DOCSLIB.ORG

3-Phosphoinositide-Dependent Kinase 1 Controls Breast Tumor

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
3-Phosphoinositide-Dependent Kinase 1 Controls Breast Tumor Volume 14 Number 8 August 2012 pp. 719–731 719 www.neoplasia.com † † Paolo Armando Gagliardi*, , Laura di Blasio*, , 3-Phosphoinositide–Dependent † ‡ † Francesca Orso , ,§, Giorgio Seano*, , † † ‡ Kinase 1 Controls Breast Tumor Roberto Sessa*, ,DanielaTaverna, ,§, † Growth in a Kinase-Dependent but Federico Bussolino*, ,§ and Luca Primo*,§,¶ 1,2 Akt-Independent Manner *Institute for Cancer Research and Treatment, Candiolo, Italy; †Department of Oncological Sciences, University of Torino, Torino, Italy; ‡Molecular Biotechnology Center, Torino, Italy; §Center for Complex Systems in Molecular Biology and Medicine, Torino, Italy; ¶Department of Clinical and Biological Sciences, University of Torino, Torino, Italy Abstract 3-Phosphoinositide–dependent protein kinase 1 (PDK1) is the pivotal element of the phosphatidylinositol 3 kinase (PI3K) signaling pathway because it phosphorylates Akt/PKB through interactions with phosphatidylinositol 3,4,5 phosphate. Recent data indicate that PDK1 is overexpressed in many breast carcinomas and that alterations of PDK1 are critical in the context of oncogenic PI3K activation. However, the role of PDK1 in tumor progression is still controversial. Here, we show that PDK1 is required for anchorage-independent and xenograft growth of breast cancer cells harboring either PI3KCA or KRAS mutations. In fact, PDK1 silencing leads to increased anoikis, re- duced soft agar growth, and pronounced apoptosis inside tumors. Interestingly, these phenotypes are reverted by PDK1 wild-type but not kinase-dead mutant, suggesting a relevant role of PDK1 kinase activity, even if PDK1 is not relevant for Akt activation here. Indeed, the expression of constitutively active forms of Akt in PDK1 knock- down cells is unable to rescue the anchorage-independent growth. In addition, Akt down-regulation and pharma- cological inhibition do not inhibit the effects of PDK1 overexpression. In summary, these results suggest that PDK1 may contribute to breast cancer, even in the absence of PI3K oncogenic mutations and through both Akt-dependent and Akt-independent mechanisms. Neoplasia (2012) 14, 719–731 Introduction The phosphatidylinositol 3 kinase (PI3K) pathway is one of the most Abbreviations: PDK1, 3-phosphoinositide–dependent protein kinase 1; PI3K, phospha- important pathways in cancer metabolism and growth [1,2]. Class IA tidylinositol 3 kinase; PIP3, phosphatidylinositol 3,4,5 triphosphate; PH, pleckstrin PI3Ks, deregulated in cancer, are heterodimers composed of a regu- homology; shRNA, short hairpin RNA Address all correspondence to: Luca Primo, PhD, Institute for Cancer Research and latory (p85) and a catalytic (p110) subunit. Binding of p85 to tyro- Treatment, Candiolo, Str. Prov. 142 Km. 3.95, 10060 Candiolo, Italy. E-mail: luca. sine kinase receptors removes the inhibitory effect of p85 on p110, [email protected] resulting in the full activation of PI3K. The activated kinase catalyzes 1This work was supported in part by grants of Italian Association for Cancer Research “ ” the phosphorylation of phosphatidylinositol 4,5 biphosphate to (to F.B. and L.P.), Intramural Grant 5 ×mille 2008 Fondazione Piemontese per la Ricerca sul Cancro ONLUS (L.P.), Regione Piemonte (Ricerca Tecnologie Convergenti phosphatidylinositol 3,4,5 triphosphate (PIP3). PIP3 acts as a dock- 2007, Grant PHOENICS, Piattaforme Tecnologiche per le Biotecnologie Grant Druidi, ing site for 3-phosphoinositide–dependent kinase 1 (PDK1) and Akt Industrial Research 2009 Grants BANP) and eLab Italian Fondazione CRT-Torino that, in turn, phosphorylates their substrates, including mammalian (F.B.), and Fondo per gli Investimenti della Ricerca di Base Grant RBAP11BYNP NEWTON (L.P. and F.B.), Compagnia San Paolo (to D.T.). target of rapamycin and glycogen synthase kinase β (GSK3β) [3]. 