent the genotype of a gene, which can be classified as homozygous or heterozygous, referring to two identical alleles or two different alleles, respectively. Genetic variation is manifested as single nucleotide changes, insertions and deletions, repetitive elements and structural rearrangements of the DNA sequence30. A mutation is a permanent change in the DNA sequence. The term genetic “variant” has been gaining popularity over the term “mutation” in the field, and refers to a benign or pathogenic alteration, or one of unknown significance.
Many decades prior to the availability of DNA sequencing technology or the sequence of the human genome, researchers first became aware of differences in the genome through the study of chromosome number and structure31. This led to the advent of molecular biology, a multifaceted field in biology with one branch focused on the structure and function of nucleic acids and proteins essential for life. Research into molecular biology gave way to the understanding of the variation present in the human genome, notably the implications of this variation and relationship to disease. Now, with the sequence of the human genome available, researchers are able to study the impact of variation in the genome, where the variation is composed of single nucleotide changes, insertions and deletions, copy-number variations, repeat variations, and structural variations, all with
14 potential disruptive effects on the genome. Although some variation can be benign, some defects in the genome can cause genetic diseases, health conditions caused by variation in the genome.
1.3.1.1 Single nucleotide variation
Single nucleotide variations (SNVs) are the most common class of genome variation, with single nucleotide changes occurring approximately once every 500–1000 nucleotide bases in the human genome sequence32. Each SNV represents a change in a single DNA building block or a nucleotide base – composed of Thymine, Adenine, Cytosine and Guanine, often shortened to T, A, C and G – commonly referred to as point mutations. An example of a SNV may be a replacement of a Thymine with a Cytosine (T>C) in a specific stretch of DNA. When these SNVs occur in a region coding for an amino acid (three nucleotides, also referred to as a codon), these SNVs can result in either synonymous (no change in amino acid) or non-synonymous changes (change from one amino acid to another).
The wobble effect is the effect caused by the redundancy of the genetic code. More specifically, each amino acid (with the exception of methionine and tryptophan) may be coded by multiple codons, or multiple three letter codes composed of A, T, C or G. As there are more codons than amino acids, the third base is not as discriminatory for the amino acid as the first two bases. Due to the redundancy in the DNA code, many SNV changes are tolerated or inconsequential. However, in certain cases, these changes can lead to pathogenic missense or nonsense changes, referring to a change in one amino acid to another, or a change in one amino acid to one coding for the truncation of a protein downstream.
Due to the high frequency of these SNVs in the genome and the fact that some SNVs are seen in approximately 1% of the population, SNVs often act as biological markers or contribute to phenotypic traits (observable and measurable features)33. For example, personal differences in SNPs may cause alterations at the level of the cell, or influence drug metabolism. In some circumstances, SNVs are associated with disease and act by
15 driving a disease phenotype (the observable characteristics of an individual) or contributing to phenotypic traits. These disease-causing SNVs are most often exonic, non-synonymous SNVs – those in the coding region causing a substitution in amino acid.
1.3.1.1.1 Splicing variation
Splicing is the editing of precursor messenger ribonucleic acid (mRNA) to mature mRNA. During splicing, introns (nucleotide sequences in a gene discarded during splicing) are removed, and exons (the part of the gene that codes for the final mRNA, which is translated into protein) are ligated together. Splice site mutations refer to genetic variants that insert, delete or change the nucleotides in the specific region where splicing takes place. As these variants can result in the retention of intronic DNA in the mRNA or result in the loss of exons from mature mRNA, variants in the splice site can have large effects on human health and disease. In fact, an estimated 15-50% of human disease variants are those that alter splicing elements34. An example of a mutation in a splice site leading to disease is seen in hypoparathyroidism, where a G to C substitution in the first nucleotide base of intron 2 in the parathyroid hormone gene (PTH) causes exon skipping (the loss of an exon), and parathyroid hormone deficiency35.
1.3.1.1.2 Insertions and deletions
Another form of variation present at the nucleotide level are micro insertions or deletions affecting 1‒50 base pairs, collectively known as “INDELs”. In terms of occurrence, INDELs represent a common alteration in the genome, second only to SNVs36. These INDELs alter the number of DNA bases in a gene by either adding or removing a piece of DNA. When occurring in functionally important sites in the human genome, these INDELs are likely to influence human traits or drive disease36. A notable example is Tay- Sachs disease in the Ashkenazi Jewish, where a four base pair insertion (c.1278insTATC) alters the reading frame of the hexosaminidase A gene (HEXA)37. This mutation leads to an infantile form of Tay-Sachs disease where the most common features include deterioration of both mental and physical abilities, and mortality approximately at the age of four. INDELs can either occur inframe when in a multiple of three (deletion or gain in
16 amino acids) or out-of-frame, where there is a change in amino acids downstream of the insertion or deletion, with a possible inframe occurrence of a stop codon. This is referred to as a frameshift and may alter or abolish the function of the resulting protein. Further, INDELs can result in aberrant splicing when occurring in splice sites.
1.3.1.2 Repetitive elements
The human genome consists of millions of copies of transposable elements (TE) and other repetitive sequences, altogether contributing up to two-thirds of the human genome38. These repetitive elements – most commonly tandem repetitive elements or interspersed repetitive elements that do not encode proteins – are labelled “junk” DNA. Although considered junk or inconsequential, a growing body of evidence has been accumulating in recent years clarifying the role of these repetitive regions in the regulation of gene expression39. Continued research into these repeat sequences is exploiting the role of these elements in gene expression.
Although most repetitive elements in the genome are harboured outside of the coding region, some repeat sequences lie within genes and are subject to mutation. For example, triplet repeat expansions (TREs) – trinucleotide repeats (i.e. CAGCAGCAG) abnormally expanded in certain genes or introns – are dynamic mutations that occur in regions with trinucleotide repeats. These TREs are the cause of TRE disorders such as Fragile X syndrome or Huntington’s disease.
1.3.1.3 Structural variation
Structural variation (SV) affects a region of DNA approximately one kilo base (1-kb) or larger40. SVs, including inversions, balanced translocations or genomic imbalances, have long been associated with chromosomal rearrangements and genetic disorders. SVs can arise through various mechanisms including non-allelic homologous recombination (HR), non-homologous end joining (NHEJ), or replication-error41.
17
1.3.1.3.1 Copy-number variation
Copy-number variation (CNV) is a form of structural variation where there is a change in copy-number involving a DNA fragment over 1-kb40. CNVs can include deletions, insertions or duplications present in variable copy-number in comparison to the reference genome. As CNVs are regions of variable copy number, they may change gene expression levels, and alter transcription levels to values higher or lower than expected in a reference genome. Due to the change in gene expression, CNVs may play a large role in phenotypic variation. Further, since CNVs encompass significantly more nucleotide content per genome than single nucleotide polymorphisms (SNPs; up to 10-fold greater or up to 12% of the genome), CNVs play an important role in genetic diversity, disease and evolution42,43.
1.3.2 Germline versus somatic variation
Germline variation is defined as variation present in the germline, or the tissue involved in forming sex cells. As a mutant sex cell may participate in fertilization, germline variation may be passed on from parent to offspring44. In contrast, somatic variation occurs in a single cell in developing somatic tissue. By definition, somatic cells are those that are never transmitted from parent to progeny44. As cells are constantly dividing and genetic material is continually replicated over the course of a lifespan, mistakes in replication can accumulate in somatic cells through a lifetime45. Although many of these variants do not have a phenotypic effect, some may alter key cellular functions by affecting normal protein function and drive certain human diseases. Early somatic variants – those occurring during embryogenesis – can also contribute to developmental disorders, cancer or aging.
1.3.3 Inherited versus de novo variation
Variation can arise in the genome through two mechanisms. Inherited variation are DNA changes transmitted from parent to offspring. Specifically, each egg and sperm cell contribute half of the genetic information needed to produce an offspring. When the egg
18 and sperm join during fertilization, a new cell is formed, composed of all the necessary genetic information needed to form an individual. This leads to variation passed on from parent to progeny.
On the other hand, de novo variation are DNA changes that are spontaneous (through DNA replication errors or spontaneous lesions) or induced (caused by mutagens such as radiation or chemical substances) in an offspring’s genome, not inherited from either parent. These de novo genetic alterations may be acquired any time post-zygotically (during the lifespan). This variation is de novo as the variation is not present in either parental genome.
Both inherited and de novo variation may provide meaningful contributions to disease. More specifically, diseases may be caused by inherited variation, or de novo variation. An example of inherited variation causing disease is hemophilia A, where multiple generations in a family inherit a variant in the coagulation factor VIII gene (F8) and present with a severe bleeding disorder. In contrast, de novo variation is best exemplified in severe early-onset pediatric diseases, where the causative mutations only arise post- zygotically given that they are lethal in the germline and/or individuals with these mutations do not reproduce46.
1.4 Human genetic diseases
Although there are diseases that occur through bacterial infection or exposure to viruses, it is estimated that most human diseases have a genetic component. A genetic disease is any disease attributed to abnormality in the human genome. These genetic diseases can range from minor to severe and can be due to any of the aforementioned variation. In this section, I describe the heritability of human genetic diseases.
1.4.1 Heritability of genetic diseases
Heritability refers to the ratio of genetic variation (VG) to phenotypic variation (VP); a fundamental tool used in the study of the inheritance of human disease that is able to partition the phenotypic variation into both genetic and environmental components47. Put
19 simply, heritability is a statistic that is used to determine the proportion of variation in a trait within a population that can be explained by genetics (rather than environment or random chance). This is modelled through the following equation:
Phenotype (푃) = Genotype (퐺) + Environment (퐸)
There are two definitions of heritability48. The first, H2 or broad-sense, refers to the genetic contributions to phenotypic variance through additive (phenotypic contributions from more than one gene or alleles of a single gene, where the sum of the effects of both alleles is equal to the sum of their effect individually), dominance (the relationship between alleles of one gene where the effect of one allele masks the other, leading to a phenotypic effect) and epistatic genetic effects (the phenomenon where one gene relies on other modifier genes, where the sum of the effects in combination do not equal the sum of the effects individually).
Var(퐺) 퐻2 = Var(푃)
The second definition, h2 or narrow sense, captures the proportion of genetic variation due to additive genetic effects (A; contributions from more than one gene or alleles of a single gene acting synergistically).
Var(퐴) ℎ2 = Var(푃)
Heritability of disease can also refer to the mode in which transmission occurs. Diseases can be monogenic, digenic or polygenic, and involve variable penetrance, each defined in the following sections.
1.4.1.1 Monogenic diseases
Monogenic diseases, or single gene disorders, are those caused by variants within a single gene. These variants can be inherited in a family; can be dominant or recessive, and autosomal or sex-linked. These modes of inheritance refer to the manner in which genetic traits are passed from one generation to the next. The modes of inheritance include: 1)
20 autosomal dominant; 2) autosomal recessive; 3) X-linked; 4) Y-linked; 5) codominant or; 6) mitochondrial. Their definitions are as follows:
1) Autosomal dominant: when one copy of a gene in a cell harbours a variant. This may be transmitted from one parent to an offspring or inherited de novo.
2) Autosomal recessive: when both copies of a gene in a cell carry variants. One copy is transmitted paternally and one copy is transmitted maternally to the offspring.
3) X-linked: when variants are harboured in genes on the X chromosome(s), one of the two sex chromosomes that can be present in the genome. Note that normally biological males have one X and one Y chromosome, and biological females have two X chromosomes.
4) Y-linked: when variants are harboured on the Y chromosome, with transmission only possible from the paternal parent to a male offspring.
5) Codominant: when two different alleles of a gene are expressed and each influence the genetic trait.
6) Mitochondrial: when genes in mitochondrial DNA carry variants and are transmitted through maternal inheritance.
Monogenic diseases can also be considered Mendelian diseases, defined as diseases where alternative genotypes fall into distinct phenotypic classes, according to Gregor Mendel’s laws of inheritance49. One example of a monogenic disease is cystic fibrosis, caused by a variant in the cystic fibrosis transmembrane conductance regulator gene (CFTR) with an autosomal recessive mode of inheritance.
1.4.1.2 Digenic diseases
Digenic diseases are those where the disease phenotypes are caused by a combination of variants in two genes, or two separate phenotypes caused by variants in two different genes acting synergistically50. To cause disease, these genes may interact directly,
21 indirectly, through a common pathway, through co-expression, or through similar function. Due to the prevalence of digenic diseases, a common resource known as the Digenic Diseases Database (DIDA) is accessible, containing information on over 40 digenic diseases and over 200 digenic combinations51. The first reported example of a digenic disease was retinitis pigmentosa, where double heterozygotes with variants in the peripherin 2 (RDS) and retinal outer segment membrane protein 1 (ROM1) loci displayed the disorder52.
1.4.1.3 Polygenic diseases
Polygenic diseases are defined as genetic disorders caused by a combination of abnormalities in more than one gene. Due to the fact that they are attributed to variants in more than a single gene, they are inherited differently than monogenic disorders (as described in Section 1.4.1.1). In humans, polygenic diseases are more frequent than monogenic disorders, and have a greater economic burden. Due to the multiple gene (multigenic) nature of these diseases, different methods have been developed to study these diseases. These approaches include: 1) the use of a priori data or a set number of genetic loci, or 2) the complete analysis of all available loci53. These may take the form of case-control studies or genome-wide association studies (GWASs), respectively, where case-control studies refer to the comparison of affected and healthy subgroups, and GWASs refer the analysis and determination of similarities in genome-wide data of an affected cohort. Association studies require the selection of several candidate genes in order to carry out association analysis53. Illustrative examples of polygenic disease are the familial dyslipidemias, such as coronary heart disease and diabetes. These are polygenic as they are associated with multiple genes, and are not inherited as simply as single gene disorders54.
1.4.1.4 Disease penetrance and expressivity
Disease penetrance and expressivity refer to factors that influence genetic changes. Explicitly, penetrance refers to the proportion of individuals with a genetic change who phenotypically exhibit a genetic disorder. When some individuals with the genetic variant
22 do not display all or some of the features of a disorder, the condition is said to have incomplete or reduced penetrance. Incomplete penetrance is demonstrated in cases of breast cancer, where variants in the breast cancer, DNA repair associated 1 or 2 genes (BRCA1 or BRCA2) may cause cancer in some individuals over the course of a lifetime, but not others55.
On the other hand, expressivity is defined as the degree in which the expression of a trait differs among individuals. This is exhibited when individuals with the same phenotype display varying severity of a disease; or in other words, the disease exists on a spectrum. For example, variable expressivity is seen in Marfan syndrome where some individuals have mild symptoms (tall and thin features with slender fingers), while some experience additional features such as life-threatening heart and blood vessel complications. Although this disorder displays variable expressivity, most individuals with Marfan syndrome carry variants in the fibrillin 1 gene (FBN1)56.
1.5 Genetic variation and rare diseases
For the rare genetic diseases described earlier – namely, lipodystrophy, extreme early- onset obesity, brachydactyly, autosomal recessive cerebral atrophy, and those ascertained from the CARE4RARE and FORGE Canada consortiums – although many cases of these diseases have been genetically explained with causative variants identified, the genetic etiology of many remain unknown. In this section, I describe the known genetics of these diseases and unexplained cases in my laboratory.
1.5.1 The genetics of lipodystrophy
Over the years, many genetic variants have been associated with lipodystrophy. As the defective gene often causes a distinct lipodystrophy phenotype, both CGL and FPLD have been divided into subtypes.
23
1.5.1.1 Congenital generalized lipodystrophy
There are four subtypes of CGL based on previously identified genes; denoted as CGL1‒ 4. CGL commonly follows an autosomal recessive mode of inheritance. Although each subtype features the complete loss of adipose tissue, different subtypes present with distinct characteristics57:
1) CGL1: characterized by the absence of metabolically active adipose tissue from birth, CGL1 is associated with variants in the 1-acylglycerol-3-phosphate O- acyltransferase 2 gene (AGPAT2), a gene encoding an enzyme required for phospholipid and triglyceride biosynthesis.
2) CGL2: featuring the lack of adipose tissue from birth, mild mental disability and cardiomyopathy, CGL2 is associated with variants in the seipin lipid droplet biogenesis associated gene (BSCL2) encoding seipin, a protein that may play a role in adipocyte differentiation.
3) CGL3: reported in a single patient, CGL3 features the absence of body fat, shortened stature and vitamin D resistance. CGL3 is correlated with variants in the caveolin 1 gene (CAV1) encoding the caveolin 1 protein, an integral component of caveolae on adipocyte membranes.
4) CGL4: featuring the absence of body fat with congenital myopathy and cardiomyopathy, CGL4 is associated with variants in the polymerase I and transcript release factor gene (PTRF; also referred to as cavin) associated with the biogenesis of caveolae.
Lipid droplets are defined as organelles responsible for the storage of triglycerides. Playing a fundamental role in metabolism, the reduction or lack of lipid droplets cause the lipodystrophies58. With each form of CGL, although each are attributed to distinct genes, all gene products are involved in adipocyte lipid droplet formation. Further, each form of CGL is associated with low leptin (the hormone of energy balance) as a result of the lack of adipose tissue. This results in excess triglycerides and high blood sugar.
24
1.5.1.2 Familial partial lipodystrophy
As in the case of CGL, FPLD also exists in various forms (FPLD1–5) with subtypes defined based on their associated gene(s). Generally, FPLD follows an autosomal dominant mode of inheritance. Similar to CGL, each subtype features a similar pattern in adipose tissue loss but various additional characteristics57:
1) FPLD1: a genetically unexplained form of FPLD, characterized by the loss of subcutaneous fat from the extremities.
2) FPLD2: a form of FPLD featuring the loss of subcutaneous fat from the extremities and truncal region from puberty. FPLD2, or Dunnigan variety, is associated with variants in the lamin A gene (LMNA) encoding the lamin A protein, where deleterious mutations result in the premature death of adipocytes.
3) FPLD3: characterized by the loss of subcutaneous fat from the extremities, principally from the distal regions. FPLD3 is associated with variants in the peroxisome proliferator-activated receptor gamma gene (PPARɣ), encoding a transcription factor required for adipogenesis.
4) FPLD4: reported in a single family, FPLD4 features the loss of subcutaneous fat from the extremities. This subtype of FPLD4 is associated with variants in the AKT serine/threonine kinase 2 gene (AKT2) encoding protein kinase B, involved in adipocyte differentiation and insulin receptor signaling.
5) FPLD5: a subtype of FPLD featuring fibrosis of adipose tissue and the loss of subcutaneous fat from the extremities. FPLD5 is attributed to variants in the perilipin 1 gene (PLIN1) encoding an integral constituent of lipid droplet membranes, involved in lipid storage. FPLD5 has also been associated with homozygous variants the cell death inducing DFFA-like effector C gene (CIDEC), encoding a protein required for lipid droplet formation and energy storage in adipose tissue.
25
1.5.1.3 Unexplained cases of lipodystrophy
With the familial lipodystrophies, although many causative gene mutations have been identified in affected individuals as described (i.e. LMNA, PPARG, AGPAT2 and BSCL2 variants), many individuals remain genetically unexplained59,60. Over the years, the Blackburn Cardiovascular Genetics Laboratory (Robarts Research Institute, London ON, Canada) has been successful in identifying the genetic basis of 120 lipodystrophy- affected patients using Sanger sequencing. Although this resulted in 44% of 267 lipodystrophy patients characterized by mutations in lipodystrophy-causing genes, 56% of patients remained genetically unexplained after Sanger sequencing.
1.5.2 The genetics of obesity
To date, there have been many genes identified that underlie monogenic and polygenic obesity. The rare, monogenic forms of human obesity have been critical in the elucidation of the pathogenic mechanisms causing obesity. These rare forms of monogenic obesity are associated with the following genes: LEP, LEPR, POMC, PCSK1, MC4R, BDNF, and NTRK2, where all aforementioned genes and protein products are involved in body weight management (described in detail in Table 1.5.2)61-67. Further, all genes encode either hormones or neurotransmitters/receptors belonging to the highly conserved leptin- melanocortin pathway, a critical pathway in the regulation of food intake and body weight.
In contrast to the monogenic forms of obesity where obesity is the main feature, the syndromic forms of early-onset obesity are Mendelian disorders with obesity as one clinical feature. The additional clinical features may include intellectual disability, dysmorphic countenances and developmental abnormalities, generally organ-specific. To date, over 30 syndromes have been identified, with Prader-Willi, Bardet-Biedl, Cohen, and Alström syndrome as classic examples68-71.
26
Table 1.5.2. Genes involved in the pathophysiology of obesity.
Gene name Symbol Function Leptin LEP Encoding the hormone leptin, this hormone is involved in the regulation of body weight. Leptin works by attaching to the leptin receptor on the surface of organs and tissues, including the hypothalamus. The hypothalamus controls states including hunger and thirst, and the release of hormones through the body. The binding of leptin in the hypothalamus triggers a feeling of satiety.
Leptin receptor LEPR The leptin receptor is a Type I cytokine receptor that binds with the hormone leptin. The leptin receptor is responsible for the regulation of energy metabolism and body weight through interactions with gangliosides in the cell membrane. Proopiomelanocortin POMC The POMC gene encodes the proopiomelanocortin protein, which is cleaved into small peptides in the body. These peptides then bind to several proteins in the body to trigger signaling pathways responsible for functions including energy homeostasis, melanocyte stimulation and immune modulation. Prohormone convertase 1 PCSK1 Encoding a member of the subtilisin-like proprotein convertase family, this protein is involved in the secretory pathway. More specifically, it functions in the proteolytic activation of polypeptide hormones and neuropeptide precursors. Melanocortin 4 receptor MC4R The MC4R gene encodes a membrane-bound receptor belonging to the melanocortin receptor family. This protein interacts with melanocyte- stimulating hormones and adrenocorticotrophic hormones and plays a role in energy homeostasis and somatic growth. Brain-derived BDNF This gene encodes a protein found in the brain and neurotrophic factor spinal cord that plays a role in growth, differentiation, and maintenance of nerve cells. The BDNF protein is localized in brain regions responsible for controlling eating, drinking and body weight. Neurotrophic tyrosine NTRK2 The NTRK2 gene encodes a membrane-bound kinase receptor type 2 receptor kinase that phosphorylates both itself and members of the mitogen-activated protein kinase pathway. Signaling through NTRK2 results in cell differentiation.
27
1.5.2.1 Unexplained cases of early-onset obesity
As in the case of the lipodystrophy patients in the laboratory, the prevalence of genetically unexplained cases is also reflected in the early-onset obesity cohort, where known obesity-causing genes, POMC, LEP, LEPR, PCSK1 and MC4R, cannot explain the phenotype of five patients and/or families with extreme early-onset obesity ascertained in the Blackburn Cardiovascular Genetics Laboratory (Robarts Research Institute, London ON, Canada)20. In some instances, these patients display variable co- morbidities (i.e. hyperphagia, intellectual disability) in addition to extreme early-onset obesity.
1.5.3 The genetics of brachydactyly
Most isolated brachydactyly syndromes display an autosomal dominant mode of inheritance, with variable penetrance. To date, several gene mutations have been designated as causative for each subtype (Table 1.5.3). Here, I describe subtype brachydactyly type A.
28
Table 1.5.3. The genetics of isolated brachydactyly.
29
1.5.3.1 Brachydactyly type A
As described by Bell in 1951, the hallmark feature of brachydactyly type A is the shortening of the middle phalanges72. Type A has been further divided into four subtypes, A1 to A4, with each subtype further subdivided into types A to D.
1.5.3.1.1 Brachydactyly type A1 (BDA1)
In the early 1900s, Farabee and Drinkwater characterized the first disorder that could be explained by Mendelian autosomal dominant inheritance – brachydactyly. In 1963, Haws and McKusick continued the analysis on Farabee’s family and associated the condition to BDA173. In BDA1, the middle phalanges of all the digits are absent or shortened, with shortening of the thumb and big toe. In some instances, the middle and terminal phalanges are fused (terminal symphalangism, or fusion of the terminal phalanges), with shortening of the metacarpals. Drinkwater found that the shortened phalanges were due to the absence of the epiphyses, which subsequently lead to overall shortened stature in adulthood22,74,75. BDA1 has been attributed to mutations in the Indian Hedgehog gene (IHH), where mutations affect endochondral ossification of the developing bones76-83.
1.5.3.1.2 Brachydactyly type A1, B (BDA1B)
Armour et al. described a family with a mild form of brachydactyly that did not fit the clinical findings of other families with BDA184. In their family, Armour and colleagues described shortened middle and terminal phalanges, with all the digits slightly shortened. The feet of this family were also affected, with the children displaying multiple coned epiphyses. From this research, Armour et al. highlighted the benefits of using a metacarpophalangeal profile in designating clinical status. In 2002, Armour et al. performed a linkage study, and mapped the condition to the cytogenetic bands 5p13.3- p13.285. However, the causative gene and putative mutations have not yet been identified.
30
1.5.3.1.3 Brachydactyly type A1, C (BDA1C)
Type A1C was first described by Byrnes and colleagues in a consanguineous French- Canadian family86. In this subtype of BDA1, individuals displayed markedly shortened middle phalanges of the second through fifth digits, and the first terminal phalanx. There was also shortening in the first metacarpals resulting in the appearance of a shortened thumb. The third to fifth metacarpals were slightly affected, and the feet were affected in this family. BDA1C is attributed to a mutation in Growth Differentiation Factor 5 (GDF5), associated with a decreased effectiveness of chondrogenesis and abnormal skeletal morphogenesis87. BDA1C is inherited in an autosomal recessive or dominant manner, with recessive mutations causing a more severe phenotype86.
1.5.3.1.4 Brachydactyly type A1, D (BDA1D)
In 2015, Racacho et al. described patients with BDA1D, a “BDA1-like” brachydactyly88. In the first proband, features included short second digits, curved fifth digits, and shortened first and second toes. Upon radiographic analysis, it was found that there was absence of the middle phalanges in the index fingers, with shortened middle phalanges in the fifth digits. The terminal phalanges of the thumbs were also affected. In the second proband, brachydactyly and clinodactyly of the fifth digits and right thumb were reported, with abnormally-shaped middle phalanges of the second digit and fifth digit. This condition was designated as BDA1-arachnodactyly. Type BDA1D has been associated with mutations in Bone Morphogenetic Protein Receptor Type 1B (BMPR1B)88. Where the p.K325N mutation acts in a dominant-negative manner. Mutations in BMPR1B result in brachydactyly by affecting normal chondrogenesis.
1.5.3.1.5 Brachydactyly type A2 (BDA2)
BDA2 is characterized by the absence or shortening of the middle phalanx of the index finger and second toe. Rarely, this feature can extend to the fifth digit. In severe cases, the middle phalanx is a rhomboid or triangular shape causing the index finger to deviate radially. BDA2 is inherited in an autosomal dominant manner, with mutations identified
31 in Bone Morphogenetic Protein 2 (BMP2), BMPR1B, and GDF589-94. The reported families are of German, Norwegian, Swiss, Chinese and Polish descent22.
1.5.3.1.6 Brachydactyly type A3 (BDA3)
In BDA3, the most common features include the shortening and slanting of the middle phalanx of the fifth digit. Due to the characteristic rhomboid or triangular shape of the middle phalanx, clinodactyly of the fifth finger is present22. The prevalence of BDA3 is quite common, often seen in syndromic forms. The frequency of BDA3 can vary from 3.4% to 21% in various, isolated ethnic populations22. Although there are multiple definitions of BDA3, Hertzog defined BDA3 as requiring the middle phalanx of the fifth finger to be less than half the size of the middle phalanx of the fourth digit95. Williams et al. also found that cone-shaped epiphyses in BDA3 are twice as likely in females than males, suggesting a strong sex-bias in BDA3 inheritance96. Although there is no candidate locus or gene identified to date, BDA3 is inherited in an autosomal dominant manner with variable penetrance22.
1.5.3.1.7 Brachydactyly type A4 (BDA4)
In 1978, Temtamy and McKusick studied a family with four generations of BDA422. The features of this family included the shortening of the second and fifth digits due to brachymesophalangy – an abnormal shortening of the middle phalanges. Although the fourth finger was not always affected, it displayed an irregularly shaped middle phalanx resulting in radial deviation of the terminal phalanx when afflicted. The feet were also affected22. BDA4 has been reported multiple times in the literature with added features including nail dysplasia, clinodactyly, short stature, and a bifid appearance of the thumb97-99. No causative locus or gene for this sub-phenotype has been identified.
1.5.3.1.8 Unexplained cases of brachydactyly
To date, various forms of brachydactyly have been characterized and numerous causative genes have been found (Table 1.5.3). Although there is much known about brachydactyly, many subtypes remain genetically undefined. We introduce a 31-year-old
32 female from Ontario referred to Dr. Hegele’s Endocrinology Clinic (London Health Sciences Centre, University Hospital, London ON, Canada) for medical consultation for a lifelong history of short stature and shortening of all digits of the upper and lower extremities. There was no history of other medical conditions, specifically no nystagmus, musculoskeletal abnormalities, developmental delay, or scoliosis. Upon examination, all digits of upper and lower extremities were noted to be short, with missing middle phalanges and splayed fingers, similar to a brachydactyly type A phenotype. The proband’s parents were both of short stature, but only her mother shared identical features including very short fingers and toes. Eight maternal aunts and one uncle had all reported abnormally shortened fingers of variable severity. One brother and her daughter had similarly shortened digits (Figure 1.5.3.1.8).
33
Figure 1.5.3.1.8. Pedigree of a Canadian autosomal dominant brachydactyly-affected family. The black arrow indicates the proband. All shaded shapes represent those clinically affected. Biological females are represented by circles and biological males are represented by squares.
34
1.5.4 The genetics of autosomal recessive cerebral atrophy
In 2013, our laboratory (Blackburn Cardiovascular Genetics Laboratory) elucidated the genetic basis of a novel pediatric neurodegenerative disorder deemed, autosomal recessive cerebral atrophy26. Using a combination of homozygosity mapping and exome sequencing, Lahiry et al. identified four individuals with a c.995C>T (p.Thr332Met) variant in the TMPRSS4 gene encoding transmembrane protease, serine 4, a protein involved in numerous biological processes26.
