DOCSLIB.ORG

BMK1 Kinase Suppresses Epithelial–Mesenchymal Transition Through the Akt/Gsk3b Signaling Pathway

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
BMK1 Kinase Suppresses Epithelial–Mesenchymal Transition Through the Akt/Gsk3b Signaling Pathway Published OnlineFirst January 26, 2012; DOI: 10.1158/0008-5472.CAN-11-2055 Cancer Tumor and Stem Cell Biology Research BMK1 Kinase Suppresses Epithelial–Mesenchymal Transition through the Akt/GSK3b Signaling Pathway Runqiang Chen, Qingkai Yang, and Jiing-Dwan Lee Abstract Epithelial–mesenchymal transition (EMT) plays a crucial role in the development of cancer metastasis. The – jun mitogen-activated protein (MAP) kinases extracellular signal regulated kinase, c- -NH2-kinase, and p38 have been implicated in promoting EMT, but a role for the MAP kinase BMK1 has not been studied. Here, we report that BMK1 signaling suppresses EMT. BMK1 elevation augmented E-cadherin–mediated cell–cell adhesion, downregulated mesenchymal markers, and decreased cell motility. Conversely, BMK1 silencing attenuated E-cadherin–mediated cell–cell adhesion, upregulated mesenchymal markers, and stimulated cell motility. BMK1 depletion dramatically increased the accumulation of endogenous Snail in the nuclear compartment. Snail accumulation was mediated by Akt/GSK3b signaling, which was activated by a modulation in the expression of the mTOR inhibitor DEPTOR. In support of these observations, BMK1 depletion promoted metastasis in vivo. Together, our findings reveal a novel mechanism of EMT control via mTOR/Akt inhibition that suppresses cancer metastasis. Cancer Res; 72(6); 1–9. Ó2012 AACR. Introduction that control cancer progression. The majority of mitogenic/ – The process of epithelial–mesenchymal transition (EMT) oncogenic signal activated signaling pathways stimulate is critically involved in the progression of human diseases, EMT(2).Inparticular,3ofthe4mitogen-activatedprotein such as cancer metastasis and fibrosis (1). EMT involves (MAP) kinase pathways described to date (namely, Erk, JNK, profound phenotypic changes that include loss of cell–cell and p38; ref. 6) induce EMT (7). The function of the fourth adhesion, loss of cell polarity, and acquisition of migratory MAP kinase, BMK1, in EMT, however, remains unknown. and invasive properties (2). Loss of E-cadherin expression is Herein, we describe our investigations into the actions of a hallmark of EMT and has become an established biomark- BMK1 in EMT and in cancer metastasis. er of the process itself (3). One principal mechanism that actstoreduceE-cadherinexpressioninEMTistheactiva- Materials and Methods tion of its associated transcriptional repressors. The E- Cell culture and reagents cadherin repressors have been classified into 2 groups, based The human cell lines A549, MCF10A, DU145, T47D, and upon their interaction with the E-cadherin promoter (2). The mouse cell line 4T1 were purchased from the American Type first group directly binds to the E-cadherin promoter to Culture Collection (ATCC) and cultured no more than 6 physically inhibit transcription and is composed of the Snail, months after purchase for the experiments described herein. Zeb, E47, and KLF8 factors (4, 5). The second group indi- The cell lines were authenticated by ATCC and maintained as rectly binds to the E-cadherin promoter, interacting with recommended. LY294002, U0126, and SB203580 were pur- other direct binding factors, and includes Twist, Goosecoid, chased from Calbiochem. Sanguinarine was purchased from E2.2, and FoxC2. Gaining a thorough understanding of the Sigma-Aldrich. process by which epithelial cells transit to mesenchymal cells is necessary for elucidating the molecular mechanisms Plasmids, virus production, and infection of target cells The human plasmid pWZL-Neo-Myr-Flag-MAPK7, DEP- TOR short hairpin RNA (shRNA), and DEPTOR cDNA were Authors' Affiliation: Department of Immunology and Microbial Science, purchased from Addgene. The human shSnail plasmid was The