2 This article refers to supplementary materials, which are designated by Figures W1 to PDK1 is a cytoplasmic kinase that phosphorylates serine/threonine W7 and are available online at www.neoplasia.com. residues in the activation segment of AGC (cAMP-dependent protein Received 24 May 2012; Revised 25 June 2012; Accepted 28 June 2012 kinases A, cGMP-dependent protein kinases G, and phospholipid- Copyright © 2012 Neoplasia Press, Inc. All rights reserved 1522-8002/12/$25.00 dependent protein kinases C) family protein, initially discovered as DOI 10.1593/neo.12856 720 PDK1 Regulates Breast Tumorigenesis Gagliardi et al. Neoplasia Vol. 14, No. 8, 2012 the kinase that phosphorylates Akt on threonine 308 upon binding to Gibco, Life Technologies, Rockville, MD) and 200 U/ml penicillin PIP3 [4–6]. In fact, PDK1 is able to recognize the phosphoinositides and 200 μg/ml streptomycin (catalog no. 67513; Sigma-Aldrich). phosphorylated in position 3 by PI3K, through its C-terminal pleck- strin homology (PH) domain. This event localizes PDK1 to the plasma Soft Agar Colony Formation Assay membrane where it phosphorylates Akt [6]. PDK1 substrates lacking One milliliter of bottom layer constituted by 0.7% agar (catalog the PH domain, such as p70S6K [7], SGK [8], RSK [9], and PKC iso- no. 214220; Becton Dickinson, Franklin Lakes, NJ) in DMEM was forms [10], require a different mechanism for their activation: PDK1, spread in each 35-mm-diameter well. A total of 1 × 104 cells were through its PIF-binding pocket, binds the hydrophobic motif on these suspended in 3 ml of DMEM–10% FBS 0.35% agar and spread over substrates, and this leads to their phosphorylation and full activation the bottom layer. A layer of medium (1.5 ml) was added on the gel [4,11]. Furthermore, it has been described that PDK1 binds and reg- layers and substituted every 3 to 4 days until the end of the assay (15- ulates other substrates through kinase-independent mechanisms. 21 days). For the quantification, colonies grown in soft agar were PDK1 has been demonstrated to activate the Ral guanine nucleotide stained with nitrotetrazolium blue chloride (N-6876; Sigma-Aldrich). exchange factors through its noncatalytic N-terminal 50 amino acids High-resolution image acquisitions by ChemiDoc XRS (170-8070; [12] and found to activate Rho-associated coiled-coil contain- Bio-Rad Laboratories, Hercules, CA) were processed and analyzed ing protein kinase 1 (ROCK1) by competing against its inhibitor using the ImageJ software (http://rsbweb.nih.gov/ij/). Only colonies RhoE [13]. with diameter bigger than 100 μm were counted. The PI3K pathway is often aberrantly activated in breast cancer with mutations occurring in up to one quarter of breast cancers. Anoikis and Apoptosis Assay PIK3CA activating mutations and PTEN loss are the most frequent 5 events in human breast tumors, whereas a significant role for Akt1 For the anoikis assay, 4 × 10 MDA-MB-231 or T-47D were mutations is also emerging [14]. Moreover, most of the elements seeded in 35-mm dishes coated with poly-hydroxy-ethyl-methacrylate (catalog no. P3942; Sigma-Aldrich) in medium with 10% FBS. For of this pathway are found hyperactive or amplified in breast tumors: 5 PIK3CA [15], PIK3CB [16], Akt1 [17], Akt2 [18], PDK1 [19], the apoptosis assay, 4 × 10 MDA-MB-231 or T-47D were seeded in p70S6 kinase [20], and IKBKE [21]. Such alterations strongly corre- 35-mm dishes in the absence of FBS. After 2 days, the percentage of late with a more aggressive phenotype and a poor prognosis. apoptotic cells was evaluated by FACS analysis using M30 Cyto- Recently, PDK1 was found overexpressed both at the protein and DEATH (12-140-349-001; Roche Applied Science, Indianapolis, IN), or alternatively, the rate of apoptosis was evaluated using Cell mRNA levels in most human breast cancer with frequent genomic plus amplifications. Moreover, its Ser-241 phosphorylated form was Death Detection ELISA (11-774-425-001; Roche). found enriched in human breast carcinoma versus benign tumors [22,23]. Despite this, forced PDK1 expression has been described Xenograft Assay to be oncogenic only in the Comma-1D