1.5.4.1 Unexplained cerebral atrophy
Recently, a second family with a history of disease resembling autosomal recessive cerebral atrophy was referred to the Blackburn Cardiovascular Genetics Laboratory from India (Figure 1.5.4.1). In this case, the proband presented with microcephaly, severe cortical atrophy and widened lateral ventricles. The parents were both clinically unaffected with normal brain structure and function. The sister of the proband was also affected but passed away prior to genetic testing.
35
Figure 1.5.4.1. Pedigree of a family with cerebral atrophy. Biological males are squares and biological females are circles. The arrow indicates the proband, whereas the shaded shapes represent those affected by the cerebral atrophy, microcephaly and widened lateral ventricles.
36
1.5.5 Genetically unexplained consortium cases
The Blackburn Cardiovascular Genetics Laboratory is actively working on 11 FORGE Canada and CARE4RARE Projects. The rare diseases in the 11 families previously listed are all genetically unexplained and require a genetic diagnosis. By using NGS technologies, I seek to identify genetic determinants underlying all the genetically unexplained rare disease cases ascertained in the Blackburn Cardiovascular Genetics Laboratory.
1.6 Next-generation sequencing and rare diseases
Since the 1970s, Sanger sequencing has been the gold standard in genetic studies with several historical accomplishments, notably the sequencing of the first human genome29. However, limitations including time requirements and high costs have led to the advent of new and improved technologies, designating Sanger sequencing as first generation sequencing100. Over the past five years, we have been in a new era of genomics, where NGS methods have become mainstay in genomic research. NGS is an umbrella term used to describe all the newer methods, capable of generating a colossal amount of data rapidly and efficiently100. It includes three dominant methods used to identify genetic variants, namely targeted resequencing, whole-exome sequencing (WES), and whole- genome sequencing (WGS).
Today, many platforms exist to perform NGS. Although each company offers a distinct method, the general workflow is as follows: 1) template preparation, 2) sequencing and imaging, 3) genome alignment and assembly, and 4) genome enrichment. Regardless of the company chosen, each method provides a rapid and inexpensive genome-wide sequence readout as an output, and allows for characterization of evolutionary relationships and the elucidation of the DNA sequence for studies in health and disease101.
37
1.6.1 Targeted resequencing
Targeted resequencing is a method of NGS that works by using NGS chemistry to isolate and sequence any number of pre-selected genes from a sample library. With the ability to rapidly sequence target genes, these targeted gene panels are able to identify causative variants in genomic loci. Targeted resequencing is one of the fastest growing applications for NGS technologies.
1.6.1.1 LipidSeq™
An excellent example of a NGS clinical resequencing panel is LipidSeq™, a targeted gene panel designed by, and used in, the Blackburn Cardiovascular Genetics Laboratory102. The objective of the pilot LipidSeq™ project was to develop a NGS-based method to facilitate in the clinical diagnosis of dyslipidemias. Using Illumina technologies, this pilot study on LipidSeq™ demonstrated a 95% concordance rate with the gold standard, Sanger sequencing, highlighting its diagnostic utility in the clinic. To date, over 3,000 DNA samples have been processed using LipidSeq™.
Currently, the LipidSeq™ panel targets ~73 genes and >180 SNPs associated with monogenic dyslipidemias. The LipidSeq™ targets genes involved in lipid metabolism as well as genes associated with lipodystrophy and its associated metabolic comorbidities (Table 1.6.1.1).
38
Table 1.6.1.1. Details regarding the genes targeted by the LipidSeq™ gene panel relating to lipodystrophy and associated metabolic comorbidities. Phenotype Gene Function RefSeq Chromosome: (NM_) Start-Stop/ Location Lipodystrophy LMNA LMNA encodes lamin A and lamin 170707 1:156052369- C proteins, which contribute to the 156109880/ structural network of the inner 1q22 nuclear membrane of cells. PPARG The PPARG gene encodes 015869 3:12329349- peroxisome proliferator-activated 12475855/ receptor-gamma (PPARɣ). This is a 3p25.2 nuclear receptor, which regulates adipocyte differentiation. LMNB2 LMNB2 encodes lamin B, a 032737 19:2428163- component of the structural network 2456966/ of nuclear membranes in 19p13.3 vertebrates. It is important for mitotic processes, nuclear stability, chromatin structure, and gene expression. CIDEC CIDEC is a DNA fragmentation 0011996 3:9908394- factor (DFF). In adipocytes, the 23 9921938/ encoded protein contributes to lipid 3p25.3 droplet formation and plays a major role in promoting apoptosis. AKT2 AKT2, an oncogene, encodes a 001626 19:40736224- serine/threonine kinase with Src 40791443/ Homology 2-like domains. It is 19q13.2 highly expressed in insulin-sensitive tissues and regulates hepatic metabolism during fasting. CAV1 CAV1 encodes caveolin-1, the main 001753 7:116164839- component in the cavaolae plasma 116201239/ membranes of most cell types. 7q31.2 Caveolin-1 is an integral membrane protein, which links integrin subunits to proto-oncogene tyrosine kinase, FYN, promoting cell cycle progression. AGPAT2 AGPAT2 encodes a 1-acylglycerol- 006412 9:139567595- 3-phosphate O-acyltransferase 139581911/ protein, which converts 9q34.3 lysophosphatidic acid to phosphatidic acid during phospholipid biosynthesis. This protein is localized to the ER.
39
BSCL2 BSCL2 encodes seipin, a 0011229 11:62457734- transmembrane protein that is 55 62477091/ activated during pre-adipocyte 11q12.3 differentiation and contributes to lipid droplet morphology. Seipin is localized to the ER. PTRF PTRF encodes cavin, a protein that 012232 17:40554467- regulates rRNA transcription and 40575506/ plays an essential role in caveolae 17q21.2 biogenesis. Cavaolae, in turn, are crucial for signal transduction and lipid transport in many cell types. LIPE LIPE encodes a hormone-sensitive 005357 19:42905664- lipase, which exists in two forms, 42931578/ depending on the translational start 19q13.2 codon. Present in steroidogenic tissues, the longer form contributes to cholesterol processing for steroid hormone production. Expressed in adipose, the shorter form hydrolyzes TGs, thereby regulating the mobilization of free fatty acids. Werner’s WRN The WRN gene encodes the Werner 000553 8:30890778- Syndrome protein, which shows dominant 31031277/ nucleolar localization, possesses 8p12 DNA helicase activity (3’ to 5’) and also acts as an exonuclease (3’ to 5’). This protein may also be involved with DNA double strand break repair.
Mature Onset HNF4A Hepatocyte nuclear factor-4-alpha 000457 20:42984441- Diabetes of the (HNF4A) is a transcription factor 43061485/ Young (MODY) belonging to the nuclear receptor 20q13.12 family. HNF4A is the most prominent DNA-binding protein in the liver, where it is known to regulate genes involved in lipid metabolism. The encoded protein also controls the expression of genes including hepatocyte nuclear factor 1 alpha. This gene may also play a role in liver, kidney and intestine development. GCK GCK is expressed in the liver and 033508 7:44183870- pancreatic islet beta cells and plays 44229022/ a significant role in glucose 7p13 metabolism. Glucokinase (GCK) is a unique member of the hexokinase family where, in metabolic pathways, hexokinases
40
phosphorylate glucose to produce glucose-6-phosphate. HNF1A Hepatocyte nuclear factor-1-alpha 000545 12:121415861- (HNF1A) or HNF1 homeobox A is 121440315/ thought to aid in the orderly and 12q24.31 sequential activation of genes during development at the level of transcription. HNF1 protein is a transcription factor that binds to a variety of promoters in the liver and is required for the expression of several liver-specific genes. PDX1 Pancreatic and duodenal homeobox 000209 13:28494168- 1 (PDX1) acts as a transactivator 28500451/ that binds the TAAT element in the 13q12.2 promoter region of target genes involved in pancreas development. The protein encoded by PDX1 is a transcriptional activator of several genes and plays a significant role in glucose-dependent regulation of insulin gene expression. HNF1B Hepatocyte nuclear factor-1-beta 000458 17:36046434- (HNF1B) is a transcription factor 36105096/ (otherwise known as transcription 17q12 factor-2) that is a member of the homeodomain-containing superfamily of transcription factors. This protein can bind as either a homodimer or a heterodimer in conjunction with HNF1A. This gene has been shown to take part in nephron development and regulates the development of the embryonic pancreas. NEUROD1 Neurogenic differentiation 1 002500 2:182540833- (NEUROD1) is a basic helix-loop- 182545392/ helix (bHLH) protein, which acts as 2q31.3 a transcription factor involved in determining cell type during development. NEUROD1 (after heterodimerization with the ubiquitous helix-loop-helix protein E47, regulates insulin gene expression by binding to a critical E-box motif on the insulin promoter. KLF11 Kruppel-like factor 11 (KFL11) 003597 2:10170776- encodes a zinc finger transcription 10194963/ factor that binds to specificity 2q25.1 protein 1-like sequences in both epsilon- and gamma-globin gene
41
promoters. Their binding inhibits cell growth and results in apoptosis. CEL Carboxyl-ester lipase (CEL) is a 001807 9:135936741- major component of pancreatic juice 135947250/ and is in charge of the hydrolysis of 9q34.2 cholesterol and other dietary esters. The protein encoded by CEL promotes large chylomicron production in the intestine and is also thought to interact with cholesterol and oxidized lipoproteins to modulate the progression of atherosclerosis. PAX4 Paired box gene 4 (PAX4) is a 006193 7:127250346- member of the PAX family of 127255982/ transcription factors. This gene 7q32.1 plays an important role during fetal development and cancer growth. In addition, it has been found that PAX4 is essential for the differentiation of insulin-producing beta cells in the mammalian pancreas. INS Consisting of two dissimilar 0011850 11:2181009- polypeptide chains, A and B, and 97 2182439/ linked by two disulfide bonds, 11p15.5 insulin is synthesized by beta cells of the islets of Langerhans. Insulin is under the control of a single gene locus and binds the insulin receptor, stimulating glucose uptake. BLK B-lymphocyte specific kinase (BLK) 001715 8:11351521- encodes a non-receptor tyrosine 11422108/ kinase. These genes are typically 8p23.1 involved in cell proliferation and differentiation. This protein stimulates insulin synthesis and secretion in response to glucose levels and enhances expression levels of several pancreatic beta-cell transcription factors. Hypertriglyceri- LPL LPL is responsible for the 000237 8:19796582- demia (HTG) breakdown of chylomicron 19824770/ triglycerides into two fatty acids and 8p22 a monoacylglycerol along the luminal surface of capillaries in the heart, skeletal muscle, and adipose tissue. It functions as a homodimer and requires APOC2 as a cofactor.
42
APOC2 APOC2 is a lipid-binding protein 000483 19:45449239- secreted in the plasma as a 45452822/ component of chylomicrons and 19q13.2 VLDLs. It is essential for lipoprotein lipase activation and TG breakdown activity. APOC3 Apolipoprotein C-III is a component 000040 11:116700624- of HDL and ApoB containing 116703787/ lipoprotein particles. It impairs 11q23.3 hepatic uptake and catabolism of ApoB-containing lipoproteins. APOA5 APOA5 is secreted in the plasma as 052968 11:116660086- a component of HDL, and to a 116663136/ lesser extent, VLDL and 11q23 chylomicrons. It is a strong stimulator of LPL-mediated TG hydrolysis and an activator of LPL. LMF1 The LMF1 protein resides in the ER 022773 16:903634- and is vital for LPL maturation and 1031318/ transport through the secretory 16q13.3 pathway. It is therefore essential for functioning circulating LPL in the blood. GPIHBP1 LPL and chylomicrons bind to 178172 8:144295068- GPIHBP1 in the capillary 144299044/ endothelial cells of the heart, 8q24.3 skeletal muscle and adipose tissue, making it an important component of chylomicron TG catabolism. GCKR GCK is expressed in the liver and 033508 7:44183870- pancreatic islet beta cells and plays 44229022/ a significant role in glucose 7p13 metabolism. It is a unique member of the hexokinase family where, in metabolic pathways, hexokinases phosphorylate glucose to produce glucose-6-phosphate. CREB3L3 cAMP responsive element-binding 032607 19:4153598- protein 3-like 3 (CREB3L3) is a 4173051/ transcription factor specific to the 19p13.3 liver. The encoded protein is localized to the ER and is activated by cyclic AMP stimulation. The encoded protein binds the cyclic AMP response element (CRE) and box-B element. TRIB1 By controlling the differentiation of 025195 8:126442563- tissue-resident M2-like 126450647/ macrophages, TRIB1 is considered 8q24.13 critical for adipose tissue
43
maintenance and the suppression of metabolic disorders. GPD1 GPD1 encodes an important protein 005276 12:50497602- involved in lipid metabolism. The 50505103/ encoded protein catalyzes the 12q13.12 conversion of dihydroxyacetone phosphate (DHAP) and reduced nicotine adenine dinucleotide (NADH) to glycerol-3-phosphate (G3P) and NAD+. GALNT2 GALNT2 encodes a membrane- 004481 1:230202956- bound glycosyltransferase protein 230417875/ that catalyzes the first step of O- 1q42.13 glycosylation of peptides in the Golgi. MLXIPL MLXIPL encodes a leucine zipper 032951 7:73007524- transcription factor, which belongs 73038903/ to the Myc/Max/Mad family. In a 7q11.23 glucose-dependent manner, it activates the promoters of genes coding for TG synthesis. Low high- ABCA1 ABCA1 is part of the ATP-binding 005502 9:107543283- density cassette (ABC) superfamily of 107690527/ lipoprotein transporters. ABCA1 is a cholesterol 9q31.1 (LHDL) efflux pump, which removes cholesterol from cells. APOA1 Apolipoprotein 1 is synthesized in 000039 11:116706467- the liver and small intestines. It is 116708338/ the main protein of plasma HDL, 11q23-q24 promotes cholesterol efflux for excretion and acts as a cofactor to LCAT. LCAT Lecithin-cholesterol acyltransferase 000229 16:67973787- (LCAT) esterifies cholesterol with a 67978656/ lecithin molecule, reducing its 16q22.1 solubility and aiding in the formation of pseudo- HDL/LDL/VLDL. LCAT has a high affinity for HDL and plays an important role in the formation of HDL cholesterol. ANGPTL3 Angiopoietin-like 3, expressed 014495 1:63063158- predominantly in the liver, is in a 63071976/ class of lipid metabolism 1p31.1-p22.3 modulators that regulate VLDL levels in the plasma. It acts as a dual inhibitor of both lipoprotein lipase and endothelial lipase.
44
ABCG1 ABCG1 encodes an ATP-binding 004915 21:43619799- cassette transporter protein which 43724497/ regulates macrophage cholesterol 21q22.3 and phospholipid transport. It also contributes to cholesterol homeostasis in several cell types. High low- APOB Apolipoprotein B is a hydrophilic 000384 2:21224301- density protein on chylomicrons, thereby 21266945/ lipoprotein allowing for transport of LDL to the 2p24-23 (HLDL) tissues of the body. ApoB-48 is synthesized in the intestines and ApoB-100 is synthesized in the liver.
Abbreviations: HDL, high density lipoprotein; VLDL, very low density lipoprotein; LPL, lipoprotein lipase; TG, triglyceride; ER, endoplasmic reticulum; LDL, low density lipoprotein; rRNA, ribosomal RNA.
45
1.6.2 Whole-exome sequencing
WES is a method of NGS capable of sequencing all protein-coding regions of the genome (approximately 1‒2%). Using a library preparation kit that captures all exonic content of the genome (known as the exome); WES allows identification of all gene variants, rather than the select few possible in the scaled-down approach of targeted resequencing. WES is a feasible and rapid approach to sequencing a large amount of DNA, and a valuable tool for rare disease research.
1.6.2.1 Whole-exome sequencing successes
WES has had momentous success as a tool for rare disease variant discovery. Although it only targets a significantly small proportion of the human genome, it stands as the method-of-choice for rare disease research because 85% of disease causing mutations found-to-date have been harboured in exons103. Further, the use of WES has had much success in identifying the genetic basis of rare diseases, with the identification of causative genes for both Schinzel-Giedion syndrome and Miller syndrome as notable examples of the first cases of WES success104,105. In sum, the genetic basis of >200 disorders have been identified using WES, making the success and efficiency of WES preferred over WGS100,106. Moreover, due to the declining cost of WES, the high diagnostic yield, and the general acceptance of WES in the health marketplace, it has become the preferred diagnostic method for rare disease patients on the diagnostic odyssey who have not been genetically explained using standard genetic techniques107.
1.6.3 Whole-genome sequencing
The third and most comprehensive form of NGS is WGS, a method reporting almost every nucleotide (~85%) in the human genome. As WGS targets most nucleotides, it is capable of determining variations in any part of the genome, including regulatory regions. These variations detected through WGS have significant implications on an individual’s phenotype, ranging from protective against disease, to causative of disease, to neutral or benign. In recent years, WGS has become a widely used tool in cancer research and the
46 analysis of somatically acquired variants in tumour tissues108. Despite the utility of WGS, there are many caveats to the widespread implementation of WGS. For example, factors including misdiagnosis, risk of incidental findings, and the gap in literature on non- exonic regions are all major considerations108. Because of these drawbacks, WES remains the preferred sequencing method for rare disease research.
1.7 Thesis project outline
With a staggering number of rare diseases without a genetic explanation, there is a substantial need to investigate these rare disorders and end the diagnostic odyssey for these individuals and their families. In the Blackburn Cardiovascular Genetics Laboratory, we have been referred patients with a variety of rare diseases including lipodystrophy, extreme-early onset obesity, brachydactyly, cerebral atrophy, and those through the FORGE Canada and CARE4RARE Projects. Generally, when familial recurrence of a rare phenotype is present, the likelihood that the disease is monogenic is high. Further, extreme severity of a disease with high penetrance also suggests the possibility of a single gene explanation. Therefore, it is predicted that these rare diseases are attributed to novel, single gene, genetic variations. Through NGS methods such as LipidSeq™ and WES, I seek to identify the molecular basis of each rare disorder.
1.7.1 Project overview
Overall, we enrolled 153 patients with lipodystrophy, 5 patients with extreme early-onset obesity, one family with brachydactyly, one family with cerebral atrophy, and 11 families associated with FORGE Canada or CARE4RARE. To start, I began by using the LipidSeq™ targeted gene panel for the lipodystrophy cohort, and Sanger sequencing for all other rare disease samples to determine if known genes could explain these disorders. In the cases where no mutations were found from Sanger sequencing or LipidSeq™, I sought to determine the genetic basis of these unexplained diseases using WES and subsequent bioinformatics analysis. In the event that candidate variants were identified, I performed variant validation and co-segregation analysis. Further, when possible, I used NGS data to identify novel CNVs.
47
1.7.2 Project hypothesis
Given the evidence of a genetic basis for lipodystrophy, extreme early-onset obesity, brachydactyly, autosomal recessive cerebral atrophy, and past CARE4RARE/ FORGE Canada cases, I hypothesize that these aforementioned diseases are caused by rare genetic variants with functional relevance, following monogenic inheritance. Furthermore, I hypothesize that these variants will co-segregate with disease status in families, and be absent from unaffected family members and control populations.
1.7.3 Project goal and aims
Using LipidSeq™ and WES, the overall goal was to utilize these NGS technologies to identify a molecular basis for each patient/family disease of interest. In order to do this, my aims were as follows:
1) To use NGS methods and bioinformatics processing, namely LipidSeq™ and WES, to detect genetic variants or CNVs.
2) To identify rare or uncommon variants that are likely causative or associated with the disease phenotype of interest.
3) To determine the functional relevance of these genetic variants using in silico tools and literature reviews.
4) To perform variant validation studies to resolve whether these newly discovered variants are co-segregating with the disease phenotype in the family or an unaffected control population.
48
Chapter 2 – Materials and Methods
2 Overview
The following section provides an overview of all the Materials used and Methods performed in this study (Figure 2). Although the study relied on several external factors, including clinical diagnoses, the processing of the LipidSeq™ targeted gene panel and WES; I was involved in patient selection and developing eligibility criteria, and responsible for all sample preparation, bioinformatics processing and data analysis, variant validation and co-segregation analysis. Most importantly, I was responsible for all variant prioritization, consisting of literature review and analysis of hundreds-to- thousands of variants per case. Furthermore, I was responsible for performing all analytics, reporting of the data, and manuscript preparation. For the CARE4RARE and FORGE Canada cases, I was significantly involved in the microcephaly-ichthyosis and widow’s peak cases (responsible for patient selection, bioinformatics processing and analysis, variant validation, and co-segregation analysis). For the remaining CARE4RARE and FORGE Canada cases, I was responsible for managing each case, organizing and chairing meetings with CARE4RARE/FORGE Canada collaborators, mentoring each student involved, and re-analyzing and confirming all results identified by students in these cases.
2.1 Ethics approval
Ethics approval was obtained for all projects in accordance with the Ethics Review Board at Western University (Certificate Number 07920E) in London, Ontario, Canada (Appendix I). For each study, informed consent and ethical approval was obtained from each participant, or in the event of a pediatric case, from a parent or guardian (the consent form can be found in Appendix II).
49
Figure 2. Flowchart of steps taken in order to identify the genetic bases of rare disorders. All steps shaded in blue represent steps where I was involved.
50
2.2 Study subjects
All study participants were recruited from Dr. Hegele’s Endocrinology Clinic (London Health Sciences Centre, University Hospital, London, ON, Canada), the Blackburn Cardiovascular Genetics Laboratory (Robarts Research Institute, London, ON, Canada), the Medical Genetics Program of Southwestern Ontario (London Health Sciences Centre, Victoria Hospital, London, ON, Canada), and the Children’s Hospital of Western Ontario (London Health Sciences Centre, Victoria Hospital, London, ON, Canada). For the CARE4RARE and FORGE Canada projects, patients were recruited from areas throughout Canada.
2.2.1 Clinical information
For each study subject, clinical information was provided from Dr. Hegele or the referring physician. For some CARE4RARE and FORGE Canada cases, clinical features were obtained from the CARE4RARE and FORGE Canada Consortiums. In the event that detailed clinical information was unavailable, the most common features and co- morbidities of the diagnosed disease were assumed present.
2.3 DNA extraction and quality control
DNA was isolated from whole blood (3 mL) using the Puregene® Blood Extraction Kit (Cat. No. 158389, Gentra Systems, Qiagen Inc., Mississauga, ON, Canada). Both the quality and quantity of the DNA sample were measured using the NanoDrop 1000 spectrophotometer with target ratios of 260:280 and 260:230 of approximately 1.8 meeting the threshold for the study. DNA was purified and diluted to 5 ng/μL for both targeted and WES.
2.4 SNP genotyping and autozygosity mapping
For certain CARE4RARE and FORGE cases, namely CARE4RARE 907 (Heterotaxy) and FORGE 11 (Osteopetrosis), 122 (Dystonia, ataxia and intellectual disability) and 352 (Microcephaly-ichthyosis), genomic DNA (gDNA) was extracted and genotyped for
51
SNPs using the Affymetrix® Genome-Wide Human SNP Array 6.0 (Santa Clara, California, United States). With the data as input, GeneSpring GT v2.0 (Agilent Technologies, Santa Clara, California, United States) software was used to identify areas of homozygosity that were identical-by-descent within family members. The SNP allele frequencies of healthy individuals were used to calculate a logarithm of the odds (LOD) score for each SNP. Homozygous regions in affected individuals with high LOD scores were prioritized when identifying candidate variants.
2.5 Next-generation sequencing
Two methods of NGS were used for the study. One technique used was targeted sequencing, namely LipidSeq™, and the second was WES, discussed in Sections 2.5.1 and 2.5.2, respectively.
2.5.1 Patient selection for LipidSeq™
One-hundred-and-fifty-three patients referred to the Blackburn Cardiovascular Genetics Laboratory with a clinical diagnosis of lipodystrophy were included in this portion of the study. Patients were prioritized based on two criteria: 1) the absence of mutations in known lipodystrophy-causing genes as previously determined from Sanger sequencing; and 2) disease severity, where those with severe phenotypic characteristics (i.e. the partial or complete absence of adipose tissue from the body) and metabolic comorbidities (i.e. insulin resistance, diabetes, hypertriglyceridemia) were selected.
2.5.1.1 LipidSeq™ targeted sequencing
After dilution and purification to 5 ng/μL, all DNA samples were indexed and pooled using the Nextera® Rapid Capture Custom Enrichment Kit, namely the “LipidSeq™” targeted sequencing design. Using LipidSeq™, 73 genes and >180 SNPs associated with lipid metabolism were sequenced for each sample. More specifically, all coding regions and a ~150-base pair (bp) pad at intron-exon boundaries were sequenced. Following indexing and pooling, library preparation was performed with the Nextera® Rapid Capture Custom Enrichment Kit, and enriched DNA samples were sequenced on an
52
Illumina MiSeq personal desktop sequencer (Illumina, San Diego, California, United States) using 2×150-bp paired-end chemistry in accordance to manufacturer instructions. DNA samples were sequenced in-house at the London Regional Genomics Centre (LRGC; http://lrgc.ca/) in London, Ontario with an average of approximately 300× depth- of-coverage.
Briefly, the extracted and purified DNA was first tagged with adapters. Reduced cycle amplification added additional motifs including unique primer binding sites, indices, and complementary regions to the oligonucleotides on the flow cell. The library was then quantified and measured using the Agilent® 2100 Bioanalyzer (Agilent Technologies, Santa Clara, California, United States) prior to being processed on the Illumina MiSeq. Once on the MiSeq, the DNA was immobilized onto a glass flow cell using the oligonucleotide complementary adapters. Bridge amplification occurred where all the strands were clonally amplified. This process occurred in parallel to millions of reactions, and resulted in cluster generation and amplification of all the fragments. After bridge amplification, sequencing was performed by way of sequencing-by-synthesis. More specifically, each nucleotide base possessed a unique fluorescence and competed for addition to the template strand, and the MiSeq instrument detected the fluorescent light emitted during synthesis. This resulted in complete sequencing of the DNA in a base-by- base fashion109.
2.5.2 Patient selection for whole-exome sequencing
Twenty patients with lipodystrophy and five children with extreme early-onset obesity from Dr. Hegele’s Endocrinology Clinic were selected for this portion of the study. These patients were chosen based on the following criteria: 1) the absence of mutations in known disease-associated genes as determined from Sanger sequencing or LipidSeq™, and 2) disease severity, where those with severe characteristics (i.e. complete absence of adipose tissue or extreme excess of adiposity) and several confounding conditions (i.e. diabetes, insulin resistance or overgrowth) were prioritized. From the group of lipodystrophy patients deemed mutation negative from Sanger sequencing or LipidSeq™, patients of Dr. Hegele’s (rather than referrals from external physicians) were prioritized
53 for WES to ensure consistent clinical diagnoses and tests were performed. The parents of the children with extreme early-onset obesity were also approached for participation in the study. This resulted in the recruitment of two sets of parents, or two sets of trios (Mother, Father and proband) to the study.
Families with rare genetic diseases (namely brachydactyly, type A1 and cerebral atrophy) referred to Dr. Hegele’s clinic or the Blackburn Cardiovascular Genetics Laboratory, and cases ascertained through the CARE4RARE and FORGE Canada projects were also selected for this portion of the study. These families were chosen based on similar criteria: lack of mutations in known disease-associated genes, disease severity, and rarity.
2.5.2.1 Whole-exome sequencing
After DNA extraction, quality control and dilution as described previously in Section 2.3, the DNA samples were indexed and pooled using the Illumina TruSeq Rapid Capture Exome Library Prep Kit in preparation for WES. The patient samples were sequenced in accordance to the WES protocol on the Illumina NextSeq 500 (Illumina, San Diego, California, United States) benchtop sequencer with 2×100-bp paired-end chemistry in accordance to the protocol used at the LRGC. Again, sequencing was performed using the sequencing-by-synthesis method, as described previously in Section 2.5.1.1. The average depth-of-coverage was approximately 100×.
The lipodystrophy samples, all early-onset obesity samples, the autosomal recessive cerebral atrophy-like trio, and the brachydactyly proband were sequenced in-house at the LRGC. For the remaining cases, WES was generously funded by the FORGE Canada and CARE4RARE Research Programs, and performed at either the Genome Québec Innovation Centre (http://gqinnovationcenter.com/) in Montreal, Québec or The Centre of Applied Genomics (http://www.tcag.ca/) in Toronto, Ontario. At both locations, the samples were run on an Illumina HiSeq 2000 (Illumina, San Diego, California, United States) sequencer using an Agilent® SureSelect v5 Target Enrichment Kit.
54
2.6 Bioinformatics processing
Following sequencing, both the LipidSeq™ and WES raw data were returned in the form of patient-specific, paired FASTQ files. FASTQ files contain FASTQ format, a text- based format with nucleotide sequence and corresponding quality scores. The paired FASTQ files were input into CLC Bio Genomics Workbench v10 (CLC Bio, Aarhus, Denmark) to align the data to the human reference genome (build Hg19). Sequence alignment was performed using a custom automated workflow (Figure 2.6).
Succinctly, the workflow began by mapping the reads to the reference genome. From there, the software performed local realignment, a “proofreading” step that used alignment information of other nearby reads in order to re-align each given read. A second “proofreading” step was then executed, where the tool effectively removed bias by discarding duplicate reads that may have arose from PCR amplification during sample preparation. Fixed ploidy variant detection was performed, using The Error Model estimation in order to estimate the probability of having a certain base in a read, but calling a different base. This tool allowed variants to be called or identified. The software then performed two steps: 1) filtered based on overlap, or kept the reads overlapping with the BED file (tab-delimited text file with information on the regions targeted using the LipidSeq™ or WES kit); and 2) created statistics for target regions, which provided a summary of the local and overall coverage. After the alignment and variant calling steps, variant data were exported in the form of a variant calling format or VCF (.vcf) file (a tab-delimited text file containing the variant information), and coverage statistics were exported in the form of a BAM file (.bam), a binary version of a SAM file (a tab- delimited text file containing the sequence alignment data).
