Iκb Kinase Ε and TANK-Binding Kinase 1 Activate AKT by Direct Phosphorylation
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Constitutive Activation of Akt/Protein Kinase B in Melanoma Leads to Up- Regulation of Nuclear Factor-B and Tumor Progression1
[CANCER RESEARCH 62, 7335–7342, December 15, 2002] Constitutive Activation of Akt/Protein Kinase B in Melanoma Leads to Up- Regulation of Nuclear Factor-B and Tumor Progression1 Punita Dhawan, Amar B. Singh, Darrel L. Ellis, and Ann Richmond2 Departments of Veterans Affairs [A. R.], Cancer Biology [P. D., A. R.], Nephrology [A. B. S.], and Medicine, Division of Dermatology [D. L. E.], Vanderbilt University School of Medicine, Nashville, Tennessee 37232 ABSTRACT iting a cumulative melanoma risk of 1.9% compared with 0.04% of patients without dysplastic nevi (7). The current lifetime incidence The serine/threonine kinase Akt/protein kinase B and the pleiotropic of melanoma in the United States is estimated at 1:74 (8). The high transcription factor nuclear factor-B [NF-B (p50/p65)] play important incidence of dysplastic nevi and melanoma presents a large public roles in the control of cell proliferation, apoptosis, and oncogenesis. Pre- vious studies from our laboratory have shown the constitutive activation health problem. of NF-B in melanoma cells. However, the mechanism of this activation is Whereas histopathology is the current gold standard for the diag- not clearly understood. The purpose of this study was to explore the role nosis of atypical melanocytic lesions, interobserver correlation in the of Akt in the activation of NF-B during melanoma tumor progression. diagnosis of dysplastic nevi is variable (9, 10). The malignant poten- Based on our observation that two of the five melanoma cell lines exam- tial of dysplastic nevi and early melanomas is difficult to predict with ined exhibit constitutive Akt activation, we evaluated Akt activation by standard histological staining. -
Targeting the Hippo Pathway in Prostate Cancer: What's New?
cancers Review Targeting the Hippo Pathway in Prostate Cancer: What’s New? Kelly Coffey Solid Tumour Target Discovery Laboratory, Translational and Clinical Research Institute, Newcastle University Centre for Cancer, Faculty of Medical Sciences, Newcastle University, Newcastle upon Tyne NE2 4HH, UK; [email protected] Simple Summary: Prostate cancer is the most commonly diagnosed cancer in men in the UK, accounting for the deaths of over 11,000 men per year. A major problem in this disease are tumours which no longer respond to available treatments. Understanding how this occurs will reveal new ways to treat these patients. In this review, the latest findings regarding a particular group of cellular factors which make up a signalling network called the Hippo pathway will be described. Accumulating evidence suggests that this network contributes to prostate cancer progression and resistance to current treatments. Identifying how this pathway can be targeted with drugs is a promising area of research to improve the treatment of prostate cancer. Abstract: Identifying novel therapeutic targets for the treatment of prostate cancer (PC) remains a key area of research. With the emergence of resistance to androgen receptor (AR)-targeting therapies, other signalling pathways which crosstalk with AR signalling are important. Over recent years, evidence has accumulated for targeting the Hippo signalling pathway. Discovered in Drosophila melanogasta, the Hippo pathway plays a role in the regulation of organ size, proliferation, migration and invasion. In response to a variety of stimuli, including cell–cell contact, nutrients and stress, a kinase cascade is activated, which includes STK4/3 and LATS1/2 to inhibit the effector proteins YAP and its paralogue TAZ. -
Supplementary Table 1. in Vitro Side Effect Profiling Study for LDN/OSU-0212320. Neurotransmitter Related Steroids