murine mammary cell model MDA-MB-231 cells were inoculated subcutaneously in nude [24,25], whereas in breast-derived cell lines, it is able to potentiate the athymic mice (5 × 106 cells) or in NOD/SCID mice (3 × 106 cells). oncogenic effects of upstream lesions but not to transform per se [19]. After 30 days, mice were killed, and tumor weight was evaluated. In mice, its oncogenic effect seems to function by altering the PI3K The tumors were cryopreserved by OCT embedding at −80°C. Cryo- pathway because PTEN-driven tumors were severely attenuated in sections of 15 μm thickness were stained with In Situ Cell Death PDK1 knockout and hypomorphic mice. However, results obtained Detection Kit, TMR red (12-156-792-910; Roche) for the evaluation with human cancer cell lines [26] together with the involvement of of apoptotic cells. PDK1 in resistance mechanisms to several anticancer drugs such as gemcitabine, trastuzumab, tamoxifen, and rapamicin suggest that Statistical Analysis – PDK1 regulates others oncogenic signaling pathways [27 30]. Data were compared using a Student’s t test. Results were expressed Here, we show that PDK1 regulates anchorage-independent as mean and SD of at least three independent experiments each in growth, resistance to anoikis, and tumor formation in breast cancer triplicate. The EC50 of log[inhibitor]-versus-response curves was cal- cells not only harboring PIK3CA genetic alterations but also in the culated with the nonlinear regression tool of the GraphPad 5 Prism absence of these lesions. software (GraphPad, La Jolla, CA). Materials and Methods PDK1, Akt, and PI3K Inhibitors BX-795 (catalog no. 1390; Axon Medchem, Groningen, the Cell Lines Netherlands), OSU-03012 (catalog no. 1-800-364-9897; Cayman 293T (CRL-11268), MDA-MB-231 (HTB-26), and T-47D Chemical, Ann Arbor, MI), LY294002 (catalog no. 9901; Cell Sig- (HTB-133) cell lines were obtained from ATCC resource center naling, Danvers, MA), and Akt inhibitor VIII (catalog no. 124017; (http://www.atcc.org). Phoenix-GP was provided by Garry P. Nolan Calbiochem, Darmstadt, Germany) were reconstituted in DMSO at − Lab (Stanford, CA). The MDA-MB-231 metastatic variant, LM2- 10 mM.
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Targeting the Hippo Pathway in Prostate Cancer: What's New?
    cancers Review Targeting the Hippo Pathway in Prostate Cancer: What’s New? Kelly Coffey Solid Tumour Target Discovery Laboratory, Translational and Clinical Research Institute, Newcastle University Centre for Cancer, Faculty of Medical Sciences, Newcastle University, Newcastle upon Tyne NE2 4HH, UK; [email protected] Simple Summary: Prostate cancer is the most commonly diagnosed cancer in men in the UK, accounting for the deaths of over 11,000 men per year. A major problem in this disease are tumours which no longer respond to available treatments. Understanding how this occurs will reveal new ways to treat these patients. In this review, the latest findings regarding a particular group of cellular factors which make up a signalling network called the Hippo pathway will be described. Accumulating evidence suggests that this network contributes to prostate cancer progression and resistance to current treatments. Identifying how this pathway can be targeted with drugs is a promising area of research to improve the treatment of prostate cancer. Abstract: Identifying novel therapeutic targets for the treatment of prostate cancer (PC) remains a key area of research. With the emergence of resistance to androgen receptor (AR)-targeting therapies, other signalling pathways which crosstalk with AR signalling are important. Over recent years, evidence has accumulated for targeting the Hippo signalling pathway. Discovered in Drosophila melanogasta, the Hippo pathway plays a role in the regulation of organ size, proliferation, migration and invasion. In response to a variety of stimuli, including cell–cell contact, nutrients and stress, a kinase cascade is activated, which includes STK4/3 and LATS1/2 to inhibit the effector proteins YAP and its paralogue TAZ.