55
Figure 2.6. Next-generation sequencing bioinformatics workflow. Custom workflow designed in CLC Genomics Workbench v10. For each individual case, the workflow uses two batched FASTQ files and generates a VCF and BAM file as output. Note that the “Filter Based on Overlap” step utilizes the BED file for the LipidSeq™ or whole-exome sequencing kit.
56
2.7 Variant annotation
After variant calling, the VCF files were utilized as input for variant annotation. For the LipidSeq™ data, ANNOVAR (http://annovar.openbioinformatics.org/), a software tool that functionally annotates genetic variants, was used to annotate the variants within the VCF files using a customized script. For the WES data, the Golden Helix VarSeq® software (Golden Helix Inc., Bozeman, Massachusetts, United States), a variant annotation and filtration software, was used to fully annotate the variants. ANNOVAR and VarSeq® both annotated each variant with predictions from in silico tools including: Polymorphism Phenotyping, v2 (PolyPhen-2; http://genetics.bwh.harvard.edu/pph2/)110, Sorting Intolerant From Tolerant (SIFT) predictor (http://sift.jcvi.org/)111, MutationTaster (http://www.mutationtaster.org/)112, and Combined Annotation Dependent Depletion (CADD; http://cadd.gs.washington.edu/score)113. For splicing mutations, concordance with in silico pathogenic predictions from the Human Splicing Finder (http://www.umd.be/HSF3/HSF.shtml)114 and the Splicing Based Analysis of Variants (SPANR; http://tools.genes.toronto.edu/)115 databases were used. For each variant, the minor allelic frequency (MAF) was also extracted from the following databases: 1000 Genomes (http://www.internationalgenome.org/1000-genomes-browsers/)116, Exome Sequencing Project (http://evs.gs.washington.edu/EVS/), Exome Aggregation Consortium (ExAC) browser (http://exac.broadinstitute.org/)117, and Genome Aggregation Database (gnomAD) (http://gnomad.broadinstitute.org/)117. Annotated variants harboured within genes associated with the disease of interest were prioritized.
2.8 Variant prioritization
Once annotated, variants were prioritized based on several criteria for causality. These stringent criteria were used to ensure the candidate variants identified for each case had a high likelihood of being disease-causing (Table 2.8). Note that given the complexities of, and differences between each case, some variant prioritization criteria varied between patient sample or family (i.e. autosomal dominant versus recessive mode of inheritance, minor allele frequency [MAF] of >1% versus 0%, etc.), and these criteria were customized for each case.
57
Table 2.8. Criteria used to prioritize candidate variants and infer them as disease causing.
Criteria considered to predict a variant as disease-causing:
I. The variant is predicted to be pathogenic by the following analyses: A. Multiple in silico prediction tools agree that the variant has a high likelihood of being disease-causing B. Gene function, expression, and pathway analyses are in line or associated with the phenotype of interest Using the following databases, but not limited to: GeneCards (http://www.genecards.org/)118, OMIM (https://www.omim.org/), NCBI Gene (https://www.ncbi.nlm.nih.gov/gene), UniProt (http://www.uniprot.org/)119, Reactome Pathway Database (http://reactome.org/)120, Human Protein Atlas (http://www.proteinatlas.org/)121, KEGG (http://www.genome.jp/kegg/)122 C. Disease databases show a relation between the gene or variant and the disorder of interest Using the following databases, but not limited to: HGMD (http://www.hgmd.cf.ac.uk/ac/all.php)123, NCBI ClinVar (https://www.ncbi.nlm.nih.gov/clinvar/), Orphanet (http://www.orpha.net/consor/cgi- bin/index.php)124, DECIPHER (https://decipher.sanger.ac.uk/)125 D. Literature searches and guidelines suggest the variant has a high likelihood of being disease- causing Using PubMed, Web of Science, and the ACMG standards and guidelines126 II. Genotype analysis shows the mutation is rare (at least <1%) or absent from a large population* III. The mutation co-segregates in the family in accordance with the predetermined mode of inheritance, and can be validated through an independent method IV. Functional assessment – including ex vivo, in vitro and in vivo bench studies – show the mutant gene product is dysfunctional *Note that the control databases (1000 Genomes, ExAC, ESP, gnomAD) were first checked to ensure their control cohorts did not include the phenotype of interest. In the event that the phenotype of interest was part of the control cohort in the database, the frequency was used with caution. The database abbreviations are as follows: OMIM, Online Mendelian Inheritance in Man; KEGG, Kyoto Encyclopaedia of Genes and Genomes; HGMD, Human Gene Mutation Database; ACMG, The American College of Medical Genetics and Genomics.
58
2.8.1 Zygosity
Given the predicted mode of inheritance of the disease from the family history, zygosity was used to prioritize specific variants. More specifically, if the disease was expected to follow an autosomal dominant mode of inheritance, heterozygous variants were prioritized; if the disease was expected to follow an autosomal recessive mode of inheritance, either homozygous variants or compound heterozygous variants were prioritized. In the event that there was no family history available, the predicted zygosity of the disease of interest was used (i.e. all known cases of congenital general lipodystrophy are associated with an autosomal recessive inheritance pattern, therefore homozygous variants were prioritized).
2.8.2 Read depth
The read depth represents the number of unique reads that include a given nucleotide in a sequence. In order to discard sequencing artifacts or Mendelian errors, variants are prioritized based on read depth. A read depth criterion of 30 was used for quality control. Note that the read depth is indicated as a quality control measurement and this step is capable of removing ~95% of Mendelian errors127.
2.8.3 Sequence ontology
Sequence ontology refers to the structured vocabulary used for genomic annotation. More specifically, it offers a common, universal set of terms and definitions for genomic data. In this project, the sequence ontology terms – disruptive inframe insertion/deletion, frameshift variant, inframe insertion/deletion, initiator codon variant, missense variant, splice acceptor/donor/region variant, stop gain/loss/retained variant – were prioritized. These non-synonymous and splicing variants were prioritized as they are more likely to be pathogenic, destabilize the protein structure, and result in dysfunctional interactions between interacting molecules128-131.
59
2.8.4 Minor allele frequency
Minor allele frequency refers to the frequency at which the second most prevalent allele occurs in a population. In this case, the MAFs were extracted from 1000 Genomes, Exome Sequencing Project, ExAC and gnomAD, as mentioned in Section 2.7. A MAF of 0.01 was used for all rare diseases with an autosomal recessive mode of inheritance, and a MAF of zero was used for rare diseases with a suspected autosomal dominant mode of inheritance.
2.8.5 In silico analyses
As specified in Section 2.7, in silico tools were used to predict the biological effect or functional relevance of the variants on protein function. Variants were prioritized if the tools predicted that the variant has a high-likelihood of being disease causing.
2.8.6 Gene and protein analysis and literature review
To narrow down the list of candidate variants, analysis into gene function, expression and pathway were performed, and disease databases were analyzed to determine a relationship between the variant and disease of interest. A comprehensive literature review was performed for each variant, and the American College of Medical Genetics (ACMG) standards and guidelines were implemented and considered. See Table 2.8 for more details on the prioritization method.
2.8.7 Association with the disease phenotype
In the event that a variant was identified in a known gene previously associated with the disorder, that variant was prioritized if it satisfied all aforementioned criteria. With regard to the LipidSeq™ data, the lipodystrophy-associated genes were selectively analyzed for potentially causative variants.
60
2.9 Copy-number variation detection
All patients processed using LipidSeq™ or with WES performed in-house were subject to CNV detection. The CNV Caller tool, an application within the VarSeq® software, was used to call CNVs with sequencing depth-of-coverage data from the previously generated BAM file. The VCF file and BED file (tab-delimited text file with information on the targeted chromosomal regions) for either LipidSeq™ or WES were also input to VarSeq®, as the program uses a set of matched control samples prepared using the same library-preparation chemistry or sequencing method (i.e. LipidSeq™ or WES kit). The CNV Caller tool is capable of identifying four CNV states: 1) wild-type diploid state; 2) heterozygous deletion; 3) homozygous deletion; and 4) duplication.
In short, the CNV calling algorithm relied on the coverage information computed from the BAM files. The algorithm inspected for a change in coverage compared to a set of reference samples as evidence of a CNV event. More specifically, the program selected the top 30 reference samples with the least percent-difference (<20%) in coverage data compared to the sample of interest. These reference samples were used to identify differences in coverage, and correct for GC-content bias and regions that were unamenable to mapping. Using the reference samples, the algorithm computed two evidence metrics: Z-score and ratio threshold value. The Z-score is a measurement referring to the number of standard deviations from the reference sample mean, whereas the ratio refers to the normalized mean for the sample divided by the average normalized mean of all the reference samples. Using these two metrics, the algorithm was able to assign a CNV state (deletion or duplication) to each target region. In addition to these metrics, a third metric, the Variant Allele Frequency (VAF), was calculated to be used as evidence for a CNV. Any VAF value other than zero or one were evidence against deletions, whereas VAF values of 1/3 and 2/3 represented supporting evidence for duplications.
In addition to evidence metrics, quality control flagging was also performed by the software. These flags indicated whether a CNV event was unreliable, specifically if there
61 was a low reference sample read depth or high variation between reference samples in the region of interest. These flags were used to filter out unlikely CNV events.
2.9.1 Copy-number variation prioritization
After CNV calling in VarSeq®, CNV events were prioritized based on both ratio- threshold value (≤0.7 for heterozygous deletions, ≥1.3 for duplications) and Z-score (≤- 3.0 for heterozygous deletions, ≥3.0 for duplications). The VAF value was considered as secondary validation of evidence. In the event that a CNV event was flagged with a quality control flag, the CNV was no longer considered a candidate CNV associated with the disease of interest.
2.10 Variant validation and co-segregation analysis
In the event that candidate variants were identified, validation and co-segregation analyses were performed using an independent method (i.e. Sanger sequencing or microarray analysis).
2.10.1 PCR
Genomic DNA was ascertained from the proband and all other family members (if available) and amplified using polymerase chain reaction (PCR) and a custom set of primers (see Appendix III for primer sequences). Unique primers were designed for each variant of interest.
2.10.2 PCR imaging and purification
After PCR, the PCR products were loaded onto a 1.5% agarose gel with RedSafe™ Nucleic Acid Staining Solution (iNtRON Biotechnology Inc., Gyeonggi Province, South Korea) and run with a 100-bp DNA Ladder (ThermoFisher Scientific, Waltham, Massachusetts, United States). The gel was run for 45 minutes at 145 volts using a Gibco BRL Horizontal 11-4 Gel Electrophoresis Apparatus (Life Technologies, Carlsbad, California, United States). The gel was subsequently imaged using the Azure Biosystems
62 c150 Gel Documentation Platform (ThermoFisher Scientific, Waltham, Massachusetts, United States). If the PCR products were of expected size when compared to the ladder fragment size, the PCR products were purified using calf intestinal alkaline phosphatase (CIAP) and exonuclease I (ThermoFisher Scientific, Waltham, Massachusetts, United States).
2.10.3 Sanger sequencing and analysis
After PCR, the cleaned and purified DNA product was sent for Sanger sequencing at the LRGC using an Applied Biosystems (ABI) 3730 Automated DNA Sequencer (Applied Biosystems, Foster City, California, United States). Electropherograms were generated and analyzed using the ABI SeqScape® Software v2.6 (Life Technologies, Carlsbad, California, United States) where it was aligned to the corresponding reference gene sequence from the National Centre for Biotechnology Information (NCBI) GenBank. If the variants were present in other clinically affected individuals in the family (when available) following the same mode of inheritance, they were considered to co-segregate with disease status in the family. In the event that the variant was absent from affected family members, the candidate variant was deemed not causative of the disease of interest.
2.11 Validation of copy-number variation events
For the validation of candidate CNVs, either Sanger sequencing as described or the CytoScan™ HD Array Kit and Reagent Kit Bundle (ThermoFisher Scientific, Waltham, Massachusetts, United States) were used. Briefly, the CytoScan™ HD Solution provides the broadest coverage for detecting human chromosomal aberrations; the CytoScan™ HD Array can reliably detect over 750,000 SNPs and 2.6 million copy-number probes (with 25-50 kilo-base copy-number changes). Due to the high SNP coverage, the CytoScan™ HD Array allows a user to accurately estimate breakpoint locations, a necessary feat in validating CNV events. The CytoScan™ HD Array was performed according to manufacturer’s instructions at Victoria Hospital in London, Ontario (London Health Sciences Centre, Victoria Hospital, London, ON, Canada). Following sequencing, the
63 data were analyzed using the Chromosome Analysis Suite (ChAS) v3.2 (ThermoFisher Scientific, Waltham, Massachusetts, United States). The regions lying between probes differing in copy-number state were used to predict the approximate size of the copy- number variant and were predicted to harbour the breakpoint of the candidate CNV.
2.12 Gene enrichment analysis
For patients with lipodystrophy or extreme early-onset obesity in which no candidate variant or multiple candidate variants were identified, PANTHER (protein annotation through evolutionary relationship) classification system (http://www.pantherdb.org/) was used to determine if any protein families (and their genes) were under-or-overrepresented using Fisher’s Exact Test in comparison to a reference database132. Put simply, PANTHER was used to determine whether certain genes or pathways were affected more-or-less often than expected by chance. For the cases in which PANTHER was run, the candidate variant list used as input was the list of variants remaining after filtering based on zygosity, ontology, and minor allele frequency. Note that proteins were classified according to family and subfamily, molecular function, biological process, and pathway.
2.13 Statistical analysis: Brachydactyly case
Statistical analysis and comparison of the anthropometric data between IHH mutation positive and IHH mutation negative individuals in the brachydactyly case was done using the Wilcoxon-Mann-Whitney test on SAS v.9.4 (SAS Institute, Cary, North Carolina, United States). The Wilcoxon-Mann-Whitney test is used when sample size is small, and data are not normally distributed133. For statistical analysis in the brachydactyly case, eighteen family members were assessed. Fourteen of these 18 family members were clinically affected, and four were clinically unaffected.
2.14 Box plot generation: Brachydactyly case
Box plots for the brachydactyly case were generated using R: The R Project for Statistical Computing software and the ggPlot2 package134.
64
Chapter 3 – Results 3 Overview
One-hundred-and-fifty-three patients with lipodystrophy, five children with extreme early-onset obesity, one family with a history of brachydactyly, one family with a history of cerebral atrophy, and 11 families with several rare diseases (as ascertained from FORGE Canada and CARE4RARE) participated in this study. Here, I discuss all the results and outcomes of NGS.
3.1 Study subjects and clinical features
For all cases studied – namely the lipodystrophy, early-onset obesity, brachydactyly, cerebral atrophy, CARE4RARE and FORGE Canada projects – patient files, clinical notes, and/or hospital records were thoroughly reviewed to develop accurate clinical descriptions and select appropriate patients for sequencing. All cases were chosen based on disease severity. In the event that limited information about the phenotype was available, the phenotype described in the OMIM database was used.
3.2 LipidSeq™ variant detection
After sequencing using the LipidSeq™ targeted gene panel, the data for all 153 patients with lipodystrophy were analyzed for potential disease-causing variants. These variants were prioritized based on zygosity, read depth, sequence ontology and minor allele frequency as discussed in Chapter 2, Section 2.8. Of the 153 total patients, 81 variants were identified within 14 lipodystrophy-associated genes: LMNA, PPARG, PLIN1, CIDEC, LIPE, LPIN1, AGPAT2, BSCL2, CAV1, AKT2, PTRF, DYRK1B, POLD1 and WRN (Figure 3.2). These variants explain the clinical phenotype or secondary complications of 58 patients (38% of the patient cohort) processed using the LipidSeq™ gene panel, as all genes are either associated with lipodystrophy or with common features often implicated in lipodystrophy (i.e. high triglycerides, high cholesterol). The 95 patients classified as mutation negative after LipidSeq™ became candidates for the WES portion of the study.
65
Figure 3.2. Variant breakdown for patients with lipodystrophy sequenced using the LipidSeq™ targeted gene panel. The DNA samples of Dr. Hegele’s patients with lipodystrophy were ascertained and sequenced using LipidSeq™. Fifty-eight mutation- positive patients were classified according to lipodystrophy-causing gene. Each region in the graph represents the gene implicated, and the number of patients with a variant in the gene. Note that some patients harboured multiple variants in more than one gene, which likely contributed to their phenotype.
66
3.3 Sanger sequencing of TMPRSS4
For the proband featuring a cerebral atrophy-like phenotype, Sanger sequencing of the expected TMPRSS4 variant region using a custom set of primers (see Appendix III) was performed to determine whether the case shared the same molecular etiology as the previous case in the Blackburn Cardiovascular Genetics Laboratory (as described in Chapter 1, Section 1.5.4). From Sanger sequencing, no variants were identified in the TMPRSS4 region of interest designating the proband eligible for the WES part of the study.
3.4 Whole-exome sequencing
Twenty patients with lipodystrophy, five children with extreme early-onset obesity, one proband with brachydactyly, one proband with a cerebral atrophy-like phenotype, and 11 CARE4RARE and FORGE Canada cases were selected for the whole-exome portion of the study. To start, patient data were collected in order to fully understand the patient phenotype. The clinical features of the lipodystrophy and extreme early-onset obesity cases are described in Table 3.4A and Table 3.4B, respectively. The clinical description of the brachydactyly, cerebral atrophy-like, CARE4RARE and FORGE Canada cases are listed in Chapter 1 (Sections 1.5.3.1.8, 1.5.4.1 and Table 1.2.5.3, sequentially). After WES, bioinformatics processing and in silico analyses were performed on the WES data to identify potential disease-causing variants. Variants were prioritized if they satisfied criteria I-III in Table 2.8 (Chapter 2).
67
Table 3.4A. Features of all patients with lipodystrophy in which whole-exome sequencing was performedA.
Patient IDB Biological SexC Classification Additional Clinical Features (if present)
1804 Female Total lipodystrophy T2D, insulin resistance, hyperlipidemia, exercise intolerance 8615 Female Total lipodystrophy T2D, iron-deficient anemia, diabetic neuropathy, history of bronchitis, class 3 obesity, CAD 1088 Female FPLD N/A 3458 Female FPLD Hypothyroidism, diabetes 3969 Female FPLD Peripheral neuropathy (motor/axonal), Charcot Marie Tooth, T2D, constant migraines, NASH 4116 Female FPLD Hypertension, T2D, chronic renal failure, hypothyroidism 4665 Female FPLD Neuropathy, T2D, Behçet syndrome, pyoderma gangrenosum, hidradenitis 5662 Female FPLD N/A 2025 Female FPLD Profound insulin resistance, decreased creatinine levels, proteinuria, dermatomyositis 3011 Female FPLD Insulin resistance, dyslipidemia, hirsutism, high triglycerides 11618 Female FPLD Hypertension, T2D, hypercholesterolemia, obesity 14318 Female FPLD Severe insulin resistance 794 Female FPLD Hepatosplenomegaly, cirrhosis and NASH, high triglycerides, high cholesterol, insulin-requiring T2D, liver failure 14106 Female FPLD N/A 1120 Male FPLD N/A 4162 Female Acquired lipodystrophy Hypercholesterolemia, lower motor neuron weakness, hair loss, osteoarthritis 4164 Female Acquired lipodystrophy Insulin-requiring T2D 4194 Female Acquired lipodystrophy T2D, diabetic neuropathy, osteoarthritis 4226 Female Acquired lipodystrophy N/A 12395 Female PCOS/FPLD T2D, neuropathy, hypertension
The abbreviations are as follows: ID, identification; N/A, not applicable; T2D, Diabetes mellitus, Type 2; CAD, coronary artery disease; FPLD, familial partial lipodystrophy; NASH, non-alcoholic steatohepatitis; PCOS, polycystic ovary syndrome. A Patients were selected based on their diagnosis with a rare metabolic disorder, poor lipid profile, and lack of mutations in known disease-related genes (as determined through Sanger sequencing). Patients of Dr. Hegele’s (London Health Sciences Centre) were prioritized to ensure consistent diagnosis, high sample quality, and detailed, accurate patient information. After whole-exome sequencing, the data were run through CLC Bio Genome Workbench v10 and annotated using the curation and annotation program, Golden Helix VarSeq®. B The sample ID number represents a random, integral laboratory number assigned upon the receipt of the patient sample to allow for the privacy and respect of the patient. C Referring to the biological sex assigned at birth.
68
Table 3.4B. Features of all patients with extreme early-onset obesity in which whole- exome sequencing was performedA.
Patient IDB Biological SexC Classification Additional Clinical Features (if present)
12340 Male Early-onset obesity Insulin resistance, hyperphagia 15544 Male Early-onset obesity Autism spectrum disorder and developmental delay, overgrowth 15858D Female Early-onset obesity Hyperphagia, overgrowth, intellectual disability 12424 Male Early-onset obesity N/A 14504D Female Early-onset obesity N/A The abbreviations are as follows: ID, identification; N/A, not applicable. A Patients were selected based on their diagnosis with a rare metabolic disorder, poor lipid profile, and lack of mutations in known disease-related genes (as determined through Sanger sequencing). After whole-exome sequencing, the data was run through CLC Bio Genome Workbench v10 and annotated using the curation and annotation program, Golden Helix VarSeq®. B The sample ID number represents a random, integral laboratory number assigned upon the receipt of the patient sample to allow for the privacy and respect of the patient. C Referring to the biological sex assigned at birth. D Trio sequencing and analysis was performed with this patient and their unrelated parents.
69
3.4.1 Lipodystrophy
From WES and bioinformatics analysis, over one-million variants were identified among the 20 patients with lipodystrophy. After variant prioritization, candidate variants were identified for 13 of the 20 patients with lipodystrophy within the following genes: ISCU, HSPG2, LDLR, PDRM16, ZMPSTE24, FLNC, GALC, ABCA4, WRN, ABCG8, FHL1, ANLN, LPL, FN1, PAPSS2, NEUROD1, BSCL2, APOB, PCSK9, and PYGM (Table 3.4.1). These variants partially explain the lipodystrophy phenotype or associated comorbidities displayed by these patients.
3.4.2 Extreme early-onset obesity
After WES, data processing and bioinformatics analysis, over 100,000 variants were called in the exomes of five children with extreme early-onset obesity. After variant prioritization, candidate variants were identified in two of the probands (Table 3.4.2). These variants are predicted to explain the extreme early-onset obesity phenotype or the associated conditions (i.e. intellectual disability) described in these patients.
70
Table 3.4.1. Candidate variants identified in patients with lipodystrophy using whole-exome sequencingA.
Patient Chromosome: Amino acid Gene DNA change Zygosity/Effect Frequency IDB Position change 1804 ISCU 12:108956417 c.19_20delinsGG p.Phe7Gly Homo/Missense 0 (CGL) 8615 HSPG2 1:22200454 c.3707C>A p.Ala1236Glu Homo/Missense 1×10-3 (CGL) 1088 LDLR 19:11221435 c.1048C>T p.Arg350Ter Het/Nonsense 8×10-6 (FPLD) PRDM16 1:3329229 c.2468G>C p.Arg823Pro Het/Missense 7×10-4 3458 ZMPSTE24 1:40756665 c.1199A>G p.Asn400Ser Het/Missense 0 (FPLD) 3969 FLNC 7:128494727 c.6988G>A p.Gly2330Ser Het/Missense 7×10-4 (FPLD) GALC 14:88452941 c.334A>G p.Thr112Ala Het/Missense 2×10-3 4116 LDLR 19:11233961 c.2252G>A p.Arg751Gln Het/Missense 8×10-5 (FPLD) 19:11233940 c.2231_2232delins p.Arg744Gln Het/Missense 0 AG 4665 ABCA4 1:94528818 c.1610G>A p.Arg537His Het/Missense 1×10-3 (FPLD) 1:94510250 c.2969G>A p.Gly990Glu Het/Missense 0 WRN 8:30998961 c.2983G>A p.Ala995Thr Het/Missense 7×10-4 8:30938692 c.1149G>T p.Leu383Phe Het/Missense 4×10-4 5662 ABCG8 2:44101538 c.1412-8delinsTT N/A Homo/Splicing 0 (FPLD) 2025 FHL1 X:135288637 c.46G>T p.Gly16Trp Het/Missense 0 (FPLD) ANLN 7:36450231 c.1205C>T p.Pro402Leu Het/Missense 0 3011 LPL 8:19811864 c.775G>A p.Asp259Asn Het/Missense 0 (FPLD) PAPSS2 10:89501019 c.1114G>T p.Val372Phe Het/Missense 8×10-6 14318 NEUROD1 2:182543418 c.170G>A p.Gly57Glu Het/Missense 0 (FPLD) BSCL2 11:62457948 c.1280T>C p.Leu427Pro Het/Missense 2×10-3 APOB 2:21232803 c.6936_6937delins p.Ile2313Val Homo/Missense 0 TG PCSK9 1:55505647 c.137G>T p.Arg46Leu Het/Missense 8×10-3 PYGM 11:64527223 c.148C>T p.Arg50Ter Het/Nonsense 1×10-4 4194 WRN 8:30921838 c.243T>G p.Phe81Leu Het/Missense 0 (ALD) Abbreviations are as follows: CGL, congenital generalized lipodystrophy; FPLD, familial partial lipodystrophy; ALD, acquired lipodystrophy; Het, heterozygous; Homo, homozygous. A The candidate genes and variants were selected based on: low frequency in multiple databases, deleterious in silico predictions, relevance to the disease phenotype, and support from numerous papers in the literature. frequency listed for each candidate variant is the frequency from gnomAD, also confirmed from the databases: 1000 Genomes, Exome Aggregation Consortium, and the Exome Sequencing Project. B The sample ID number represents a random, integral laboratory number assigned upon the receipt of the patient sample to allow for the privacy and respect of the patient.
71
Table 3.4.2. Candidate variants identified in patients with extreme early-onset obesity using whole-exome sequencingA.
Chromosome: Amino acid Patient IDB Gene DNA change Zygosity/Effect Frequency Position change
15544 BLK 8:11405609 c.244G>C p.Gly82Arg Het/Missense 1×10-5
MC4R 18:58038832 c.751A>C p.Ile251Leu Het/Missense 6×10-3
15858 BBS10 c.424G>A p.Asp142Asn Het/Missense 0
SETD8 c.995T>C p.Leu332Pro Het/Missense 0
c.713G>C p.Arg238Pro Het/Missense 0
KMT2C c.2645T>C p.Ile882Thr Het/Missense 0
Abbreviations are as follows: Het, heterozygous; Homo, homozygous; Hemi, hemizygous. A The candidate genes and variants were selected based on: low frequency in multiple databases, deleterious in silico predictions, relevance to the disease phenotype, and support from numerous papers in the literature. frequency listed for each candidate variant is the frequency from gnomAD, also confirmed from the databases: 1000 Genomes, Exome Aggregation Consortium, and the Exome Sequencing Project. B The sample ID number represents a random, integral laboratory number assigned upon the receipt of the patient sample to allow for the privacy and respect of the patient.
72
3.4.3 BrachydactylyA
From WES and bioinformatics processing of the DNA sample from the proband, over 37,000 variants were identified in the proband’s exome. After a non-synonymous rare variant prioritization approach and literature review, I was left with one candidate variant correlating with the brachydactyly phenotype. This variant, a heterozygous disruptive inframe insertion (c.285_287dupGAA, p.Glu95_Asn96insLys), was detected in the Indian hedgehog gene (IHH). This IHH variant is predicted to exert a damaging effect on protein function from multiple in silico prediction tools, is considered novel in multiple control population databases, and has not been previously reported in the literature. Dominant variants in the IHH gene are associated with brachydactyly type A1, correlating with the phenotype and inheritance pattern seen in this family83.
3.4.4 Cerebral atrophy-like
Due to the absence of the expected variant in TMPRSS4, WES and bioinformatics analysis was performed on the DNA of the proband featuring a cerebral atrophy-like phenotype and his parents in order to perform trio analysis and identify causative genetic factors. From this analysis, one homozygous candidate variant (from 52,958 total variants) in the Kinetochore Scaffold 1 or CASC5 gene was identified (c.6485A>G, p.Glu2162Gly), associated with primary microcephaly-4. This gene variant is predicted to cause a pathogenic effect on protein function from in silico tools and is present at a minor allele frequency of 6×10-6 in control population databases. Note that the frequency in the normal population is associated with heterozygotes.
A A version of this section has been submitted for publication83. 73
3.4.5 CARE for RARE and FORGE Canada
From WES and bioinformatics processing on the exomes of the affected probands, candidate variants were identified in eight of the 11 CARE4RARE or FORGE Canada cases, namely microcephaly-ichthyosis, autosomal dominant isolated cryptophthalmos, widow’s peak syndrome, amyoplasia, metaphyseal chondrodysplasia, craniosynostosis, heterotaxy disorder, and craniorachischisis (Table 3.4.5).
Here, I focus on the microcephaly-ichthyosis and widow’s peak cases. With the microcephaly-ichthyosis case, the DNA from two affected infants were subject to WES. From WES and data processing, a total of 121,280 variants were identified in both exomes. After prioritization, this was narrowed down to one candidate variant in the vacuolar protein sorting-52 gene (VPS52; c.57delG, p.Thr20fs). The VPS52 gene is associated with pluripotent differentiation for ectodermal cell interactions. Further, mutations in the VPS52 complex are associated with microcephaly, a clinical feature of the affected probands.
For the widow’s peak case, two affected individuals had their DNA extracted and WES performed. From WES and bioinformatics analysis, a total of 1,873,928 variants were identified in the two exomes. After prioritizing based on variants on the X chromosome (due to the predicted X-linked dominant inheritance), frequency, read depth and sequence ontology, one candidate variant in the lysine-specific demethylase 6a gene (KDM6A) (c.2703-6_2703-5delTT) remained. Variation in the KDM6A gene is associated with Kabuki Syndrome-2, matching the phenotype of the proband.