Scripps Research Institute, La Jolla, California from OriGene. The procedures used to produce retroviruses Note: Supplementary data for this article are available at Cancer Research andtoinfecttargetcellshavebeendescribedpreviously(8). Online (http://cancerres.aacrjournals.org/). To produce recombinant lentiviruses, vectors encoding R. Chen and Q. Yang contributed equally to this work. shRNA against human BMK1, mouse BMK1, or control nontarget shRNAs were purchased from Open Biosystems; Corresponding Author: Jiing-Dwan Lee, Department of Immunology and fl Microbial Science, The Scripps Research Institute, 10550 N. Torrey Pines lentiviruses were generated by cotransfection of subcon u- Rd., IMM12, La Jolla, CA 92037. Phone: 858-784-8703; Fax: 858-784- ent human embryonic kidney (HEK) 293FT cells (Invitrogen) 8343; E-mail: [email protected] with one of the above expression plasmids and a packaging doi: 10.1158/0008-5472.CAN-11-2055 plasmid (pMDL, pREV, or pVSVG) using the GenJet DNA Ó2012 American Association for Cancer Research. in vitro transfection reagent (SignaGen Laboratories). www.aacrjournals.org OF1 Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 2012 American Association for Cancer Research. Published OnlineFirst January 26, 2012; DOI: 10.1158/0008-5472.CAN-11-2055 Chen et al. Infectious lentiviruses were collected 48 hours after trans- Luciferase assay fection and centrifuged to remove cell debris. A549 cells The luciferase assay was done as described previously (10). were transduced with the viruses expressing shRNA against The pG5E1bLuc and internal control pRL-TK plasmids were humanBMK1,DEPTOR,Snail,ornontargetshRNAs.4T1 cotransfected into cells along with a construct encoding the cells were transduced with lentiviruses expressing shRNA GAL4-binding domain fused to MEF2C. that targeted mouse BMK1 or nontarget shRNAs. Immunoflourescence Antibodies and immunoblotting Cellsweregrownonglasscoverslipsina6-wellplateand Cells were lysed in radioimmunoprecipitation assay buffer washed 3 times with PBS before fixing with 2% formaldehyde and blots were carried out as described previously (9). in PBS (pH 7.4) for 15 minutes at room temperature. The Antibodies used were as follows: anti–glyceraldehyde-3- cells were then washed 3 times with PBS and permeabilized phosphate dehydrogenase (anti-GAPDH; Sigma-Aldrich); with 0.2% Triton X-100 plus 1% normal goat serum (NGS) in anti-Snail, anti-GSK3b,anti-GSK3b (Ser 9), anti-Akt, anti- PBS for 5 minutes on ice. Cells were again washed 3 times p-Akt (Ser 473), anti-p-BMK1 (T218/Y220), anti-p-Akt (Thr with 1% NGS in PBS. Coverslips were incubated with respec- 308), anti-ZO-1, and anti–E-cadherin (Cell Signaling); anti- tive primary antibodies at 1:100 dilutions overnight at 4oC. DEPTOR (Novus Biologicals); anti-vimentin V9 (NeoMar- After 3 washes with 1% NGS in PBS, incubation with fluo- kers); anti–N-cadherin (BD Transduction); anti-twist1, rescein-conjugated secondary antibodies at 1:50 dilutions anti-Zeb1, and anti-Zeb2 (Santa Cruz Biotechnology); and was carried out. Cells were then washed 4 times with PBS, anti-BMK1 (10). All immunoblotting experiments were mounted with medium containing 40,6-diamidino-2-pheny- repeated at least 3 times. The statistics for immunoblotting lindole (DAPI; Vector Laboratories), and analyzed using experiements in Figs. 1 to 5 were presented in Supplemen- fluorescence microscopy. tary Fig. S1 and S2 (statistics for immunoblotting in Fig. 1C,Fig.2BandE,andFig.3A–C and G are in Supplementary Cell motility assays Fig. S1A–S1G, respectively. Statistics for immunoblotting Cells were harvested with Trypsin/EDTA, washed twice in Fig. 3E and F, Fig. 4A–DandF,andFig.5AandCare with Dulbecco's modified Eagle's medium, and resuspended in Supplementary Fig. S2A–S2I, respectively). in serum-free medium at a density of 106 cells/mL. Lower EV BMK1 A C EV BMK1 D 1.0 2.2 6 E-Cadherin 1.0 2.3 markers ZO-1 Epithelial 4 1.0 0.6 EV BMK1 B N-Cadherin 1.0 0.4 Vimentin 2 E-Cadherin