DOCSLIB.ORG

The Curing AI for Precision Medicine

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Curing AI for Precision Medicine The Curing AI for Precision Medicine Hoifung Poon 1 Medicine Today Is Imprecise Top 20 drugs 80% non-responders Wasted 1/3 health spending $750 billion / year 2 Disruption 1: Big Data 2009 2013: 40% 93% 3 Disruption 2: Pay-for-Performance Goal: 75% by 2020 4 Vemurafenib on BRAF-V600 Melanoma Before Treatment 15 Weeks 5 Vemurafenib on BRAF-V600 Melanoma Before Treatment 15 Weeks 23 Weeks 6 Why We Haven’t Solved Precision Medicine? … ATTCGGATATTTAAGGC … … ATTCGGGTATTTAAGCC … … ATTCGGATATTTAAGGC … … ATTCGGGTATTTAAGCC … … ATTCGGATATTTAAGGC … … ATTCGGGTATTTAAGCC … High-Throughput Data Discovery Bottleneck #1: Knowledge Bottleneck #2: Reasoning AI is the key to overcome these bottlenecks 7 Use Case: Molecular Tumor Board 8 www.ucsf.edu/news/2014/11/120451/bridging-gap-precision-medicine Use Case: Molecular Tumor Board Problem: Hard to scale U.S. 2015: 1.6 million new cases, 600K deaths 902 cancer hospitals Memorial Sloan Kettering 2016: Sequence: Tens of thousand Board can review: A few hundred Wanted: Decision support for cancer precision medicine 9 First-Generation Molecular Tumor Board Knowledge bottleneck E.g., given a tumor sequence, determine: What genes and mutations are important What drugs might be applicable Can do manually but hard to scale 10 Next-Generation Molecular Tumor Board Reasoning bottleneck E.g., personalize drug combinations Can’t do manually, ever 11 Big Medical Data Decision Support Precision Medicine Machine Predict Reading Drug Combo 12 13 PubMed 26 millions abstracts Two new abstracts every minute Adds over one million every year 14 Machine Reading PMID: 123 … VDR+ binds to SMAD3 to form … PMID: 456 Knowledge … JUN expression Base is induced by SMAD3/4 … …… 15 Machine Reading Involvement of p70(S6)-kinase activation in IL-10 up-regulation in human monocytes by gp41 envelope protein of human immunodeficiency virus type 1 ... 16 Machine Reading Involvement of p70(S6)-kinase activation in IL-10 up-regulation in human monocytes by gp41 envelope protein of human immunodeficiency virus type 1 ... human gp41 p70(S6)-kinase IL-10 monocyte GENE GENE GENE CELL 17 Machine Reading Involvement of p70(S6)-kinase activation in IL-10 up-regulation in human monocytes by gp41 envelope protein of human immunodeficiency virus type 1 ... Involvement REGULATION Theme Cause up-regulation REGULATION activation REGULATION Theme Cause Site Theme human gp41 p70(S6)-kinase IL-10 monocyte GENE GENE GENE CELL 18 Long Tail of Variations TP53 inhibits BCL2. Tumor suppressor P53 down-regulates the activity of BCL-2 proteins. BCL2 transcription is suppressed by P53 expression. The inhibition of B-cell CLL/Lymphoma 2 expression by TP53 … …… negative regulation 532 inhibited, 252 inhibition, 218 inhibit, 207 blocked, 175 inhibits, 157 decreased, 156 reduced, 112 suppressed, 108 decrease, 86 inhibitor, 81 Inhibition, 68 inhibitors, 67 abolished, 66 suppress, 65 block, 63 prevented, 48 suppression, 47 blocks, 44 inhibiting, 42 loss, 39 impaired, 38 reduction, 32 down-regulated, 29 abrogated, 27 prevents, 27 attenuated, 26 repression, 26 decreases, 26 down-regulation, 25 diminished, 25 downregulated, 25 suppresses, 22 interfere, 21 absence, 21 repress …… 19 Machine Reading Prior work Focused on Newswire / Web Popular entities and facts Redundancy Simple methods often suffice High-value verticals Healthcare, finance, law, etc. Little redundancy: Rare entities and facts Novel challenges require sophisticated NLP 20 Precision Medicine Machine Reading Challenges Advances Annotation Bottleneck Distant Supervision Complex Knowledge Grounded Semantic Parsing Reasoning Neural Embedding Distant Supervision with Beyond Sentence Boundary Discourse Modeling 21 Free Lunch: Existing KB Regulation Theme Cause Positive A2M FOXO1 NCI Positive ABCB1 TP53 Pathway KB Negative BCL2 TP53 … … … 22 Free Lunch: Existing KB Regulation Theme Cause Positive A2M FOXO1 NCI Positive ABCB1 TP53 Pathway KB Negative BCL2 TP53 … … … 23 Free Lunch: Existing KB Regulation Theme Cause Positive A2M FOXO1 NCI Positive ABCB1 TP53 Pathway KB Negative BCL2 TP53 … … … TP53 inhibits BCL2. Tumor suppressor P53 down-regulates the activity of BCL-2 proteins. BCL2 transcription is suppressed by P53 expression. The inhibition of B-cell CLL/Lymphoma 2 expression by TP53 … …… 24 Free Lunch: Existing KB Regulation Theme Cause Positive A2M FOXO1 NCI Positive ABCB1 TP53 Pathway KB Negative BCL2 TP53 … … … TP53 inhibits BCL2. Tumor suppressor P53 down-regulates the activity of BCL-2 proteins. BCL2 transcription is suppressed by P53 expression. The inhibition of B-cell CLL/Lymphoma 2 expression by TP53 … …… 25 Free Lunch: Existing KB Regulation Theme Cause Positive A2M FOXO1 NCI Positive ABCB1 TP53 Pathway KB Negative BCL2 TP53 … … … TP53 inhibits BCL2. Tumor suppressor P53 down-regulatesDistant the activity Supervision of BCL-2 proteins. BCL2 transcription is suppressed by P53 expression. The inhibition of B-cell CLL/Lymphoma 2 expression by TP53 … …… 26 Genetic Pathways PubMed-scale extraction 15,000 genes, 1.5 million unique regulations Compare w. NCI: 10,000 unique regulations Applications UCSC Genome Browser, MSR Interactions Track U. Wisconsin breast cancer study Etc. Poon, Toutanova, Quirk, “Distant Supervision for Cancer Pathway Extraction from Text”. PSB-15. 27 Complex Knowledge Outperform 19 out of 24 supervised participants in GENIA Shared Task Parikh, Poon, Toutanova. “Grounded Semantic Parsing for Complex Knowledge Extraction”, NAACL-15. 28 Cross-Sentence, N-ary Relations The deletion mutation on exon-19 of EGFR gene was present in 16 patients, while the L858E point mutation on exon-21 was noted in 10. All patients were treated with gefitinib and showed a partial response. 29 Drug-Gene Interactions Distant supervision w. discourse modeling Orders of magnitude increase: 162 79,952 No need for annotated examples Quirk & Poon, “Distant Supervision for Relation Extraction beyond the Sentence Boundary”, arxiv.org/abs/1609.04873. 30 Reasoning: Neural Embedding Embed gene network Entity / Relation (v1, v2, …, vk) Relation triple <subj, rel, obj> Score Distant supervision: Known relations score higher Increased recall by 20 points on held-out Toutanova et al., “Representing Text for Joint Embedding of Text and Knowledge Bases”, EMNLP-15. Toutanova et al., “Compositional Learning of Embeddings for Relation Paths in Knowledge Bases and Text”, ACL-16. 