74
Table 3.4.5. Status of all CARE for RARE and FORGE Canada cases.
Case Status
FORGE 214, Angelman-like syndrome Nothing significant found with the functional studies Input into MatchMaker Exchange FORGE 122, Dystonia, ataxia and Compound heterozygous variants previously found in the NudC intellectual disability* Domain Containing 2 (NUDCD2) Variants Sanger sequenced again, and are found to not co- segregate in the family Rainfall plots generated to determine mutational burden; gene enrichment analysis performed FORGE 11, Osteopetrosis Exome analysis phase – looking for candidate variants Waiting for DNA on an additional case FORGE 352, Microcephaly-ichthyosis* Candidate variant (p.Thr20fs) found in the vacuolar protein sorting 52 (VPS52) gene co-segregates in the pedigree Waiting on DNA for additional affected family members C4R 572, Autosomal dominant isolated Investigating a candidate variant in the Diacylglycerol Kinase cryptophthalmos Delta (DGKD) gene C4R 573, Widow’s peak syndrome* Candidate variant (c.2703-6_2703-5delTT) identified in Lysine Demethylase 6A (KDM6A) RNA extraction performed on the samples of both affected individuals RT-PCR to be performed to confirm the variant C4R 575, Amyoplasia New mutations identified in affected patients and not in parents: heparin sulfate proteoglycan 2 (HSPG2; p.Val3507Leu) in affected male, TEA Domain Transcription Factor 4 (TEAD4; p.Val212Met) in affected female Currently looking to recruit additional patients C4R 592, Metaphyseal chondrodysplasia Candidate variant identified in the Dishevelled Segment Polarity Protein 3 (DVL3) gene (p.Gln301Ter) Currently investigating other variants and considering functional studies C4R 664, Craniosynostosis* Candidate variant identified in the TNF Receptor Associated Factor 7 (TRAF7) gene (c.1673C>T, p.S558F) C4R 907, Heterotaxy disorder Candidate variant identified in the Interferon Related Developmental Regulator 1 (IFRD1) gene (c.568-4_568-3delTT) Waiting on DNA to confirm the variant of interest C4R 924, Craniorachischisis* Variants of interest identified in the Zinc Finger And BTB Domain Containing 33 (ZBTB33; p.Asp189_Asp190insAla) and the LFNG O-Fucosylpeptide 3-Beta-N- Acetylglucosaminyltransferase (LFNG; p.Trp49Argfs) genes Confirmed to co-segregate with disease status in the pedigree
Abbreviations are as follows: FORGE, Finding of Rare Disease Genes Canada project. Results listed are those up until July 1, 2018. *The red asterisk represents the projects I was directly involved in or working with undergraduate students on. The remaining cases without an asterisk were those in which I assumed an administrative role.
75
3.5 Shared sequence variation
From over one million total variants across the 25 rare metabolic disease (lipodystrophy and early-onset obesity) exomes, six ultra-rare androgen receptor (AR) variants were identified in four patients with partial lipodystrophy and one with extreme early-onset obesity (Table 3.5). Of these six identified variants, three have never been reported in the literature or in any database. For the variants that are not novel, note that a frequency greater than zero-percent was prioritized to account for heterozygotes in the normal control population.
The markedly high prevalence of rare AR variants in this small patient cohort is unexpected; furthermore, AR variants have never been described in either of these two disorders characterized by abnormal tissue distribution. All variants detected were harboured within the N-terminal domain of the AR protein product (Figure 3.5)
76
Table 3.5. Candidate variants identified in the androgen receptor gene.
Patient ID Amino Acid Change Sequence Ontology Zygosity/Effect Frequency (Phenotype)A
2025 (FPLD) Gly470_Gly473del In-frame deletion Homozygous 5 × 10-3 3011 (FPLD) Gln80_Glu81insGlnGlnGln In-frame insertion Heterozygous 0 4116 (FPLD) His384Gln Missense Heterozygous 0 14318 (FPLD) Gly470_Gly473del In-frame deletion Homozygous 5 × 10-3 Gln62Leu Missense Heterozygous 4 × 10-5 15544 (Obesity) Gln69fs Frameshift Hemizygous 0 The candidate genes and variants were selected based on: low frequency in multiple databases, deleterious in silico predictions, relevance to the disease phenotype, and support from numerous papers in the literature. The frequencies listed for each candidate variant were extracted from gnomAD and verified using independent databases, ExAC, 1000 Genomes and ESP. Abbreviations are as follows: FPLD, familial partial lipodystrophy. A The sample ID number represents a random, integral laboratory number assigned upon the receipt of the patient sample to allow for the privacy and respect of the patient.
77
Figure 3.5. Androgen receptor gene and protein structure. Amino acid changes of interest in the androgen receptor (AR) protein structure are represented by the yellow stars.
78
3.6 Copy-number variation discovery
All patients processed using LipidSeq™ (individuals with lipodystrophy) or with WES performed in-house (lipodystrophy and obesity cases) were subject to CNV detection. To call CNVs, the CNV Caller tool within the VarSeq® software was used. CNVs were called using sequencing depth-of-coverage data from each BAM file. As discussed in Chapter 2, CNVs were prioritized based on both ratio-threshold value (≤0.7 for heterozygous deletions, ≥1.3 for duplications) and Z-score (≤-3.0 for heterozygous deletions, ≥3.0 for duplications).
3.6.1 LipidSeq™ copy-number variation detection
For each patient with lipodystrophy processed on the LipidSeq™, the CNV Caller tool within VarSeq™ was used to call CNVs. After CNV calling and prioritization, seven candidate CNVs were identified within seven patients and predicted to be causative of the lipodystrophy phenotypes (Table 3.6.1).
In total, three heterozygous deletions and four duplications were detected and prioritized as causative. The deletions were present in AGPAT2, PLIN1 and CIDEC, where AGPAT2 is associated with CGL1, and both PLIN1 and CIDEC are associated with FPLD5. Each deletion is expected to cause or be associated with the lipodystrophy phenotype of these patients. The duplications identified in four patients were present in PLIN1, MFN2, APOA5/APOA4 and CREB3L3 associated with FPLD5, neuropathy, high triglycerides, and hyperlipidemia/hypertriglyceridemia, respectively. While the PLIN1 variant is expected to cause the lipodystrophy phenotype, the MFN2, APOA5/APOA4 and CREB3L3 duplication CNVs are thought to be associated with the secondary complications of lipodystrophy (i.e. high triglycerides).
79
Table 3.6.1. Candidate copy-number variants identified in patients with lipodystrophy using the LipidSeq™ targeted gene panel.
Patient IDA Region (affected probes) Gene(s), Exon(s)B CNV State
1120C 19:4153347-4173301 CREB3L3, 5’UTR – 3’UTR Duplication
4192 11:116659835-116694261 APOA5, APOA4, 5’UTR – 3’UTR Duplication
14557 1:12052361-12057728 MFN2, exons 4 – 6 Duplication
15678 15:90207349-90216895 PLIN1, exon 3 – 3’UTR Duplication
1099D 15:90220425-90220484 PLIN1, exon 2 Deletion/Heterozygous
15529 3:9921657-9922188 CIDEC, alternative non-coding exon 1 Deletion/Heterozygous
2108 9:139581377-139582161 AGPAT2, 5’UTR – exon 1 Deletion/Heterozygous
After sequencing using the LipidSeq™ panel, the data was run through CLC Bio Genome Workbench v10 and annotated using the curation and annotation program, Golden Helix VarSeq®. Copy-number variation was called using the depth of coverage and the CNV caller algorithm embedded in the Golden Helix VarSeq® software. Abbreviations are as follows: ID, identification; CNV, copy-number variation; UTR, untranslated region. A The sample ID number represents a random, integral laboratory number assigned upon the receipt of the patient sample to allow for the privacy and respect of the patient. B All known genes and exons/regions affected. C Copy-number alteration confirmed using the independent method, CytoScan™ HD. D Copy-number alteration confirmed using Sanger sequencing.
80
3.6.2 Exome copy-number variation detection
For the 25 lipodystrophy and obesity exomes, the CNV Caller tool in VarSeq® was utilized to call CNVs. After prioritization based on ratio threshold value and Z-score, no CNVs were predicted to be causative from WES data.
3.7 Validation of candidate variants and copy-number variations
When a candidate variant or CNV is discovered, it is imperative to ensure the variant or CNV is not a sequencing artifact, and to determine whether the variant or CNV co- segregates with disease status in the family (if available). For select cases, variants were confirmed through Sanger sequencing, and CNVs were confirmed through Sanger sequencing, WES, or the CytoScan™ HD microarray.
3.7.1 IHH validation (brachydactyly)A
The IHH p.Glu95_Asp96insLys variant was validated using PCR and Sanger sequencing. Primers were designed (see Appendix III) for the region of interest (c.285_287dupGAA, p.Glu95_Asn96insLys) and genomic DNA from the family was genotyped to confirm the presence of the mutation. Seventeen family members were genotyped for the mutation using direct Sanger sequencing, and the variant was determined to co-segregate with disease status in the family. Figure 3.7.1A shows the same family pedigree as Chapter 1, Figure 1.5.3.1.8 with additional genotyping information, Figure 3.7.1B illustrates the results from Sanger sequencing.
A A version of this section has been submitted for publication83. 81
Figure 3.7.1A. Pedigree and IHH genotype information for a Canadian autosomal dominant brachydactyly type A1-affected family. The proband, as indicated by the black arrow, was the first patient ascertained. All red and blue shaded individuals represent those whose DNA samples were Sanger sequenced for the IHH variant (exon 1, c.285_287dupGAA, p.Glu95_Asn96insLys). The reddened squares (males) and circles (females) represent affected individuals with brachydactyly type A1 who carry the IHH variant. The blue coloured squares and circles indicate those who are unaffected by brachydactyly and do not carry the IHH variant. The green coloured squares and circles represent the individuals clinically diagnosed with brachydactyly whose DNA was not obtained or sequenced. Diagonal lines indicate deceased individuals.
82
Figure 3.7.1B. Chromosome location, gene structure, sequence analysis and protein structure of Indian Hedgehog. A shows chromosome 2 and the location of the IHH gene drawn to scale. B shows the genomic DNA for the IHH gene. C shows the mRNA for IHH with the mutation indicated. Electrophoretic tracings for the IHH variant for both unaffected and affected family members are also shown. D shows the IHH protein structure with key domains, regions, and the mutation indicated.
83
3.7.2 VPS52 validation (microcephaly-ichthyosis)
Using PCR followed by Sanger sequencing, the VPS52 (c.57delG, p.Thr20fs) variant was validated in the two affected individuals. Additionally, the DNA of an available, unaffected sibling was Sanger sequenced to confirm the absence of the variant. The VPS52 variant was found to co-segregate with disease status in the pedigree (Figure 3.7.2).
3.7.3 KDM6A validation (widow’s peak)
The KDM6A variant (c.2703-6_2703-5delTT) was subjected to PCR and Sanger sequencing to confirm the validity of the candidate variant. The variant was present in both affected individuals, and absent in an unaffected family member, confirming co- segregation with disease status in the family (Figure 3.7.3).
3.7.4 AR validation (lipodystrophy and obesity)
All six AR gene variants (p.Gly470_Gly473del, p.Gln80_Glu81insGlnGlnGln, p.His384Gln, p.Gly470_Gly473del, p.Gln62Leu, p.Gln69fs) were subject to PCR and Sanger sequencing for validation. Due to the high GC-content of the AR gene, the sequencing results were inconclusive and validation of the AR variants is ongoing.
84
Figure 3.7.2. Sanger sequencing confirmation of the VPS52 gene variant in a family with a history of microcephaly-ichthyosis. From whole-exome sequencing, one candidate variant (c.57delG) in the vacuolar protein sorting-52 gene (VPS52) was predicted to be causative of the microcephaly-ichthyosis phenotype in the family. The arrows indicate the probands. After whole-exome sequencing, Sanger sequencing was utilized to confirm the variant in the two affected probands and confirm the absence of the variant in an available unaffected family member. Squares indicate biological males, circles indicate biological females, and diagonal lines represent individuals who are deceased.
85
Figure 3.7.3. Sanger sequencing confirmation of the KDM6A gene variant in a family with a history of widow’s peak syndrome. From whole-exome sequencing, one candidate variant (c.2703-6_2705-5delTT) in the lysine-specific demethylase 6a gene (KDM6A) was predicted to be causative of the widow’s peak syndrome phenotype in the family. After whole-exome sequencing, Sanger sequencing was utilized to confirm the variant in the two affected probands and confirm the absence of the variant in an available unaffected family member. Squares indicate biological males, and circles indicate biological females. Horizontal lines over the squares represent the samples subjected to whole-exome sequencing.
86
3.7.5 Copy-number variation validation
After CNV detection, validation was necessary to ensure that the CNV events called were not artifacts or false positives. In order to validate the CNVs, three independent methods were used, namely Sanger sequencing, WES and the CytoScan™ HD array. To date, two CNVs in patients 1099 and 1120 have been confirmed while five are ongoing.
3.7.5.1 Patient 1099: PLIN1 exon 2 deletion
From the VarSeq® CNV Caller tool and LipidSeq™ data, an exon 2 deletion was identified in the PLIN1 gene. This CNV event was validated using PCR, gel electrophoresis and Sanger sequencing on the patient and normal control samples (no lipodystrophy) with primers flanking exons 1 and 3 (Figure 3.7.5.1; see Appendix III for primer details).
87
Figure 3.7.5.1. Validation of a PLIN1 exon 2 deletion in a patient with familial partial lipodystrophy. Panel A: Sanger sequencing results showing the deletion of exon 2. Panel B: PCR and agarose gel electrophoresis across the breakpoints to confirm a PLIN1 exon 2 deletion in a patient with familial partial lipodystrophy. Lane 1 shows a 1-kb ladder, lane 2 shows a normal control, and lane 3 shows the patient sample. The patient is heterozygous for both the wild type sequence and a 1646-bp deletion.
88
3.7.5.2 Patient 1120: CREB3L3 duplication
From the VarSeq® CNV Caller tool and LipidSeq™ data, a full gene deletion of CREB3L3 was detected. To confirm this CNV event and determine whether the neighbouring genes were affected, WES was performed. From WES, it was determined that several neighbouring genes were also duplicated (Figure 3.7.5.2). More specifically, the PIAS4, ZBTB7A, MAP2K2, CREB3L3, SIRT6, and ANKRD24 genes were fully duplicated (5’UTR–3’UTR). Notably, the SIRT6 gene encodes the sirtuin-6 protein, a nuclear protein that catalyzes deacylation and mono-ADP ribosylation. Deficiency of SIRT6 results in accelerated aging, suggesting a link between lamin A and SIRT6, as lamin A defects are associated with progeroid features and lipodystrophy. Lamin A deficiency is the main cause of FPLD2, matching the phenotype of the patient.
To further validate the CNV event detected from WES, the DNA of the patient was subjected to genotyping using the CytoScan™ HD array. The microarray demonstrated the same results as the WES data, confirming the validity of the multi-gene duplication.
89
Figure 3.7.5.2. Detection of a duplication event from LipidSeq™ versus whole-exome sequencing data. Panel A shows the CNV event called by the VarSeq® CNV Caller tool using LipidSeq™ data. Panel B illustrates the CNV event called by the VarSeq® CNV Caller tool using exome data. In each panel, the top region shows the CNV state as determined from both ratio and Z-score metrics, and the bottom region shows the exon map of the affected gene(s). The regions highlighted in blue as “duplicate” are the regions where a duplication event occurred.
90
3.8 Gene enrichment analysis
In the event that multiple candidate variants, no candidate variants or no candidate CNVs were identified, PANTHER was used to analyze gene lists and determine whether there was overrepresentation of certain protein families, molecular functions, biological processes, or cellular components and pathways. The list of genes remaining after initial rare non-synonymous filtering (non-synonymous sequence ontology, Read Depth ≥ 30, Minor Allele Frequency ≤ 1%) were used as input. From analysis on the gene lists of patients with lipodystrophy and early-onset obesity, two partial lipodystrophy patients were found to harbour variants with significant overrepresentation in specific biological pathways. More specifically, for patient 14318, gene overrepresentation was identified in the biological pathways of O-glycan processing and tissue homeostasis. For patient 11618, overrepresentation was significant in the interferon-gamma-mediated signaling pathway.
3.9 Statistical analysis: Brachydactyly case
To strengthen the association of the IHH variant with the brachydactyly phenotype displayed in the family, family-based association analyses were performed using the Wilcoxon-Mann-Whitney test and anthropometric measurements. From these tests, the IHH variant was associated with shortened length of middle phalanges by 21.1% (P<0.001), of palms by 13.8% (P<0.01), of middle digit to palm ratio by 6.8% (P<0.03) and of stature by 9.5% (P<0.001), consistent with the relative mild clinical phenotype displayed by the patient (Figure 3.9).
91
Figure 3.9. Comparison of anthropometric measures between those positive for the IHH mutation and those negative for the IHH mutation. Physical measurements were taken for all available family members with brachydactyly. Validation of the IHH mutation was performed using Sanger sequencing. Statistical analysis was performed using the Wilcoxon-Mann-Whitney test on SAS v9.4. Box plots were generated using the ggPlot2 package in R project v3.4.3. Panel A represents the digit length (cm) for IHH mutation positive and mutation negative individuals taken from the base of the third finger to the tip. B shows the palm length (cm) for IHH mutation positive and negative individuals taken from the base of the palm to the top of the palm. C displays the height in inches for mutation positive and negative individuals. D shows the digit-palm ratio for mutation positive and negative individuals, where the digit and palm lengths were taken as described previously.
92
Chapter 4 – Discussion 4 Summary of findings
In this MSc Thesis, I have identified genetic variants underlying several rare diseases using NGS technologies. More specifically, each case was subjected to either LipidSeq™ targeted sequencing or WES. Bioinformatics processing and in silico analyses were then utilized to identify potential disease-causing variants from the LipidSeq™ and WES data.
From LipidSeq™ targeted sequencing of 153 patients clinically diagnosed with lipodystrophy, 58 patients were found to harbour 81 variants within 14 lipodystrophy- associated genes. Furthermore, seven patients were found to harbour CNVs in lipodystrophy-associated genes. This is the first report of systematically screening for CNVs in patients with lipodystrophy, and these are the first CNVs reported in lipodystrophy patients in the literature.
From WES and bioinformatics analysis, candidate variants were identified in 13 of the 20 patients with lipodystrophy, and two of the five patients with extreme early-onset obesity. For the rare disease cases ascertained through the Blackburn Cardiovascular Genetics Laboratory, namely the brachydactyly and autosomal recessive cerebral atrophy-like, candidate variants were identified in both cases. Last, for the rare disease cases ascertained through the CARE4RARE and FORGE Canada Consortiums, eight out of the 11 cases had candidate variants identified.
Of the candidate variants found, several were validated using Sanger sequencing and many were found to co-segregate with disease status in the pedigrees. These variants have been prioritized and will be considered for future functional studies. Of the candidate CNVs identified, the CNV in patient 1120 (CREB3L3 and surrounding genes) was confirmed using the independent methods of WES and CytoScan™ HD. Secondary validation (through Sanger sequencing) of the PLIN1 CNV was also performed using Sanger sequencing.
93
The context of these findings are discussed within the subsequent sections in this Chapter. Additionally, I discuss the implications, limitations, and future directions for this study, and the benefits and caveats of using NGS for identifying the genetic basis of rare diseases.
4.1 LipidSeq™
LipidSeq™, the custom-designed targeted NGS panel, was utilized for the sequencing of lipodystrophy-associated genes in patients with various forms of lipodystrophy. From the DNA of 153 patients with lipodystrophy, LipidSeq™ targeted sequencing, bioinformatics processing and variant curation were performed, and 81 variants harboured within 14 genes were identified among the 58 patients. Furthermore, from CNV calling and prioritization, seven novel CNVs were identified within seven patients.
4.1.1 Unexpected variation in POLD1
From the LipidSeq™ data, despite the fact that many of the causative genetic variants were harboured within common lipodystrophy-associated genes (i.e. LMNA, PPARG, PLIN1, etc.); an unexpected 14 variants were detected within POLD1. The POLD1 gene, encoding polymerase (DNA-directed), 1, is a catalytic and proofreading subunit of DNA polymerase (Pol), involved in lagging strand DNA synthesis during replication135,136. In order to aid in high fidelity DNA replication, synthesis and repair, POLD1 works with accessory proteins POLD2, POLD3 and POLD4. Together with these subunits, the heterotetramer interacts with Proliferating Nuclear Cell Antigen (PCNA) and the clamp loader, Replication Factor C (RFC) to form the polymerase holoenzyme. In addition to its role in lagging strand synthesis, Pol plays a role in proofreading (through exonuclease activity), and lesion repair resulting from mutagenic exposure. Furthermore, Pol is important in DNA repair mechanisms including base excision repair, mismatch repair, double strand break repair, and nucleotide excision repair. Mutations in Pol have been associated with genomic instability and tumourigenesis. Variants have also been identified in the developmental disorders mandibular hypoplasia, deafness, progeroid features and lipodystrophy (MDPL), and Werner’s syndrome137.
94
MDPL is an extremely rare, heterogeneous, multi-system disorder featuring premature aging of the tissues and organs. Most importantly, MDPL features variable lipodystrophy. In 2013, Weedon et al. reported POLD1 variants in four individuals featuring a prominent, atypical lipodystrophy phenotype136. Using deletion mutants, they showed that POLD1 variants abolished polymerase activity while maintaining exonuclease activity.
Due to the similar adipose tissue distribution of MDPL and the lipodystrophy seen in our patient cohort, I encourage LipidSeq™ targeted sequencing to differentiate lipodystrophy associated with POLD1 versus lipodystrophy caused by genes such as LMNA, PPARG and PLIN1. Differentiation may change treatment, thereby altering patient prognosis. Moreover, due to the higher than expected prevalence of POLD1 variants in our cohort, I suggest that lipodystrophy associated with POLD1 variants may be underestimated, further encouraging investigation of POLD1 in addition to classic lipodystrophy- associated genes in the future.
4.1.2 Copy-number variation findings
The advent of LipidSeq™ targeted sequencing has shown numerous benefits for patients with metabolic disease and clinical medicine, notably for the clarification of disease phenotypes caused by pathogenic variants. Understudied however, was the contribution of CNVs to lipodystrophy phenotypes. Using LipidSeq™ data and the CNV Caller Tool in VarSeq®, I detected CNVs by analysing depth of coverage readings from next- generation sequencing results. From the 153 uncharacterized lipodystrophy patients who were evaluated for potential CNVs, I identified seven novel CNVs that have never been reported in the literature or in any control database. Three individuals carried heterozygous deletions (patients 1099, 2108 and 15529), while four carried heterozygous duplications (patients 1120, 4192, 14557 and 15678).
4.1.2.1 Patient 1099
In a biological male with FPLD, a PLIN1 heterozygous deletion of exon 2 was identified. Using Sanger sequencing, this PLIN1 deletion was confirmed to be a 1646-bp deletion.
95
Perilipin-1, encoded by the PLIN1 gene, is a lipid droplet coat protein expressed in adipocytes, involved in the facilitation of lipolysis. Loss-of-function variants in PLIN1 are associated with autosomal dominant FPLD4, a subtype of partial lipodystrophy featuring variable loss of adipose tissue from the extremities138. As mutant PLIN1 proteins have an increased propensity for degradation and heterozygous knockout mice display significantly reduced fat mass, I suggest that the PLIN1 exon 2 deletion is causing the lipodystrophy in this patient139.
4.1.2.2 Patient 2108
In patient 2108 – a biological female clinically diagnosed with autosomal dominant Dunnigan-Köbberling syndrome – a heterozygous deletion of the 5’UTR–exon 1 region of AGPAT2 was identified. Dunnigan-Köbberling syndrome is a form of lipodystrophy characterized by the loss of adipose tissue from the body, sparing the face140. As homozygous variants of AGPAT2 are associated with CGL (a more severe, recessive form of complete lipodystrophy), I suggest that this heterozygous CNV event may be causing the milder, partial lipodystrophy phenotype in this patient.
4.1.2.3 Patient 15529
In a biological female featuring FPLD, a heterozygous deletion of alternative non-coding exon 1 in CIDEC was detected. Generally, recessive variants in CIDEC are associated with FPLD5. As this is a heterozygous deletion, it is predicted that this CIDEC CNV is contributing to the FPLD phenotype rather than causing it. As alternative non-coding exons play a large role in alternative splicing, I suggest that this CNV affects the splicing of the CIDEC gene. Further, as a candidate variant (c.T53G, p.V18G) was identified in the AGPAT2 gene through LipidSeq™ sequencing, I propose that the CIDEC CNV and AGPAT2 variant are acting synergistically to cause the partial lipodystrophy phenotype.
4.1.2.4 Patient 4192
In another biological female with FPLD, I detected a duplication of the entire APOA5 and APOA4 genes. APOA5 encodes apolipoprotein A-V, a low abundance plasma protein that
96 plays a role in triacylglycerol homeostasis141. APOA4 encodes apolipoprotein A-IV, a component of chylomicrons and high-density lipoproteins that plays a protective role in reverse-cholesterol transport142. GWASs have identified multiple SNPs in APOA5 that are associated with elevated TGs. Furthermore, studies on mutant Apoa5-/- mice demonstrate aberrant lipoprotein binding and TG modulation functions143. Due to the duplication of the entire APOA5 coding gene, I suggest that the duplication may be contributing towards the lipodystrophy phenotype in this patient. Furthermore, I suggest the duplication may be synergistically working with the APOA4 duplication and an additional aberrant gene product in order to cause the lipodystrophy present in this patient. In the future, I suggest WES to determine added genetic factors causing the lipodystrophy phenotype.
4.1.2.5 Patient 14557
In a patient (14557) with FPLD, I identified a novel duplication event in the MFN2 gene. The MFN2 gene encodes the mitofusin 2 protein, involved in the morphology of mitochondria. As the mitochondria require flexibility in morphology to maintain mitochondrial function, the mitofusin 2 protein is generated in many tissues and cells including muscle, the spinal cord, nerves, and peripheral nerves. Variants in MFN2 are the primary cause of autosomal dominant Charcot-Marie-Tooth (CMT) disease, type 2A144. CMT is a heterogeneous disorder, characterized by peripheral neuropathy145. An additional clinical disease associated with MFN2 mutations is multiple symmetric lipomatosis (MSL), a mitochondrial disorder associated with abnormal brown fat metabolism. Patients with MSL feature lipomatosis (multiple lipomas or benign fat tissue tumours on the body) as well as lipodystrophy. MSL has been attributed to a p.R707W (c.2119C>T) mutation146. As our patient was found to carry a heterozygous p.R707W mutation in MFN2 in addition to a heterozygous duplication, I suggest this variant and CNV are cooperatively contributing to the lipodystrophy phenotype. Additionally, due to the overlap between FPLD and MSL in terms of lipoatrophy, I suggest that the CNV duplication and variant in MFN2 are causing an atypical form of lipodystrophy. Follow- up studies are required to confirm the pathogenicity of the CNV event and the effects of the CNV combined with the p.R707W variant.
97
4.1.2.6 Patient 15678
From CNV detection, a biological female with FPLD was found to harbour a heterozygous duplication of PLIN1 (exon 3 – 3’UTR). As in the case with patient 1099, I propose that the FPLD phenotype in this patient can be explained by the PLIN1 duplication. As both excess and insufficient lipid storage in white adipose tissue lipid droplets can result in dyslipidemia, insulin resistance and diabetes, I suggest the PLIN1 duplication is contributing to the lipodystrophic phenotype of this patient147. Furthermore, as a novel heterozygous AGPAT2 variant (c.T53G, p.V168G) was also detected in this patient’s genome from LipidSeq™, I suggest this AGPAT2 variant and PLIN1 duplication are both contributing to the patient’s lipodystrophy.
4.1.2.7 Patient 1120
In a biological male clinically diagnosed with FPLD, a duplication of the CREB3L3 gene was identified. The cyclic AMP-responsive element-binding protein 3-like protein 3 (CREB3L3) gene encodes a transcription factor that activates unfolded protein response target genes during endoplasmic reticulum stress. Activated by cAMP stimulation, CREB3L3 binds the cAMP response element (CRE) and box-B element to activate transcription. In addition, CREB3L3 is involved in fatty acid oxidation and ketogenesis, and induced during fasted or insulin-resistant states148. Variations in CREB3L3 cause hypertriglyceridemia, where Creb3l3-/- mice have elucidated the mechanism as due to inefficient catalysis of triglyceride clearance149. As the entire CREB3L3 gene was duplicated, I speculated that neighbouring genes (such as the SIRT6 gene associated with lipid metabolism) were also affected. To confirm this prediction, I pursued WES. The results of the CNV detection from WES data are further discussed in Section 4.2.13.
In addition to the CREB3L3 CNV, patient 1120 also harbours two missense mutations, each in PLIN1 (c.G814A, p.V272M) and PTRF (c.C168A, p.S56R) predicted as deleterious from in silico prediction tools. Moreover, PLIN1 and PTRF are associated with FPLD5 and CGL4, respectively, each associated with lipodystrophy. All together, I suggest that the CREB3L3 duplication, along with the variants in PLIN1 and PTRF, are
98 modulating or causing the lipodystrophy phenotype and abnormal lipid profile present in this patient.
