DOCSLIB.ORG

Mechanisms of IKBKE Activation in Cancer Sridevi Challa University of South Florida, [email protected]

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mechanisms of IKBKE Activation in Cancer Sridevi Challa University of South Florida, Challasridevi@Gmail.Com University of South Florida Scholar Commons Graduate Theses and Dissertations Graduate School 1-29-2017 Mechanisms of IKBKE Activation in Cancer Sridevi Challa University of South Florida, [email protected] Follow this and additional works at: http://scholarcommons.usf.edu/etd Part of the Biochemistry Commons, Biology Commons, and the Cell Biology Commons Scholar Commons Citation Challa, Sridevi, "Mechanisms of IKBKE Activation in Cancer" (2017). Graduate Theses and Dissertations. http://scholarcommons.usf.edu/etd/6617 This Dissertation is brought to you for free and open access by the Graduate School at Scholar Commons. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Scholar Commons. For more information, please contact [email protected]. Mechanisms of IKBKE Activation in Cancer by Sridevi Challa A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Cell Biology, Microbiology, and Molecular Biology College of Arts and Sciences University of South Florida Major Professor: Mokenge P. Malafa, M.D. Gary Reuther, Ph.D. Eric Lau, Ph.D. Domenico Coppola, M.D. Date of Approval: January 12, 2017 Keywords: EGFR, Olaparib, resistance Copyright © 2017, Sridevi Challa DEDICATION This dissertation is dedicated to my kind and courageous mother. ACKNOWLEDGMENTS I would like to acknowledge Dr. Cheng for trusting me with completion of the projects. I would like to thank him for giving me the freedom to explore any aspect of research and always willing to provide the necessary resources and guidance for my projects. I want to also acknowledge Ted and the Cheng lab personnel for their support. I want to also thank Dr. Malafa and his lab for supporting me during the latter part of this work and for his constant insights to make these projects clinically relevant. I would also like to acknowledge Dr. Robert Wenham for his guidance in the olaparib project. Collaboration with them gave me new perspective in cancer research. I want to acknowledge the faculty who served as my committee members: Dr. Seto, Dr. Wu, Dr. Hazelhurst, Dr. Yang and especially Dr. Reuther, Dr. Lau, Dr. Coppola and Dr. Watabe. I would not have completed these projects and my graduate studies without their intellectual guidance. In addition, I want to acknowledge the entire faculty and staff of Moffitt Cancer Center for sharing their expertise and for inspiring me towards a common goal of finding the cure. Especially I want to acknowledge the immense support and directions provided by Dr. Wright and Cathy Gaffney throughout the Ph.D. program. I want to also acknowledge Smitha Pillai for her continuous support and encouragement during difficult times and for always being ready to listen to me, and Greg for giving me helpful suggestions. Lastly, I want to thank my family for their constant support through my entire graduate school and beyond and for always trusting me with my decisions. TABLE OF CONTENTS List of Tables ................................................................................................................................. iv List of Figures ..................................................................................................................................v Abstract ......................................................................................................................................... vii Chapter 1: Background ....................................................................................................................1 Lung cancer ..........................................................................................................................1 Lung cancer classification and its mutational landscape .........................................1 Therapeutic approaches for lung cancer ..................................................................2 KRas signaling in cancer .........................................................................................3 EGFR signaling ........................................................................................................4 Therapeutic challenges of Non-small cell lung cancer ............................................6 Role of PI3K and MAPK pathways in EGFR-TKI resistance .................................8 Pancreatic cancer ...............................................................................................................10 Pathogenesis of Pancreatic cancer .........................................................................10 Therapeutic opportunities and challenges of pancreatic cancer ............................11 Ovarian cancer ...................................................................................................................13 Signaling pathways and therapeutic opportunities for ovarian cancer ..................13 EphA2 signaling in ovarian cancer ........................................................................15 Success and limitations of PARP inhibitors for ovarian cancer ............................17 Essential role of IKBKE signaling in cancer and immunity ..............................................18 IKBKE signaling in inflammation .........................................................................19 IKBKE in NFκB pathway activation .....................................................................20 IKBKE in anti-viral immunity ...............................................................................21 IKBKE in tumor immunity ....................................................................................22 IKBKE in cancer cells ...........................................................................................23 