DOCSLIB.ORG

Targeting the Hippo Pathway in Prostate Cancer: What's New?

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Targeting the Hippo Pathway in Prostate Cancer: What's New? cancers Review Targeting the Hippo Pathway in Prostate Cancer: What’s New? Kelly Coffey Solid Tumour Target Discovery Laboratory, Translational and Clinical Research Institute, Newcastle University Centre for Cancer, Faculty of Medical Sciences, Newcastle University, Newcastle upon Tyne NE2 4HH, UK; [email protected] Simple Summary: Prostate cancer is the most commonly diagnosed cancer in men in the UK, accounting for the deaths of over 11,000 men per year. A major problem in this disease are tumours which no longer respond to available treatments. Understanding how this occurs will reveal new ways to treat these patients. In this review, the latest findings regarding a particular group of cellular factors which make up a signalling network called the Hippo pathway will be described. Accumulating evidence suggests that this network contributes to prostate cancer progression and resistance to current treatments. Identifying how this pathway can be targeted with drugs is a promising area of research to improve the treatment of prostate cancer. Abstract: Identifying novel therapeutic targets for the treatment of prostate cancer (PC) remains a key area of research. With the emergence of resistance to androgen receptor (AR)-targeting therapies, other signalling pathways which crosstalk with AR signalling are important. Over recent years, evidence has accumulated for targeting the Hippo signalling pathway. Discovered in Drosophila melanogasta, the Hippo pathway plays a role in the regulation of organ size, proliferation, migration and invasion. In response to a variety of stimuli, including cell–cell contact, nutrients and stress, a kinase cascade is activated, which includes STK4/3 and LATS1/2 to inhibit the effector proteins YAP and its paralogue TAZ. Transcription by their partner transcription factors is inhibited by modulation Citation: Coffey, K. Targeting the of YAP/TAZ cellular localisation and protein turnover. Trnascriptional enhanced associate domain Hippo Pathway in Prostate Cancer: (TEAD) transcription factors are their classical transcriptional partner but other transcription factors, What’s New? Cancers 2021, 13, 611. including the AR, have been shown to be modulated by YAP/TAZ. In PC, this pathway can be https://doi.org/10.3390/cancers dysregulated by a number of mechanisms, making it attractive for therapeutic intervention. This 13040611 review looks at each component of the pathway with a focus on findings from the last year and discusses what knowledge can be applied to the field of PC. Academic Editors: Delila Gasi Tandefelt Keywords: Hippo pathway; prostate cancer; YAP/TAZ; cell signalling Received: 20 December 2020 Accepted: 20 January 2021 Published: 4 February 2021 1. Introduction Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in Prostate cancer (PC) is the most commonly diagnosed cancer in men in the UK, published maps and institutional affil- accounting for the deaths of over 11,000 men per year (Prostate Cancer UK). As an androgen- iations. regulated cancer, initial treatments revolve around targeting the activity of the androgen receptor (AR) which is initially very effective. However, patients will become unresponsive to this treatment and go on to develop castration-resistant PC (CRPC). Treatments for PC have improved over the years with the introduction of second-generation anti-androgens such as enzalutamide; however, treatment relapse is still a problem. Therefore, there is Copyright: © 2021 by the author. still an unmet clinical need to develop novel treatments for CRPC and to understand the Licensee MDPI, Basel, Switzerland. This article is an open access article molecular pathways which lead to this disease status. In addition, with an increase in distributed under the terms and the occurrence of AR-negative neuroendocrine tumours (NEPC) following anti-androgen conditions of the Creative Commons treatments, greater understanding of other cellular signalling pathways will yield novel Attribution (CC BY) license (https:// therapeutic targets for these types of aggressive and fatal tumours. creativecommons.org/licenses/by/ One such signalling pathway that has been gaining significant interest in PC research 4.0/). is the Hippo pathway (Figure1). Indeed, this pathway is proving to be critical in many Cancers 2021, 13, 