4.1.3 Benefits of LipidSeq™
The use of LipidSeq™ targeted sequencing offers several benefits. First, LipidSeq™ is a targeted panel, with the flexibility to adapt with the growing body of literature. As novel lipodystrophy genes are continually being discovered (i.e. adrenoceptor alpha 2A [ADRA2A] mutations in FPLD150), the LipidSeq™ has the ability to stay current and include all known genes associated with dyslipidemia. Second, as LipidSeq™ is restricted to specific genes, it lessens the probability of incidental findings associated with other disorders. With concerns regarding the proper disclosure of incidental findings, the use of LipidSeq™ decreases the possibility of these findings and the potential for genetic discrimination in the workplace or from insurers. Third, in comparison to Sanger sequencing, LipidSeq™ can rapidly provide a higher diagnostic yield at a cost-effective rate. With LipidSeq™ data generation taking less than a week, LipidSeq™ offers a quick turnaround from bench-to-bedside. Last and most importantly, LipidSeq™ allows for the genetic diagnosis of several metabolic disorders. Notably in the 153-person lipodystrophy cohort, LipidSeq™ sequencing led to the genetic diagnosis of 40% of patients through variants or CNVs, speaking to the utility of LipidSeq™ in the clinic. For these patients, the results may have actionable consequences in the realms of treatment, management or predictive recurrence risks, altogether improving patient outcome and prognosis.
4.1.4 Limitations of LipidSeq™
Although I was able to use the LipidSeq™ targeted gene panel to identify the genetic basis (variants and CNVs) of 40% of patients with lipodystrophy, 60% of cases remain genetically unexplained, speaking to the limitations of LipidSeq™. This gap in variant and/or CNV discovery is due to the inherited constraints of LipidSeq™ targeted sequencing. First, with LipidSeq™ there is low-to-no coverage of the untranslated and non-coding regions, making the identification of candidate variants in those regions
99 impossible. This is a drawback of LipidSeq™ as disease-associated variants have been known to be harboured in the UTR. For example, in 2017 Wang et al. identified a TBX5 3’UTR variant driving congenital heart disease in a Han Chinese population151. Second, with targeted NGS-based approaches, although there can be identification of CNV events, many CNVs can be missed depending on the location of the event. More specifically, numerous CNV events occur in highly repetitive regions through genomic instability, non-allelic HR or NHEJ152. Due to these areas being relatively unamenable to mapping (i.e. due to guanine-cytosine rich regions), these areas are either missed or not targeted through LipidSeq™ sequencing. Last, despite the fact that the LipidSeq™ is flexible and can be modified to incorporate any gene of interest, variant discovery from LipidSeq™ is restricted to a priori knowledge. Therefore, it is impossible for LipidSeq™ sequencing to allow for the identification of novel disease-associated genes. Albeit the utility of LipidSeq™ in identifying variants in known lipodystrophy-associated genes, it is necessary to use broader methods such as WES in order to identify novel pathogenic genes and variants, not previously implicated in lipodystrophy.
4.2 Whole-exome sequencing of patients with rare metabolic diseases
In patients with prior Sanger sequencing or LipidSeq™ sequencing in which no candidate variants were found, WES was pursued in order to identify novel disease-causing variants. Rare metabolic disease patients – namely 20 patients with lipodystrophy and five with extreme early-onset obesity – were subjected to the WES process. Following WES, data processing and bioinformatics analysis were performed to identify and prioritize putative disease-causing variants. After individual analysis, the exomes of individuals with lipodystrophy and extreme early-onset obesity were evaluated for shared variation. From these analyses, 13 of the 20 patients with lipodystrophy and two of five patients with extreme early-onset obesity had candidate variants identified. Furthermore, variation in the AR gene was detected in four patients with partial lipodystrophy and one patient with extreme early-onset obesity, creating a connection between the two opposite phenotypes.
100
4.2.1 Lipodystrophy
WES was performed for 20 patients with variable forms of lipodystrophy. WES identified variants within 13 patients discussed herein.
4.2.1.1 Patient 1804
In a biological female clinically diagnosed with CGL, a homozygous variant in the iron- sulfur cluster assembly enzyme (ISCU, c.19_20delinsGG, p.Phe7Gly) was identified. The ISCU protein is a scaffold protein required for the de novo synthesis of iron-sulfur clusters (Fe-S) in mitochondria. Specifically, ISCU is responsible for the maturation of mitochondrial and cytoplasmic proteins153. These Fe-S clusters are required for the function of numerous proteins, including those required for iron regulation and DNA repair. Proteins with these Fe-S clusters are also required for energy production in the mitochondria154. As Fe-S clusters are required cofactors for proteins involved in several biological processes, it is likely that dysfunction of the iron-sulfur cluster biogenesis pathway underlies several human diseases.
Mutations in ISCU are causative of iron-sulfur deficiency myopathy, or myopathy with exercise intolerance. This disease features severe, progressive muscle weakness, severe exercise intolerance and cardiomyopathy155,156. As patient 1804 exhibits exercise intolerance, specifically exertion-related chest complications, I suggest that this novel ISCU variant is contributing towards the phenotype present in this patient. As a candidate variant has not been identified as causative of her lipodystrophy, I suggest further analysis of the exome data using less stringent criteria (i.e. lower read depth) to determine the genetic basis of the lipodystrophy in this patient. I also suggest considering other genetic factors (discussed in Section 4.8) as causing the lipodystrophy in this patient.
4.2.1.2 Patient 8615
From WES, patient 8615 – a biological female featuring general lipodystrophy, diabetes, iron-deficient anemia, diabetic neuropathy, central obesity and coronary artery disease –
101 was found to harbour a homozygous variant in the heparin sulfate proteoglycan 2 gene or HSPG2 (c.3707C>A, p.Ala1236Glu) encoding for the perlecan protein. The perlecan protein belongs to the extracellular matrix basement membrane, where it supports cells in many tissues. Additionally, perlecan is found in cartilage and plays a role in cell signaling, angiogenesis and muscle contraction157. Perlecan also plays a large role in the cardiovascular system, where it plays a role in lipid metabolism by interacting with lipoprotein lipase and apolipoprotein B. Variants in HSPG2 have been linked to coronary artery disease, insulin sensitivity, adipose tissue defects and metabolic syndrome, all secondary features of the proband158,159. Therefore, I predict that the HSPG2 variants are contributing towards the lipodystrophy phenotype of this patient. As the definitive cause of the lipodystrophy present in this patient has not been elucidated, I suggest further analysis of the exome of this patient using less stringent criteria, as discussed prior.
4.2.1.3 Patient 1088
In patient 1088, a biological female featuring FPLD, high cholesterol, diabetes and high blood pressure, two candidate variants were detected and are predicted to cause the phenotype of the patient. The first is a missense variant (c.2468G>C, p.Arg823Pro) in PRDM16 encoding the PR domain containing 16 protein, a transcription co-regulator that binds and activates PPARɣ to develop brown adipocytes from brown adipose tissue (BAT). When functioning normally, BAT oxidizes chemical energy to produce heat in protection against obesity. An association between PRDM16 variants and a metabolic syndrome phenotype in a Uygur Chinese population has been reported, which suggests it may be involved in the development of lipodystrophy, as lipodystrophy is classified as a metabolic disorder160. The second candidate variant (c.1048C>T, p.Arg250Ter) is a classified pathogenic variant within LDLR, encoding the low-density lipoprotein receptor. LDL receptors are cell surface proteins involved in the receptor-mediated endocytosis of LDL cholesterol. Under normal circumstances, LDL is transported into the cell through receptor binding, and carried to the lysosome where it is subsequently degraded. Mutations in LDLR cause familial hypercholesterolemia (FH), an autosomal dominant disorder characterized by elevation of serum cholesterol bound to LDL, promoting the deposit of cholesterol in the arteries, tendons, and skin161.
102
In sum, these findings suggest that patient 1088 is not only affected with FPLD but may also have FH, explaining the high cholesterol levels. Considering the chance of developing familial partial lipodystrophy is approximately one in 50,000 and the prevalence of FH is one in 300, this makes the phenotype of patient 1088 one in 15 million. This illustrates the power of WES in the clinic, as it would be difficult for a clinician to diagnose a disorder with such low and improbable statistical odds.
4.2.1.4 Patient 3458
In patient 3458, a female clinically diagnosed with FPLD, a novel, heterozygous variant in the ZMPSTE24 gene was detected (c.1199A>G, p.Asn400Ser). The ZMPSTE24 protein is a zinc metalloproteinase STE24 with a role in processing farnesylated proteins162. ZMPSTE24 also ensures the correct processing and maturation of lamin A. Mutations in ZMPSTE24 are known to cause mandibuloacral dysplasia with type B lipodystrophy (MADB). This condition features bone abnormalities, patchy skin colouring, and loss of fat tissue across the body163. Mutations in ZMPSTE24 are also associated with severe progeria and restrictive dermopathy (thin, easily eroded skin and joint contracture). Complete loss-of-function alleles are associated with restrictive dermopathy, whereas residual or partial activity of ZMPSTE24 correlates with increased disease severity and MADB or progeroid features164. We suggest that this ZMPSTE24 variant is contributing towards the lipodystrophy phenotype of this patient. As a note, Sanger sequencing performed 12 years ago missed the variant in ZMPSTE24. The recent identification of this variant using WES highlights the power of NGS in variant identification.
4.2.1.5 Patient 3969
In patient 3969, a biological female featuring FPLD, candidate variants were identified in FLNC (c.6988G>A, p.Gly2330Ser) and GALC (c.334A>G, p.Thr112Ala). FLNC encodes gamma filamin, a protein that aids in the crosslinking of actin filaments in the cortical cytoplasm, involved in the anchoring of membrane proteins for the actin cytoskeleton. As gamma filamin is muscle-specific, dominant mutations in FLNC cause myofibrillar
103 myopathy, a myopathy characterized by muscle weakness and the atrophy of the upper and lower extremities165. GALC encodes galacosylceramidase, an enzyme involved in breaking down galactolipid fats in the nervous system, epithelial cells of the small intestine and colon, and kidneys166. Defects in GALC are associated with Krabbe disease, a disease featuring mobility restrictions due to damage to myelin-forming cells in the nervous system. Due to the loss of myelin, nerves in the brain cannot properly transmit signals, leading to Krabbe disease167,168. As the primary health concern of patient 3969 is peripheral neuropathy, I suggest that the variants in FLNC and GALC are contributing towards the neuropathy phenotype. Additional analysis should be done to determine whether these genetic variants interact to amplify the neuropathy in this patient. Furthermore, future directions for this patient should include continued analysis of her exome data using less stringent criteria to determine the genetic basis of her lipodystrophy.
4.2.1.6 Patient 4116
After WES and bioinformatics analysis, patient 4116 – a biological female clinically diagnosed with FPLD – had two LDLR candidate variants (c.2252G>A, p.Arg751Gln; c.2231_2232delinsAG, p.Arg744Gln) identified in her exome. Similar to patient 1088 as discussed in Section 4.2.1.3, the LDLR variants are likely contributing to the high cholesterol levels in this patient. In addition to the LDLR variants, a novel variant in the AR gene was also detected (c.1152C>G, p.His384Gln) in the patient’s exome (discussed in Section 4.2.3). Together, the LDLR and AR variants are likely contributing to the abnormal lipid profile of the patient. Future work should focus on identifying the genetic basis of the lipodystrophy phenotype of the patient. This can be done by using less stringent criteria when analysing the exome data or considering alternative genetic factors (as discussed in Section 4.8).
4.2.1.7 Patient 4665
In a biological female with FPLD (patient 4665), four candidate variants were identified from WES. Two variants were detected in ABCA4 (c.1610G>A, p.Arg537His;
104 c.2969G>A, p.Gly990Glu) and two in WRN (c.2983G>A, p.Ala995Thr; c.1149G
4.2.1.8 Patient 5662
The DNA of patient 5662, a female featuring FPLD was subjected to WES and bioinformatics processing. After analysis, a homozygous splicing variant was identified in ABCG8 (c.1412-8delinsTT). This ABCG8 splicing variant is predicted to alter the wild type splice acceptor site from multiple in silico splicing prediction tools, is considered novel in multiple control databases, and has not been previously reported in the literature.
The ABCG8 gene encodes sterolin-2, half of the protein, sterolin. In the body, sterolin is involved in eliminating fatty components of plant-based foods that cannot be used in human cells171. Mutations in ABCG8 have been identified in individuals with sitosterolemia, a condition characterized by the accumulation of plant sterols and the impaired ability to remove cholesterol from the body. Furthermore, individuals with sitosterolemia feature atherosclerosis, xanthomas, and blood abnormalities172. I propose that the ABCG8 gene is contributing to the abnormal lipid profile of the patient; however, further analysis of the exome data is required to determine the genetic cause of the patient’s lipodystrophy.
105
4.2.1.9 Patient 2025
Patient 2025 is a biological female that was clinically diagnosed with lipodystrophy. Upon review of the patient’s clinical data, it was discovered that the patient also has dermatomyositis – a rare genetic inflammatory disease causing severe myopathy, painful skin rashes, sensitivity to light and calcinosis (calcium deposits in the muscle). Furthermore, the patient suffers from severe insulin resistance and proteinuria. Due to the fact that this patient has dermatomyositis in addition to lipodystrophy, variants associated with dermatomyositis were also prioritized during exome analysis.
In this patient, three candidate variants were identified within three candidate genes: FHL1 (c.46G>T, p.Gly16Trp), ANLN (c.1205C>T, p.Pro402Leu) and AR (c.1369_1380delGGCGGCGGCGGC, p.Gly470_Gly473del). The FHL1 gene (four and a half LIM domains 1) encodes three isoforms that play critical roles in skeletal muscle and cardiac muscle movement. More specifically, FHL1A plays a key role in sarcomere assembly, FHL1B plays a role in the nuclear envelope, and FLH1C is thought to play a role in the function of skeletal and cardiac muscles173. Dominant mutations in FHL1 have been linked to reducing-body myopathy (RBM), a rare myopathy featuring the progressive weakness of the muscles, a rigid spine, and a progressive disease course174. The ANLN gene encodes anillin, an actin binding protein with a role in cell growth and migration. Variants in ANLN are causative of focal segmental glomerulosclerosis-8, a renal disease featuring proteinuria and the progressive decline in renal function175. The AR variant is discussed in Section 4.2.3.
Due to the association with myopathy, proteinuria and renal function and the severe myopathy and renal dysfunction in the patient, I suggest that the novel FHL1 and ANLN variants are contributing towards the disease phenotype of the patient. Furthermore, I suggest that the AR gene variant is contributing to the metabolic profile of patient 2025.
4.2.1.10 Patient 3011
Patient 3011 is a biological female featuring FPLD, insulin resistance, dyslipidemia, hirsutism (overgrowth of hair) and hypertriglyceridemia. From WES, I identified three
106 candidate gene variants contributing to the phenotype of the patient: LPL (c.775G>A, p.Asp259Asn), PAPSS2 (c.1114G>T, p.Val372Phe), and AR (c.170_171insGCAGCAGCA, p.Gln80_Glu81insGlnGlnGln). The LPL gene encodes lipoprotein lipase, an enzyme found within cells that line capillaries in muscles and adipose tissue. LPL plays a key role in breaking down fat into triglycerides, which are then transferred from organs to the blood through lipoproteins. Mutations in LPL have been associated with many conditions, including atherosclerosis, insulin resistance, and dyslipidemia associated with diabetes176. The PAPSS2 gene encodes 3'-phosphoadenosine 5'-phosphosulfate synthase 2, a sulfate donor co-substrate required for sulfotransferase (SULT) enzymes. These SULT enzymes catalyze many endogenous and exogenous compounds, such as drugs and xenobiotics177. Mutations in PAPSS2 are associated with brachyolmia type 4 with mild epiphyseal changes (BCYM4). Furthermore, variants in PAPSS4 have been associated with hirsutism, androgen excess and polycystic ovary syndrome, all clinical features of patient 3011178. The AR variant is discussed in detail in Section 4.2.3.
All together, I predict that the LPL, PAPPS2 and AR gene variants are all contributing to the patient’s phenotype. More specifically, it is likely that the LPL variant is contributing to the insulin resistance, dyslipidemia and hypertriglyceridemia, whereas the PAPSS2 variant is contributing to the polycystic ovary syndrome and hirsutism. The AR variant is likely also contributing to the hirsutism and involved in the metabolic profile of the patient. Further analysis is required to confirm the pathogenicity of the novel variants and identify the genetic basis of the patient’s lipodystrophy (as discussed in Section 4.8).
4.2.1.11 Patient 14318
Patient 14318 is a biological female in her teens, clinically diagnosed with FPLD. From WES and bioinformatics analysis, several candidate variants were detected. These include variants in NEUROD1 (c.170G>A, p.Gly57Glu), BSCL2 (c.1280T>C, p.Leu427Pro), APOB (c.6936_6937delinsTG, p.Ile2313Val), PCSK9 (c.137G>T, p.Arg46Leu), and PYGM (c.148C>T, p.Arg50Ter) and AR (c.185A>T, p.Gln62Leu; c.1369_1380delGGCGGCGGCGGC, p.Gly470_Gly473del).
107
NEUROD1, encoding the neurogenic differentiation 1 protein, is a transcription factor involved in cell type determination during development. NEUROD1 is also important in the regulating insulin gene expression. Mutations in NEUROD1 are associated with mature-onset diabetes of the young 6 (MODY6) and autosomal dominant diabetes mellitus179. The BSCL2 gene encodes seipin, an endoplasmic reticulum protein involved in late pre-adipocyte differentiation and lipid droplet formation180. Mutations in BSCL2 are associated with CGL2, as discussed in Chapter 1. APOB encodes apolipoprotein B, the main apolipoprotein on low density lipoproteins (LDLs) and chylomicrons181. Defects in APOB are associated with autosomal dominant hypercholesterolemia. The prohormone convertase 9 (PCSK9) gene encodes a serine protease involved in the elevation of plasma LDL cholesterol and reduction of hepatic and extrahepatic LDL receptor levels182. Mutations in PCSK9 are causative of autosomal dominant hypercholesterolemia, 3, featuring significantly high cholesterol levels. The glycogen phosphorylase, muscle associated (PYGM) gene or the muscle isoform of glycogen phosphorylase is involved in the breakdown of glycogen during glycogenolysis183. Mutations in PYGM are associated with glycogen storage disease type V (GSDV), a disease caused by the impaired breakdown of glycogen. Due to this defective enzyme being unable to break down glycogen, muscle cells cannot produce energy and become easily fatigued184. The AR variant is further discussed in Section 4.2.3.
Together, I suggest that the variants within NEUROD1, BSCL2, APOB, PCSK9, PYGM and AR are all contributing to the severe lipodystrophy phenotype of this young patient. Further research is required to determine the pathogenicity of the novel variants and determine whether these variants work synergistically (see Section 4.8 for details).
4.2.1.12 Patient 4194
In patient 4194, a female clinically diagnosed with acquired lipodystrophy, a variant in the WRN gene (c.243T>G, p.Phe81Leu) was detected from WES. Variants in the WRN gene are associated with Werner syndrome or adult progeria, characterized by dramatic aging, abnormal fat deposition, diabetes mellitus, diminished infertility and atherosclerosis185. More specifically, patients with Werner syndrome experience fat loss
108 from the extremities with excess fat in the truncal region, similar to patients with FPLD170. As Werner syndrome is generally caused by homozygous variants, I suggest that this heterozygous variant is causing the milder phenotype seen in this patient.
As patient 4194 has a form of acquired lipodystrophy generally caused by environmental effects, I also propose the possibility that this heterozygous variant in WRN could have been activated by environmental factors, leading to the onset of lipodystrophy in this patient. Note that this patient was not processed on the LipidSeq™ gene panel prior to WES.
4.2.1.13 Patient 1120
After identifying a CREB3L3 duplication from LipidSeq™ targeted sequencing, the DNA of patient 1120 was subjected to WES to investigate whether additional neighbouring genes were also duplicated. From WES data and CNV analysis, the duplication in patient 1120 was found to span six genes: protein inhibitor of activated STAT 4 (PIAS4), zinc finger and BTB domain containing 7A (ZBTB7A), mitogen-activated protein kinase kinase 2 (MAP2K2), CREB3L3, SIRT6, and ankyrin repeat domain 24 (ANKRD24). Interestingly, one of the duplicated genes is the SIRT6 gene, encoding the sirtuin-6 protein.
The sirtuin-6 or SIRT6 protein is a protein deacetylase and mono-ADP ribosyltransferase enzyme activated under stress conditions186. SIRT6 is a major player in many pathways associated with aging, such as glycolysis, lipid metabolism, inflammation and DNA repair187. Mutations in SIRT6 are a major cause of progeroid diseases, which feature lipodystrophy, kyphosis (excessive convex curvature of the spine), neurodegeneration, immune deficiency, and metabolic defects188. Specific to metabolism, the SIRT6 protein is considered the epigenetic gatekeeper of glucose metabolism, playing a key role in glucose homeostasis. This role was demonstrated in SIRT6 knockout mice, where the complete loss of subcutaneous fat and insulin hypersensitivity led to early mortality189,190. As our patient harbours a duplication of SIRT6 in addition to CREB3L3, I propose that
109 the lipodystrophy phenotype and metabolic abnormalities featured by this patient are caused by this large CNV event.
4.2.2 Extreme early-onset obesity
The DNA of five children with extreme early-onset obesity were subjected to WES. Candidate variants were identified in two patients from WES and bioinformatics processing.
4.2.2.1 Patient 15544
In a male child with early-onset obesity, features of autism spectrum disorder, developmental delay and overgrowth, candidate variants were detected in three genes: BLK (c.244G>C, p.Gly82Arg), MC4R (c.751A>C) and AR (c.204_205insA, p.Gln69fs). Further discussion on the AR gene is in Section 4.2.3.
The BLK gene encodes a non-receptor tyrosine kinase involved in cell proliferation and differentiation. Playing a role in B-cell receptor signaling and development, this protein is also known to stimulate insulin synthesis and secretion191. Mutations in BLK are associated with mature-onset diabetes of the young (MODY11), characterized by autosomal dominant diabetes and insulin-dependence192. As discussed in Chapter 1, the MC4R gene is a member of the melanocortin receptor family that interacts with adrenocorticotrophic hormones. Defects in this gene are known to cause autosomal dominant obesity. The AR variant is discussed further in Section 4.2.3. Together, I suggest that the defects in BLK, MC4R and AR are contributing to the extreme early-onset obesity phenotype of this patient by modulating normal lipid metabolism.
4.2.2.2 Patient 15858
In a female child featuring extreme early-onset obesity, hyperphagia and intellectual disability, a novel heterozygous missense variant (c.2645T>C, p.Ile882Thr) was identified within the KMT2C gene. KMT2C encodes the lysine-specific methyltransferase 2C, a histone methyltransferase that regulates gene transcription through modification of
110 chromatin structure. Particularly, KMT2C mediates the mono- and tri-methylation of histone H3 at lysine 4193. In 2012, Kleefstra et al. discovered a dominant mutation in KMT2C as causative for Kleefstra syndrome-2, a neurodevelopmental disease characterized by delayed development, intellectual disability, childhood obesity, and prominent facial features194. As the description of intellectual disability, obesity, and facial features (hypertelorism, synophrys, carp mouth with macroglossia) of Kleefstra syndrome matches the phenotype of the patient, I suggest that this child has a form of Kleefstra syndrome-2195.
In addition to the dominant KMT2C variant, additional variants were identified in the Bardet-Biedl Syndrome 10 (BBS10) and SET domain containing (lysine methyltransferase) 8 (SETD8) gene. As variants in BBS10 are associated with Bardet- Biedl syndrome and variants in SETD8 are associated with adipogenesis and rodent obesity, I suggest that these gene variants are also modulating the phenotype and causing the extreme overgrowth and obesity features of this patient196,197. Further studies (such as those outlined in Section 4.8) are necessary to confirm the pathogenicity of the KMT2C variant and determine whether the SETD8 or BBS10 variants are involved in the disease phenotype of this patient.
4.2.3 Lipodystrophy-obesity connection
With lipodystrophy and obesity, despite the fact that they sit on opposite ends of the spectrum (excess versus absent adiposity), they share many metabolic complications including diabetes mellitus, hypertriglyceridemia and hepatic steatosis. Furthermore, although both disorders are widely heterogeneous in terms of underlying genes and pathways, the diseases both feature severe insulin resistance, suggesting a commonality between the two disorders and the potential for shared genetic variation198. To determine whether there was a connection between lipodystrophy and obesity, I analyzed all exomes for shared variation.
Altogether, over one million variants were identified in the 25 rare metabolic disease exomes of interest. From the 25 exomes, ultra-rare androgen receptor gene (AR)
111 mutations were detected in 20%. These variants include missense mutations in two familial partial lipodystrophy females, small deletions in three insulin resistant partial lipodystrophy females, and a frameshift in a male child with extreme early-onset obesity. Of these identified variants, four have never been recorded in the literature. Due to the burden of ultra-rare AR mutations in these rare metabolic phenotypes, I suggest that the AR gene may be the common link between lipodystrophy and extreme early-onset obesity.
The AR gene encodes a DNA-binding transcription factor involved in the regulation of gene expression. Activated by androgens, these androgen receptors allow the body to appropriately respond to these hormones, playing critical roles in the reproductive, muscular, skeletal, cardiovascular and central nervous systems. In the literature, dysfunctional androgen levels have been known to predispose individuals to metabolic abnormalities. More specifically, hyperandrogenism in women has shown to predispose to T2D, and hypoandrogenism in men has been linked to insulin resistance and metabolic syndrome199,200. Furthermore, androgen receptor-deficient mice have been shown to develop obesity and metabolic dysfunction, further demonstrating the association between aberrant AR and metabolic disease features201. Due to the high frequency of AR variants in this cohort, I suggest that AR mutations are contributing to these metabolic phenotypes by modulating the metabolic dysfunction in these patients.
Although these effects on metabolic syndrome are well established, our study is the first to suggest a direct association between AR mutations, lipodystrophy and obesity. In addition, because the burden of ultra-rare AR variants is specific to the N-terminal domain (NTD), I suggest an important role of the NTD in metabolic function. Identifying a common genetic factor for both lipodystrophy and extreme early-onset obesity can allow for the understanding of the pathways controlling insulin sensitivity and glucose uptake and allow for the development of therapeutic interventions for adipose tissue disorders. In the future, I suggest assessing all lipodystrophy and obesity patients for AR gene variation, and functional studies on the AR protein (additional details in Section 4.8).
112
4.3 Whole-exome sequencing of rare disease families
For families with a history of rare disease referred to the Blackburn Cardiovascular Genetics Laboratory (namely, BDA1 and cerebral atrophy-like), WES was performed on the DNA of the proband followed by bioinformatics processing and variant curation. From thousands of variants, one candidate variant was identified for each case. The successful identification of candidate variants for both cases highlights the capability of WES in identifying novel variants. Notably, the BDA1 case demonstrates the ability of WES to clarify the genetic basis of “cold cases”.
4.3.1 Brachydactyly type A1A
Fifteen years ago, a 31-year-old female from Ontario was referred for medical consultation at Dr. Hegele’s clinic for a lifelong history of short stature and shortening of all digits of the upper and lower extremities. After discussion regarding her family history, it was discovered that the brachydactyly phenotype co-segregated in her family. After Sanger sequencing of all known brachydactyly-associated genes was performed at the Blackburn Cardiovascular Laboratory, the family remained genetically unexplained and the case was left untouched for 15 years. One patient sample was recently processed using WES and analyzed for variants of interest. In this family, we report autosomal dominant BDA1, characterized by short stature and shortened digits. Affected family members carry a heterozygous in-frame insertion in IHH, designated c.285_287dupGAA, p.Glu95_Asn96insLys, explaining their brachydactyly phenotype. This IHH variant is predicted to exert a damaging effect on protein function from multiple in silico prediction tools, co-segregates with disease status in the family, is considered novel in multiple control population databases, and has not been previously reported in the literature.
A A version of this section has been submitted for publication83. 113
4.3.1.1 IHH and brachydactyly type A1
Previously, a genetic basis of BDA1 had been identified, with causative mutations harboured in IHH77,202. Located at the chromosomal position 2q35-36, IHH encodes the IHH protein, a member of the hedgehog family of proteins. Along with sonic and desert hedgehog, IHH acts as a signaling molecule that regulates patterning processes in both vertebrate and invertebrate development203. In vertebrates, the family is involved in limb polarity and chondrogenesis, with IHH playing a critical role in human skeletal development. IHH mutants show decreased chondrocyte maturation and proliferation, and the failure of osteoblast development in endochondral bones, highlighting the role that IHH plays in bone formation and cartilage differentiation204. The connection between skeletogenesis and BDA1 has been solidified in Ihh-/- mice studies, where the loss of IHH signaling leads to reduction defects in the forelimbs and digits205.
Several mutations have been identified in the IHH gene. Dominant mutations in IHH are causative of BDA1, whereas recessive mutations in IHH have been linked to an extended phenotype, acrocapitofemoral dysplasia, which features short stature, short limbs and cone-shaped epiphyses206. All mutations responsible for BDA1 have been limited to the N-terminal active fragment of IHH79. These mutations have been restricted to codon positions 95, 100, 131 and 154, with ours as no exception. The prevalence of BDA1 mutations at these codon positions suggests they are mutation hotspots, with high conservation of these amino acid positions existing between humans and species including mice, chicken, frog and zebrafish207. This feature solidifies the importance of the N-terminal region in bone development and differentiation, especially since mutations causing acrocapitofemoral dysplasia differ and are exclusively at the distal N and C terminal regions.
The IHH protein works through a feedback control mechanism. IHH binds to the PTC1/patched receptor, which in turn, binds to SMO/smoothened to activate the Gli complex of transcription factors. From there, these transcription factors continue to signal and regulate downstream genes affecting patterning. Because IHH acts later in
114 endochondral bone formation, mutations in IHH lead to the delay in bone growth and subsequent digit abnormality. Studies on IHH-null mice uncovered the association between IHH mutations and BDA1, as loss of IHH signaling leads to shortened forelimbs and abnormal digits. We propose that our novel variant is acting in the same manner, leading to digit reduction and shortened stature. More specifically, although our variant is the first insertion identified in BDA1, we suggest that our variant acts similar to the p.Glu95Lys missense mutation identified by Ma et al., where the mutation results in the conversion of a negatively charged area to a positive area in a critical calcium-binding groove207. In turn, this leads to instability of the N-terminal fragment, and the potential increased intracellular degradation through the lysosome.