31 Big Medical Data Decision Support Precision Medicine Predict Drug Combo 32 Drug Combination Problem: What combos to try? Cancer drug: 250+ approved, 1200+ developing Pairwise: 719,400; three-way: 287,280,400 Wanted: Prioritize drug combos in silico 33 Drug Combination Problem: What combos to try? Cancer drug: 250+ approved, 1200+ developing Pairwise: 719,400; three-way: 287,280,400 Wanted: Prioritize drug combos in silico Drug 1 Drug 2 34 35 BeatAML Targeted drugs: 149 Pairs: 11,026 Tested: 102; Unknown: 10,924 36 Machine Learning Evaluation: Cell kill + Synergy Learning: Ranking loss Features Panomics: Gene expression, … Pharmacology: Drug targets Network knowledge: TP53 inhibits BCL2, … 37 Interpretable Model Feature Weight Feature Weight BCL2 and MAPK3 (moderate) 0.0442 BCL2 or MAPK3 (moderate) 0.041 MAP2K1 or MAPK10 (moderate) 0.0402 AKT2 and BCL2 (high) 0.033 BCL2 or MAPK3 (moderate) 0.0325 MAP2K1 or MAPK10 (moderate) 0.033 CSNK1E or PLK4 (high) 0.0311 BCL2 and MAPK3 (moderate) 0.031 MAP2K7 and MAPK7 (moderate) 0.0301 MAP2K5 and MAPK4 (high) 0.031 AKT3 and MAP2K1 (high) 0.0293 BCL2 and MAPK1 (high) 0.030 NEK2 or PLK1 (moderate) 0.0286 MAPK4 and SRC (high) 0.029 PSMB1 or PSMB2 (moderate) 0.0267 MAP2K2 or MAPK10 (moderate) 0.028 MAPK9 and STK11 (high) 0.0263 AKT3 and MAP2K1 (high) 0.027 MAPK1 and MAPK13 (moderate) 0.0263 BCL2 and MAPK3 (high) 0.027 … … … … BIRC5 or PLK4 (moderate) -0.0321 CSNK1D or PLK4 (moderate) -0.026 MAP2K2 or MAPK14 (high) -0.0324 MAP2K1 or MAPK13 (moderate) -0.026 AKT3 and MAPK8 (moderate) -0.0336 STK10 and STK33 (high) -0.027 STK10 and STK33 (high) -0.0337 AKT3 and MAPK8 (moderate) -0.028 BCL2 or MAPK8 (moderate) -0.0343 MAPK3 and SRC (high) -0.028 EGFR and MAPK3 (moderate) -0.036 BIRC5 or PLK4 (moderate) -0.029 MAPK10 and MAPK3 (moderate) -0.0381 MAP2K1 and MAPK10 (moderate) -0.031 MAP2K1 and MAPK10 (moderate) -0.0395 PLK1 and TAOK1 (moderate) -0.032 BCL2 or MAPK1 (high) -0.0442 MAP2K2 or MAPK14 (high) -0.034 BCL2 or MAPK8 (high) -0.0507 AURKB or PLK4 (moderate) -0.034 Composite metric AA metric 38 Interpretable Model Feature Weight Feature Weight BCL2 and MAPK3 (moderate) 0.0442 BCL2 or MAPK3 (moderate) 0.041 MAP2K1 or MAPK10 (moderate) 0.0402 AKT2 and BCL2 (high) 0.033 BCL2 or MAPK3 (moderate) 0.0325 MAP2K1 or MAPK10 (moderate) 0.033 CSNK1E or PLK4 (high) 0.0311 BCL2 and MAPK3 (moderate) 0.031 MAP2K7 and MAPK7 (moderate) 0.0301 MAP2K5 and MAPK4 (high) 0.031 AKT3 and MAP2K1 (high) 0.0293 BCL2 and MAPK1 (high) 0.030 NEK2 or PLK1 Hanover:(moderate) 0.0286 BCL2MAPK4 + andMEK SRC (high) 0.029 PSMB1 or PSMB2 (moderate) 0.0267 MAP2K2 or MAPK10 (moderate) 0.028 MAPK9 and STK11 (high) 0.0263 AKT3 and MAP2K1 (high) 0.027 MAPK1 and MAPK13 (moderate) 0.0263 BCL2 and MAPK3 (high) 0.027 … … … … BIRC5 or PLK4 (moderate) -0.0321 CSNK1D or PLK4 (moderate) -0.026 ImpendingMAP2K2 or MAPK14 (high) trial on-0.0324 VenetoclaxMAP2K1 or MAPK13 (moderate)/ Trametinib-0.026 AKT3 and MAPK8 (moderate) -0.0336 STK10 and STK33 (high) -0.027 STK10 and STK33 (high) -0.0337 AKT3 and MAPK8 (moderate) -0.028 BCL2 or MAPK8 (moderate) -0.0343 MAPK3 and SRC (high) -0.028 EGFR and MAPK3
Load more

Recommended publications
  • Deregulated Gene Expression Pathways in Myelodysplastic Syndrome Hematopoietic Stem Cells