markers Mesenchymal Mesenchymal 1.0 7.3 Relative luciferase activity BMK1 0 1.0 1.0 EV BMK1 ZO-1 GAPDH E 200 150 100 * N-Cadherin per field 50 Migratory cells 0 EV BMK1 Vimentin EV BMK1 Figure 1. BMK1 enhances cell epithelial properties. A, phase-contrast microscopic images of A549 cells carrying control vector (EV) or expression vector encoding BMK1. Scale bar, 50 mm. B, fluorescence microscopic staining of E-cadherin, ZO-1, N-cadherin, and vimentin (green) is indicated in the EV and BMK1 A549 cells. Nuclear DNA was stained with DAPI (blue). Scale bar, 20 mm. C, expression levels of epithelial markers, E-cadherin and ZO-1, as well as mesenchymal markers, N-cadherin and vimentin, were examined by immunoblotting of EV and BMK1 A549 cells. GAPDH was used as a loading control. The relative expression levels of indicated proteins in BMK1 cells was determined by setting the expression level, measuring by densitometry, in EV cells at a value of 1.0. D, MEF2C transactivation activity was determined in EV and BMK1 A549 cells using luciferase assay. E, motility of EV and BMK1 A549 cells was analyzed. Each bar represents the mean Æ SD of samples measured in triplicate. Ã, P < 0.05. Scale bar, 50 mm. OF2 Cancer Res; 72(6) March 15, 2012 Cancer Research Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 2012 American Association for Cancer Research. Published OnlineFirst January 26, 2012; DOI: 10.1158/0008-5472.CAN-11-2055 BMK1 Suppresses EMT Du145 MCF10A A C E shCont shCont shBMK1 shCont shBMK1 shBMK1 1.0 0.2 1.0 0.4 800 * E-Cadherin 600 1.0 0.3 1.0 0.3 * ZO-1 400 1.0 4.2 1.0 6.1 Snail 200 3.61.0 1.0 3.1 * N-Cadherin Migratory cells per field Migratory 0 shContshBMK1 shCont shBMK1 shCont shBMK1 1.0 3.0 1.0 3.3 1 h 3 h 5 h Vimentin 1.0 1.0 1.0 1.0 GAPDH B D shCont shBMK1 1,500 shCont shBMK1 1,200 * 1.0 0.3 0 h 900 E-Cadherin 600 300 * 1.0 0.2 0 Migratory cells per field per cells Migratory markers ZO-1 Epithelial 30 h F 1.0 3.3 N-Cadherin 1.0 3.4 100 Vimentin markers 80 * Mesenchymal Mesenchymal 1.0 0.2 60 BMK1 40 20 1.0 1.0 Ratio of migration of initial width)(% 0 GAPDH Figure 2.
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Genetics of Familial Non-Medullary Thyroid Carcinoma (FNMTC)
    cancers Review Genetics of Familial Non-Medullary Thyroid Carcinoma (FNMTC) Chiara Diquigiovanni * and Elena Bonora Unit of Medical Genetics, Department of Medical and Surgical Sciences, University of Bologna, 40138 Bologna, Italy; [email protected] * Correspondence: [email protected]; Tel.: +39-051-208-8418 Simple Summary: Non-medullary thyroid carcinoma (NMTC) originates from thyroid follicular epithelial cells and is considered familial when occurs in two or more first-degree relatives of the patient, in the absence of predisposing environmental factors. Familial NMTC (FNMTC) cases show a high genetic heterogeneity, thus impairing the identification of pivotal molecular changes. In the past years, linkage-based approaches identified several susceptibility loci and variants associated with NMTC risk, however only few genes have been identified. The advent of next-generation sequencing technologies has improved the discovery of new predisposing genes. In this review we report the most significant genes where variants predispose to FNMTC, with the perspective that the integration of these new molecular findings in the clinical data of patients might allow an early detection and tailored therapy of the disease, optimizing patient management. Abstract: Non-medullary thyroid carcinoma (NMTC) is the most frequent endocrine tumor and originates from the follicular epithelial cells of the thyroid. Familial NMTC (FNMTC) has been defined in pedigrees where two or more first-degree relatives of the patient present the disease in absence of other predisposing environmental factors. Compared to sporadic cases, FNMTCs are often multifocal, recurring more frequently and showing an early age at onset with a worse outcome. FNMTC cases Citation: Diquigiovanni, C.; Bonora, E.