    [Show full text]
  • MRT67307 Kinase Inhibitor; TBK1 and Ikkε Inhibitor Catalog Code: Inh-Mrt for Research Use Only Version 19E07-NJ
    MRT67307 Kinase inhibitor; TBK1 and IKKε inhibitor Catalog Code: inh-mrt https://www.invivogen.com/mrt67307 For research use only Version 19E07-NJ PRODUCT INFORMATION CHEMICAL PROPERTIES Contents CAS Number: 1190378-57-4 (free base) • 10 mg MRT67307 (hydrochloride) Formula: C26H36N6O2 . x HCl Molecular weight: 464.60 g/mol (free base) Storage and stability Solubility: 15 mg/ml H2O - MRT67307 is provided as a dried powder and shipped at room temperature. Upon receipt, store product at -20 °C. METHODS - Upon resuspension of MRT67307 prepare aliquots and store Preparation of stock solution (10 mg/ml) at -20 °C. Resuspended product is stable for at least 3 months when 1. Add 1ml of endotoxin-free H O properly stored. 2 2. Use immediately or store aliquots at -20 °C - Avoid repeated freeze-thaw cycles. 3. Prepare dilutions using sterile endotoxin-free water Quality control Working concentration range: 1 - 20 µM (for cell culture assays) - Purity: ≥95% (UHPLC) - Inhibition of TBK1/IKKε by MRT67307 has been confirmed using Inhibition of TBK1/IKKε by MRT67307 in a cellular assay cellular assays. Below is a protocol using InvivoGen’s THP1-Dual™ cells for studying - Absence of bacterial contamination (e.g. lipoproteins and endotoxins) specific inhibition of the IRF pathway by MRT67307. These cells has been confirmed using HEK-Blue™ hTLR2 and HEK-Blue™ hTLR4 cells. express both an inducible Lucia luciferase reporter and an inducible secreted embryonic alkaline phosphatase (SEAP) reporter to measure PRODUCT DESCRIPTION the activation of the IRF or NF-κB pathways, respectively. Changes in MRT67307 is a potent, reversible kinase inhibitor, and a derivative the Lucia expression levels upon inhibition can be readily assessed by of BX7951.
    [Show full text]
  • Mechanisms of IKBKE Activation in Cancer Sridevi Challa University of South Florida, [email protected]
    University of South Florida Scholar Commons Graduate Theses and Dissertations Graduate School 1-29-2017 Mechanisms of IKBKE Activation in Cancer Sridevi Challa University of South Florida, [email protected] Follow this and additional works at: http://scholarcommons.usf.edu/etd Part of the Biochemistry Commons, Biology Commons, and the Cell Biology Commons Scholar Commons Citation Challa, Sridevi, "Mechanisms of IKBKE Activation in Cancer" (2017). Graduate Theses and Dissertations. http://scholarcommons.usf.edu/etd/6617 This Dissertation is brought to you for free and open access by the Graduate School at Scholar Commons. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Scholar Commons. For more information, please contact [email protected]. Mechanisms of IKBKE Activation in Cancer by Sridevi Challa A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Cell Biology, Microbiology, and Molecular Biology College of Arts and Sciences University of South Florida Major Professor: Mokenge P. Malafa, M.D. Gary Reuther, Ph.D. Eric Lau, Ph.D. Domenico Coppola, M.D. Date of Approval: January 12, 2017 Keywords: EGFR, Olaparib, resistance Copyright © 2017, Sridevi Challa DEDICATION This dissertation is dedicated to my kind and courageous mother. ACKNOWLEDGMENTS I would like to acknowledge Dr. Cheng for trusting me with completion of the projects. I would like to thank him for giving me the freedom to explore any aspect of research and always willing to provide the necessary resources and guidance for my projects. I want to also acknowledge Ted and the Cheng lab personnel for their support.