611. https://doi.org/10.3390/cancers13040611 https://www.mdpi.com/journal/cancers Cancers 2021, 13, x FOR PEER REVIEW 2 of 17 Cancers 2021, 13, 611 2 of 17 One such signalling pathway that has been gaining significant interest in PC research is the Hippo pathway (Figure 1). Indeed, this pathway is proving to be critical in many cancers.cancers. Originally Originally discovered discovered in in the the fruitfly, fruitfly, Drosophila melanogaster [1],[1], its its conservation acrossacross the the species species to to regulate regulate organ organ size, proliferation proliferation and and stem stem cell biology makes its dysregulationdysregulation an an obvious obvious interest interest to to cancer cancer biologists. The The Hippo Hippo pathway pathway is is a a cascade cascade of of kinasekinase enzymes enzymes which, which, in in response response to to various various stimuli stimuli including including cell–cell cell–cell contact, contact, nutrients nutrients andand the the surrounding surrounding microenvironment, microenvironment, inhibi inhibitt downstream downstream effector effector proteins, proteins, namely, namely, YAP/TAZ,YAP/TAZ, toto switchswitch off off transcriptional transcriptional programmes programmes which which promote promote cell growth. cell Critically,growth. Critically,this is not thethis only is not method the only of regulation method forof regulation these effector for proteinsthese effector which themselvesproteins which have themselvesbeen found have to be been altered found in cancers, to be altered including in cancers, PC. including PC. FigureFigure 1.1. TheThe HippoHippo pathway. pathway. In responseIn response to a varietyto a variety of stimuli, of stimuli, upstream upstream kinases STK4/3kinases areSTK4/3 activated are activated by their interaction by their interactionwith SAV to with phosphorylate SAV to phosphorylate LATS1/2 and LATS1/2 MOB1. and LATS MOB1. kinase LATS activity kinase is activated,activity is activated, resulting in resulting phosphorylation in phosphorylation of effector ofproteins effector YAP/TAZ. proteins YAP/TAZ. This results This in results cytoplasmic in cytoplasmic sequestration sequestration and interaction and interaction with the wi chaperoneth the chaperone protein, protein, 14-3-3, in14-3- the 3,cytoplasm in the cytoplasm to inhibit to its inhibit ability toits promoteability to transcription. promote transcription. Further phosphorylation Further phosphorylation of YAP/TAZ of then YAP/TAZ occurs viathen CK1 occurs to result via CK1in β-TrCP-mediated to result in ubiquitinationβ-TrCP-mediated and proteasomalubiquitination degradation. and proteaso Whenmal YAP/TAZ degradation. cannot beWhen phosphorylated, YAP/TAZ itcannot resides be in phosphorylated,the nucleus where it itresides can associate in the withnucleu transcriptions where it factors,can associate such as with Transcriptional transcripti Enhancedon factors, Associate such as DomainTranscriptional (TEAD) Enhanced Associate Domain (TEAD) transcription factors, to stimulate transcription of genes involved in cell proliferation, transcription factors, to stimulate transcription of genes involved in cell proliferation, cell cycle regulation, prevention of cell cycle regulation, prevention of apoptosis, migration and invasion. apoptosis, migration and invasion. Recently,Recently, the the Hippo Hippo pathway pathway and and its its upstream upstream activators activators were were reviewed reviewed in in great great detaildetail [2,3] [2,3] and and its its role role in in PC PC was was nicely nicely reviewed reviewed by by Salem Salem and and Hansen Hansen in in early early 2019 2019 [4]. [4]. However,However, there hashas beenbeen aa burst burst of of activity activity in in this this field field in thein the last last year year and and this this review review will willfocus focus on providing on providing a critical a critical update update in this fast-movingin this fast-moving area of research,area of research, focusing primarilyfocusing primarilyon PC and on identifying PC and identifying where progress where in otherprog cancersress in other could becancers applied could to further be applied advance to furtherour knowledge. advance our knowledge. 