    [Show full text]
  • Targeting the Hippo Pathway in Prostate Cancer: What's New?
    cancers Review Targeting the Hippo Pathway in Prostate Cancer: What’s New? Kelly Coffey Solid Tumour Target Discovery Laboratory, Translational and Clinical Research Institute, Newcastle University Centre for Cancer, Faculty of Medical Sciences, Newcastle University, Newcastle upon Tyne NE2 4HH, UK; [email protected] Simple Summary: Prostate cancer is the most commonly diagnosed cancer in men in the UK, accounting for the deaths of over 11,000 men per year. A major problem in this disease are tumours which no longer respond to available treatments. Understanding how this occurs will reveal new ways to treat these patients. In this review, the latest findings regarding a particular group of cellular factors which make up a signalling network called the Hippo pathway will be described. Accumulating evidence suggests that this network contributes to prostate cancer progression and resistance to current treatments. Identifying how this pathway can be targeted with drugs is a promising area of research to improve the treatment of prostate cancer. Abstract: Identifying novel therapeutic targets for the treatment of prostate cancer (PC) remains a key area of research. With the emergence of resistance to androgen receptor (AR)-targeting therapies, other signalling pathways which crosstalk with AR signalling are important. Over recent years, evidence has accumulated for targeting the Hippo signalling pathway. Discovered in Drosophila melanogasta, the Hippo pathway plays a role in the regulation of organ size, proliferation, migration and invasion. In response to a variety of stimuli, including cell–cell contact, nutrients and stress, a kinase cascade is activated, which includes STK4/3 and LATS1/2 to inhibit the effector proteins YAP and its paralogue TAZ.
    [Show full text]
  • The MKKK62-MKK3-MAPK7/14 Module Negatively Regulates Seed
    Mao et al. Rice (2019) 12:2 https://doi.org/10.1186/s12284-018-0260-z ORIGINAL ARTICLE Open Access The MKKK62-MKK3-MAPK7/14 module negatively regulates seed dormancy in rice Xingxue Mao1,2†, Jianjun Zhang3†, Wuge Liu1,2†, Shijuan Yan4, Qing Liu1,2, Hua Fu1,2, Junliang Zhao1,2, Wenjie Huang4, Jingfang Dong1,2, Shaohong Zhang1,2, Tifeng Yang1,2, Wu Yang1,2, Bin Liu1,2* and Feng Wang1,2* Abstract Background: Seed dormancy directly affects the phenotype of pre-harvest sprouting, and ultimately affects the quality and yield of rice seeds. Although many genes controlling seed dormancy have been cloned from cereals, the regulatory mechanisms controlling this process are complex, and much remains unknown. The MAPK cascade is involved in many signal transduction pathways. Recently, MKK3 has been reported to be involved in the regulation of seed dormancy, but its mechanism of action is unclear. Results: We found that MKKK62-overexpressing rice lines (OE) lost seed dormancy. Further analyses showed that the abscisic acid (ABA) sensitivity of OE lines was decreased. In yeast two-hybrid experiments, MKKK62 interacted with MKK3, and MKK3 interacted with MAPK7 and MAPK14. Knock-out experiments confirmed that MKK3, MAPK7, and MAPK14 were involved in the regulation of seed dormancy. The OE lines showed decreased transcript levels of OsMFT, a homolog of a gene that controls seed dormancy in wheat. The up-regulation of OsMFT in MKK3-knockout lines (OE/mkk3) and MAPK7/14-knockout lines (OE/mapk7/mapk14) indicated that the MKKK62-MKK3-MAPK7/ MAPK14 system controlled seed dormancy by regulating the transcription of OsMFT.