    [Show full text]
  • Cep-2020-00633.Pdf
    Clin Exp Pediatr Vol. 64, No. 5, 208–222, 2021 Review article CEP https://doi.org/10.3345/cep.2020.00633 Understanding the genetics of systemic lupus erythematosus using Bayesian statistics and gene network analysis Seoung Wan Nam, MD, PhD1,*, Kwang Seob Lee, MD2,*, Jae Won Yang, MD, PhD3,*, Younhee Ko, PhD4, Michael Eisenhut, MD, FRCP, FRCPCH, DTM&H5, Keum Hwa Lee, MD, MS6,7,8, Jae Il Shin, MD, PhD6,7,8, Andreas Kronbichler, MD, PhD9 1Department of Rheumatology, Wonju Severance Christian Hospital, Yonsei University Wonju College of Medicine, Wonju, Korea; 2Severance Hospital, Yonsei University College of Medicine, Seoul, Korea; 3Department of Nephrology, Yonsei University Wonju College of Medicine, Wonju, Korea; 4Division of Biomedical Engineering, Hankuk University of Foreign Studies, Yongin, Korea; 5Department of Pediatrics, Luton & Dunstable University Hospital NHS Foundation Trust, Luton, UK; 6Department of Pediatrics, Yonsei University College of Medicine, Seoul, Korea; 7Division of Pediatric Nephrology, Severance Children’s Hospital, Seoul, Korea; 8Institute of Kidney Disease Research, Yonsei University College of Medicine, Seoul, Korea; 9Department of Internal Medicine IV (Nephrology and Hypertension), Medical University Innsbruck, Innsbruck, Austria 1,3) The publication of genetic epidemiology meta-analyses has analyses have redundant duplicate topics and many errors. increased rapidly, but it has been suggested that many of the Although there has been an impressive increase in meta-analyses statistically significant results are false positive. In addition, from China, particularly those on genetic associa tions, most most such meta-analyses have been redundant, duplicate, and claimed candidate gene associations are likely false-positives, erroneous, leading to research waste. In addition, since most suggesting an urgent global need to incorporate genome-wide claimed candidate gene associations were false-positives, cor- data and state-of-the art statistical inferences to avoid a flood of rectly interpreting the published results is important.
    [Show full text]
  • Iκb Kinase Ε and TANK-Binding Kinase 1 Activate AKT by Direct Phosphorylation
    IκB kinase ε and TANK-binding kinase 1 activate AKT by direct phosphorylation Xiaoduo Xiea, Denghong Zhangb, Bin Zhaoa, Min-Kan Lua, Ming Youc, Gianluigi Condorellib, Cun-Yu Wangd, and Kun-Liang Guana,1 aDepartment of Pharmacology and Moores Cancer Center and bDepartment of Medicine, University of California at San Diego, La Jolla, CA 92093; cCancer Center, Medical College of Wisconsin, Milwaukee, WI 53226; and dLaboratory of Molecular Signaling, Division of Oral Biology and Medicine, University of California Los Angeles School of Dentistry, Los Angeles, CA 90095 Edited* by Jack E. Dixon, The Howard Hughes Medical Institute, Chevy Chase, MD, and approved March 8, 2011 (received for review October 27, 2010) AKT activation requires phosphorylation of the activation loop The noncanonical IκB kinase ε (IKKε) has been demonstrated (T308) by 3-phosphoinositide-dependent protein kinase 1 (PDK1) to play an essential role in Ras-induced cell transformation, which and the hydrophobic motif (S473) by the mammalian target of requires activation of both the Raf-MEK-ERK and PI3K-AKT rapamycin complex 2 (mTORC2). We recently observed that pathways (20). Of particular interest is the observation that IKKε phosphorylation of the AKT hydrophobic motif was dramatically can functionally replace the requirement of AKT to support cell elevated, rather than decreased, in mTOR knockout heart tissues, transformation, which suggests that IKKε may act as an AKT indicating the existence of other kinase(s) contributing to AKT regulator or effector. Consistently, IKKε was found to be ampli- phosphorylation. Here we show that the atypical IκB kinase ε and fied in several types of human cancer, including ovarian cancer TANK-binding kinase 1 (IKKε/TBK1) phosphorylate AKT on both the and breast cancer (20, 21).