Mechanisms of regulation of IKBKE expression and function .............................25 Post-translational modifications of IKBKE ...........................................................27 Chapter 2: IKBKE is a substrate of EGFR and a therapeutic target in non-small cell lung cancer with activating mutations of EGFR ......................................................................30 Introduction ........................................................................................................................30 Materials and methods .......................................................................................................31 Cell culture, plasmids and antibodies ....................................................................31 Western blot, immunoprecipitation and in vitro kinase assays ..............................32 MTT and clonogenic assays ...................................................................................33 Mass spectrometry .................................................................................................33 Confocal microscopy and immunohistochemistry.................................................33 Cell migration/invasion assay, cell cycle analysis and xenograft study ................34 i Statistical analysis ..................................................................................................34 Results ................................................................................................................................34 NSCLC cell lines with activating EGFR mutation are more sensitive to IKBKE inhibition: activating mutations of EGFR activate IKBKE ................34 IKBKE directly interacts with EGFR ....................................................................36 EGFR phosphorylates IKBKE at tyrosine-153 and -179 residues.........................38 Phosphorylation of IKBKE by EGFR increases IKBKE kinase activity and IKBKE mediates EGFR signaling and cellular function. ................................43 Therapeutic targeting of IKBKE for NSCLC cells with EGFR mutation and TKI resistance ...........................................................................................47 Discussion ..........................................................................................................................51 Chapter 3: Targeting IKBKE and its feedback circuit in pancreatic cancer ..................................55 Introduction ........................................................................................................................55 Materials and methods .......................................................................................................57 Cell lines and reagents ...........................................................................................57 Cell viability and drug synergy studies ..................................................................57 Migration and invasion assays ...............................................................................58 3-D matrigel spheroid culture ................................................................................58 Cancer stem cells assays ........................................................................................58 RNA isolation and RT-qPCR.................................................................................58 Phospho-RTK arrays ..............................................................................................59 Animals and Treatments ........................................................................................59 Statistical analysis ..................................................................................................59 Results ................................................................................................................................60
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Expression and Prognostic Role of IKBKE and TBK1 in Stage I Non-Small Cell Lung Cancer
    Cancer Management and Research Dovepress open access to scientific and medical research Open Access Full Text Article ORIGINAL RESEARCH Expression and prognostic role of IKBKE and TBK1 in stage I non-small cell lung cancer This article was published in the following Dove Press journal: Cancer Management and Research Xin Wang1,2 Background: The inhibitors of nuclear factor kappa-B kinase subunit epsilon (IKBKE) and Feifei Teng2 TANK-binding kinase 1 (TBK1) are important members of the nonclassical IKK family that Jie Lu3 share the kinase domain. They are important oncogenes for activation of several signaling Dianbin Mu4 pathways in several tumors. This study aims to explore the expression of IKBKE and TBK1 Jianbo Zhang4 and their prognostic role in stage I non-small cell lung cancer (NSCLC). Jinming Yu1,2 Patients and methods: A total of 142 surgically resected stage I NSCLC patients were enrolled and immunohistochemistry of IKBKE and TBK1 was performed. 1 Department of Oncology, Renmin Results: IKBKE and TBK1 were expressed in 121 (85.2%) and 114 (80.3%) of stage I Hospital of Wuhan University, Wuhan, fi Hubei 430060, People’s Republic of China; NSCLC patients respectively. IKBKE expression was signi cantly associated with TBK1 2Department of Radiation Oncology, expression (P=0.004). Furthermore, multivariate regression analyses showed there was a fi Shandong Cancer Hospital Af liated to significant relationship between patients with risk factors, the recurrence pattern of metas- Shandong University, Shandong Academy of Medical Sciences, Jinan, Shandong tasis and IKBKE+/TBK1+ co-expression (P=0.032 and P=0.022, respectively). In Kaplan– 250117, People’s Republic of China; Meier survival curve analyses, the IKBKE+/TBK1+ co-expression subgroup was signifi- 3Department of Neurosurgery, Shandong Province Qianfoshan Hospital of Shandong cantly associated with poor overall survival (P=0.014).