    [Show full text]
  • MRT67307 Kinase Inhibitor; TBK1 and Ikkε Inhibitor Catalog Code: Inh-Mrt for Research Use Only Version 19E07-NJ
    MRT67307 Kinase inhibitor; TBK1 and IKKε inhibitor Catalog Code: inh-mrt https://www.invivogen.com/mrt67307 For research use only Version 19E07-NJ PRODUCT INFORMATION CHEMICAL PROPERTIES Contents CAS Number: 1190378-57-4 (free base) • 10 mg MRT67307 (hydrochloride) Formula: C26H36N6O2 . x HCl Molecular weight: 464.60 g/mol (free base) Storage and stability Solubility: 15 mg/ml H2O - MRT67307 is provided as a dried powder and shipped at room temperature. Upon receipt, store product at -20 °C. METHODS - Upon resuspension of MRT67307 prepare aliquots and store Preparation of stock solution (10 mg/ml) at -20 °C. Resuspended product is stable for at least 3 months when 1. Add 1ml of endotoxin-free H O properly stored. 2 2. Use immediately or store aliquots at -20 °C - Avoid repeated freeze-thaw cycles. 3. Prepare dilutions using sterile endotoxin-free water Quality control Working concentration range: 1 - 20 µM (for cell culture assays) - Purity: ≥95% (UHPLC) - Inhibition of TBK1/IKKε by MRT67307 has been confirmed using Inhibition of TBK1/IKKε by MRT67307 in a cellular assay cellular assays. Below is a protocol using InvivoGen’s THP1-Dual™ cells for studying - Absence of bacterial contamination (e.g. lipoproteins and endotoxins) specific inhibition of the IRF pathway by MRT67307. These cells has been confirmed using HEK-Blue™ hTLR2 and HEK-Blue™ hTLR4 cells. express both an inducible Lucia luciferase reporter and an inducible secreted embryonic alkaline phosphatase (SEAP) reporter to measure PRODUCT DESCRIPTION the activation of the IRF or NF-κB pathways, respectively. Changes in MRT67307 is a potent, reversible kinase inhibitor, and a derivative the Lucia expression levels upon inhibition can be readily assessed by of BX7951.
    [Show full text]
  • Mechanisms of IKBKE Activation in Cancer Sridevi Challa University of South Florida, [email protected]
    University of South Florida Scholar Commons Graduate Theses and Dissertations Graduate School 1-29-2017 Mechanisms of IKBKE Activation in Cancer Sridevi Challa University of South Florida, [email protected] Follow this and additional works at: http://scholarcommons.usf.edu/etd Part of the Biochemistry Commons, Biology Commons, and the Cell Biology Commons Scholar Commons Citation Challa, Sridevi, "Mechanisms of IKBKE Activation in Cancer" (2017). Graduate Theses and Dissertations. http://scholarcommons.usf.edu/etd/6617 This Dissertation is brought to you for free and open access by the Graduate School at Scholar Commons. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Scholar Commons. For more information, please contact [email protected]. Mechanisms of IKBKE Activation in Cancer by Sridevi Challa A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Cell Biology, Microbiology, and Molecular Biology College of Arts and Sciences University of South Florida Major Professor: Mokenge P. Malafa, M.D. Gary Reuther, Ph.D. Eric Lau, Ph.D. Domenico Coppola, M.D. Date of Approval: January 12, 2017 Keywords: EGFR, Olaparib, resistance Copyright © 2017, Sridevi Challa DEDICATION This dissertation is dedicated to my kind and courageous mother. ACKNOWLEDGMENTS I would like to acknowledge Dr. Cheng for trusting me with completion of the projects. I would like to thank him for giving me the freedom to explore any aspect of research and always willing to provide the necessary resources and guidance for my projects. I want to also acknowledge Ted and the Cheng lab personnel for their support.