2.2. STK4/STK3 STK4/STK3 STK4STK4 (MST1) (MST1) and and STK3 STK3 (MST2) (MST2) are are stress-ac stress-activatedtivated kinases kinases at at the the top top of of the kinase cascadecascade which which will will ultimately ultimately regulate regulate the the activity activity of of effector effector proteins, YAP/TAZ, as as well well asas havinghaving Hippo-independent Hippo-independent effects effects within within the cell. the STK4 cell. is activatedSTK4 is by activated autophospho- by autophosphorylationrylation within its activation within its loop activation at Thr183 loop which at Thr183 in turn which results in turn in results caspase-mediated in caspase- mediatedcleavage undercleavage apoptotic under apoptotic conditions conditions to produce to a produce more activated a more formactivated [5–8 ].form This [5–8]. form Thisis then form able is tothen move able to to the move nucleus to the of nucleus the cell of where the cell it results where init activationresults
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Hidden Targets in RAF Signalling Pathways to Block Oncogenic RAS Signalling
    G C A T T A C G G C A T genes Review Hidden Targets in RAF Signalling Pathways to Block Oncogenic RAS Signalling Aoife A. Nolan 1, Nourhan K. Aboud 1, Walter Kolch 1,2,* and David Matallanas 1,* 1 Systems Biology Ireland, School of Medicine, University College Dublin, Belfield, Dublin 4, Ireland; [email protected] (A.A.N.); [email protected] (N.K.A.) 2 Conway Institute of Biomolecular & Biomedical Research, University College Dublin, Belfield, Dublin 4, Ireland * Correspondence: [email protected] (W.K.); [email protected] (D.M.) Abstract: Oncogenic RAS (Rat sarcoma) mutations drive more than half of human cancers, and RAS inhibition is the holy grail of oncology. Thirty years of relentless efforts and harsh disappointments have taught us about the intricacies of oncogenic RAS signalling that allow us to now get a pharma- cological grip on this elusive protein. The inhibition of effector pathways, such as the RAF-MEK-ERK pathway, has largely proven disappointing. Thus far, most of these efforts were aimed at blocking the activation of ERK. Here, we discuss RAF-dependent pathways that are regulated through RAF functions independent of catalytic activity and their potential role as targets to block oncogenic RAS signalling. We focus on the now well documented roles of RAF kinase-independent functions in apoptosis, cell cycle progression and cell migration. Keywords: RAF kinase-independent; RAS; MST2; ASK; PLK; RHO-α; apoptosis; cell cycle; cancer therapy Citation: Nolan, A.A.; Aboud, N.K.; Kolch, W.; Matallanas, D. Hidden Targets in RAF Signalling Pathways to Block Oncogenic RAS Signalling.
    [Show full text]
  • Phospho-RAF1(S43) Antibody Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab) Catalog # Ap3332a
    9765 Clairemont Mesa Blvd, Suite C San Diego, CA 92124 Tel: 858.875.1900 Fax: 858.622.0609 Phospho-RAF1(S43) Antibody Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab) Catalog # AP3332a Specification Phospho-RAF1(S43) Antibody - Product Information Application DB,E Primary Accession P04049 Other Accession P11345, Q99N57, A7E3S4 Reactivity Human Predicted Bovine, Mouse, Rat Host Rabbit Clonality Polyclonal Isotype Rabbit Ig Clone Names RB11127 Calculated MW 73052 Phospho-RAF1(S43) Antibody - Additional Information Gene ID 5894 Dot blot analysis of Phospho-RAF1-S43 Phospho-specific Pab (Cat.AP3332a) on Other Names nitrocellulose membrane. 50ng of RAF proto-oncogene serine/threonine-protein Phospho-peptide or Non Phospho-peptide per kinase, Proto-oncogene c-RAF, cRaf, Raf-1, dot were adsorbed. Antobodies working RAF1, RAF concentration was 0.5ug per ml. Target/Specificity This RAF1 Antibody is generated from rabbits Phospho-RAF1(S43) Antibody - immunized with a KLH conjugated synthetic phosphopeptide corresponding to amino acid Background residues surrounding S43 of human RAF1. Raf-1 is a MAP kinase kinase kinase (MAP3K) Dilution which functions downstream of the Ras family of DB~~1:500 membrane associated GTPases to which it binds directly. Once activated Raf-1 can phosphorylate Format to activate the dual specificity protein kinases Purified polyclonal antibody supplied in PBS MEK1 and MEK2 which in turn phosphorylate to with 0.09% (W/V) sodium azide. This antibody activate the serine/threonine specific protein is purified through a protein A column, kinases ERK1 and ERK2. Activated ERKs are followed by peptide affinity purification. pleiotropic effectors of cell physiology and play an important role in the control of gene Storage expression involved in the cell division cycle, Maintain refrigerated at 2-8°C for up to 6 apoptosis, cell differentiation and cell migration.