    [Show full text]
  • Targeting the Hippo Pathway in Prostate Cancer: What's New?
    cancers Review Targeting the Hippo Pathway in Prostate Cancer: What’s New? Kelly Coffey Solid Tumour Target Discovery Laboratory, Translational and Clinical Research Institute, Newcastle University Centre for Cancer, Faculty of Medical Sciences, Newcastle University, Newcastle upon Tyne NE2 4HH, UK; [email protected] Simple Summary: Prostate cancer is the most commonly diagnosed cancer in men in the UK, accounting for the deaths of over 11,000 men per year. A major problem in this disease are tumours which no longer respond to available treatments. Understanding how this occurs will reveal new ways to treat these patients. In this review, the latest findings regarding a particular group of cellular factors which make up a signalling network called the Hippo pathway will be described. Accumulating evidence suggests that this network contributes to prostate cancer progression and resistance to current treatments. Identifying how this pathway can be targeted with drugs is a promising area of research to improve the treatment of prostate cancer. Abstract: Identifying novel therapeutic targets for the treatment of prostate cancer (PC) remains a key area of research. With the emergence of resistance to androgen receptor (AR)-targeting therapies, other signalling pathways which crosstalk with AR signalling are important. Over recent years, evidence has accumulated for targeting the Hippo signalling pathway. Discovered in Drosophila melanogasta, the Hippo pathway plays a role in the regulation of organ size, proliferation, migration and invasion. In response to a variety of stimuli, including cell–cell contact, nutrients and stress, a kinase cascade is activated, which includes STK4/3 and LATS1/2 to inhibit the effector proteins YAP and its paralogue TAZ.
    [Show full text]
  • Workflows for Rapid Functional Annotation of Diverse
    insects Article Workflows for Rapid Functional Annotation of Diverse Arthropod Genomes Surya Saha 1,2 , Amanda M. Cooksey 2,3, Anna K. Childers 4 , Monica F. Poelchau 5 and Fiona M. McCarthy 2,* 1 Boyce Thompson Institute, 533 Tower Rd., Ithaca, NY 14853, USA; [email protected] 2 School of Animal and Comparative Biomedical Sciences, University of Arizona, 1117 E. Lowell St., Tucson, AZ 85721, USA; [email protected] 3 CyVerse, BioScience Research Laboratories, University of Arizona, 1230 N. Cherry Ave., Tucson, AZ 85721, USA 4 Bee Research Laboratory, Beltsville Agricultural Research Center, Agricultural Research Service, USDA, 10300 Baltimore Ave., Beltsville, MD 20705, USA; [email protected] 5 National Agricultural Library, Agricultural Research Service, USDA, 10301 Baltimore Ave., Beltsville, MD 20705, USA; [email protected] * Correspondence: fi[email protected] Simple Summary: Genomic technologies are accumulating information about genes faster than ever before, and sequencing initiatives, such as the Earth BioGenome Project, i5k, and Ag100Pest Initiative, are expected to increase this rate of acquisition. However, if genomic sequencing is to be used for the improvement of human health, agriculture, and our understanding of biological systems, it is necessary to identify genes and understand how they contribute to biological outcomes. While there are several well-established workflows for assembling genomic sequences and identifying genes, understanding gene function is essential to create actionable knowledge. Moreover, this functional annotation process must be easily accessible and provide information at a genomic scale to keep up Citation: Saha, S.; Cooksey, A.M.; with new sequence data. We report a well-defined workflow for rapid functional annotation of whole Childers, A.K.; Poelchau, M.F.; proteomes to produce Gene Ontology and pathways information.