    [Show full text]
  • Cep-2020-00633.Pdf
    Clin Exp Pediatr Vol. 64, No. 5, 208–222, 2021 Review article CEP https://doi.org/10.3345/cep.2020.00633 Understanding the genetics of systemic lupus erythematosus using Bayesian statistics and gene network analysis Seoung Wan Nam, MD, PhD1,*, Kwang Seob Lee, MD2,*, Jae Won Yang, MD, PhD3,*, Younhee Ko, PhD4, Michael Eisenhut, MD, FRCP, FRCPCH, DTM&H5, Keum Hwa Lee, MD, MS6,7,8, Jae Il Shin, MD, PhD6,7,8, Andreas Kronbichler, MD, PhD9 1Department of Rheumatology, Wonju Severance Christian Hospital, Yonsei University Wonju College of Medicine, Wonju, Korea; 2Severance Hospital, Yonsei University College of Medicine, Seoul, Korea; 3Department of Nephrology, Yonsei University Wonju College of Medicine, Wonju, Korea; 4Division of Biomedical Engineering, Hankuk University of Foreign Studies, Yongin, Korea; 5Department of Pediatrics, Luton & Dunstable University Hospital NHS Foundation Trust, Luton, UK; 6Department of Pediatrics, Yonsei University College of Medicine, Seoul, Korea; 7Division of Pediatric Nephrology, Severance Children’s Hospital, Seoul, Korea; 8Institute of Kidney Disease Research, Yonsei University College of Medicine, Seoul, Korea; 9Department of Internal Medicine IV (Nephrology and Hypertension), Medical University Innsbruck, Innsbruck, Austria 1,3) The publication of genetic epidemiology meta-analyses has analyses have redundant duplicate topics and many errors. increased rapidly, but it has been suggested that many of the Although there has been an impressive increase in meta-analyses statistically significant results are false positive. In addition, from China, particularly those on genetic associa tions, most most such meta-analyses have been redundant, duplicate, and claimed candidate gene associations are likely false-positives, erroneous, leading to research waste. In addition, since most suggesting an urgent global need to incorporate genome-wide claimed candidate gene associations were false-positives, cor- data and state-of-the art statistical inferences to avoid a flood of rectly interpreting the published results is important.
    [Show full text]
  • Iκb Kinase Ε and TANK-Binding Kinase 1 Activate AKT by Direct Phosphorylation
    IκB kinase ε and TANK-binding kinase 1 activate AKT by direct phosphorylation Xiaoduo Xiea, Denghong Zhangb, Bin Zhaoa, Min-Kan Lua, Ming Youc, Gianluigi Condorellib, Cun-Yu Wangd, and Kun-Liang Guana,1 aDepartment of Pharmacology and Moores Cancer Center and bDepartment of Medicine, University of California at San Diego, La Jolla, CA 92093; cCancer Center, Medical College of Wisconsin, Milwaukee, WI 53226; and dLaboratory of Molecular Signaling, Division of Oral Biology and Medicine, University of California Los Angeles School of Dentistry, Los Angeles, CA 90095 Edited* by Jack E. Dixon, The Howard Hughes Medical Institute, Chevy Chase, MD, and approved March 8, 2011 (received for review October 27, 2010) AKT activation requires phosphorylation of the activation loop The noncanonical IκB kinase ε (IKKε) has been demonstrated (T308) by 3-phosphoinositide-dependent protein kinase 1 (PDK1) to play an essential role in Ras-induced cell transformation, which and the hydrophobic motif (S473) by the mammalian target of requires activation of both the Raf-MEK-ERK and PI3K-AKT rapamycin complex 2 (mTORC2). We recently observed that pathways (20). Of particular interest is the observation that IKKε phosphorylation of the AKT hydrophobic motif was dramatically can functionally replace the requirement of AKT to support cell elevated, rather than decreased, in mTOR knockout heart tissues, transformation, which suggests that IKKε may act as an AKT indicating the existence of other kinase(s) contributing to AKT regulator or effector. Consistently, IKKε was found to be ampli- phosphorylation. Here we show that the atypical IκB kinase ε and fied in several types of human cancer, including ovarian cancer TANK-binding kinase 1 (IKKε/TBK1) phosphorylate AKT on both the and breast cancer (20, 21).