    Leukemia (2010) 24, 756–764 & 2010 Macmillan Publishers Limited All rights reserved 0887-6924/10 $32.00 www.nature.com/leu ORIGINAL ARTICLE Deregulated gene expression pathways in myelodysplastic syndrome hematopoietic stem cells A Pellagatti1, M Cazzola2, A Giagounidis3, J Perry1, L Malcovati2, MG Della Porta2,MJa¨dersten4, S Killick5, A Verma6, CJ Norbury7, E Hellstro¨m-Lindberg4, JS Wainscoat1 and J Boultwood1 1LRF Molecular Haematology Unit, NDCLS, John Radcliffe Hospital, Oxford, UK; 2Department of Hematology Oncology, University of Pavia Medical School, Fondazione IRCCS Policlinico San Matteo, Pavia, Italy; 3Medizinische Klinik II, St Johannes Hospital, Duisburg, Germany; 4Division of Hematology, Department of Medicine, Karolinska Institutet, Stockholm, Sweden; 5Department of Haematology, Royal Bournemouth Hospital, Bournemouth, UK; 6Albert Einstein College of Medicine, Bronx, NY, USA and 7Sir William Dunn School of Pathology, University of Oxford, Oxford, UK To gain insight into the molecular pathogenesis of the the World Health Organization.6,7 Patients with refractory myelodysplastic syndromes (MDS), we performed global gene anemia (RA) with or without ringed sideroblasts, according to expression profiling and pathway analysis on the hemato- poietic stem cells (HSC) of 183 MDS patients as compared with the the French–American–British classification, were subdivided HSC of 17 healthy controls. The most significantly deregulated based on the presence or absence of multilineage dysplasia. In pathways in MDS include interferon signaling, thrombopoietin addition, patients with RA with excess blasts (RAEB) were signaling and the Wnt pathways. Among the most signifi- subdivided into two categories, RAEB1 and RAEB2, based on the cantly deregulated gene pathways in early MDS are immuno- percentage of bone marrow blasts.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Recombinant MAP2K2 Protein
    Recombinant MAP2K2 protein Catalog No: 81332, 81632 Quantity: 20, 1000 µg Expressed In: Baculovirus Concentration: 0.3 µg/µl Source: Human Buffer Contents: Recombinant MAP2K2 protein is supplied in 25 mM HEPES-NaOH pH 7.5, 300 mM NaCl, 10% glycerol, 0.04% Triton X-100, and 0.5 mM TCEP. Background: MAP2K2 (Mitogen-Activated Protein Kinase Kinase Kinase 2) is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase plays a critical role in mitogen growth factor signal transduction. It phosphorylates and activates MAPK1/ERK2 and MAPK2/ERK3. The activation of this kinase itself is dependent on the Ser/Thr phosphorylation by MAP kinase kinase kinases. Mutations in this gene cause cardiofaciocutaneous syndrome (CFC syndrome), a disease characterized by heart defects, cognitive disability, and distinctive facial features similar to those found in Noonan syndrome. Protein Details: Recombinant MAP2K2 protein was expressed in baculovirus expression system as the full length protein (accession number NP_109587.1) with a N-terminal FLAG Tag. The molecular weight of the protein is 45.7 kDa. Application Notes: This product was manufactured as described in Protein Details. Where possible, Active Motif has developed functional or activity assays for Recombinant MAP2K2 protein gel recombinant proteins. Additional characterization such as enzyme kinetic activity 10% SDS-PAGE with Coomassie blue assays, inhibitor screening or other biological activity assays may not have been staining MW: 45.7 kDa performed for every product. All available data for a given product is shown on the lot- Purity: >90% specific Technical Data Sheet. Storage and Guarantee: Recombinant proteins in solution are temperature sensitive and must be stored at -80°C to prevent degradation.