Supplementary Table 1. In vitro side effect profiling study for LDN/OSU-0212320. Percent Inhibition Receptor 10 µM Neurotransmitter Related Adenosine, Non-selective 7.29% Adrenergic, Alpha 1, Non-selective 24.98% Adrenergic, Alpha 2, Non-selective 27.18% Adrenergic, Beta, Non-selective -20.94% Dopamine Transporter 8.69% Dopamine, D1 (h) 8.48% Dopamine, D2s (h) 4.06% GABA A, Agonist Site -16.15% GABA A, BDZ, alpha 1 site 12.73% GABA-B 13.60% Glutamate, AMPA Site (Ionotropic) 12.06% Glutamate, Kainate Site (Ionotropic) -1.03% Glutamate, NMDA Agonist Site (Ionotropic) 0.12% Glutamate, NMDA, Glycine (Stry-insens Site) 9.84% (Ionotropic) Glycine, Strychnine-sensitive 0.99% Histamine, H1 -5.54% Histamine, H2 16.54% Histamine, H3 4.80% Melatonin, Non-selective -5.54% Muscarinic, M1 (hr) -1.88% Muscarinic, M2 (h) 0.82% Muscarinic, Non-selective, Central 29.04% Muscarinic, Non-selective, Peripheral 0.29% Nicotinic, Neuronal (-BnTx insensitive) 7.85% Norepinephrine Transporter 2.87% Opioid, Non-selective -0.09% Opioid, Orphanin, ORL1 (h) 11.55% Serotonin Transporter -3.02% Serotonin, Non-selective 26.33% Sigma, Non-Selective 10.19% Steroids Estrogen 11.16% 1 Percent Inhibition Receptor 10 µM Testosterone (cytosolic) (h) 12.50% Ion Channels Calcium Channel, Type L (Dihydropyridine Site) 43.18% Calcium Channel, Type N 4.15% Potassium Channel, ATP-Sensitive -4.05% Potassium Channel, Ca2+ Act., VI 17.80% Potassium Channel, I(Kr) (hERG) (h) -6.44% Sodium, Site 2 -0.39% Second Messengers Nitric Oxide, NOS (Neuronal-Binding) -17.09% Prostaglandins Leukotriene, -
Interaction Between the Protein Kinase B-Raf and the A-Subunit of the IIS Proteasome Regulator1
(CANCER RESEARCH 58. 2986-2990, July 15, I998| Advances in Brief Interaction between the Protein Kinase B-Raf and the a-Subunit of the IIS Proteasome Regulator1 Andreas Kalmes,2 Garsten Hagemann,2 Christoph K. Weber, Ludmilla Wixler, Tillman Schuster, and Ulf R. Kapp* InstituÃfürMedizinische Strahlenkunde und Zettforschung (MSZ). University of Würzburg,97078 Würzburg,Germany ¡C.H.. C. K. W.. L. W.. T. S.. U. K. R.], and Department of Surgery, University of Washington, Seattle. Washington 9SI95 ¡A.KJ Abstract using the yeast two-hybrid system. In addition to the already known B-Raf-binding proteins (MEK and several 14-3-3 isoforms), we iso Protein kinases of the Raf family act as signal-transducing elements lated PA28a, the subunit of the 1IS proteasome regulator (11, 12), as downstream of activated cell surface receptors and are involved in the a novel B-Raf-binding partner. regulation of proliferation, differentiation, and cell survival. Whereas the role of c-Raf-1 as a mitogen-activated protein/extracellular signal-regu The 11S regulator is one of two known activators of the 20S lated kinase activator within the mitogenic cascade is well established, less proteasome (13). Both of these activators seem to possess different is known about the mammalian Raf isoforins A-Raf and B-Raf. Here we functions in vivo. The PA700 activator complex (19S regulator) binds report that B-Raf binds to PA28a, one of two subunits of the 1IS regulator to the 20S proteasome core complex to form the active 26S protea of proteasomes. PA28<* was isolated as a B-Raf-binding protein in a yeast some, which mediates the ATP- and ubiquitination-dependent degra two-hybrid screen of a PC 12 cDNA library. -
MRT67307 Kinase Inhibitor; TBK1 and Ikkε Inhibitor Catalog Code: Inh-Mrt for Research Use Only Version 19E07-NJ
MRT67307 Kinase inhibitor; TBK1 and IKKε inhibitor Catalog Code: inh-mrt https://www.invivogen.com/mrt67307 For research use only Version 19E07-NJ PRODUCT INFORMATION CHEMICAL PROPERTIES Contents CAS Number: 1190378-57-4 (free base) • 10 mg MRT67307 (hydrochloride) Formula: C26H36N6O2 . x HCl Molecular weight: 464.60 g/mol (free base) Storage and stability Solubility: 15 mg/ml H2O - MRT67307 is provided as a dried powder and shipped at room temperature. Upon receipt, store product at -20 °C. METHODS - Upon resuspension of MRT67307 prepare aliquots and store Preparation of stock solution (10 mg/ml) at -20 °C. Resuspended product is stable for at least 3 months when 1. Add 1ml of endotoxin-free H O properly stored. 2 2. Use immediately or store aliquots at -20 °C - Avoid repeated freeze-thaw cycles. 