    [Show full text]
  • Molecular Mechanisms Underlying Innate Immune Kinase
    MOLECULAR MECHANISMS UNDERLYING INNATE IMMUNE KINASE TBK1-DRIVEN ONCOGENIC TRANSFORMATION APPROVED BY SUPERVISORY COMMITTEE Michael A White, Ph.D. Melanie H. Cobb, Ph.D. Lawrence Lum, Ph.D. John D. Minna, M.D. DEDICATION This work is dedicated to my mother and Arlene for their love and support. ACKNOWLEDGEMENTS I am very grateful to my mentor, Dr. Michael White, for his continuous support and guidance through the entire study. I really appreciate his inspiration, patience, and generosity. I would also like to thank my committee members, Dr. Cobb, Dr. Lum, and Dr. Minna, for their invaluable advice and discussion. I thank all the White lab members and my friends for their help, suggestion, and discussion. Particularly, I would like to thank Rosie, Michael, Brian, Tzuling, and Malia for their long-term support and collaboration. I would also like to thank my friends, Veleka, Pei-Ling, Jen-Chieh, Shu-Yi, Chih-Chiang, Jen-Shuan, Yi-Chun, and Yu-San for their friendship. I am grateful to Drs. Rolf Brekken, Zhijian James Chen, Xuetao Cao, Philip Tsichlis, Charles Yeaman, William Hahn, Keqiang Ye, and Shu-Chan Hsu, Bing Su, Dos Sarbassov, Mark Magnuson, David Sabatini, Thomas Tan, and Bert Vogelstein for many of the reagents used in these studies. Finally, and most importantly, I would like to thank my mother and Arlene for their unending support and encouragement. MOLECULAR MECHANISMS UNDERLYING INNATE IMMUNE KINASE TBK1-DRIVEN ONCOGENIC TRANSFORMATION by YI-HUNG OU DISSERTATION Presented to the Faculty of the Graduate School of Biomedical Sciences The University of Texas Southwestern Medical Center at Dallas In Partial Fulfillment of the Requirements For the Degree of DOCTOR OF PHILOSOPHY The University of Texas Southwestern Medical Center at Dallas Dallas, Texas April, 2013 Copyright by YI-HUNG OU, 2013 All Rights Reserved MOLECULAR MECHANISMS UNDERLYING INNATE IMMUNE KINASE TBK1-DRIVEN ONCOGENIC TRANSFORMATION Publication No.
    [Show full text]
  • BMK1 Kinase Suppresses Epithelial–Mesenchymal Transition Through the Akt/Gsk3b Signaling Pathway
    Published OnlineFirst January 26, 2012; DOI: 10.1158/0008-5472.CAN-11-2055 Cancer Tumor and Stem Cell Biology Research BMK1 Kinase Suppresses Epithelial–Mesenchymal Transition through the Akt/GSK3b Signaling Pathway Runqiang Chen, Qingkai Yang, and Jiing-Dwan Lee Abstract Epithelial–mesenchymal transition (EMT) plays a crucial role in the development of cancer metastasis. The – jun mitogen-activated protein (MAP) kinases extracellular signal regulated kinase, c- -NH2-kinase, and p38 have been implicated in promoting EMT, but a role for the MAP kinase BMK1 has not been studied. Here, we report that BMK1 signaling suppresses EMT. BMK1 elevation augmented E-cadherin–mediated cell–cell adhesion, downregulated mesenchymal markers, and decreased cell motility. Conversely, BMK1 silencing attenuated E-cadherin–mediated cell–cell adhesion, upregulated mesenchymal markers, and stimulated cell motility. BMK1 depletion dramatically increased the accumulation of endogenous Snail in the nuclear compartment. Snail accumulation was mediated by Akt/GSK3b signaling, which was activated by a modulation in the expression of the mTOR inhibitor DEPTOR. In support of these observations, BMK1 depletion promoted metastasis in vivo. Together, our findings reveal a novel mechanism of EMT control via mTOR/Akt inhibition that suppresses cancer metastasis. Cancer Res; 72(6); 1–9. Ó2012 AACR. Introduction that control cancer progression. The majority of mitogenic/ – The process of epithelial–mesenchymal transition (EMT) oncogenic signal activated signaling pathways stimulate is critically involved in the progression of human diseases, EMT(2).Inparticular,3ofthe4mitogen-activatedprotein such as cancer metastasis and fibrosis (1). EMT involves (MAP) kinase pathways described to date (namely, Erk, JNK, profound phenotypic changes that include loss of cell–cell and p38; ref.