    [Show full text]
  • Molecular Mechanisms Underlying Innate Immune Kinase
    MOLECULAR MECHANISMS UNDERLYING INNATE IMMUNE KINASE TBK1-DRIVEN ONCOGENIC TRANSFORMATION APPROVED BY SUPERVISORY COMMITTEE Michael A White, Ph.D. Melanie H. Cobb, Ph.D. Lawrence Lum, Ph.D. John D. Minna, M.D. DEDICATION This work is dedicated to my mother and Arlene for their love and support. ACKNOWLEDGEMENTS I am very grateful to my mentor, Dr. Michael White, for his continuous support and guidance through the entire study. I really appreciate his inspiration, patience, and generosity. I would also like to thank my committee members, Dr. Cobb, Dr. Lum, and Dr. Minna, for their invaluable advice and discussion. I thank all the White lab members and my friends for their help, suggestion, and discussion. Particularly, I would like to thank Rosie, Michael, Brian, Tzuling, and Malia for their long-term support and collaboration. I would also like to thank my friends, Veleka, Pei-Ling, Jen-Chieh, Shu-Yi, Chih-Chiang, Jen-Shuan, Yi-Chun, and Yu-San for their friendship. I am grateful to Drs. Rolf Brekken, Zhijian James Chen, Xuetao Cao, Philip Tsichlis, Charles Yeaman, William Hahn, Keqiang Ye, and Shu-Chan Hsu, Bing Su, Dos Sarbassov, Mark Magnuson, David Sabatini, Thomas Tan, and Bert Vogelstein for many of the reagents used in these studies. Finally, and most importantly, I would like to thank my mother and Arlene for their unending support and encouragement. MOLECULAR MECHANISMS UNDERLYING INNATE IMMUNE KINASE TBK1-DRIVEN ONCOGENIC TRANSFORMATION by YI-HUNG OU DISSERTATION Presented to the Faculty of the Graduate School of Biomedical Sciences The University of Texas Southwestern Medical Center at Dallas In Partial Fulfillment of the Requirements For the Degree of DOCTOR OF PHILOSOPHY The University of Texas Southwestern Medical Center at Dallas Dallas, Texas April, 2013 Copyright by YI-HUNG OU, 2013 All Rights Reserved MOLECULAR MECHANISMS UNDERLYING INNATE IMMUNE KINASE TBK1-DRIVEN ONCOGENIC TRANSFORMATION Publication No.
    [Show full text]
  • Mutational Profiling of Lipomas
    bioRxiv preprint doi: https://doi.org/10.1101/585307; this version posted March 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Mutational profiling of lipomas Deepika Kanojia1*, Pushkar Dakle1, Anand Mayakonda1,2, Rajeev Parameswaran3, Mark E Puhaindran4, Victor Lee Kwan Min5, Vikas Madan1 and H Phillip Koeffler1,6,7 1Cancer Science Institute of Singapore, National University of Singapore, Singapore; 2Epigenomics and Cancer Risk Factors, German Cancer Research Center (DKFZ), Heidelberg, Germany; 3Division of Surgical Oncology, National University Cancer Institute, Singapore; 4Department of Hand and Reconstructive Microsurgery, National University Hospital; 5Department of Pathology, National University Hospital; 6Division of Hematology/Oncology, Cedars-Sinai Medical Center, University of California, School of Medicine, Los Angeles, California, USA; 7National University Cancer Institute, National University Hospital, Singapore. *Correspondence: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/585307; this version posted March 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Abstract Lipomas are benign fatty tumors with a high prevalence rate, mostly found in adults but have a good prognosis. Until now, reason for lipoma occurrence not been identified. We performed whole exome sequencing to define the mutational spectrum in ten lipoma patients along with their matching control samples.