4.3.2 Cerebral atrophy-like
In 2013, our laboratory used homozygosity mapping and WES to identify the genetic basis of a novel pediatric neurodegenerative disorder, autosomal recessive cerebral atrophy. This phenotype is caused by a missense variant (c.995C>T, p.Thr332Met) in the TMPRSS4 gene. Recently, our laboratory was referred a second case from India with a high resemblance to the initial autosomal recessive cerebral atrophy case. More specifically, the patient displayed microcephaly and cerebral atrophy. Using Sanger sequencing of the region containing the previously identified TMPRSS4 variant, I sought to determine whether this phenotype shared the same genetic basis. When no variants were identified from Sanger sequencing, I pursued WES to identify novel disease- associated variants. From WES and bioinformatics processing of the proband’s exome, I identified a variant in the kinetochore scaffold 1 gene (CASC5; c.6485A>G, p.Glu2162Gly) matching the phenotype of the proband.
4.3.2.1 CASC5 and primary microcephaly-4
During cell division, genetic material must be accurately transmitted from parent to daughter cells. To ensure this, eukaryotes couple the movement of spindle microtubules to replicated chromosomes through a multi-protein attachment complex termed the kinetochore. The kinetochore is a disc-shaped protein that holds the sister chromatids
115 together during cell division. In total, kinetochores perform four functions: 1) create a sturdy interface with centromeric chromatin, 2) contribute a microtubule-binding interface, 3) generate the spindle assembly checkpoint, and 4) correct improper attachments208. Even the simplest kinetochores consist of over 19 proteins, with all proteins highly conserved among eukaryotes. One such protein that localizes to the kinetochore is the kinetochore scaffold 1 protein, encoded by the CASC5 gene. This protein is pertinent for two events: the accurate attachment of centromeres to the microtubules, and spindle-assembly checkpoint signaling209.
Microcephaly, Primary Hereditary (MCPH) is a neurodevelopmental disorder featuring intellectual disability coupled with microcephaly from birth, where the microcephaly is caused by the reduction of the cerebral cortex. To date, several causative genes have been identified, including: microcephalin, CDK5 Regulatory Subunit Associated Protein 2 (CDK5RAP2), Abnormal Spindle Microtubule Assembly (ASPM), Centrosomal Protein 135 (CEP135), Centrosomal Protein 152 (CEP152) and CASC5210. Although each of these genes play a unique role in the pathogenesis of MCPH, each is predicted to cause MCPH by disturbing mitotic spindle orientation, causing premature chromosomal condensation, or affecting microtubule dynamics211.
Specifically, variants in the CASC5 gene cause microcephaly 4, primary, autosomal recessive – a form of MCPH featuring brain reduction and mental handicap209. Although the pathophysiological mechanism has not been resolved, it is thought that variants in CASC5 affect the ability for CASC5 to bind the mitotic spindle checkpoint protein, BUBR1, an essential component of the mitotic checkpoint212. Variants in BUBR1 are associated with Mosaic Variegated Aneuploidy (MVA) Syndrome 1, a phenotype attributed to a mitotic chromosomal segregation defect leading to aneuploidy213. Due to the required direct interaction between CASC5 and BUBR1, it is suggested that defects in CASC5 are pathogenic by way of a common mechanism involving chromosome missegregation. As our variant is in the same exon as known, classified microcephaly-4 variants, I suggest that our variant acts in a similar fashion, causing chromosome missegregation, and allowing premature entry into mitosis.
116
4.4 Whole-exome sequencing for CARE for RARE and FORGE Canada projects
For families ascertained through clinicians as part of the CARE4RARE and FORGE Canada projects, WES was performed on the DNA of the probands followed by bioinformatics processing and variant curation. From thousands of variants, candidate variants were narrowed down for eight of the 11 total cases. The successful identification of candidate variants for these rare disease cases demonstrates the utility of WES in identifying novel variants. Furthermore, as this was the effort of numerous clinicians and scientists, it emphasizes the importance of collaboration in the discovery of the genetic basis of rare diseases. Herein, I discuss two cases, microcephaly-ichthyosis and widow’s peak syndrome, and briefly summarize the project.
4.4.1 Microcephaly-ichthyosis in the Old Order Amish
The Old Order Amish are a North American religious group from Anabaptist origins. In Canada, the majority of the Old Order settlements are within Ontario, mainly in the Norfolk and Bruce counties. Due to social isolation, the founder effect (loss of genetic variation in an area established by a small number of individuals), and the many genetic bottleneck events in Amish history, there is a high incidence of particular genetic disorders among the Old Order Amish214. This is due to the autozygosity – chromosomal segments or alleles that are identical-by-descent due to consanguineous mating – often present in the Old Order Amish population.
In an Old Order Amish family with a history of microcephaly and ichthyosis, WES, bioinformatics processing and variant detection was performed. From WES on the DNA of the proband, a novel frameshift insertion was identified in the VPS52 gene (c.57delG, p.Thr20fs). This variant results in a premature stop codon 30 amino acids from the start site, ultimately leading to deletion of 90% of the protein. Furthermore, this frameshift variant co-segregates with disease status in the pedigree, is predicted to be pathogenic from in silico prediction tools, is not present in any disease database, and has not been reported previously in the literature. This variant is also harboured within an autozygous
117 block in the family, 6p22.2p21.2. Due to the severity of the frameshift and the association of the gene defects with the phenotype, I propose that the VPS52 variant is causing the recurring microcephaly-ichthyosis phenotype in this family.
The VPS52 gene encodes the vacuolar protein sorting-52 protein, a component of the Golgi associated retrograde protein (GARP) complex. The GARP complex is a large complex involved in the retrograde transport of proteins from endosomes to the trans- Golgi network215. Moreover, the GARP complex is a tetrameric complex consisting of four proteins, VPS51, VPS52, VPS53 and VPS54. These four proteins tether together to fulfil retrograde vesicle trafficking.
Vps52 acts to support the growth and pluripotent differentiation of the embryonic ectoderm through cell-cell interactions in extraembryonic tissues. Null mutations in Vps52 have been shown to cause early embryonic lethality, ectoderm death, and gastrulation defects in murine models216. Furthermore, Vps52 knockouts result in the complete loss of GARP function215. Due to the similarity between the consequences of null Vps52 and the microcephaly-ichthyosis phenotype in this family, I predict that the variants in VPS52 are causative of the disease. More specifically, as the ectoderm is responsible for skin formation and there is embryonic lethality in the affected individuals, I suggest that the VPS52 frameshift variant is causative of the microcephaly-ichthyosis lethal phenotype. Functional studies are required to confirm that the variant is indeed causing the microcephaly-ichthyosis phenotype in this family.
4.4.2 Widow’s peak syndrome
Widow’s peak syndrome is an ultra-rare X-linked dominant disease featuring a prominent widow’s peak (pointed frontal hairline), facial abnormalities and skeletal anomalies. Described by Kapur et al. in 1989, widow’s peak syndrome has only been reported once previously in the literature217. Through CARE4RARE, we report a second case of widow’s peak syndrome with matching features, namely, a pointed frontal hairline, epiphyseal dysplasia (disorder of bone and cartilage development affecting the long bones or epiphyses in the arms and legs), rotated ears, bilateral ptosis (drooping of both
118 eyelids) and knee joint issues. From WES, bioinformatics processing and variant detection, I report a novel splicing variant in KDM6A (c.2703-6_2703-5delTT), predicted to be pathogenic from in silico prediction tools. Using Sanger sequencing, this variant was found to co-segregate with disease status in the family.
Mutations in KDM6A are causative of Kabuki syndrome-2, a congenital syndrome featuring intellectual disability, facial anomalies (long palpebral fissures and eversion of the eyelids), prominent ears, scoliosis, and radiographic abnormalities218,219. Due to the overlapping clinical features of widow’s peak syndrome and Kabuki syndrome-2, I suggest that this family features a novel disease overlapping with these syndromes. Furthermore, I propose a potential link between these exclusive disorders. Due to the presence of the variant in a polyT region, it is necessary to quantitatively confirm the KDM6A variant. SNaPshot Multiplex sequencing was unsuccessful in confirming the variant, therefore, it is necessary to perform reverse transcription polymerase chain reaction (RT-PCR) in the future. To date, RNA extraction has been done and RT-PCR is ongoing.
4.4.3 CARE for RARE and FORGE summary
In summary, eight of 11 CARE4RARE and FORGE Canada Cases in the Blackburn Cardiovascular Genetics Laboratory were solved using WES and bioinformatics analysis, highlighting the utility of WES in gene discovery. The cases with candidate variants identified are microcephaly-ichthyosis, autosomal dominant isolated cryptophthalmos, widow’s peak syndrome, amyoplasia, metaphyseal chondrodysplasia, craniosynostosis, heterotaxy disorder, and craniorachischisis. Each aforementioned case requires functional assessment in order to confirm the pathogenicity of the variants of interest. For the remaining cases, namely, Angelman-like syndrome, dystonia, ataxia and intellectual disability, and osteopetrosis, it is necessary to consider factors beyond the exome.
4.5 Gene enrichment analysis
From PANTHER computing and analysis on data from patients with lipodystrophy and extreme early-onset obesity, two patients with partial lipodystrophy were found to
119 harbour variants with significant overrepresentation in specific biological pathways. Namely, patient 14318 had overrepresentation of genes involved in O-glycan processing and tissue homeostasis, and patient 11618 had overrepresentation of genes involved in interferon-gamma-mediated signaling (PANTHER outputs in Appendix IV).
The O-glycan processing pathway is involved in adding a carbohydrate or carbohydrate derivative to an O-linked residue to form a core O-glycan structure. As these genes are fundamental, defects in this pathway often result in severe metabolic perturbations or embryonic lethality220. For patient 14318, there was a 5.11-fold enrichment of genes involved in this biological process. Therefore, variants in genes involved in O-glycan processing were considered for association with lipodystrophy. From this gene list associated with O-glycan processing, most of the genes involved were those belonging to the mucin gene family. As mucin genes are highly polymorphic with variable number tandem repeat (VNTR) length polymorphisms, these variants were excluded as they are likely unassociated with the lipodystrophy in this patient221,222.
Genes involved in maintaining tissue homeostasis are those that regulate somatic stem cell activity223. In patient 14318 there was a 3.35-fold enrichment of genes involved in this biological process. For the list of overrepresented genes in patient 14318 involved in tissue homeostasis, each gene was examined for association with lipodystrophy. As there was no literature supporting an association between each gene and/or variant with lipodystrophy, these genes were not prioritized as candidates. Although there is no available literature supporting these genes now, future work should continue to investigate the variants within these genes for their potential contribution to lipodystrophy.
For patient 11618, genes involved in interferon-gamma mediated signaling were overrepresented. More specifically, there was 6.54-fold enrichment of the genes in this pathway. As most of these genes were human leukocyte antigen (HLA) genes with a high degree of polymorphism, they were deemed unassociated with the lipodystrophy in this patient.
120
In sum, although PANTHER was helpful in identifying overrepresented biological processes in these patients, no gene lists generated from PANTHER are predicted to contribute to the partial lipodystrophy phenotypes of these patients.
4.6 Clinical utility of LipidSeq™ and whole-exome sequencing
From the utilization of the LipidSeq™ resequencing gene panel, 40% of a 153-person lipodystrophy cohort was, at least partially, genetically explained. From WES, 65% of lipodystrophy patients, 40% of extreme early-onset obesity patients, two rare disease cases (brachydactyly type A1 and cerebral atrophy-like), and 73% of CARE4RARE/FORGE Canada cases had candidate variants identified. Together, these statistics indicate the clinical utility of NGS, especially in the context of variant discovery in rare disease research.
4.6.1 Comparison of LipidSeq™ and whole-exome sequencing to whole-genome sequencing
As some cases remained genetically unexplained following the implementation of LipidSeq™ and WES, it begs the question whether WGS would have been preferred. Here, I argue that although WGS is capable of sequencing almost all three-billion base pairs of the human genome, compared to 2% with WES and even less with targeted sequencing, LipidSeq™ and WES are still superior to WGS for rare disease research. With WGS, there are several implications affecting clinicians, researchers and patients. These implications refer to data yield, interpretation and ethics.
Although the diagnostic yield is greater with WGS, there are several issues concerning amassing such a wealth of data. In terms of computational storage, it is impractical for most laboratories to store such data. Furthermore, the processing of the data require high computational and statistical power, often unavailable at a cost-efficient rate. As large cohorts would need to be processed and screened to result in a clinical outcome, it is unfeasible for most laboratories to advance towards the sole use of WGS. In addition, the
121 body of literature regarding intergenic regions and their role in disease is sparse. Without an abundance of information on these regions or a universal standard for their interpretation, it is difficult for providers to assess risk without creating false reassurance or needless worry. Last, there are several ethical implications regarding the availability of such data. Without distinct laws in place on genetic discrimination, issues may arise when patients with WES data try to obtain insurance. Additionally, with an almost guaranteed likelihood of incidental findings, there is apprehension to progress towards WGS. As WGS has shown to only offer limited clinical utility compared to WES (only 3% increased detection in a recent study), WES is recommended over WGS224.
4.7 Limitations of the project
Although I demonstrated the clinical utility of NGS in solving or clarifying the molecular basis of rare disorders, there are limitations and study caveats to consider. These caveats are divided to those specific to this project, and those specific to the use of targeted panels and WES technology.
4.7.1 Study considerations
1) Acquired lipodystrophy cases
In this study, I relied on an assumption that all the lipodystrophy cases were genetic. For many patients in our lipodystrophy cohort, it is likely that some of these lipodystrophy cases are acquired with no inherited component. The presence of acquired lipodystrophy cases was demonstrated when it was determined that four patients subjected to WES had acquired lipodystrophy. Acquired lipodystrophy refers to lipodystrophy that sporadically appears during a random point in life. As up to 70% of human immunodeficiency virus (HIV)-infected individuals on highly active antiretroviral therapy (HAART) therapy report to have HIV-associated lipodystrophy, it is likely that some forms of lipodystrophy are drug-related or environmental225. The study of these cases may have caused an underestimation of the clinical utility of LipidSeq™ and WES. In the future, it is necessary to consider these cases separately in order to refrain from any bias in the results.
122
2) Limited clinical information
For some of the cases listed in this MSc Thesis, clinical information was limited. Moreover, some of the cases were referred from external physicians to the laboratory leading to inconsistencies in clinical diagnosis. As additional clinical information would have streamlined the variant prioritization process (i.e. if information was available on mode of inheritance, secondary complications, etc.) and potentially changed the outcome of cases, this was an inherent limitation of the study.
3) Lack of trios and families
For many of the pediatric cases and those affecting multiple members in a family, one frequent challenge was the inaccessibility of patient samples. Regardless of whether it was due to lack of proximity of the patients or lack of willingness to participate in genetic research, the inaccessibility of patient samples made it difficult to confirm variants, co- segregation and pathogenicity. To account for the unavailable DNA samples, I used numerous databases; however, it would have been beneficial to ascertain these samples to perform trio and family analysis.
Furthermore, as rare diseases are so uncommon it can often be more challenging to study these diseases due to small sample size. In this study, some cases were limited to a single affected individual. This n-of-1 problem also contributed to the difficulty in confirming variants and pathogenicity.
4.7.2 General methodological limitations
In general, there are numerous limitations with targeted sequencing and WES. With these methods, several genetic factors are not considered. These include large rearrangements, mitochondrial gene mutations, epigenetic factors, uniparental disomy, environmental effects, and mutations in repetitive and GC-rich regions. As these were not investigated, I may be lacking all the information necessary to genetically explain each patient or rare disease case.
123
4.8 Future directions
From this MSc Thesis, there are several considerations in terms of future directions. These include those specific to this project and those necessary for the rare disease research field. These are separated into their respective categories below.
Future work for the project
From here, future work for this project will require focus on confirming the WES results and ensuring the disease-causing criteria for candidate variants are fulfilled. For cases with a candidate variant or multiple variants identified, validation and co-segregation analyses should be performed if not done so already. For all candidate CNVs identified, secondary validation using an independent method (i.e. Sanger sequencing or CytoScan™ HD) should be done. Ultimately, functional studies are required to confirm the pathogenicity of each CNV in causing the disease of interest. These studies are recommended for all novel variants, particularly the CARE4RARE and FORGE Canada cases, and are listed in the following sub-section. For those cases in which a candidate variant (or multiple candidate variants) was not identified, the exome data should be revisited and re-evaluated using less stringent criteria (i.e. higher minor allele frequencies and lower read depth stringency) and other factors, as discussed in the following section, should be considered.
Functional assessments to be considered for this project
For those cases in which a candidate variant was identified using NGS – namely the lipodystrophy, extreme early-onset obesity, brachydactyly, cerebral atrophy-like and solved CARE4RARE/FORGE Canada cases – it is suggested that functional assessments be undertaken to confirm the validity and pathogenicity of the candidate variants. These experiments may include, but are not limited to the following:
1) Western blotting
A Western blot is an analytic method used in molecular biology to identify specific protein molecules from a mixture of proteins extracted from cells. By separating based on
124 size, transferring to a solid support, and using a primary and secondary antibody to visualize a target protein, Western blotting can elucidate the molecular weight of a protein of interest226.
For this project, Western blotting can be used as a first tier assessment of whether a protein product is present or absent. More specifically, Western blotting can allude to whether the defective gene results in abnormal protein expression. If Western blotting demonstrates a change in expression, additional studies may be pursued to determine if the protein product is dysfunctional.
2) mRNA quantification (RT-qPCR)
Reverse transcription quantitative polymerase chain reaction (RT-qPCR) is a technology used to analyze RNA expression. By converting labile RNA to more stable complementary DNA (cDNA) using a reverse transcriptase and using real-time fluorescence to quantify the quantity of DNA present at each cycle during PCR, RT- qPCR can be used for measuring gene expression and copy-number variation227. In this study, RT-qPCR can be used to determine differences in mRNA expression between patients with genetic variants and control samples. Additionally, this technique can allow for independent confirmation of NGS results228.
3) Co-immunoprecipitation
In a cell, two or more proteins can interact and lead to biological effects. Co- immunoprecipitation (co-IP) is a common method used to analyze protein-protein interactions. Briefly, in co-IP the protein of interest is isolated using a specific antibody, and interacting partners are identified by subsequent Western blotting229. In this project, co-IP may be a useful technique in determining AR protein interactions. Furthermore, with the lipodystrophy patients harbouring variants in multiple genes, co-IP may be useful in elucidating protein interactions.
125
4) Molecular studies
In molecular biology, molecular studies and model systems are common methods used to study the biological consequences of the genetic variation underlying human diseases. These studies may include in vitro assays, ex vivo studies, or in vivo models.
In vitro assays are those used to determine whether gene products are defective and/or disrupt downstream pathways. These assays typically introduce the variant into the DNA of an artificial system to assess the biological effects on protein function and connecting pathways. Ex vivo studies are those that are generally performed on extracted patient tissues. Experiments to determine gene expression or protein interactions are pursued with patient-derived cells to investigate the pathogenicity of a candidate variant. In vivo experiments are those done within a model system. Common model organisms include Drosophila melanogaster (fruit flies), Caenorhabditis elegans (roundworms), Danio rerio (zebrafish) and mus musculus (mice). Model organisms are an efficient and effective strategy, as you can manipulate the genome of the animal and investigate the resultant phenotype.
In this project, molecular studies would be useful to confirm that the novel candidate variants discovered are indeed pathogenic.
Further considerations for the project
For those cases in which a candidate variant was not identified – namely Angelman-like syndrome; osteopetrosis; dystonia, ataxia and intellectual disability; remaining lipodystrophy cases; and the remaining extreme early-onset obesity cases – it is necessary to consider other genetic factors or determinants of disease. Here I list some avenues that are being pursued, and others that are options for the future:
1) Mosaicism
Mosaicism describes a situation where different cells in an individual carry a distinct number of chromosomes or chromosomal arrangements. This is demonstrated as the
126 presence of two genotypes in a single individual from a single egg230. Mosaicism is often the cause of sporadic disease in affected individuals with unaffected parents231.
In one study, I took mosaicism into account when analysing the LipidSeq™ results of a child with prenatal hypoglycemia. This child could not be explained solely by a heterozygous mutation in KCNJ11. After consideration of mosaicism, it was determined through surgery and DNA testing that the child harboured somatic ABCC8 mutations in her pancreas. Together, the KCNJ11 and ABCC8 variants explained her phenotype.
2) Splicing
Splice variants play a central role in the diversification of genomes and in cellular function. Furthermore, splice sites are associated with disease states and may drive disease phenotypes232. As exonic regions were prioritized more in this study, it is necessary to retroactively consider splicing variants, especially those more distal to the exons.
Recently, my laboratory began a collaboration with Dr. Brendan Frey of the University of Toronto in order to classify splice variants and use algorithms to predict the pathogenicity of each splice variant. Continued work on understanding these splice region variants and their contribution to disease will be pursued in the future.
3) Chromosomal rearrangements
Chromosomal rearrangements involve large structural changes including deletions, duplications, inversions and translocations. As the DNA is sheared prior to WES and the WES kit only captures ~150-bp reads, it is necessary to consider cytogenetic techniques to determine whether chromosomal rearrangements may be involved.
4) Regulatory regions
Regulatory regions are one of the mechanisms through which protein levels are controlled. Regulatory regions include promoters, enhancers, silencers and insulators233. As much of the regulatory content is harboured within intergenic DNA not sequenced through WES, it is imperative that the sequence of these regions be considered.
127
5) Digenic disorders
Digenic disorders refer to those diseases where mutations on two genes interact to cause the phenotype234. In this MSc Thesis, I consistently use knowledge of candidate genes and protein-protein interactions in order to consider the possibility of digenic inheritance. Future work will continue to explore the prospect of digenic inheritance by keeping up with current literature and continually checking for newly elucidated interactions between candidate genes.
6) Polygenic disorders
Polygenic diseases are those caused by the contribution of numerous distinct or interacting genes53. Generally, in these disorders each variant contributes a small-to- moderate effect on the phenotype, cumulatively causing the disease. To determine whether the genetic basis of any of the unsolved cases are polygenic, it would be necessary to perform a GWAS to identify genetic loci associated with the disease. From there, it would be possible to develop a polygenic risk score – a metric that summarizes all genome-wide genotype data to predict the genetic risk of a disorder – to determine risk for disease235.
7) Matchmaker Exchange
Due to the scarcity of rare diseases and the small datasets in each laboratory for each rare disease case, it is necessary for data sharing in the research community. The Matchmaker Exchange (MME) platform was designed to provide a robust approach to gene discovery through the creation of a network connecting databases of rare phenotypes and genotypes using a programming interface236. Put simply, MME is a platform allowing clinicians, physicians and patients to connect with the hope for serendipitous occasions where two investigators learn that they share similar rare disease cases (i.e. cases with similar features or symptoms). So far, the Angelman-like syndrome case has been input into MME, with other CARE4RARE and FORGE Canada cases to follow if necessary.
128
8) Epigenetics
The term “epigenetics” refers to a change in gene expression without a change in DNA sequence. These modifications in gene expression may be through changes in methylation or acetylation. As epigenetics has been shown to play a large role in phenotypic traits and disease, it is necessary to consider epigenetic mechanisms of disease. In the future, it may be necessary to explore epigenetic changes. For example, future work could include the use of bisulfite genomic sequencing – a method to detect changes in DNA methylation through the conversion of genomic DNA with sodium bisulfite – to evaluate the epigenetic landscape of each unsolved disease.
Future directions for the rare disease research field
For the rare disease research field, there is an ample amount of work that needs to be done. Three main points that should be focused on are: 1) the standardization of variant interpretation and analysis; 2) the conversion of all data to open-source; and 3) the increase in awareness of rare diseases. With candidate variant interpretation, it is necessary for all clinicians and researchers to conform to a standard set of guidelines to ease communication and promote collaboration. In this study, I considered the ACMG standards and guidelines for variant interpretation126. I suggest the adoption of these guidelines across the field to 1) promote a universal standard of variant interpretation and 2) reduce any possible contradictions regarding variant interpretation. I also encourage that all data be open-source and accessible. As rare diseases are extremely difficult to study due to small sample sizes and low statistical power, it is necessary that all investigators make their data publically available to allow for further and faster advancements within the field. Last, I advocate for increased awareness of rare diseases. As individuals with rare diseases face a diagnostic odyssey, it is necessary to increase the awareness of these diseases to pave the way towards the end of the diagnostic odyssey for these patients. By raising awareness with policy makers, researchers, physicians and the public, it may translate to greater research funding and research interest, more robust diagnoses in the clinic, and ultimately, the elucidation of molecular mechanisms and potentially, novel treatments or cures in the future.
129
4.9 Conclusions
NGS technologies, including targeted resequencing panels and WES, are highly robust, efficient and cost-effective approaches in the diagnosis of rare disorders. In this MSc Thesis, I have effectively achieved my goal: to demonstrate the utility of NGS in rare disease research, the laboratory and the clinic, and identify a molecular basis for rare disease patients and families of interest. More specifically, I have fulfilled my aims to apply NGS technologies to detect genetic variants and CNVs, identify rare variants underlying disease phenotypes, determine the functional relevance of these variants using in silico tools, and perform variant validation studies to determine whether the variants co-segregate with disease status in families.
More specifically, by processing 153 patients clinically diagnosed with lipodystrophy through the LipidSeq™, a custom gene panel used for the clinical diagnosis of monogenic dyslipidemias, 81 variants in 14 lipodystrophy-associated genes (LMNA, PPARG, PLIN1, CIDEC, LIPE, LPIN1, AGPAT2, BSCL2, CAV1, AKT2, PTRF, DYRK1B, POLD1 and WRN) were identified within 58 patients. Furthermore, an additional seven CNV events were detected in seven patients with lipodystrophy, namely duplications in PLIN1, MFN2, APOA5/APOA4, CREB3L3 and deletions in AGPAT2, PLIN1 and CIDEC. This is the first report of systematically screening for CNV events, and these represent the first CNVs identified in patients with lipodystrophy.
Twenty patients with lipodystrophy and five patients with extreme early-onset obesity were subjected to WES and bioinformatics analysis. From WES, candidate variants were discovered in 13 patients with lipodystrophy and two with extreme early-onset obesity in the following genes: ISCU, HSPG2, LDLR, PDRM16, ZMPSTE24, FLNC, GALC, AR, ABCA4, WRN, ABCG8, FHL1, ANLN, LPL, FN1, PAPSS2, NEUROD1, BSCL2, APOB, PCSK9, PYGM, BLK, MC4R, BBS10, SETD8, and KMT2C. Furthermore, two of two rare disease cases (brachydactyly type A1, IHH; cerebral atrophy-like, CASC5) and eight of 11 CARE4RARE/FORGE Canada had candidate variants identified from WES data and bioinformatics processing. The successful identification of candidate genes and the clarification of the genetic determinants underlying many of these rare disease cases
130 demonstrate the power of WES in rare disease research. Additionally, as many of these genetic variants have never been reported, these results highlight the effectiveness of NGS in detecting novel genetic variation.
In sum, in my MSc Thesis project I have identified novel disease-associated genes, characterized novel variants, and demonstrated the utility of targeted sequencing and WES in clarifying the genetic basis of rare genetic diseases. Furthermore, I have provided instructions on how to perform NGS and bioinformatics in a robust, efficient manner, and effectively ended the diagnostic odyssey for some patients through the identification of candidate variants. Understanding these genetic variants and their association with each will lead to many positive implications, most importantly, benefits to families, changes in treatment options for genetically explained patients, and added knowledge for the field.
4.10 Project significance
Broadly, many significant outcomes may result from this MSc Thesis. These outcomes take three forms: benefits to the family, therapeutic benefits, and scientific benefits. On the family level, identifying the molecular basis of these rare diseases can allow for several positive outcomes. First, it can allow the physician to assign a definitive name of the condition. Although this may not lead to altered management, this may allow the individual or the family to find support in community groups or the scientific literature. Second, it marks the end of the diagnostic odyssey. As a tumultuous journey for individuals, the end of the diagnostic odyssey may prevent unnecessary tests, prescriptions or consultations. Third, it may open the door for preventative medicine. For example, one clinical story describes a lipodystrophy patient whose LMNA mutation discovery encouraged physicians to approach her case differently. This enabled the detection of a severe cardiac rhythm disorder, and allowed subsequent life-saving treatment237. Last, it may provide recurrence risk for future pregnancies. The understanding of recurrence may allow for advanced family planning and preparation on the psychosocial level.
131
The second significant outcome of this research is the effect that these results have on treatment options for an affected individual. Through a genetic diagnosis, a physician may be able to offer a change in surveillance, or modification in medication. These alterations may provide an improved prognosis for an individual.
The third outcome of genetic variant discovery are the benefits that these results have on the rare disease research field. By identifying a genetic basis of a rare disorder, the results may provide insight on both normal and disease pathways and pave the way towards the development of novel therapeutic interventions.
In addition to the positive implications on rare disease research, the application of NGS technologies in rare disease research also has significant implications on the field. More specifically, by demonstrating the clinical utility of LipidSeq™ and WES for rare disease cases, we can encourage other researchers or clinicians to use these methods when investigating the genetic basis of rare disease phenotypes.
In sum, identifying the molecular bases of rare disorders using NGS technologies demonstrated the power of NGS as a clinical diagnostic tool, and contributed the first step towards the long-term goal – to develop novel treatments and end the diagnostic odyssey for these rare disease patients.
132
References
1. MacKenzie, A. & Boycott, K.M. The future is now for rare genetic diseases. CMAJ: Canadian Medical Association Journal = Journal de l'Association Medicale Canadienne 184, 1603 (2012).
2. Basel, D. & McCarrier, J. Ending a Diagnostic Odyssey: Family Education, Counseling, and Response to Eventual Diagnosis. Pediatric Clinics of North America 64, 265-72 (2017).