    [Show full text]
  • Novel Regulation of Mtor Complex 1 Signaling by Site-Specific Mtor Phosphorylation
    Novel Regulation of mTOR Complex 1 Signaling by Site-Specific mTOR Phosphorylation by Bilgen Ekim Üstünel A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Cell and Developmental Biology) in The University of Michigan 2012 Doctoral Committee: Assistant Professor Diane C. Fingar, Chair Associate Professor Billy Tsai Associate Professor Anne B. Vojtek Assistant Professor Patrick J. Hu Assistant Professor Ken Inoki “Our true mentor in life is science.” (“Hayatta en hakiki mürşit ilimdir.”) Mustafa Kemal Atatürk, the founder of Turkish Republic © Bilgen Ekim Üstünel 2012 Acknowledgements This thesis would not have been possible without the enormous support and encouragement of my Ph.D. advisor Diane C. Fingar. I am sincerely thankful for her research insight and guidance during my Ph.D. training. I would like to express my great appreciation to Billy Tsai, Anne B. Vojtek, Ken Inoki, and Patrick J. Hu for serving on my thesis committee, whose advice and help have been valuable. I would like to thank all members of the Fingar, Tsai, and Verhey labs for the discussion in our group meetings. I also would like to thank the CDB administrative staff, especillay Kristen Hug, for their help. I thank Ed Feener for performing the liquid chromatography tandem mass spectrometry analysis to identify novel phosphorylation sites on mTOR and Steve Riddle for performing the in vitro kinome screen to identify candidate kinases for mTOR S2159 phosphorylation site. I thank Brian Magnuson, Hugo A. Acosta-Jaquez, and Jennifer A. Keller for contributing to my first-author paper published in Molecular and Cellular Biology Journal in 2011.
    [Show full text]
  • PRODUCTS and SERVICES Target List
    PRODUCTS AND SERVICES Target list Kinase Products P.1-11 Kinase Products Biochemical Assays P.12 "QuickScout Screening Assist™ Kits" Kinase Protein Assay Kits P.13 "QuickScout Custom Profiling & Panel Profiling Series" Targets P.14 "QuickScout Custom Profiling Series" Preincubation Targets Cell-Based Assays P.15 NanoBRET™ TE Intracellular Kinase Cell-Based Assay Service Targets P.16 Tyrosine Kinase Ba/F3 Cell-Based Assay Service Targets P.17 Kinase HEK293 Cell-Based Assay Service ～ClariCELL™ ～ Targets P.18 Detection of Protein-Protein Interactions ～ProbeX™～ Stable Cell Lines Crystallization Services P.19 FastLane™ Structures ～Premium～ P.20-21 FastLane™ Structures ～Standard～ Kinase Products For details of products, please see "PRODUCTS AND SERVICES" on page 1～3. Tyrosine Kinases Note: Please contact us for availability or further information. Information may be changed without notice. Expression Protein Kinase Tag Carna Product Name Catalog No. Construct Sequence Accession Number Tag Location System HIS ABL(ABL1) 08-001 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) ABL(ABL1) BTN BTN-ABL(ABL1) 08-401-20N Full-length 2-1130 NP_005148.2 N-terminal DYKDDDDK Insect (sf21) ABL(ABL1) [E255K] HIS ABL(ABL1)[E255K] 08-094 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) HIS ABL(ABL1)[T315I] 08-093 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) ABL(ABL1) [T315I] BTN BTN-ABL(ABL1)[T315I] 08-493-20N Full-length 2-1130 NP_005148.2 N-terminal DYKDDDDK Insect (sf21) ACK(TNK2) GST ACK(TNK2) 08-196 Catalytic domain
    [Show full text]
  • Elucidating the Regulation and Effectors of the Breast Cancer Oncogene, Ikkepsilon