    [Show full text]
  • Influencers on Thyroid Cancer Onset: Molecular Genetic Basis
    G C A T T A C G G C A T genes Review Influencers on Thyroid Cancer Onset: Molecular Genetic Basis Berta Luzón-Toro 1,2, Raquel María Fernández 1,2, Leticia Villalba-Benito 1,2, Ana Torroglosa 1,2, Guillermo Antiñolo 1,2 and Salud Borrego 1,2,* 1 Department of Maternofetal Medicine, Genetics and Reproduction, Institute of Biomedicine of Seville (IBIS), University Hospital Virgen del Rocío/CSIC/University of Seville, 41013 Seville, Spain; [email protected] (B.L.-T.); [email protected] (R.M.F.); [email protected] (L.V.-B.); [email protected] (A.T.); [email protected] (G.A.) 2 Centre for Biomedical Network Research on Rare Diseases (CIBERER), 41013 Seville, Spain * Correspondence: [email protected]; Tel.: +34-955-012641 Received: 3 September 2019; Accepted: 6 November 2019; Published: 8 November 2019 Abstract: Thyroid cancer, a cancerous tumor or growth located within the thyroid gland, is the most common endocrine cancer. It is one of the few cancers whereby incidence rates have increased in recent years. It occurs in all age groups, from children through to seniors. Most studies are focused on dissecting its genetic basis, since our current knowledge of the genetic background of the different forms of thyroid cancer is far from complete, which poses a challenge for diagnosis and prognosis of the disease. In this review, we describe prevailing advances and update our understanding of the molecular genetics of thyroid cancer, focusing on the main genes related with the pathology, including the different noncoding RNAs associated with the disease.
    [Show full text]
  • Prioritization and Comprehensive Analysis of Genes Associated with Melanoma
    ONCOLOGY LETTERS 18: 127-136, 2019 Prioritization and comprehensive analysis of genes associated with melanoma CHENG FENG, MING BAI, HAILIN ZHANG, ANG ZENG and WENCHAO ZHANG Department of Plastic Surgery, Peking Union Medical College Hospital, Beijing 100730, P.R. China Received August 13, 2018; Accepted February 28, 2019 DOI: 10.3892/ol.2019.10284 Abstract. Melanoma is a malignant tumor derived from accuracy and appropriate treatment due to medical advances, melanocytes, which occurs mostly in the skin. A major chal- its pathogenesis and natural course remain unclear. lenge in cancer research is the biological interpretation of the Melanoma is a malignant type of tumor, which may be complexity of cancer somatic mutation profiles. The aim of the composed of epidermal melanocytes, nevocytes or dermal present study was to obtain a comprehensive understanding of melanocytes. Epidemiology studies revealed that melanoma the formation and development of melanoma and to identify its is likely to be caused by hereditary factors and environmental associated genes. In the present study, a pipeline was proposed risk factors, including sex, age, ethnicity and geographic loca- for investigating key genes associated with melanoma based tion (6,7). This is in line with the most vital and potentially on the Online Mendelian Inheritance in Man and Search Tool reversible risk factor of malignant melanoma arising from for the Retrieval of Interacting Genes/Proteins databases an interaction between environmental exposure and genetic through a random walk model. Additionally, functional enrich- susceptibility. Gandini et al (8) revealed the association ment analysis was performed for key genes associated with between melanoma and ultraviolet (UV)-irradiation, and melanoma.
    [Show full text]
  • Human MAPK10 Peptide (DAG-P1762) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use
    Human MAPK10 peptide (DAG-P1762) This product is for research use only and is not intended for diagnostic use. PRODUCT INFORMATION Antigen Description The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This protein is a neuronal-specific form of c-Jun N-terminal kinases (JNKs). Through its phosphorylation and nuclear localization, this kinase plays regulatory roles in the signaling pathways during neuronal apoptosis. Beta-arrestin 2, a receptor-regulated MAP kinase scaffold protein, is found to interact with, and stimulate the phosphorylation of this kinase by MAP kinase kinase 4 (MKK4). Cyclin-dependent kianse 5 can phosphorylate, and inhibit the activity of this kinase, which may be important in preventing neuronal apoptosis. Four alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008] Specificity Specific to a subset of neurons in the nervous system. Present in the hippocampus and areas, cerebellum, striatum, brain stem, and weakly in the spinal cord. Very weak expression in testis and kidney. Nature Synthetic Expression System N/A Purity 70 - 90% by HPLC. Conjugate Unconjugated Sequence Similarities Belongs to the protein kinase superfamily. CMGC Ser/Thr protein kinase family. MAP kinase subfamily.Contains 1 protein kinase domain. Cellular Localization Cytoplasm. Procedure None Format Liquid Preservative None Storage Shipped at 4°C. Upon delivery aliquot and store at -20°C or -80°C. Avoid repeated freeze / thaw cycles.