3. Shashi, V. et al. The utility of the traditional medical genetics diagnostic evaluation in the context of next-generation sequencing for undiagnosed genetic disorders. Genetics in Medicine: Official Journal of the American College of Medical Genetics 16, 176-82 (2014).
4. Zhang, M., Zhu, C., Jacomy, A., Lu, L.J. & Jegga, A.G. The orphan disease networks. American Journal of Human Genetics 88, 755-766 (2011).
5. Sawyer, S.L. et al. Utility of whole-exome sequencing for those near the end of the diagnostic odyssey: time to address gaps in care. Clinical Genetics 89, 275-84 (2016).
6. Lander, E.S. & Botstein, D. Homozygosity mapping: a way to map human recessive traits with the DNA of inbred children. Science 236, 1567-70 (1987).
7. Bamshad, M.J. et al. Exome sequencing as a tool for Mendelian disease gene discovery. Nature Reviews Genetics 12, 745-55 (2011).
8. Garg, A. Lipodystrophies. The American Journal of Medicine 108, 143-52 (2000).
9. Garg, A. Acquired and inherited lipodystrophies. The New England Journal of Medicine 350, 1220-34 (2004).
10. Handelsman, Y. et al. The clinical approach to the detection of lipodystrophy - an AACE consensus statement. Endocrine Practice 19, 107-16 (2013).
11. Vantyghem, M.C. et al. Fertility and obstetrical complications in women with LMNA-related familial partial lipodystrophy. Journal of Clinical Endocrinology and Metabolism 93, 2223-9 (2008).
12. Cortes, V.A. & Fernandez-Galilea, M. Lipodystrophies: adipose tissue disorders with severe metabolic implications. Journal of Physiology and Biochemistry 71, 471-8 (2015).
13. Berardinelli, W. An undiagnosed endocrinometabolic syndrome: report of 2 cases. The Journal of Clinical Endocrinology and Metabolism 14, 193-204 (1954).
133
14. Seip, M. Lipodystrophy and gigantism with associated endocrine manifestations. A new diencephalic syndrome? Acta Paediatrica 48, 555-74 (1959).
15. Garg, A., Peshock, R.M. & Fleckenstein, J.L. Adipose tissue distribution pattern in patients with familial partial lipodystrophy (Dunnigan variety). The Journal of Clinical Endocrinology and Metabolism 84, 170-4 (1999).
16. Garg, A., Speckman, R.A. & Bowcock, A.M. Multisystem dystrophy syndrome due to novel missense mutations in the amino-terminal head and alpha-helical rod domains of the lamin A/C gene. The American Journal of Medicine 112, 549-55 (2002).
17. Subramanyam, L., Simha, V. & Garg, A. Overlapping syndrome with familial partial lipodystrophy, Dunnigan variety and cardiomyopathy due to amino- terminal heterozygous missense lamin A/C mutations. Clinical Genetics 78, 66-73 (2010).
18. Fiorenza, C.G., Chou, S.H. & Mantzoros, C.S. Lipodystrophy: pathophysiology and advances in treatment. Nature Reviews Endocrinology 7, 137-50 (2011).
19. Rao, D.P., Kropac, E., Do, M.T., Roberts, K.C. & Jayaraman, G.C. Childhood overweight and obesity trends in Canada. Health Promotion and Chronic Disease Prevention in Canada: Research, Policy and Practice 36, 194-8 (2016).
20. Choquet, H. & Meyre, D. Genomic insights into early-onset obesity. Genome Medicine 2, 36 (2010).
21. Bouchard, C. Childhood obesity: are genetic differences involved? The American Journal of Clinical Nutrition 89, 1494S-1501S (2009).
22. Temtamy, S.A. & McKusick, V.A. The genetics of hand malformations. Birth Defects Original Article Series 14, i-xviii, 1-619 (1978).
23. Temtamy, S.A. & Aglan, M.S. Brachydactyly. Orphanet Journal of Rare Diseases 3, 15 (2008).
24. Bertram, L. & Tanzi, R.E. The genetic epidemiology of neurodegenerative disease. The Journal of Clinical Investigation 115, 1449-57 (2005).
25. Matilla-Duenas, A. et al. Rare Neurodegenerative Diseases: Clinical and Genetic Update. Advances in Experimental Medicine and Biology 1031, 443-496 (2017).
26. Lahiry, P. et al. A mutation in the serine protease TMPRSS4 in a novel pediatric neurodegenerative disorder. Orphanet Journal of Rare Diseases 8, 126 (2013).
27. CHEO Research Institute. CARE for RARE. (2018). at
134
28. International Human Genome Sequencing Consortium. Finishing the euchromatic sequence of the human genome. Nature 431, 931-45 (2004).
29. Lander, E.S. et al. Initial sequencing and analysis of the human genome. Nature 409, 860-921 (2001).
30. Feero, W.G., Guttmacher, A.E. & Collins, F.S. Genomic medicine - an updated primer. The New England Journal of Medicine 362, 2001-11 (2010).
31. Feuk, L., Carson, A.R. & Scherer, S.W. Structural variation in the human genome. Nature Reviews Genetics 7, 85-97 (2006).
32. Sherry, S.T., Ward, M. & Sirotkin, K. dbSNP - database for single nucleotide polymorphisms and other classes of minor genetic variation. Genome Research 9, 677-9 (1999).
33. Bessenyei, B., Marka, M., Urban, L., Zeher, M. & Semsei, I. Single nucleotide polymorphisms: aging and diseases. Biogerontology 5, 291-303 (2004).
34. Baralle, D. & Buratti, E. RNA splicing in human disease and in the clinic. Clinical Science 131, 355-68 (2017).
35. Parkinson, D.B. & Thakker, R.V. A donor splice site mutation in the parathyroid hormone gene is associated with autosomal recessive hypoparathyroidism. Nature Genetics 1, 149-52 (1992).
36. Mullaney, J.M., Mills, R.E., Pittard, W.S. & Devine, S.E. Small insertions and deletions (INDELs) in human genomes. Human Molecular Genetics 19, R131-6 (2010).
37. Frisch, A. et al. Origin and spread of the 1278insTATC mutation causing Tay- Sachs disease in Ashkenazi Jews: genetic drift as a robust and parsimonious hypothesis. Human Genetics 114, 366-76 (2004).
38. de Koning, A.P., Gu, W., Castoe, T.A., Batzer, M.A. & Pollock, D.D. Repetitive elements may comprise over two-thirds of the human genome. PLoS Genetics 7, e1002384 (2011).
39. Liang, K.C., Tseng, J.T., Tsai, S.J. & Sun, H.S. Characterization and distribution of repetitive elements in association with genes in the human genome. Computational Biology and Chemistry 57, 29-38 (2015).
40. Freeman, J.L. et al. Copy number variation: new insights in genome diversity. Genome Research 16, 949-61 (2006).
41. Stankiewicz, P. & Lupski, J.R. Structural variation in the human genome and its role in disease. Annual Review of Medicine 61, 437-55 (2010).
135
42. Redon, R. et al. Global variation in copy number in the human genome. Nature 444, 444-54 (2006).
43. Hastings, P.J., Lupski, J.R., Rosenberg, S.M. & Ira, G. Mechanisms of change in gene copy number. Nature Reviews Genetics 10, 551-64 (2009).
44. Griffiths, A.J.F., Miller, J.H., Suzuki, D.T., et al. Somatic versus germinal mutation. An Introduction to Genetic Analysis (W. H. Freeman, New York, 2000).
45. Martincorena, I. & Campbell, P.J. Somatic mutation in cancer and normal cells. Science 349, 1483-9 (2015).
46. Acuna-Hidalgo, R., Veltman, J.A. & Hoischen, A. New insights into the generation and role of de novo mutations in health and disease. Genome Biology 17, 241 (2016).
47. Tenesa, A. & Haley, C.S. The heritability of human disease: estimation, uses and abuses. Nature Reviews Genetics 14, 139-49 (2013).
48. Visscher, P.M., Hill, W.G. & Wray, N.R. Heritability in the genomics era-- concepts and misconceptions. Nature Reviews Genetics 9, 255-66 (2008).
49. Antonarakis, S.E. & Beckmann, J.S. Mendelian disorders deserve more attention. Nature reviews. Genetics 7, 277-82 (2006).
50. Gazzo, A. et al. Understanding mutational effects in digenic diseases. Nucleic Acids Research 45, e140 (2017).
51. Gazzo, A.M. et al. DIDA: a curated and annotated digenic diseases database. Nucleic Acids Research 44, D900-7 (2016).
52. Kajiwara, K., Berson, E.L. & Dryja, T.P. Digenic retinitis pigmentosa due to mutations at the unlinked peripherin/RDS and ROM1 loci. Science 264, 1604-8 (1994).
53. Lvovs, D., Favorova, O.O. & Favorov, A.V. A Polygenic Approach to the Study of Polygenic Diseases. Acta Naturae 4, 59-71 (2012).
54. Peltonen, L., Perola, M., Naukkarinen, J. & Palotie, A. Lessons from studying monogenic disease for common disease. Human Molecular Genetics 15 Spec No 1, R67-74 (2006).
55. McCoy, M.L., Mueller, C.R. & Roskelley, C.D. The role of the breast cancer susceptibility gene 1 (BRCA1) in sporadic epithelial ovarian cancer. Reproductive Biology and Endocrinology: RB&E 1, 72 (2003).
56. Ambani, L.M., Gelehrter, T.D. & Sheahan, D.G. Variable expression of Marfan syndrome in monozygotic twins. Clinical Genetics 8, 358-63 (1975).
136
57. Garg, A. Clinical review: Lipodystrophies: genetic and acquired body fat disorders. The Journal of Clinical Endocrinology and Metabolism 96, 3313-25 (2011).
58. Krahmer, N., Farese, R.V., Jr. & Walther, T.C. Balancing the fat: lipid droplets and human disease. EMBO Molecular Medicine 5, 973-83 (2013).
59. Garg, A. & Agarwal, A.K. Lipodystrophies: disorders of adipose tissue biology. Biochimica et Biophysica Acta 1791, 507-13 (2009).
60. Agarwal, A.K. & Garg, A. Genetic basis of lipodystrophies and management of metabolic complications. Annual Review of Medicine 57, 297-311 (2006).
61. Souren, N.Y. et al. Common SNPs in LEP and LEPR associated with birth weight and type 2 diabetes-related metabolic risk factors in twins. International Journal of Obesity 32, 1233-9 (2008).
62. Clement, K. et al. A mutation in the human leptin receptor gene causes obesity and pituitary dysfunction. Nature 392, 398-401 (1998).
63. Challis, B.G. & Millington, G.W.M. Proopiomelanocortin Deficiency. GeneReviews((R)) (eds. Adam, M.P. et al.) (Seattle (WA), 1993).
64. Benzinou, M. et al. Common nonsynonymous variants in PCSK1 confer risk of obesity. Nature Genetics 40, 943-5 (2008).
65. Mergen, M., Mergen, H., Ozata, M., Oner, R. & Oner, C. A novel melanocortin 4 receptor (MC4R) gene mutation associated with morbid obesity. The Journal of Clinical Endocrinology and Metabolism 86, 3448 (2001).
66. Rosas-Vargas, H., Martinez-Ezquerro, J.D. & Bienvenu, T. Brain-derived neurotrophic factor, food intake regulation, and obesity. Archives of Medical Research 42, 482-94 (2011).
67. Gray, J. et al. Functional characterization of human NTRK2 mutations identified in patients with severe early-onset obesity. International Journal of Obesity 31, 359-64 (2007).
68. Gunay-Aygun, M., Schwartz, S., Heeger, S., O'Riordan, M.A. & Cassidy, S.B. The changing purpose of Prader-Willi syndrome clinical diagnostic criteria and proposed revised criteria. Pediatrics 108, E92 (2001).
69. Muller, J. et al. Identification of 28 novel mutations in the Bardet-Biedl syndrome genes: the burden of private mutations in an extensively heterogeneous disease. Human Genetics 127, 583-93 (2010).
70. Seifert, W. et al. Mutational spectrum of COH1 and clinical heterogeneity in Cohen syndrome. Journal of Medical Genetics 43, e22 (2006).
137
71. Marshall, J.D. et al. New Alstrom syndrome phenotypes based on the evaluation of 182 cases. Archives of Internal Medicine 165, 675-83 (2005).
72. Bell, J. Treasury of Human Inheritance Vol. 5 (Cambridge University Press, London, 1951).
73. Haws, D.V. & McKusick, V.A. Farabee's Brachydactylous Kindred Revisited. Bulletin of the Johns Hopkins Hospital 113, 20-30 (1963).
74. Drinkwater, H. An account of a brachydactylous family. Proceedings of the Royal Society of Edinburgh 28, 35-57 (1908).
75. Drinkwater, H. Account of a family showing minor-brachydactyly. Journal of Genetics 2, 21-40 (1912).
76. Kirkpatrick, T.J. et al. Identification of a mutation in the Indian Hedgehog (IHH) gene causing brachydactyly type A1 and evidence for a third locus. Journal of Medical Genetics 40, 42-4 (2003).
77. Gao, B. et al. Mutations in IHH, encoding Indian hedgehog, cause brachydactyly type A-1. Nature Genetics 28, 386-8 (2001).
78. McCready, M.E. et al. A novel mutation in the IHH gene causes brachydactyly type A1: a 95-year-old mystery resolved. Human Genetics 111, 368-75 (2002).
79. Byrnes, A.M. et al. Brachydactyly A-1 mutations restricted to the central region of the N-terminal active fragment of Indian Hedgehog. European Journal of Human Genetics : European Journal of Human Genetics 17, 1112-20 (2009).
80. Liu, M. et al. A novel heterozygous mutation in the Indian hedgehog gene (IHH) is associated with brachydactyly type A1 in a Chinese family. Journal of Human Genetics 51, 727-31 (2006).
81. Stattin, E.L., Linden, B., Lonnerholm, T., Schuster, J. & Dahl, N. Brachydactyly type A1 associated with unusual radiological findings and a novel Arg158Cys mutation in the Indian hedgehog (IHH) gene. European Journal of Medical Genetics 52, 297-302 (2009).
82. Lodder, E.M., Hoogeboom, A.J., Coert, J.H. & de Graaff, E. Deletion of 1 amino acid in Indian hedgehog leads to brachydactylyA1. American Journal of Medical Genetics Part A 146A, 2152-4 (2008).
83. Ho, R., McIntyre, A.D., Kennedy, B.A., & Hegele, R.A. Whole-exome sequencing identifies a novel IHH insertion in an Ontario family with brachydactyly type A1. SAGE Open Medicine Case Reports Submitted (2018).
138
84. Armour, C.M., Bulman, D.E. & Hunter, A.G. Clinical and radiological assessment of a family with mild brachydactyly type A1: the usefulness of metacarpophalangeal profiles. Journal of Medical Genetics 37, 292-6 (2000).
85. Armour, C.M., McCready, M.E., Baig, A., Hunter, A.G. & Bulman, D.E. A novel locus for brachydactyly type A1 on chromosome 5p13.3-p13.2. Journal of Medical Genetics 39, 186-8 (2002).
86. Byrnes, A.M. et al. Mutations in GDF5 presenting as semidominant brachydactyly A1. Human Mutation 31, 1155-62 (2010).
87. Chang, S.C. et al. Cartilage-derived morphogenetic proteins. New members of the transforming growth factor-beta superfamily predominantly expressed in long bones during human embryonic development. The Journal of Biological Chemistry 269, 28227-34 (1994).
88. Racacho, L. et al. Two novel disease-causing variants in BMPR1B are associated with brachydactyly type A1. European Journal of Human Genetics 23, 1640-5 (2015).
89. Ploger, F. et al. Brachydactyly type A2 associated with a defect in proGDF5 processing. Human Molecular Genetics 17, 1222-33 (2008).
90. Lehmann, K. et al. Mutations in bone morphogenetic protein receptor 1B cause brachydactyly type A2. Proceedings of the National Academy of Sciences of the United States of America 100, 12277-82 (2003).
91. Badura-Stronka, M. et al. Novel mutation in the BMPR1B gene (R486L) in a Polish family and further delineation of the phenotypic features of BMPR1B- related brachydactyly. Birth Defects Research. Part A, Clinical and Molecular Teratology 103, 567-72 (2015).
92. Su, P. et al. A 4.6 kb genomic duplication on 20p12.2-12.3 is associated with brachydactyly type A2 in a Chinese family. Journal of Medical Genetics 48, 312- 6 (2011).
93. Liu, X. et al. Identification of duplication downstream of BMP2 in a Chinese family with brachydactyly type A2 (BDA2). PloS One 9, e94201 (2014).
94. Dathe, K. et al. Duplications involving a conserved regulatory element downstream of BMP2 are associated with brachydactyly type A2. American Journal of Human Genetics 84, 483-92 (2009).
95. Hertzog, K.P. Shortened fifth medial phalanges. American Journal of Physical Anthropology 27, 113-18 (1967).
139
96. Williams, K.D. et al. Heritability of brachydactyly type A3 in children, adolescents, and young adults from an endogamous population in eastern Nepal. Human Biology 79, 609-22 (2007).
97. Bass, H.N. Familial absence of middle phalanges with nail dysplasia: a new syndrome. Pediatrics 42, 318-23 (1968).
98. Cuevas-Sosa, A. & Garcia-Segur, F. Brachydactyly with absence of middle phalanges and hypoplastic nails: a new hereditary syndrome. The Journal of Bone and Joint Surgery, British Volume 53, 101-5 (1971).
99. Ohzeki, T. et al. Brachydactyly type A-4 (Temtamy type) with short stature in a Japanese girl and her mother. American Journal of Medical Genetics 46, 260-2 (1993).
100. Bick, D. & Dimmock, D. Whole exome and whole genome sequencing. Current Opinion in Pediatrics 23, 594-600 (2011).
101. Metzker, M.L. Sequencing technologies - the next generation. Nature Reviews Genetics 11, 31-46 (2010).
102. Johansen, C.T. et al. LipidSeq: a next-generation clinical resequencing panel for monogenic dyslipidemias. Journal of Lipid Research 55, 765-72 (2014).
103. Choi, M. et al. Genetic diagnosis by whole exome capture and massively parallel DNA sequencing. Proceedings of the National Academy of Sciences of the United States of America 106, 19096-101 (2009).
104. Ng, S.B. et al. Exome sequencing identifies the cause of a Mendelian disorder. Nature Genetics 42, 30-5 (2010).
105. Hoischen, A. et al. De novo mutations of SETBP1 cause Schinzel-Giedion syndrome. Nature Genetics 42, 483-5 (2010).
106. Farhan, S.M. & Hegele, R.A. Exome sequencing: new insights into lipoprotein disorders. Current Cardiology Reports 16, 507 (2014).
107. Lazaridis, K.N. et al. Outcome of Whole Exome Sequencing for Diagnostic Odyssey Cases of an Individualized Medicine Clinic: The Mayo Clinic Experience. Mayo Clinic Proceedings 91, 297-307 (2016).
108. Berberich, A.J., Ho, R. & Hegele, R.A. Whole genome sequencing in the clinic: empowerment or too much information? CMAJ: Canadian Medical Association Journal = Journal de l'Association Medicale Canadienne 190, E124-E125 (2018).
109. Mardis, E.R. The impact of next-generation sequencing technology on genetics. Trends in Genetics 24, 133-41 (2008).
140
110. Adzhubei, I., Jordan, D.M. & Sunyaev, S.R. Predicting functional effect of human missense mutations using PolyPhen-2. Current Protocols in Human Genetics Chapter 7, Unit7 20 (2013).
111. Kumar, P., Henikoff, S. & Ng, P.C. Predicting the effects of coding non- synonymous variants on protein function using the SIFT algorithm. Nature Protocols 4, 1073-81 (2009).
112. Schwarz, J.M., Cooper, D.N., Schuelke, M. & Seelow, D. MutationTaster2: mutation prediction for the deep-sequencing age. Nature Methods 11, 361-2 (2014).
113. Kircher, M. et al. A general framework for estimating the relative pathogenicity of human genetic variants. Nature Genetics 46, 310-5 (2014).
114. Desmet, F.O. et al. Human Splicing Finder: an online bioinformatics tool to predict splicing signals. Nucleic Acids Research 37, e67 (2009).
115. Xiong, H.Y. et al. RNA splicing. The human splicing code reveals new insights into the genetic determinants of disease. Science 347, 1254806 (2015).
116. Auton, A. et al. A global reference for human genetic variation. Nature 526, 68- 74 (2015).
117. Lek, M. et al. Analysis of protein-coding genetic variation in 60,706 humans. Nature 536, 285-91 (2016).
118. Fishilevich, S. et al. GeneHancer: genome-wide integration of enhancers and target genes in GeneCards. Database: the Journal of Biological Databases and Curation 2017(2017).
119. Pundir, S., Martin, M.J. & O'Donovan, C. UniProt Protein Knowledgebase. Methods in Molecular Biology 1558, 41-55 (2017).
120. Fabregat, A. et al. The Reactome Pathway Knowledgebase. Nucleic Acids Research 44, D481-7 (2016).
121. Uhlen, M. et al. Proteomics. Tissue-based map of the human proteome. Science 347, 1260419 (2015).
122. Kanehisa, M., Furumichi, M., Tanabe, M., Sato, Y. & Morishima, K. KEGG: new perspectives on genomes, pathways, diseases and drugs. Nucleic Acids Research 45, D353-D361 (2017).
123. Stenson, P.D. et al. The Human Gene Mutation Database: building a comprehensive mutation repository for clinical and molecular genetics, diagnostic testing and personalized genomic medicine. Human Genetics 133, 1-9 (2014).
141
124. Pavan, S. et al. Clinical Practice Guidelines for Rare Diseases: The Orphanet Database. PloS One 12, e0170365 (2017).
125. Firth, H.V. et al. DECIPHER: Database of Chromosomal Imbalance and Phenotype in Humans Using Ensembl Resources. American Journal of Human Genetics 84, 524-33 (2009).
126. Richards, S. et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genetics in Medicine: Official Journal of the American College of Medical Genetics 17, 405- 24 (2015).
127. Patel, Z.H. et al. The struggle to find reliable results in exome sequencing data: filtering out Mendelian errors. Frontiers in Genetics 5, 16 (2014).
128. Sunyaev, S., Ramensky, V. & Bork, P. Towards a structural basis of human non- synonymous single nucleotide polymorphisms. Trends in Genetics 16, 198-200 (2000).
129. Wang, Z. & Moult, J. SNPs, protein structure, and disease. Human Mutation 17, 263-70 (2001).
130. Ferrer-Costa, C., Orozco, M. & de la Cruz, X. Characterization of disease- associated single amino acid polymorphisms in terms of sequence and structure properties. Journal of Molecular Biology 315, 771-86 (2002).
131. Kucukkal, T.G., Petukh, M., Li, L. & Alexov, E. Structural and physico-chemical effects of disease and non-disease nsSNPs on proteins. Current Opinion in Structural Biology 32, 18-24 (2015).
132. Mi, H., Muruganujan, A., Casagrande, J.T. & Thomas, P.D. Large-scale gene function analysis with the PANTHER classification system. Nature Protocols 8, 1551-66 (2013).
133. Hart, A. Mann-Whitney test is not just a test of medians: differences in spread can be important. BMJ 323, 391-3 (2001).
134. Wickham, H. ggplot2: Elegant Graphics for Data Analysis. 1 edn (Springer- Verlag New York, New York, 2009).
135. Palles, C. et al. Germline mutations affecting the proofreading domains of POLE and POLD1 predispose to colorectal adenomas and carcinomas. Nature Genetics 45, 136-44 (2013).
136. Weedon, M.N. et al. An in-frame deletion at the polymerase active site of POLD1 causes a multisystem disorder with lipodystrophy. Nature Genetics 45, 947-50 (2013).
142
137. Nicolas, E., Golemis, E.A. & Arora, S. POLD1: Central mediator of DNA replication and repair, and implication in cancer and other pathologies. Gene 590, 128-41 (2016).
138. Kozusko, K. et al. Clinical and molecular characterization of a novel PLIN1 frameshift mutation identified in patients with familial partial lipodystrophy. Diabetes 64, 299-310 (2015).
139. Tansey, J.T. et al. Perilipin ablation results in a lean mouse with aberrant adipocyte lipolysis, enhanced leptin production, and resistance to diet-induced obesity. Proceedings of the National Academy of Sciences of the United States of America 98, 6494-9 (2001).
140. Jackson, S.N., Howlett, T.A., McNally, P.G., O'Rahilly, S. & Trembath, R.C. Dunnigan-Kobberling syndrome: an autosomal dominant form of partial lipodystrophy. QJM: Monthly Journal of the Association of Physicians 90, 27-36 (1997).
141. Pennacchio, L.A. et al. An apolipoprotein influencing triglycerides in humans and mice revealed by comparative sequencing. Science 294, 169-73 (2001).
142. Wang, F. et al. Apolipoprotein A-IV: a protein intimately involved in metabolism. Journal of Lipid Research 56, 1403-18 (2015).
143. Sharma, V. et al. Aberrant hetero-disulfide bond formation by the hypertriglyceridemia-associated p.Gly185Cys APOA5 variant (rs2075291). Arteriosclerosis, Thrombosis, and Vascular Biology 34, 2254-60 (2014).
144. Zuchner, S. et al. Mutations in the mitochondrial GTPase mitofusin 2 cause Charcot-Marie-Tooth neuropathy type 2A. Nature Genetics 36, 449-51 (2004).
145. Hikiami, R. et al. Charcot-Marie-Tooth disease type 2A with an autosomal- recessive inheritance: the first report of an adult-onset disease. Journal of Human Genetics 63, 89-92 (2018).
146. Sawyer, S.L. et al. Homozygous mutations in MFN2 cause multiple symmetric lipomatosis associated with neuropathy. Human Molecular Genetics 24, 5109-14 (2015).
147. Konige, M., Wang, H. & Sztalryd, C. Role of adipose specific lipid droplet proteins in maintaining whole body energy homeostasis. Biochimica et Biophysica Acta 1842, 393-401 (2014).
148. Nakagawa, Y. et al. CREB3L3 controls fatty acid oxidation and ketogenesis in synergy with PPARalpha. Scientific Reports 6, 39182 (2016).
149. Zhang, C. et al. Endoplasmic reticulum-tethered transcription factor cAMP responsive element-binding protein, hepatocyte specific, regulates hepatic
143
lipogenesis, fatty acid oxidation, and lipolysis upon metabolic stress in mice. Hepatology 55, 1070-82 (2012).
150. Garg, A., Sankella, S., Xing, C. & Agarwal, A.K. Whole-exome sequencing identifies ADRA2A mutation in atypical familial partial lipodystrophy. JCI Insight 1(2016).
151. Wang, F. et al. A TBX5 3'UTR variant increases the risk of congenital heart disease in the Han Chinese population. Cell Discovery 3, 17026 (2017).
152. Cardoso, A.R., Oliveira, M., Amorim, A. & Azevedo, L. Major influence of repetitive elements on disease-associated copy number variants (CNVs). Human Genomics 10, 30 (2016).
153. Tong, W.H. & Rouault, T. Distinct iron-sulfur cluster assembly complexes exist in the cytosol and mitochondria of human cells. The EMBO Journal 19, 5692-700 (2000).
154. Li, K., Tong, W.H., Hughes, R.M. & Rouault, T.A. Roles of the mammalian cytosolic cysteine desulfurase, ISCS, and scaffold protein, ISCU, in iron-sulfur cluster assembly. The Journal of Biological Chemistry 281, 12344-51 (2006).
155. Kollberg, G. et al. Clinical manifestation and a new ISCU mutation in iron- sulphur cluster deficiency myopathy. Brain: a Journal of Neurology 132, 2170-9 (2009).
156. Mochel, F. et al. Splice mutation in the iron-sulfur cluster scaffold protein ISCU causes myopathy with exercise intolerance. American Journal of Human Genetics 82, 652-60 (2008).
157. Arikawa-Hirasawa, E., Wilcox, W.R. & Yamada, Y. Dyssegmental dysplasia, Silverman-Handmaker type: unexpected role of perlecan in cartilage development. American Journal of Medical Genetics 106, 254-7 (2001).
158. Cai, H., Wang, X.L. & Wilcken, D.E. Genetic polymorphism of heparan sulfate proteoglycan (perlecan, HSPG2), lipid profiles and coronary artery disease in the Australian population. Atherosclerosis 148, 125-9 (2000).
159. Yamashita, Y., Nakada, S., Yoshihara, T., Nara, T., Furuya, N., Miida, T., Hattori, N., and Arikawa-Hirasawa, E. Perlecan, a heparan sulfate proteoglycan, regulates systemic metabolism with dynamic changes in adipose tissue and skeletal muscle. Scientific Reports 8(2018).
160. Zhang, J.H. et al. Association of genetic variations of PRDM16 with metabolic syndrome in a general Xinjiang Uygur population. Endocrine 41, 539-41 (2012).
161. Marais, A.D. Familial hypercholesterolaemia. The Clinical Biochemist, Reviews 25, 49-68 (2004).
144
162. Freije, J.M. et al. Identification and chromosomal location of two human genes encoding enzymes potentially involved in proteolytic maturation of farnesylated proteins. Genomics 58, 270-80 (1999).
163. Ahmad, Z., Zackai, E., Medne, L. & Garg, A. Early onset mandibuloacral dysplasia due to compound heterozygous mutations in ZMPSTE24. American Journal of Medical Genetics, Part A 152A, 2703-10 (2010).
164. Barrowman, J., Wiley, P.A., Hudon-Miller, S.E., Hrycyna, C.A. & Michaelis, S. Human ZMPSTE24 disease mutations: residual proteolytic activity correlates with disease severity. Human Molecular Genetics 21, 4084-93 (2012).
165. Duff, R.M. et al. Mutations in the N-terminal actin-binding domain of filamin C cause a distal myopathy. American Journal of Human Genetics 88, 729-740 (2011).