    Elucidating the Regulation and Effectors of the Breast Cancer Oncogene, IKKepsilon The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Zhou, Alicia. 2012. Elucidating the Regulation and Effectors of the Breast Cancer Oncogene, IKKepsilon. Doctoral dissertation, Harvard University. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:10086028 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA 2012 – Alicia Yiran Zhou All rights reserved. Dissertation Advisor: Dr. William C. Hahn Alicia Yiran Zhou Elucidating the regulation and effectors of the breast cancer oncogene, IKKepsilon Abstract The IkappaB kinase epsilon (IKKepsilon, IKKi, IKBKE) is both a regulator of innate immunity and a breast cancer oncogene that is amplified and overexpressed in ~30% of breast cancers. IKKepsilon promotes malignant transformation through the activation of NF-kappaB signaling. In addition, breast cancers that harbor amplifications in the IKBKE gene are dependent on IKKepsilon protein expression for survival. IKKepsilon has been characterized as a non-canonical inhibitor of kappaB kinase (IKK) that activates both the interferon response pathway and NF- kappaB signaling in innate immunity. In this dissertation, I explore both the regulation and effectors of the IKKepsilon kinase in the context of malignant transformation. I found that IKKepsilon is modified and regulated by K63-linked polyubiquitination, a proteasome- and degradation-independent form of ubiquitination, at Lysine 30 and Lysine 401.
    [Show full text]
  • The Breast Cancer Oncogene Ikke Coordinates Mitochondrial Function and Serine Metabolism
    Article The breast cancer oncogene IKKe coordinates mitochondrial function and serine metabolism Ruoyan Xu1,†, William Jones1,†, Ewa Wilcz-Villega1, Ana SH Costa2,3, Vinothini Rajeeve4, Robert B Bentham5,6, Kevin Bryson7, Ai Nagano1, Busra Yaman1, Sheila Olendo Barasa1, Yewei Wang1, Claude Chelala1, Pedro Cutillas3, Gyorgy Szabadkai5,6,8 , Christian Frezza2 & Katiuscia Bianchi1,* Abstract 2017). A key step leading to inflammation in both compartments is activation of the transcription factor nuclear factor jB (NFjB), IjBkinasee (IKKe) is a key molecule at the crossroads of inflamma- mediated via canonical or alternative, non-canonical pathways. Key tion and cancer. Known to regulate cytokine secretion via NFjBand players in both pathways are the members of the IjB kinase (IKK) IRF3, the kinase is also a breast cancer oncogene, overexpressed in a family, which, by phosphorylating IjB, induce its proteasome- variety of tumours. However, to what extent IKKe remodels cellular mediated degradation, a step required for the release of NFjB from metabolism is currently unknown. Here, we used metabolic tracer its IjB-imposed cytosolic localisation, thus leading to its nuclear analysis to show that IKKe orchestrates a complex metabolic repro- translocation (Cle´ment et al, 2008). gramming that affects mitochondrial metabolism and consequently Evidence in support of the crucial role played by the IKK family in serine biosynthesis independently of its canonical signalling role. We inflammation-induced malignant transformation was provided by the found that IKKe upregulates the serine biosynthesis pathway (SBP) reduction of tumour incidence following the deletion of the canonical indirectly, by limiting glucose-derived pyruvate utilisation in the TCA IKK family member IKKb in intestinal epithelial and myeloid cells in cycle, inhibiting oxidative phosphorylation.
    [Show full text]