    [Show full text]
  • MAPK1/MAPK3 Monoclonal Antibody, Clone Sb46b
    MAPK1/MAPK3 monoclonal antibody, clone SB46b Catalog # : MAB3337 規格 : [ 500 ug ] List All Specification Application Image Product Mouse monoclonal antibody raised against recombinant Western Blot Description: MAPK1/MAPK3. Immunogen: Recombinant protein corresponding to human MAPK1/MAPK3. Host: Mouse enlarge Reactivity: Human Immunoprecipitation Specificity: human Erk 1 and human Erk2. Form: Liquid Isotype: IgG2a Recommend Western Blot (1-2 ug/mL) Usage: Immunoprecipitation (10-15ug) The optimal working dilution should be determined by the end user. Storage Buffer: In 100 mM BBS, pH 8.0 Storage Store at 4°C. Instruction: Datasheet: Download Publication Reference 1. Hydrophobic as well as charged residues in both MEK1 and ERK2 are important for their proper docking. Xu Be, Stippec S, Robinson FL, Cobb MH.J Biol Chem. 2001 Jul 13;276(28):26509-15. Epub 2001 May 14. 2. Mitogen-activated protein (MAP) kinase pathways: regulation and physiological functions. Pearson G, Robinson F, Beers Gibson T, Xu BE, Karandikar M, Berman K, Cobb MH.Endocr Rev. 2001 Apr;22(2):153-83. 3. Molecular cloning, expression, and characterization of the human mitogen-activated protein kinase p44erk1. Charest DL, Mordret G, Harder KW, Jirik F, Pelech SL.Mol Cell Biol. 1993 Aug;13(8):4679-90. Applications Western Blot Page 1 of 3 2021/6/20 Human PBMC (Lane 1) and spleen lysate (Lane 2) was stained with MAPK1/3 monoclonal antibody, clone SB46b (Cat # MAB3337). Goat anti-Mouse IgG2a was used to develop. Immunoprecipitation MAPK1 MAPK3 Gene Information Entrez GeneID: 5595 Gene Name: MAPK3 Gene Alias: ERK1,HS44KDAP,HUMKER1A,MGC20180,P44ERK1,P44MAPK,PRKM3 Gene mitogen-activated protein kinase 3 Description: Omim ID: 601795 Gene Ontology: Hyperlink Gene Summary: The protein encoded by this gene is a member of the MAP kinase family.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Map2k1 and Map2k2 Genes Contribute to the Normal Development of Syncytiotrophoblasts During Placentation
    RESEARCH ARTICLE 1363 Development 136, 1363-1374 (2009) doi:10.1242/dev.031872 Map2k1 and Map2k2 genes contribute to the normal development of syncytiotrophoblasts during placentation Valérie Nadeau*, Stéphanie Guillemette*, Louis-François Bélanger, Olivier Jacob, Sophie Roy and Jean Charron† The mammalian genome contains two ERK/MAP kinase kinase genes, Map2k1 and Map2k2, which encode dual-specificity kinases responsible for ERK/MAP kinase activation. In the mouse, loss of Map2k1 function causes embryonic lethality, whereas Map2k2 mutants survive with a normal lifespan, suggesting that Map2k1 masks the phenotype due to the Map2k2 mutation. To uncover the specific function of MAP2K2 and the threshold requirement of MAP2K proteins during embryo formation, we have successively ablated the Map2k gene functions. We report here that Map2k2 haploinsufficiency affects the normal development of placenta in the absence of one Map2k1 allele. Most Map2k1+/–Map2k2+/– embryos die during gestation because of placenta defects restricted to extra-embryonic tissues. The impaired viability of Map2k1+/–Map2k2+/– embryos can be rescued when the Map2k1 deletion is restricted to the embryonic tissues. The severity of the placenta phenotype is dependent on the number of Map2k mutant alleles, the deletion of the Map2k1 allele being more deleterious. Moreover, the deletion of one or both Map2k2 alleles in the context of one null Map2k1 allele leads to the formation of multinucleated trophoblast giant (MTG) cells. Genetic experiments indicate that these structures are derived from Gcm1-expressing syncytiotrophoblasts (SynT), which are affected in their ability to form the uniform SynT layer II lining the maternal sinuses. Thus, even though Map2k1 plays a predominant role, these results enlighten the function of Map2k2 in placenta development.