    [Show full text]
  • Machine-Learning and Chemicogenomics Approach Defi Nes and Predicts Cross-Talk of Hippo and MAPK Pathways
    Published OnlineFirst November 18, 2020; DOI: 10.1158/2159-8290.CD-20-0706 RESEARCH ARTICLE Machine -Learning and Chemicogenomics Approach Defi nes and Predicts Cross-Talk of Hippo and MAPK Pathways Trang H. Pham 1 , Thijs J. Hagenbeek 1 , Ho-June Lee 1 , Jason Li 2 , Christopher M. Rose 3 , Eva Lin 1 , Mamie Yu 1 , Scott E. Martin1 , Robert Piskol 2 , Jennifer A. Lacap 4 , Deepak Sampath 4 , Victoria C. Pham 3 , Zora Modrusan 5 , Jennie R. Lill3 , Christiaan Klijn 2 , Shiva Malek 1 , Matthew T. Chang 2 , and Anwesha Dey 1 ABSTRACT Hippo pathway dysregulation occurs in multiple cancers through genetic and non- genetic alterations, resulting in translocation of YAP to the nucleus and activation of the TEAD family of transcription factors. Unlike other oncogenic pathways such as RAS, defi ning tumors that are Hippo pathway–dependent is far more complex due to the lack of hotspot genetic alterations. Here, we developed a machine-learning framework to identify a robust, cancer type–agnostic gene expression signature to quantitate Hippo pathway activity and cross-talk as well as predict YAP/TEAD dependency across cancers. Further, through chemical genetic interaction screens and multiomics analyses, we discover a direct interaction between MAPK signaling and TEAD stability such that knockdown of YAP combined with MEK inhibition results in robust inhibition of tumor cell growth in Hippo dysregulated tumors. This multifaceted approach underscores how computational models combined with experimental studies can inform precision medicine approaches including predictive diagnostics and combination strategies. SIGNIFICANCE: An integrated chemicogenomics strategy was developed to identify a lineage- independent signature for the Hippo pathway in cancers.
    [Show full text]
  • C-RAF (Phospho-Tyr341) Antibody
    Product Datasheet C-RAF (Phospho-Tyr341) Antibody Catalog No: #11668 Package Size: #11668-1 50ul #11668-2 100ul Orders: [email protected] Support: [email protected] Description Product Name C-RAF (Phospho-Tyr341) Antibody Host Species Rabbit Clonality Polyclonal Purification Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodies were purified by affinity-chromatography using epitope-specific phosphopeptide. Non-phospho specific antibodies were removed by chromatogramphy using non-phosphopeptide. Applications WB IHC Species Reactivity Hu Specificity The antibody detects endogenous levels of Raf1 only when phosphorylated at tyrosine 341. Immunogen Type Peptide-KLH Immunogen Description Peptide sequence around phosphorylation site of tyrosine 341 (S-Y-Y(p)-W-E) derived from Human C-RAF . Target Name C-RAF Modification Phospho Other Names C-RAF; C-Raf; CRAF; RAF-1; Accession No. Swiss-Prot#: P04049; NCBI Gene#: 5894; NCBI Protein#: NP_002871.1. SDS-PAGE MW 74kd Concentration 1.0mg/ml Formulation Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Storage Store at -20°C/1 year Application Details Western blotting: 1:500~1:1000 Immunohistochemistry: 1:50~1:100 Images Western blot analysis of extracts from Jurkat cells treated with Paclitaxel using Raf1 (Phospho-Tyr341) Antibody #11668.The lane on the right is treated with the antigen-specific peptide. Address: 8400 Baltimore Ave., Suite 302, College Park, MD 20740, USA http://www.sabbiotech.com 1 Immunohistochemical analysis of paraffin-embedded human pancreas tissue using Raf1 (Phospho-Tyr341) antibody #11668 (left)or the same antibody preincubated with blocking peptide (right).