3. Prepare dilutions using sterile endotoxin-free water Quality control Working concentration range: 1 - 20 µM (for cell culture assays) - Purity: ≥95% (UHPLC) - Inhibition of TBK1/IKKε by MRT67307 has been confirmed using Inhibition of TBK1/IKKε by MRT67307 in a cellular assay cellular assays. Below is a protocol using InvivoGen’s THP1-Dual™ cells for studying - Absence of bacterial contamination (e.g. lipoproteins and endotoxins) specific inhibition of the IRF pathway by MRT67307. These cells has been confirmed using HEK-Blue™ hTLR2 and HEK-Blue™ hTLR4 cells. express both an inducible Lucia luciferase reporter and an inducible secreted embryonic alkaline phosphatase (SEAP) reporter to measure PRODUCT DESCRIPTION the activation of the IRF or NF-κB pathways, respectively. Changes in MRT67307 is a potent, reversible kinase inhibitor, and a derivative the Lucia expression levels upon inhibition can be readily assessed by of BX7951. -
Mechanisms of IKBKE Activation in Cancer Sridevi Challa University of South Florida, [email protected]
University of South Florida Scholar Commons Graduate Theses and Dissertations Graduate School 1-29-2017 Mechanisms of IKBKE Activation in Cancer Sridevi Challa University of South Florida, [email protected] Follow this and additional works at: http://scholarcommons.usf.edu/etd Part of the Biochemistry Commons, Biology Commons, and the Cell Biology Commons Scholar Commons Citation Challa, Sridevi, "Mechanisms of IKBKE Activation in Cancer" (2017). Graduate Theses and Dissertations. http://scholarcommons.usf.edu/etd/6617 This Dissertation is brought to you for free and open access by the Graduate School at Scholar Commons. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Scholar Commons. For more information, please contact [email protected]. Mechanisms of IKBKE Activation in Cancer by Sridevi Challa A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Cell Biology, Microbiology, and Molecular Biology College of Arts and Sciences University of South Florida Major Professor: Mokenge P. Malafa, M.D. Gary Reuther, Ph.D. Eric Lau, Ph.D. Domenico Coppola, M.D. Date of Approval: January 12, 2017 Keywords: EGFR, Olaparib, resistance Copyright © 2017, Sridevi Challa DEDICATION This dissertation is dedicated to my kind and courageous mother. ACKNOWLEDGMENTS I would like to acknowledge Dr. Cheng for trusting me with completion of the projects. I would like to thank him for giving me the freedom to explore any aspect of research and always willing to provide the necessary resources and guidance for my projects. I want to also acknowledge Ted and the Cheng lab personnel for their support. -
Dynamic Modelling of the Mtor Signalling Network Reveals Complex
www.nature.com/scientificreports OPEN Dynamic modelling of the mTOR signalling network reveals complex emergent behaviours conferred by Received: 24 August 2017 Accepted: 1 December 2017 DEPTOR Published: xx xx xxxx Thawfeek M. Varusai1,4 & Lan K. Nguyen2,3,4 The mechanistic Target of Rapamycin (mTOR) signalling network is an evolutionarily conserved network that controls key cellular processes, including cell growth and metabolism. Consisting of the major kinase complexes mTOR Complex 1 and 2 (mTORC1/2), the mTOR network harbours complex interactions and feedback loops. The DEP domain-containing mTOR-interacting protein (DEPTOR) was recently identifed as an endogenous inhibitor of both mTORC1 and 2 through direct interactions, and is in turn degraded by mTORC1/2, adding an extra layer of complexity to the mTOR network. Yet, the dynamic properties of the DEPTOR-mTOR network and the roles of DEPTOR in coordinating mTORC1/2 activation dynamics have not been characterised. Using computational modelling, systems analysis and dynamic simulations we show that DEPTOR confers remarkably rich and complex dynamic behaviours to mTOR signalling, including abrupt, bistable switches, oscillations and co-existing bistable/oscillatory responses. Transitions between these distinct modes of behaviour are enabled by modulating DEPTOR expression alone. We characterise the governing conditions for the observed dynamics by elucidating the network in its vast multi-dimensional parameter space, and develop strategies to identify core network design motifs underlying these dynamics. Our fndings provide new systems-level insights into the complexity of mTOR signalling contributed by DEPTOR. Discovered in the early 1990s as an anti-fungal agent produced by the soil bacterium Streptomyces hygroscopicus, rapamycin has continually surprised scientists with its diverse clinical efects including potent immunosuppres- sive and anti-tumorigenic properties1–3. -