166. Chen, Y.Q., Rafi, M.A., de Gala, G. & Wenger, D.A. Cloning and expression of cDNA encoding human galactocerebrosidase, the enzyme deficient in globoid cell leukodystrophy. Human Molecular Genetics 2, 1841-5 (1993).
167. Spratley, S.J. et al. Molecular Mechanisms of Disease Pathogenesis Differ in Krabbe Disease Variants. Traffic 17, 908-22 (2016).
168. Wenger, D.A., Rafi, M.A. & Luzi, P. Krabbe disease: One Hundred years from the bedside to the bench to the bedside. Journal of Neuroscience Research 94, 982-9 (2016).
169. Molday, R.S., Zhong, M. & Quazi, F. The role of the photoreceptor ABC transporter ABCA4 in lipid transport and Stargardt macular degeneration. Biochimica et Biophysica Acta 1791, 573-83 (2009).
170. Mori, S. et al. Enhanced intra-abdominal visceral fat accumulation in patients with Werner's syndrome. International Journal of Obesity and Related Metabolic Disorders: Journal of the International Association for the Study of Obesity 25, 292-5 (2001).
171. Kidambi, S. & Patel, S.B. Cholesterol and non-cholesterol sterol transporters: ABCG5, ABCG8 and NPC1L1: a review. Xenobiotica; the Fate of Foreign Compounds in Biological Systems 38, 1119-39 (2008).
172. Niu, D.M. et al. Clinical observations, molecular genetic analysis, and treatment of sitosterolemia in infants and children. Journal of Inherited Metabolic Disease 33, 437-43 (2010).
173. Cowling, B.S. et al. Four and a half LIM protein 1 gene mutations cause four distinct human myopathies: a comprehensive review of the clinical, histological and pathological features. Neuromuscular Disorders 21, 237-51 (2011).
145
174. Malfatti, E. et al. Skeletal muscle biopsy analysis in reducing body myopathy and other FHL1-related disorders. Journal of Neuropathology and Experimental Neurology 72, 833-45 (2013).
175. Gbadegesin, R.A. et al. Mutations in the gene that encodes the F-actin binding protein anillin cause FSGS. Journal of the American Society of Nephrology 25, 1991-2002 (2014).
176. Mead, J.R., Irvine, S.A. & Ramji, D.P. Lipoprotein lipase: structure, function, regulation, and role in disease. Journal of Molecular Medicine 80, 753-69 (2002).
177. Xu, Z.H., Freimuth, R.R., Eckloff, B., Wieben, E. & Weinshilboum, R.M. Human 3'-phosphoadenosine 5'-phosphosulfate synthetase 2 (PAPSS2) pharmacogenetics: gene resequencing, genetic polymorphisms and functional characterization of variant allozymes. Pharmacogenetics 12, 11-21 (2002).
178. Oostdijk, W. et al. PAPSS2 deficiency causes androgen excess via impaired DHEA sulfation - in vitro and in vivo studies in a family harboring two novel PAPSS2 mutations. The Journal of Clinical Endocrinology and Metabolism 100, E672-80 (2015).
179. Fajans, S.S., Bell, G.I. & Polonsky, K.S. Molecular mechanisms and clinical pathophysiology of maturity-onset diabetes of the young. The New England Journal of Medicine 345, 971-80 (2001).
180. Cui, X. et al. Seipin ablation in mice results in severe generalized lipodystrophy. Human Molecular Genetics 20, 3022-30 (2011).
181. Law, S.W. et al. Human apolipoprotein B-100: cloning, analysis of liver mRNA, and assignment of the gene to chromosome 2. Proceedings of the National Academy of Sciences of the United States of America 82, 8340-4 (1985).
182. Schmidt, R.J. et al. Secreted proprotein convertase subtilisin/kexin type 9 reduces both hepatic and extrahepatic low-density lipoprotein receptors in vivo. Biochemical and Biophysical Research Communications 370, 634-40 (2008).
183. Gautron, S. et al. Molecular mechanisms of McArdle's disease (muscle glycogen phosphorylase deficiency). RNA and DNA analysis. The Journal of Clinical Investigation 79, 275-81 (1987).
184. Bruno, C. et al. McArdle disease: the mutation spectrum of PYGM in a large Italian cohort. Human Mutation 27, 718 (2006).
185. Simha, V. & Garg, A. Phenotypic heterogeneity in body fat distribution in patients with congenital generalized lipodystrophy caused by mutations in the AGPAT2 or seipin genes. The Journal of Clinical Endocrinology and Metabolism 88, 5433-7 (2003).
146
186. Frye, R.A. Phylogenetic classification of prokaryotic and eukaryotic Sir2-like proteins. Biochemical and Biophysical Research Communications 273, 793-8 (2000).
187. Lombard, D.B., Schwer, B., Alt, F.W. & Mostoslavsky, R. SIRT6 in DNA repair, metabolism and ageing. Journal of Internal Medicine 263, 128-41 (2008).
188. Rodgers, J.T. & Puigserver, P. Certainly can't live without this: SIRT6. Cell Metabolism 3, 77-8 (2006).
189. Zhong, L. & Mostoslavsky, R. SIRT6: a master epigenetic gatekeeper of glucose metabolism. Transcription 1, 17-21 (2010).
190. Mostoslavsky, R. et al. Genomic instability and aging-like phenotype in the absence of mammalian SIRT6. Cell 124, 315-29 (2006).
191. Islam, K.B., Rabbani, H., Larsson, C., Sanders, R. & Smith, C.I. Molecular cloning, characterization, and chromosomal localization of a human lymphoid tyrosine kinase related to murine Blk. Journal of Immunology 154, 1265-72 (1995).
192. Borowiec, M. et al. Mutations at the BLK locus linked to maturity onset diabetes of the young and beta-cell dysfunction. Proceedings of the National Academy of Sciences of the United States of America 106, 14460-5 (2009).
193. Koemans, T.S. et al. Functional convergence of histone methyltransferases EHMT1 and KMT2C involved in intellectual disability and autism spectrum disorder. PLoS Genetics 13, e1006864 (2017).
194. Kleefstra, T. et al. Disruption of an EHMT1-associated chromatin-modification module causes intellectual disability. American Journal of Human Genetics 91, 73-82 (2012).
195. Neas, K.R. et al. Three patients with terminal deletions within the subtelomeric region of chromosome 9q. American Journal of Medical Genetics, Part A 132A, 425-30 (2005).
196. Stoetzel, C. et al. BBS10 encodes a vertebrate-specific chaperonin-like protein and is a major BBS locus. Nature Genetics 38, 521-4 (2006).
197. Okamura, M., Inagaki, T., Tanaka, T. & Sakai, J. Role of histone methylation and demethylation in adipogenesis and obesity. Organogenesis 6, 24-32 (2010).
198. Chehab, F.F. Obesity and lipodystrophy - where do the circles intersect? Endocrinology 149, 925-34 (2008).
199. Navarro, G., Allard, C., Xu, W. & Mauvais-Jarvis, F. The role of androgens in metabolism, obesity, and diabetes in males and females. Obesity 23, 713-9 (2015).
147
200. Kelly, D.M. et al. Testosterone differentially regulates targets of lipid and glucose metabolism in liver, muscle and adipose tissues of the testicular feminised mouse. Endocrine 54, 504-515 (2016).
201. Sato, T. et al. Late onset of obesity in male androgen receptor-deficient (AR KO) mice. Biochemical and Biophysical Research Communications 300, 167-71 (2003).
202. Yang, X. et al. A locus for brachydactyly type A-1 maps to chromosome 2q35- q36. American Journal of Human Genetics 66, 892-903 (2000).
203. Hammerschmidt, M., Brook, A. & McMahon, A.P. The world according to hedgehog. Trends in Genetics 13, 14-21 (1997).
204. Gao, B. et al. A mutation in Ihh that causes digit abnormalities alters its signalling capacity and range. Nature 458, 1196-200 (2009).
205. St-Jacques, B., Hammerschmidt, M. & McMahon, A.P. Indian hedgehog signaling regulates proliferation and differentiation of chondrocytes and is essential for bone formation. Genes and Development 13, 2072-86 (1999).
206. Hellemans, J. et al. Homozygous mutations in IHH cause acrocapitofemoral dysplasia, an autosomal recessive disorder with cone-shaped epiphyses in hands and hips. American Journal of Human Genetics 72, 1040-6 (2003).
207. Ma, G. et al. Indian hedgehog mutations causing brachydactyly type A1 impair Hedgehog signal transduction at multiple levels. Cell Research 21, 1343-57 (2011).
208. Santaguida, S. & Musacchio, A. The life and miracles of kinetochores. The EMBO Journal 28, 2511-31 (2009).
209. Genin, A. et al. Kinetochore KMN network gene CASC5 mutated in primary microcephaly. Human Molecular Genetics 21, 5306-17 (2012).
210. Woods, C.G., Bond, J. & Enard, W. Autosomal recessive primary microcephaly (MCPH): a review of clinical, molecular, and evolutionary findings. American Journal of Human Genetics 76, 717-28 (2005).
211. Faheem, M. et al. Molecular genetics of human primary microcephaly: an overview. BMC Medical Genomics 8 Suppl 1, S4 (2015).
212. Bolanos-Garcia, V.M. et al. Structure of a Blinkin-BUBR1 complex reveals an interaction crucial for kinetochore-mitotic checkpoint regulation via an unanticipated binding Site. Structure 19, 1691-700 (2011).
213. Hanks, S. et al. Constitutional aneuploidy and cancer predisposition caused by biallelic mutations in BUB1B. Nature Genetics 36, 1159-61 (2004).
148
214. Payne, M., Rupar, C.A., Siu, G.M. & Siu, V.M. Amish, Mennonite, and Hutterite genetic disorder database. Paediatrics & Child Health 16, e23-4 (2011).
215. Karlsson, P. et al. Loss of vps54 function leads to vesicle traffic impairment, protein mis-sorting and embryonic lethality. International Journal of Molecular Sciences 14, 10908-25 (2013).
216. Sugimoto, M. et al. Molecular identification of t(w5): Vps52 promotes pluripotential cell differentiation through cell-cell interactions. Cell Reports 2, 1363-74 (2012).
217. Kapur, S., Swinford, A., Freimanis, A.K. & Lachman, R.S. Apparently previously undescribed X-linked dominant syndrome with facial and skeletal anomalies. American Journal of Medical Genetics 33, 357-63 (1989).
218. Niikawa, N., Matsuura, N., Fukushima, Y., Ohsawa, T. & Kajii, T. Kabuki make- up syndrome: a syndrome of mental retardation, unusual facies, large and protruding ears, and postnatal growth deficiency. The Journal of Pediatrics 99, 565-9 (1981).
219. Lederer, D. et al. Deletion of KDM6A, a histone demethylase interacting with MLL2, in three patients with Kabuki syndrome. American Journal of Human Genetics 90, 119-24 (2012).
220. Yarema, K.J. & Bertozzi, C.R. Characterizing glycosylation pathways. Genome Biology 2, (2001).
221. Rose, M.C. & Voynow, J.A. Respiratory tract mucin genes and mucin glycoproteins in health and disease. Physiological Reviews 86, 245-78 (2006).
222. Fowler, J., Vinall, L. & Swallow, D. Polymorphism of the human muc genes. Frontiers in Bioscience: a Journal and Virtual Library 6, D1207-15 (2001).
223. Biteau, B., Hochmuth, C.E. & Jasper, H. Maintaining tissue homeostasis: dynamic control of somatic stem cell activity. Cell Stem Cell 9, 402-11 (2011).
224. Alfares, A. et al. Whole-genome sequencing offers additional but limited clinical utility compared with reanalysis of whole-exome sequencing. Genetics in Medicine: Official Journal of the American College of Medical Genetics (2018).
225. Mallewa, J.E. et al. HIV-associated lipodystrophy: a review of underlying mechanisms and therapeutic options. The Journal of Antimicrobial Chemotherapy 62, 648-60 (2008).
226. Mahmood, T. & Yang, P.C. Western blot: technique, theory, and trouble shooting. North American Journal of Medical Sciences 4, 429-34 (2012).
149
227. Klein, D. Quantification using real-time PCR technology: applications and limitations. Trends in Molecular Medicine 8, 257-60 (2002).
228. Jozefczuk, J. & Adjaye, J. Quantitative real-time PCR-based analysis of gene expression. Methods in Enzymology 500, 99-109 (2011).
229. Yaciuk, P. Co-immunoprecipitation of protein complexes. Methods in Molecular Medicine 131, 103-11 (2007).
230. Foulkes, W.D. & Real, F.X. Many mosaic mutations. Current Oncology 20, 85-7 (2013).
231. Biesecker, L.G. & Spinner, N.B. A genomic view of mosaicism and human disease. Nature Reviews Genetics 14, 307-20 (2013).
232. Furnham, N., Ruffle, S. & Southan, C. Splice variants: a homology modeling approach. Proteins 54, 596-608 (2004).
233. Riethoven, J.J. Regulatory regions in DNA: promoters, enhancers, silencers, and insulators. Methods in Molecular Biology 674, 33-42 (2010).
234. Schaffer, A.A. Digenic inheritance in medical genetics. Journal of Medical Genetics 50, 641-52 (2013).
235. Lewis, C.M. & Vassos, E. Prospects for using risk scores in polygenic medicine. Genome Medicine 9, 96 (2017).
236. Philippakis, A.A. et al. The Matchmaker Exchange: a platform for rare disease gene discovery. Human Mutation 36, 915-21 (2015).
237. Vouillarmet, J. & Laville, M. A Case of Familial Partial Lipodystrophy: From Clinical Phenotype to Genetics. Canadian Journal of Diabetes 40, 376-378 (2016).
150
Appendices Appendix I: Ethics Approval
151
Appendix II: Consent Form
152
153
154
155
156
Appendix III: Primer List
Gene Primer Names Primer Sequence (5’-3’) IHH Forward CTCGCCTACAAGCAGTTCAGC Reverse AAAATGTGCCAGGGGGTGGGTAG TMPRSS4 Forward CCGGGAAAGGCTGAGTAACAAAAC Reverse GATAGTCTTAGCCCAGGTTTCTC AR* AR1-F1 GTTGAACTCTTCTGAGCAAGAG AR1-F2 GGATGAGGAACAGCAACCTTCAC AR1-R5 GTGAAGGTTGCTGTTCCTCATCC AR1-F3 CCAAGGACAATTACTTAGGGG AR1-R4 CCCCTAAGTAATTGTCCTTGG AR1-F4 CAAAGGGCTAGAAGGCGAGAGCC AR1-R3 GGCTCTCGCCTTCTAGCCCTTTG AR1-F5 GAAGAAGGCCAGTTGTATGG AR1-R2 CCATACAACTGGCCTTCTTC AR1-R1 GAACACAGAGTGACTCTGCCCTG AR2-FWD GACCTGAGACTTCACTTGCC AR2-REV CCCTGAAAGGTTAGTGTCTCTC AR3-FWD CCCGAAGAAAGAGACTCTGGAAAC AR3-REV GACTAGAAAATGAGGGAGAAGGGG AR4-FWD CTATGTCACCCAGGCTAGAGC AR4-REV GGATTTCACCAGGCAAAGGTG AR5-FWD CTCAACCCGTCAGTACCCAG AR5-REV CCATCACCACCAACCAGGTCTG AR6-FWD GAGGGATGGCAATCAGAGAC AR6-REV GTCCTCTCTGAATCTCTGTGC AR7-FWD CTAATGCTCCTTCGTGGGCATG AR7-REV CATTGGCTCTATCAGGCTGTTC AR8-FWD GAAGAGGCTAGCAGAGGCCAC AR8-REV CAGGCAGAAGACATCTGAAAGG PLIN1 Forward CTTCAGCTCTGCCACCTACC Reverse AAGAGGAGCCTGTTGTGTGG VPS52 Forward GCTAAGAGAACAGCGAAGGTTCCG Reverse CAGCTCAGGTCTTTCTGAAGCTAGG
KDM6A Forward CATCTCATGGACTTGTGCAAATGCC Reverse GTGGTCTTGGAGGTGGACATTTATC *AR primer naming method: geneexon-Forward/Reverse(number if necessary)
157
Appendix IV: PANTHER gene lists
Patient 14318, O-glycan processing
158
Patient 14318, tissue homeostasis
159
Patient 11618, interferon-gamma-mediated signaling
160
Curriculum Vitae Rosettia Ho
EDUCATION Master of Science 2018 Supervisor: Dr. Robert A. Hegele Department of Biochemistry, Schulich School of Medicine and Dentistry Robarts Research Institute, Western University, London ON, Canada
Bachelor of Science, Honours Specialization Genetics and Biochemistry 2016 Western University, London ON
EMPLOYMENT Graduate Teaching Assistant January – April 2018 Biochemistry 4455G: Translation in Cancer Biology, Western University, London ON
Graduate Teaching Assistant September – December 2016 and 2017 Biochemistry 4450A: Molecular Genetics of Human Cancer, Western University, London ON
Graduate Teaching Assistant January – April 2017 Biochemistry 3380G: Biochemistry Laboratory, Western University, London ON
Research Assistant (Part-time) September 2014 – July 2016 Dr. Kwok and Dr. Tam, Department of Social Work, King’s University College, London ON Involved in the following research studies: Chinese Youth in Conflict with the Law, Violence Against Women in China, and Examining Gatekeeping and Assessment of Professional Suitability in Canadian Social Work Education Responsible for transcribing qualitative interviews, attending workshops, attending qualitative interviews, and generating bibliographies for grant proposals
Research Assistant (Full-time Summer) May – September 2014 Dr. Hegele, Blackburn Cardiovascular Genetics Lab, Robarts Research Institute, London ON Projects included: Identifying the Molecular Basis of Lipodystrophy Through Next-Generation Sequencing, Absence of Protective APOC3 Mutations in Dyslipidemic Patients, DYRK1B R102C Mutations in Uncharacterized Lipodystrophy Patients, and assisting with Provisional Patent Application – LipidSeq™ and ONDRISeq™
161
LABORATORY EXPERIENCE: TECHNIQUES/SKILLS Primer design Gel electrophoresis Protein purification Whole-exome sequencing preparation DNA gel isolation Polymerase chain reaction Sanger sequencing DNA/RNA extraction Sequence alignment and analysis (DNA, RNA, protein) Bioinformatics processing Bioinformatics and statistical tools
ADDITIONAL SKILLS
Languages – English, Cantonese
Computer Software – Microsoft Excel, Publisher, Access, PowerPoint; CLC Bio Genomics Workbench; ANNOVAR; SeqScape; SAS; Golden Helix VarSeq®
HONOURS, AWARDS AND ACHIEVEMENTS
CIHR International Symposium on Atherosclerosis Travel Award 2018 Canadian Institutes of Health Research (CIHR) Institute of Circulatory and Respiratory Health (ICHR) Funding Amount: $1000
Dean’s Honor List 2012 – 2016 Western University, London ON
Western Scholarship of Excellence 2011 Western University, London ON
TRAINING AND CERTIFICATION
Teaching Assistant Training Program September 2017 Western University, London ON
162
PUBLICATIONS
Ho, R. and Hegele, R.A. (2018). Complex effects of laminopathy mutations on nuclear structure and function. Clinical Genetics Submitted: CGE-00672-2018.
Ho, R., Wang, J. Cao, H., and Hegele, R.A. The identification of novel CNVs in patients with inherited lipodystrophy. In: Atherosclerosis Supplements. June 9–12, 2018; International Symposium on Atherosclerosis, Toronto, ON. Abstract C2-2.06
Ho, R., Wang, J. McIntyre, A.D., and Hegele, R.A. Connecting extreme ends of the spectrum: ultra-rare androgen receptor mutations in metabolic phenotypes. In: Atherosclerosis Supplements. June 9–12, 2018; International Symposium on Atherosclerosis, Toronto, ON. Abstract P2.043.
Ho, R., McIntyre, A.D., Kennedy, B.A., and Hegele, R.A. (2018). Whole-exome sequencing identifies a novel IHH insertion in an Ontario family with brachydactyly type A1. SAGE Open Medical Case Reports Submitted: SOMCR-18-0068.
Berberich A.J., Ho, R., and Hegele, R.A. (2018). Whole-genome sequencing in the clinic: empowerment or too much information? Canadian Medical Association Journal 190.
Ho, R.*, Dron, J.S.* and Hegele, R.A. (2017). Recent Advances in the Genetics of Atherothrombotic Disease and Its Determinants. Arteriosclerosis, Thrombosis, and Vascular Biology 37(10), e158-e166. *These authors contributed equally to this article.
POSTERS
Connecting Extreme Ends of the Spectrum: Ultra-rare Androgen Receptor Mutations in Metabolic Phenotypes (June 9–12, 2018) Presented at the International Symposium on Atherosclerosis at the Toronto Metro Convention Centre, Toronto ON
Identification of a novel IHH insertion causative of brachydactyly type A1 (May 11, 2018) Presented at Schulich School of Medicine and Dentistry Department of Medicine Resident Research Day at the Lamplighter, Best Western, London ON
Identification of a novel IHH insertion causative of brachydactyly type A1 (May 10, 2018) Presented at London Health Research Day 2018 at the Convention Centre, London ON
163
Determining the genetic basis of rare diseases using whole-exome sequencing: Brachydactyly type A1 (November 16, 2017) Presented at the Western University Health and Research Conference at Western University, London ON
Dual genetic diagnoses identified in a large family with brachydactyly type A1 and insulin resistance using whole-exome sequencing (October 20, 2017) Presented at the American Society of Human Genetics 2017 Annual Meeting at the Orange County Convention Center, Orlando USA
Determining the genetic basis of rare diseases using whole-exome sequencing: Brachydactyly type A1 (June 20, 2017) Presented at the Robarts Research Retreat at Kings University College, London ON *Won the “Best Poster Award” at the conference
Ultra rare androgen receptor mutations in metabolic phenotypes (June 20, 2017) Presented at the Robarts Research Retreat at Kings University College, London ON
Determining the genetic basis of rare diseases using whole-exome sequencing: Brachydactyly type A1 (April 23, 2017) Presented at the Canadian Human and Statistical Genetics Meeting at Le Chateau Frontenac, Quebec City QC
Ultra rare androgen receptor mutations in metabolic phenotypes (March 28, 2017) Presented at London Health Research Day 2017 at the Convention Centre, London ON
Determining the molecular basis of rare disorders using whole-exome sequencing (January 20, 2017) Presented at the Harold B. Stewart Memorial Lecture at Western University, London ON
Absence of Protective APOC3 Mutations in Dyslipidemic Patients (August 2014) Presented at Western University’s Biochemistry Undergraduate Summer Research Program (BUSRP) Presentation Day
164
ORAL PRESENTATIONS
Novel CNVs in patients with inherited lipodystrophy (June 13, 2018) Presented at the Department of Biochemistry Graduate Student Spring Symposium at Western University, London ON
The identification of novel CNVs in patients with inherited lipodystrophy (June 11, 2018) Presented at the International Symposium on Atherosclerosis at the Toronto Metro Convention Centre, Toronto ON
The identification of novel CNVs in patients with inherited lipodystrophy (June 1, 2018) Presented at the Robarts Research Retreat at King’s University College, London ON * Won a monetary award ($100) and my name engraved on a plaque
Connecting extreme ends of the spectrum: obesity and lipodystrophy (January 10, 2018) Presented at the Molecular Data Club at Robarts Research Institute, London ON
Genetic testing: finding the needle in a haystack (September 29, 2017) Presented with Strong Brains, Strong Minds, Strong Muscles at the Kiwanis Senior’s Centre, London ON
Determining the genetic basis of rare diseases using whole-exome sequencing: Brachydactyly type A1 (June 20, 2017) Presented at the Robarts Research Retreat at King’s University College, London ON
Determining the genetic basis of rare diseases using whole-exome sequencing (May 31, 2017) Presented at the Molecular Data Club at Robarts Research Institute, London ON
Determining the genetic basis of rare diseases using whole-exome sequencing: Brachydactyly type A1 (April 22-25, 2017) Selected to present at the Canadian Human and Statistical Genetics Meeting at Le Chateau Frontenac, Quebec City QC
Gene hunting: determining the molecular basis of lipodystrophy using whole-exome sequencing (March 21-22, 2015) Presented at Ontario Biology Day at Carleton University, Ottawa ON
165
CONFERENCES/EDUCATIONAL EVENTS
American Society of Human Genetics 2017 Annual Conference (presented) October 2017 Hosted by the American Society of Human Genetics at the Orange County Convention Centre, Orlando USA
Robarts Research Retreat (presented) June 2017 Hosted by Robarts Research Institute at King’s University College, London ON
Sixth Annual Canadian Human and Statistical Genetics Meeting (presented) April 2017 Hosted by the Canadian Institute of Health Research, Le Chateau Frontenac, Quebec City QC
London Health Research Day (presented) March 2017 Hosted by Schulich School of Medicine and Dentistry, at the Convention Centre, London ON
Harold B. Stewart Memorial Lecture (presented) January 2017 Schulich School of Medicine and Dentistry, Western University, London ON
Genetics in Your Practice Education Day (participated) November 2016 Hosted by the Medical Genetics Program of Southwestern Ontario, at the Sheraton, London ON
Ontario Biology Day (presented) March 2015 Carleton University, Ottawa ON
Biology and Environmental Sciences Research Day (presented) March 2015 Department of Biology, Western University, London ON
166
VOLUNTEERING
Schulich Graduate Student Council Representative July 2017 – present LHSC University Hospital, London ON Representative for the Biochemistry Department in the council The council is responsible for meeting every month, informing every department of the changes happening within Schulich School of Medicine and Dentistry, and representing all departmental graduate students during voting and decision- making The Representative is responsible for relaying all information to the Department and responding to student inquires
Crisis and Support Line (Counselling) September 2014 – present ANOVA, formerly known as the Sexual Assault Centre London and Women’s Community House, London ON Volunteer on the Crisis and Support Line providing non-directive, non- judgmental support and information to anyone who has been directly or indirectly impacted by sexual violence or domestic violence
Big Bike Participant/Volunteer June 20, 2017 Western University, London ON Raised funds and participated in the annual Big Bike event, where all proceeds go to the Heart and Stroke Foundation Also assisted at the Waffle Breakfast event hosted by Robarts Research Institute to raise additional funds
Discovery Day 2018 Host May 4, 2018 Western University, London ON Helped run the Biochemistry Laboratory Workshop for high school students at Discovery Day at Western University
Medical Genetics Sponsored Studentship November 2017 – April 2018 Medical Genetics, LHSC Victoria Hospital, London ON Responsibilities include: assisting genetic counsellors with generating pedigrees, assessing lifetime risks of cancer using IBIS and BOADICEA, and prioritizing patients for appointments Opportunities also include shadowing the Genetic Counsellors during new clinic appointments and follow-ups Currently involved in updating the website content
Food Services: Menu Pick Up/Patient Visiting January 2017 – November 2017 LHSC University Hospital, London ON Duties included: picking up menus from all inpatient floors in the hospital, going room-to-room to visit patients and pick up outstanding menus, delivering cards, and helping patients complete their daily menus
167
Panel Interviewee June 19, 2017 London Central Secondary School, London ON Attended Grade 12 English classes to answer any questions about life beyond high school Sat on a panel with other volunteers and provided guidance and support
Big Bike Participant/Volunteer June 14, 2017 Western University, London ON Raised funds and participated in the annual Big Bike event, where all proceeds go to the Heart and Stroke Foundation Also assisted at the Waffle Breakfast event hosted by Robarts Research Institute to raise additional funds
Magic Wand Planning Committee January 2017 – June 2017 Ronald McDonald House of Southwestern Ontario, London ON On the organizing committee for the 2nd biennial Storybook Ball, a night of dinner and dancing and magical fun to raise money for the Ronald McDonald House Responsibilities included: obtaining sponsorships and donations, planning and setting up the event, and running the event
Discovery Day 2017 Host May 12, 2017 Western University, London ON Helped run the Biochemistry Laboratory Workshop for high school students at Discovery Day at Western University
President September 2016 – April 2017 Western Aikido Club, Western University, London ON As the Sport Western Aikido Club’s President, I planned, organized and carried out daily presidential responsibilities such as financial accounting, email communication to other executive members, and weekly communication with the Western Rec Centre I also assisted in planning club events, and attended Rec Centre Presidential Meetings
Unit Support (Surgical Outpatients) April 2012 – January 2017 LHSC University Hospital, London ON As a unit support volunteer in surgical outpatients, I assisted with greeting and welcoming patients, visitors and staff I also provided assistance to surgeons, residents, nurses, and occupational therapists by putting together operation room kits, wound kits and breast surgery care kits
LAMP Presenter (Graduate Student Meet and Greet) November 2016 Western University, London ON For the LAMP meet and greet, I sat on the panel and answered questions from undergraduate students pertaining to research and graduate school
168
Registration Volunteer (Genetics in Your Practice Education Day) November 2016 Hosted by the Medical Genetics Program of Southwestern Ontario, at the Sheraton, London ON For the Medical Genetics Education Day, I was in charge of registration for all health care professionals and attendees, and organizing event handouts and CME certificates
Vice President/Communications September 2015 – April 2016 Western Aikido Club, Western University, London ON As the Vice President, I was responsible for planning, organizing and carrying out daily club responsibilities, and maintaining club communications
Research Assistant September 2015 – April 2016 Dr. Hegele, Blackburn Cardiovascular Genetics Lab, Robarts Research Institute, London ON I helped run various scientific experiments, assisted in the writing of a provisional patent, and assisted the Medical Administrator with clerical duties
Child Mentor (Stand by Me Program) September – April 2013 and 2014 Thames Valley District School Board, London ON Acted as a caring adult mentor for at-risk children under the age of 12 Committed two hours a week to my mentee for one-on-one meetings, and provided friendship, reinforcement, academic support and encouragement
Daffodil Sales April 2011, 2012, 2013 Canadian Cancer Society, London ON Involved in the Daffodil Month sales to raise money for the Canadian Cancer Society