    [Show full text]
  • Dysfunctional Mechanotransduction Through the YAP/TAZ/Hippo Pathway As a Feature of Chronic Disease
    cells Review Dysfunctional Mechanotransduction through the YAP/TAZ/Hippo Pathway as a Feature of Chronic Disease 1, 2, 2,3, 4 Mathias Cobbaut y, Simge Karagil y, Lucrezia Bruno y, Maria Del Carmen Diaz de la Loza , Francesca E Mackenzie 3, Michael Stolinski 2 and Ahmed Elbediwy 2,* 1 Protein Phosphorylation Lab, Francis Crick Institute, London NW1 1AT, UK; [email protected] 2 Department of Biomolecular Sciences, Kingston University, Kingston-upon-Thames KT1 2EE, UK; [email protected] (S.K.); [email protected] (L.B.); [email protected] (M.S.) 3 Department of Chemical and Pharmaceutical Sciences, Kingston University, Kingston-upon-Thames KT1 2EE, UK; [email protected] 4 Epithelial Biology Lab, Francis Crick Institute, London NW1 1AT, UK; [email protected] * Correspondence: [email protected] These authors contribute equally to this work. y Received: 30 November 2019; Accepted: 4 January 2020; Published: 8 January 2020 Abstract: In order to ascertain their external environment, cells and tissues have the capability to sense and process a variety of stresses, including stretching and compression forces. These mechanical forces, as experienced by cells and tissues, are then converted into biochemical signals within the cell, leading to a number of cellular mechanisms being activated, including proliferation, differentiation and migration. If the conversion of mechanical cues into biochemical signals is perturbed in any way, then this can be potentially implicated in chronic disease development and processes such as neurological disorders, cancer and obesity. This review will focus on how the interplay between mechanotransduction, cellular structure, metabolism and signalling cascades led by the Hippo-YAP/TAZ axis can lead to a number of chronic diseases and suggest how we can target various pathways in order to design therapeutic targets for these debilitating diseases and conditions.
    [Show full text]
  • Egfrviii and Pten Deletion Mutations Influence Genotype-Dependent Kinome Activation
    EGFRvIII and Pten Deletion Mutations Influence Genotype-Dependent Kinome Activation in Immortalized Murine Astrocyte Models of Glioblastoma Madison Butler C. Ryan Miller Lab Abstract Glioblastoma (GBM) is the most common malignant primary brain tumor. Receptor tyrosine kinase (RTK) pathways are frequently mutated in GBM, including alterations in the RTK Epidermal Growth Factor Receptor (EGFR). Moreover, EGFR variant III (EGFRvIII) is the most common activating mutation in GBM. Given its frequency, specificity, and role in promoting gliomagenesis, EGFR dysfunction is a prime target for drug treatment. However, multiple resistance mechanisms, such as co-occurrence of EGFRvIII and deletion of the tumor suppressor PTEN, prevent effective treatment via activation of alternate kinase pathways. To observe the differential kinase activation involved in EGFRvIII- and PTEN loss- driven gliomagenesis and identify potential kinase targets for dual therapy, we examined immortalized murine astrocytes derived from non-germline genetically engineered mouse models expressing four core genotypes: wild-type EGFR + wild- type Pten (C), wild-type EGFR + Pten deletion (CP), EGFRvIII + wild-type Pten (CEv3), and EGFRvIII + Pten deletion (CEv3P). We used RNA sequencing and multiplexed inhibitor bead affinity chromatography and mass spectrometry (MIB-MS) to determine the baseline transcriptomes and kinomes of each genotype. We determined that cell lines exhibited genotype- dependent baseline RNA expression and kinase activity as a result of EGFRvIII and/or Pten deletion relative to C astrocytes and across genotypes. We observed several differentially- activated kinases that represent potential targets for dual treatment with EGFR TKI. We are currently examining changes in the kinome profile of each cell line after both acute and chronic treatment with tyrosine kinase inhibitors (TKI).
    [Show full text]
  • Genetic Variations Associated with Resistance to Doxorubicin and Paclitaxel in Breast Cancer
    GENETIC VARIATIONS ASSOCIATED WITH RESISTANCE TO DOXORUBICIN AND PACLITAXEL IN BREAST CANCER by Irada Ibrahim-zada A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Laboratory Medicine and Pathobiology University of Toronto © Copyright by Irada Ibrahim-zada 2010 ii Genetic variations associated with resistance to doxorubicin and paclitaxel in breast cancer Irada Ibrahim-zada Doctor of Philosophy Department of Laboratory Medicine and Pathobiology University of Toronto 2010 Abstract Anthracycline- and taxane-based regimens have been the mainstay in treating breast cancer patients using chemotherapy. Yet, the genetic make-up of patients and their tumors may have a strong impact on tumor sensitivity to these agents and to treatment outcome. This study represents a new paradigm assimilating bioinformatic tools with in vitro model systems to discover novel genetic variations that may be associated with chemotherapy response in breast cancer. This innovative paradigm integrates drug response data for the NCI60 cell line panel with genome-wide Affymetrix SNP data in order to identify genetic variations associated with drug resistance. This genome wide association study has led to the discovery of 59 candidate loci that may play critical roles in breast tumor sensitivity to doxorubicin and paclitaxel. 16 of them were mapped within well-characterized genes (three related to doxorubicin and 13 to paclitaxel). Further in silico characterization and in vitro functional analysis validated their differential expression in resistant cancer cell lines treated with the drug of interest (over-expression of RORA and DSG1, and under-expression of FRMD6, SGCD, SNTG1, LPHN2 and DCT). iii Interestingly, three and six genes associated with doxorubicin and paclitaxel resistance, respectively, are involved in the apoptotic process in cells.