Cep-2020-00633.Pdf
Clin Exp Pediatr Vol. 64, No. 5, 208–222, 2021 Review article CEP https://doi.org/10.3345/cep.2020.00633 Understanding the genetics of systemic lupus erythematosus using Bayesian statistics and gene network analysis Seoung Wan Nam, MD, PhD1,*, Kwang Seob Lee, MD2,*, Jae Won Yang, MD, PhD3,*, Younhee Ko, PhD4, Michael Eisenhut, MD, FRCP, FRCPCH, DTM&H5, Keum Hwa Lee, MD, MS6,7,8, Jae Il Shin, MD, PhD6,7,8, Andreas Kronbichler, MD, PhD9 1Department of Rheumatology, Wonju Severance Christian Hospital, Yonsei University Wonju College of Medicine, Wonju, Korea; 2Severance Hospital, Yonsei University College of Medicine, Seoul, Korea; 3Department of Nephrology, Yonsei University Wonju College of Medicine, Wonju, Korea; 4Division of Biomedical Engineering, Hankuk University of Foreign Studies, Yongin, Korea; 5Department of Pediatrics, Luton & Dunstable University Hospital NHS Foundation Trust, Luton, UK; 6Department of Pediatrics, Yonsei University College of Medicine, Seoul, Korea; 7Division of Pediatric Nephrology, Severance Children’s Hospital, Seoul, Korea; 8Institute of Kidney Disease Research, Yonsei University College of Medicine, Seoul, Korea; 9Department of Internal Medicine IV (Nephrology and Hypertension), Medical University Innsbruck, Innsbruck, Austria 1,3) The publication of genetic epidemiology meta-analyses has analyses have redundant duplicate topics and many errors. increased rapidly, but it has been suggested that many of the Although there has been an impressive increase in meta-analyses statistically significant results are false positive. In addition, from China, particularly those on genetic associa tions, most most such meta-analyses have been redundant, duplicate, and claimed candidate gene associations are likely false-positives, erroneous, leading to research waste. In addition, since most suggesting an urgent global need to incorporate genome-wide claimed candidate gene associations were false-positives, cor- data and state-of-the art statistical inferences to avoid a flood of rectly interpreting the published results is important. -
Molecular Mechanisms Underlying Innate Immune Kinase
MOLECULAR MECHANISMS UNDERLYING INNATE IMMUNE KINASE TBK1-DRIVEN ONCOGENIC TRANSFORMATION APPROVED BY SUPERVISORY COMMITTEE Michael A White, Ph.D. Melanie H. Cobb, Ph.D. Lawrence Lum, Ph.D. John D. Minna, M.D. DEDICATION This work is dedicated to my mother and Arlene for their love and support. ACKNOWLEDGEMENTS I am very grateful to my mentor, Dr. Michael White, for his continuous support and guidance through the entire study. I really appreciate his inspiration, patience, and generosity. I would also like to thank my committee members, Dr. Cobb, Dr. Lum, and Dr. Minna, for their invaluable advice and discussion. I thank all the White lab members and my friends for their help, suggestion, and discussion. Particularly, I would like to thank Rosie, Michael, Brian, Tzuling, and Malia for their long-term support and collaboration. I would also like to thank my friends, Veleka, Pei-Ling, Jen-Chieh, Shu-Yi, Chih-Chiang, Jen-Shuan, Yi-Chun, and Yu-San for their friendship. I am grateful to Drs. Rolf Brekken, Zhijian James Chen, Xuetao Cao, Philip Tsichlis, Charles Yeaman, William Hahn, Keqiang Ye, and Shu-Chan Hsu, Bing Su, Dos Sarbassov, Mark Magnuson, David Sabatini, Thomas Tan, and Bert Vogelstein for many of the reagents used in these studies. Finally, and most importantly, I would like to thank my mother and Arlene for their unending support and encouragement. MOLECULAR MECHANISMS UNDERLYING INNATE IMMUNE KINASE TBK1-DRIVEN ONCOGENIC TRANSFORMATION by YI-HUNG OU DISSERTATION Presented to the Faculty of the Graduate School of Biomedical Sciences The University of Texas Southwestern Medical Center at Dallas In Partial Fulfillment of the Requirements For the Degree of DOCTOR OF PHILOSOPHY The University of Texas Southwestern Medical Center at Dallas Dallas, Texas April, 2013 Copyright by YI-HUNG OU, 2013 All Rights Reserved MOLECULAR MECHANISMS UNDERLYING INNATE IMMUNE KINASE TBK1-DRIVEN ONCOGENIC TRANSFORMATION Publication No. -