    [Show full text]
  • Genetics of Familial Non-Medullary Thyroid Carcinoma (FNMTC)
    cancers Review Genetics of Familial Non-Medullary Thyroid Carcinoma (FNMTC) Chiara Diquigiovanni * and Elena Bonora Unit of Medical Genetics, Department of Medical and Surgical Sciences, University of Bologna, 40138 Bologna, Italy; [email protected] * Correspondence: [email protected]; Tel.: +39-051-208-8418 Simple Summary: Non-medullary thyroid carcinoma (NMTC) originates from thyroid follicular epithelial cells and is considered familial when occurs in two or more first-degree relatives of the patient, in the absence of predisposing environmental factors. Familial NMTC (FNMTC) cases show a high genetic heterogeneity, thus impairing the identification of pivotal molecular changes. In the past years, linkage-based approaches identified several susceptibility loci and variants associated with NMTC risk, however only few genes have been identified. The advent of next-generation sequencing technologies has improved the discovery of new predisposing genes. In this review we report the most significant genes where variants predispose to FNMTC, with the perspective that the integration of these new molecular findings in the clinical data of patients might allow an early detection and tailored therapy of the disease, optimizing patient management. Abstract: Non-medullary thyroid carcinoma (NMTC) is the most frequent endocrine tumor and originates from the follicular epithelial cells of the thyroid. Familial NMTC (FNMTC) has been defined in pedigrees where two or more first-degree relatives of the patient present the disease in absence of other predisposing environmental factors. Compared to sporadic cases, FNMTCs are often multifocal, recurring more frequently and showing an early age at onset with a worse outcome. FNMTC cases Citation: Diquigiovanni, C.; Bonora, E.
    [Show full text]
  • N-Glycan Trimming in the ER and Calnexin/Calreticulin Cycle
    Neurotransmitter receptorsGABA and A postsynapticreceptor activation signal transmission Ligand-gated ion channel transport GABAGABA Areceptor receptor alpha-5 alpha-1/beta-1/gamma-2 subunit GABA A receptor alpha-2/beta-2/gamma-2GABA receptor alpha-4 subunit GABAGABA receptor A receptor beta-3 subunitalpha-6/beta-2/gamma-2 GABA-AGABA receptor; A receptor alpha-1/beta-2/gamma-2GABA receptoralpha-3/beta-2/gamma-2 alpha-3 subunit GABA-A GABAreceptor; receptor benzodiazepine alpha-6 subunit site GABA-AGABA-A receptor; receptor; GABA-A anion site channel (alpha1/beta2 interface) GABA-A receptor;GABA alpha-6/beta-3/gamma-2 receptor beta-2 subunit GABAGABA receptorGABA-A receptor alpha-2receptor; alpha-1 subunit agonist subunit GABA site Serotonin 3a (5-HT3a) receptor GABA receptorGABA-C rho-1 subunitreceptor GlycineSerotonin receptor subunit3 (5-HT3) alpha-1 receptor GABA receptor rho-2 subunit GlycineGlycine receptor receptor subunit subunit alpha-2 alpha-3 Ca2+ activated K+ channels Metabolism of ingested SeMet, Sec, MeSec into H2Se SmallIntermediateSmall conductance conductance conductance calcium-activated calcium-activated calcium-activated potassium potassium potassiumchannel channel protein channel protein 2 protein 1 4 Small conductance calcium-activatedCalcium-activated potassium potassium channel alpha/beta channel 1 protein 3 Calcium-activated potassiumHistamine channel subunit alpha-1 N-methyltransferase Neuraminidase Pyrimidine biosynthesis Nicotinamide N-methyltransferase Adenosylhomocysteinase PolymerasePolymeraseHistidine basic
    [Show full text]