    [Show full text]
  • Common and Distinctive Functions of the Hippo Effectors Taz and Yap In
    TISSUE-SPECIFIC STEM CELLS aRandall Division of Cell and Common and Distinctive Functions of the Hippo Molecular Biophysics, King’s College London, London, UK; Effectors Taz and Yap in Skeletal Muscle Stem Cell bSchool of Medicine, Medical Sciences & Nutrition, Function University of Aberdeen, Foresterhill, Aberdeen, a b b a Scotland, UK; cSystems CONGSHAN SUN, VANESSA DE MELLO, ABDALLA MOHAMED, HUASCAR P. O RTUSTE QUIROGA, c b d,e,f Biology Ireland, Conway AMAYA GARCIA-MUNOZ, ABDULLAH AL BLOSHI, ANNIE M. TREMBLAY, c g b c Institute, Dublin, Ireland; ALEXANDER VON KRIEGSHEIM, ELAINA COLLIE-DUGUID, NEIL VARGESSON, DAVID MATALLANAS, d b,h a Stem Cell Program, HENNING WACKERHAGE, PETER S. ZAMMIT Children’s Hospital, Boston, Massachusetts, USA; Key Words. Taz • Yap • Tead • Satellite cells • Muscle stem cells eDepartment of Stem Cell and Regenerative Biology, Harvard University, ABSTRACT Cambridge, Massachusetts, USA; fHarvard Stem Cell Hippo pathway downstream effectors Yap and Taz play key roles in cell proliferation and regen- Institute, Cambridge, eration, regulating gene expression especially via Tead transcription factors. To investigate their Massachusetts, USA; gCentre role in skeletal muscle stem cells, we analyzed Taz in vivo and ex vivo in comparison with Yap. for Genome Enabled Biology Small interfering RNA knockdown or retroviral-mediated expression of wild-type human or con- and Medicine, School of stitutively active TAZ mutants in satellite cells showed that TAZ promoted proliferation, a func- Medicine, Medical Sciences tion shared with YAP. However, at later stages of myogenesis, TAZ also enhanced myogenic and Nutrition, University of differentiation of myoblasts, whereas YAP inhibits such differentiation. Functionally, while mus- Aberdeen, Foresterhill, cle growth was mildly affected in Taz (gene Wwtr1–/–) knockout mice, there were no overt Aberdeen, Scotland, UK; effects on regeneration.
    [Show full text]
  • MRT67307 Kinase Inhibitor; TBK1 and Ikkε Inhibitor Catalog Code: Inh-Mrt for Research Use Only Version 19E07-NJ
    MRT67307 Kinase inhibitor; TBK1 and IKKε inhibitor Catalog Code: inh-mrt https://www.invivogen.com/mrt67307 For research use only Version 19E07-NJ PRODUCT INFORMATION CHEMICAL PROPERTIES Contents CAS Number: 1190378-57-4 (free base) • 10 mg MRT67307 (hydrochloride) Formula: C26H36N6O2 . x HCl Molecular weight: 464.60 g/mol (free base) Storage and stability Solubility: 15 mg/ml H2O - MRT67307 is provided as a dried powder and shipped at room temperature. Upon receipt, store product at -20 °C. METHODS - Upon resuspension of MRT67307 prepare aliquots and store Preparation of stock solution (10 mg/ml) at -20 °C. Resuspended product is stable for at least 3 months when 1. Add 1ml of endotoxin-free H O properly stored. 2 2. Use immediately or store aliquots at -20 °C - Avoid repeated freeze-thaw cycles. 3. Prepare dilutions using sterile endotoxin-free water Quality control Working concentration range: 1 - 20 µM (for cell culture assays) - Purity: ≥95% (UHPLC) - Inhibition of TBK1/IKKε by MRT67307 has been confirmed using Inhibition of TBK1/IKKε by MRT67307 in a cellular assay cellular assays. Below is a protocol using InvivoGen’s THP1-Dual™ cells for studying - Absence of bacterial contamination (e.g. lipoproteins and endotoxins) specific inhibition of the IRF pathway by MRT67307. These cells has been confirmed using HEK-Blue™ hTLR2 and HEK-Blue™ hTLR4 cells. express both an inducible Lucia luciferase reporter and an inducible secreted embryonic alkaline phosphatase (SEAP) reporter to measure PRODUCT DESCRIPTION the activation of the IRF or NF-κB pathways, respectively. Changes in MRT67307 is a potent, reversible kinase inhibitor, and a derivative the Lucia expression levels upon inhibition can be readily assessed by of BX7951.