Kinase Signaling Cascades in the Mitochondrion: a Matter of Life Or Death$
Free Radical Biology & Medicine 38 (2005) 2–11 www.elsevier.com/locate/freeradbiomed Serial Review: The powerhouse takes control of the cell: The role of mitochondria in signal transduction Serial Review Editor: Victor Darley-Usmar Kinase signaling cascades in the mitochondrion: a matter of life or death$ Craig Horbinski, Charleen T. Chu* Division of Neuropathology, Department of Pathology, University of Pittsburgh School of Medicine, Pittsburgh, PA 15213, USA Received 15 July 2004; accepted 22 September 2004 Available online 27 October 2004 Abstract In addition to powering energy needs of the cell, mitochondria function as pivotal integrators of cell survival/death signals. In recent years, numerous studies indicate that each of the major kinase signaling pathways can be stimulated to target the mitochondrion. These include protein kinase A, protein kinase B/Akt, protein kinase C, extracellular signal-regulated protein kinase, c-Jun N-terminal kinase, and p38 mitogen- activated protein kinase. Although most studies focus on phosphorylation of pro- and antiapoptotic proteins (BAD, Bax, Bcl-2, Bcl-xL), kinase- mediated regulation of complex I activity, anion and cation channels, metabolic enzymes, and Mn-SOD mRNA has also been reported. Recent identification of a number of scaffold proteins (AKAP, PICK, Sab) that bring specific kinases to the cytoplasmic surface of mitochondria further emphasizes the importance of mitochondrial kinase signaling. Immunogold electron microscopy, subcellular fractionation, and immuno- fluorescence studies demonstrate the presence of kinases within subcompartments of the mitochondrion, following diverse stimuli and in neurodegenerative diseases. Given the sensitivity of these signaling pathways to reactive oxygen and nitrogen species, in situ activation of mitochondrial kinases may represent a potent reverse-signaling mechanism for communication of mitochondrial status to the rest of the cell. -
BMK1 Kinase Suppresses Epithelial–Mesenchymal Transition Through the Akt/Gsk3b Signaling Pathway
Published OnlineFirst January 26, 2012; DOI: 10.1158/0008-5472.CAN-11-2055 Cancer Tumor and Stem Cell Biology Research BMK1 Kinase Suppresses Epithelial–Mesenchymal Transition through the Akt/GSK3b Signaling Pathway Runqiang Chen, Qingkai Yang, and Jiing-Dwan Lee Abstract Epithelial–mesenchymal transition (EMT) plays a crucial role in the development of cancer metastasis. The – jun mitogen-activated protein (MAP) kinases extracellular signal regulated kinase, c- -NH2-kinase, and p38 have been implicated in promoting EMT, but a role for the MAP kinase BMK1 has not been studied. Here, we report that BMK1 signaling suppresses EMT. BMK1 elevation augmented E-cadherin–mediated cell–cell adhesion, downregulated mesenchymal markers, and decreased cell motility. Conversely, BMK1 silencing attenuated E-cadherin–mediated cell–cell adhesion, upregulated mesenchymal markers, and stimulated cell motility. BMK1 depletion dramatically increased the accumulation of endogenous Snail in the nuclear compartment. Snail accumulation was mediated by Akt/GSK3b signaling, which was activated by a modulation in the expression of the mTOR inhibitor DEPTOR. In support of these observations, BMK1 depletion promoted metastasis in vivo. Together, our findings reveal a novel mechanism of EMT control via mTOR/Akt inhibition that suppresses cancer metastasis. Cancer Res; 72(6); 1–9. Ó2012 AACR. Introduction that control cancer progression. The majority of mitogenic/ – The process of epithelial–mesenchymal transition (EMT) oncogenic signal activated signaling pathways stimulate is critically involved in the progression of human diseases, EMT(2).Inparticular,3ofthe4mitogen-activatedprotein such as cancer metastasis and fibrosis (1). EMT involves (MAP) kinase pathways described to date (namely, Erk, JNK, profound phenotypic changes that include loss of cell–cell and p38; ref.