    [Show full text]
  • Targeting Mir128-3P Alleviates Myocardial Insulin Resistance And
    RESEARCH ARTICLE Targeting mir128-3p alleviates myocardial insulin resistance and prevents ischemia- induced heart failure Andrea Ruiz-Velasco1, Min Zi1, Susanne S Hille2,3, Tayyiba Azam1, Namrita Kaur1, Juwei Jiang1, Binh Nguyen1, Karolina Sekeres4, Pablo Binder1, Lucy Collins1, Fay Pu5, Han Xiao6, Kaomei Guan4, Norbert Frey2,3, Elizabeth J Cartwright1, Oliver J Mu¨ ller2,3*, Xin Wang1*, Wei Liu1* 1Faculty of Biology, Medicine, and Health, the University of Manchester, Manchester, United Kingdom; 2Department of Internal Medicine III, University of Kiel, Kiel, Germany; 3DZHK, German Centre for Cardiovascular Research, Partner Site Hamburg/Kiel/Lu¨ beck, Kiel, Germany; 4Institute of Pharmacology and Toxicology, Faculty of Medicine Carl Gustav Carus, Technische Universitaet Dresden, Dresden, Germany; 5Edinburgh University Medical School, Edinburgh, United Kingdom; 6Institute of Vascular Medicine, Peking University, Beijing, China Abstract Myocardial insulin resistance contributes to heart failure in response to pathological stresses, therefore, a therapeutic strategy to maintain cardiac insulin pathways requires further investigation. We demonstrated that insulin receptor substrate 1 (IRS1) was reduced in failing mouse hearts post-myocardial infarction (MI) and failing human hearts. The mice manifesting severe cardiac dysfunction post-MI displayed elevated mir128-3p in the myocardium. Ischemia- upregulated mir128-3p promoted Irs1 degradation. Using rat cardiomyocytes and human-induced pluripotent stem cell-derived cardiomyocytes, we elucidated that mitogen-activated protein kinase *For correspondence: 7 (MAPK7, also known as ERK5)-mediated CCAAT/enhancer-binding protein beta (CEBPb) [email protected] (OJM); transcriptionally represses mir128-3p under hypoxia. Therapeutically, functional studies [email protected] (XW); demonstrated gene therapy-delivered cardiac-specific MAPK7 restoration or overexpression of [email protected] (WL) CEBPb impeded cardiac injury after MI, at least partly due to normalization of mir128-3p.
    [Show full text]
  • Novel Regulation of Mtor Complex 1 Signaling by Site-Specific Mtor Phosphorylation
    Novel Regulation of mTOR Complex 1 Signaling by Site-Specific mTOR Phosphorylation by Bilgen Ekim Üstünel A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Cell and Developmental Biology) in The University of Michigan 2012 Doctoral Committee: Assistant Professor Diane C. Fingar, Chair Associate Professor Billy Tsai Associate Professor Anne B. Vojtek Assistant Professor Patrick J. Hu Assistant Professor Ken Inoki “Our true mentor in life is science.” (“Hayatta en hakiki mürşit ilimdir.”) Mustafa Kemal Atatürk, the founder of Turkish Republic © Bilgen Ekim Üstünel 2012 Acknowledgements This thesis would not have been possible without the enormous support and encouragement of my Ph.D. advisor Diane C. Fingar. I am sincerely thankful for her research insight and guidance during my Ph.D. training. I would like to express my great appreciation to Billy Tsai, Anne B. Vojtek, Ken Inoki, and Patrick J. Hu for serving on my thesis committee, whose advice and help have been valuable. I would like to thank all members of the Fingar, Tsai, and Verhey labs for the discussion in our group meetings. I also would like to thank the CDB administrative staff, especillay Kristen Hug, for their help. I thank Ed Feener for performing the liquid chromatography tandem mass spectrometry analysis to identify novel phosphorylation sites on mTOR and Steve Riddle for performing the in vitro kinome screen to identify candidate kinases for mTOR S2159 phosphorylation site. I thank Brian Magnuson, Hugo A. Acosta-Jaquez, and Jennifer A. Keller for contributing to my first-author paper published in Molecular and Cellular Biology Journal in 2011.
    [Show full text]