    [Show full text]
  • Mechanisms of IKBKE Activation in Cancer Sridevi Challa University of South Florida, [email protected]
    University of South Florida Scholar Commons Graduate Theses and Dissertations Graduate School 1-29-2017 Mechanisms of IKBKE Activation in Cancer Sridevi Challa University of South Florida, [email protected] Follow this and additional works at: http://scholarcommons.usf.edu/etd Part of the Biochemistry Commons, Biology Commons, and the Cell Biology Commons Scholar Commons Citation Challa, Sridevi, "Mechanisms of IKBKE Activation in Cancer" (2017). Graduate Theses and Dissertations. http://scholarcommons.usf.edu/etd/6617 This Dissertation is brought to you for free and open access by the Graduate School at Scholar Commons. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Scholar Commons. For more information, please contact [email protected]. Mechanisms of IKBKE Activation in Cancer by Sridevi Challa A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Cell Biology, Microbiology, and Molecular Biology College of Arts and Sciences University of South Florida Major Professor: Mokenge P. Malafa, M.D. Gary Reuther, Ph.D. Eric Lau, Ph.D. Domenico Coppola, M.D. Date of Approval: January 12, 2017 Keywords: EGFR, Olaparib, resistance Copyright © 2017, Sridevi Challa DEDICATION This dissertation is dedicated to my kind and courageous mother. ACKNOWLEDGMENTS I would like to acknowledge Dr. Cheng for trusting me with completion of the projects. I would like to thank him for giving me the freedom to explore any aspect of research and always willing to provide the necessary resources and guidance for my projects. I want to also acknowledge Ted and the Cheng lab personnel for their support.
    [Show full text]
  • Quantitative Conformational Profiling of Kinase Inhibitors Reveals Origins of Selectivity for Aurora Kinase Activation States
    Quantitative conformational profiling of kinase inhibitors reveals origins of selectivity for Aurora kinase activation states Eric W. Lakea, Joseph M. Murettab, Andrew R. Thompsonb, Damien M. Rasmussenb, Abir Majumdara, Erik B. Faberc, Emily F. Ruffa, David D. Thomasb, and Nicholas M. Levinsona,d,1 aDepartment of Pharmacology, University of Minnesota, Minneapolis, MN 55455; bDepartment of Biochemistry, Molecular Biology, and Biophysics, University of Minnesota, Minneapolis, MN 55455; cDepartment of Medicinal Chemistry, University of Minnesota, Minneapolis, MN 55455; and dMasonic Cancer Center, University of Minnesota, Minneapolis, MN 55455 Edited by Kevan M. Shokat, University of California, San Francisco, CA, and approved November 7, 2018 (received for review June 28, 2018) Protein kinases undergo large-scale structural changes that tightly lytically important Asp–Phe–Gly (DFG) motif, located on the regulate function and control recognition by small-molecule in- flexible activation loop of the kinase, is flipped relative to its hibitors. Methods for quantifying the conformational effects of orientation in the active state (referred to as “DFG-out,” in inhibitors and linking them to an understanding of selectivity contrast to the active “DFG-in” state). The observation that the patterns have long been elusive. We have developed an ultrafast inactive DFG-out states of kinases are more divergent than the time-resolved fluorescence methodology that tracks structural catalytically competent DFG-in state has led to a focus on type II movements of the kinase activation loop in solution with inhibitors as a potential answer to the selectivity problem (8, 9). angstrom-level precision, and can resolve multiple structural states However, kinome-wide profiling of kinase inhibitors has revealed and quantify conformational shifts between states.
    [Show full text]