    [Show full text]
  • Molecular Basis of Tank-Binding Kinase 1 Activation by Transautophosphorylation
    Molecular basis of Tank-binding kinase 1 activation by transautophosphorylation Xiaolei Maa,1, Elizabeth Helgasonb,1, Qui T. Phungc, Clifford L. Quanb, Rekha S. Iyera, Michelle W. Leec, Krista K. Bowmana, Melissa A. Starovasnika, and Erin C. Dueberb,2 Departments of aStructural Biology, bEarly Discovery Biochemistry, and cProtein Chemistry, Genentech, South San Francisco, CA 94080 Edited by Tony Hunter, Salk Institute for Biological Studies, La Jolla, CA, and approved April 25, 2012 (received for review December 30, 2011) Tank-binding kinase (TBK)1 plays a central role in innate immunity: it the C-terminal scaffolding/dimerization domain (SDD), a do- serves as an integrator of multiple signals induced by receptor- main arrangement that appears to be shared among the IKK mediated pathogen detection and as a modulator of IFN levels. family of kinases (3). Deletion or mutation of the ULD in TBK1 Efforts to better understand the biology of this key immunological or IKKε severely impairs kinase activation and substrate phos- factor have intensified recently as growing evidence implicates phorylation in cells (22, 23). Furthermore, the integrity of the aberrant TBK1 activity in a variety of autoimmune diseases and ULD in IKKβ is not only required for kinase activity (24) but was fi cancers. Nevertheless, key molecular details of TBK1 regulation and shown also to confer substrate speci city in conjunction with the β substrate selection remain unanswered. Here, structures of phos- adjacent SDD (25). Recent crystal structures of the IKK phorylated and unphosphorylated human TBK1 kinase and ubiq- homodimer demonstrate that the ULD and SDD form a joint, uitin-like domains, combined with biochemical studies, indicate three-way interface with the KD within each protomer of the a molecular mechanism of activation via transautophosphorylation.
    [Show full text]
  • MRT67307 Kinase Inhibitor; TBK1 and Ikkε Inhibitor Catalog Code: Inh-Mrt for Research Use Only Version 19E07-NJ
    MRT67307 Kinase inhibitor; TBK1 and IKKε inhibitor Catalog Code: inh-mrt https://www.invivogen.com/mrt67307 For research use only Version 19E07-NJ PRODUCT INFORMATION CHEMICAL PROPERTIES Contents CAS Number: 1190378-57-4 (free base) • 10 mg MRT67307 (hydrochloride) Formula: C26H36N6O2 . x HCl Molecular weight: 464.60 g/mol (free base) Storage and stability Solubility: 15 mg/ml H2O - MRT67307 is provided as a dried powder and shipped at room temperature. Upon receipt, store product at -20 °C. METHODS - Upon resuspension of MRT67307 prepare aliquots and store Preparation of stock solution (10 mg/ml) at -20 °C. Resuspended product is stable for at least 3 months when 1. Add 1ml of endotoxin-free H O properly stored. 2 2. Use immediately or store aliquots at -20 °C - Avoid repeated freeze-thaw cycles. 3. Prepare dilutions using sterile endotoxin-free water Quality control Working concentration range: 1 - 20 µM (for cell culture assays) - Purity: ≥95% (UHPLC) - Inhibition of TBK1/IKKε by MRT67307 has been confirmed using Inhibition of TBK1/IKKε by MRT67307 in a cellular assay cellular assays. Below is a protocol using InvivoGen’s THP1-Dual™ cells for studying - Absence of bacterial contamination (e.g. lipoproteins and endotoxins) specific inhibition of the IRF pathway by MRT67307. These cells has been confirmed using HEK-Blue™ hTLR2 and HEK-Blue™ hTLR4 cells. express both an inducible Lucia luciferase reporter and an inducible secreted embryonic alkaline phosphatase (SEAP) reporter to measure PRODUCT DESCRIPTION the activation of the IRF or NF-κB pathways, respectively. Changes in MRT67307 is a potent, reversible kinase inhibitor, and a derivative the Lucia expression levels upon inhibition can be readily assessed by of BX7951.
    [Show full text]
  • Downloaded As a CSV Dump file
    cells Article Transcriptome and Methylome Analysis Reveal Complex Cross-Talks between Thyroid Hormone and Glucocorticoid Signaling at Xenopus Metamorphosis Nicolas Buisine 1,† , Alexis Grimaldi 1,†, Vincent Jonchere 1,† , Muriel Rigolet 1, Corinne Blugeon 2 , Juliette Hamroune 2 and Laurent Marc Sachs 1,* 1 UMR7221 Molecular Physiology and Adaption, CNRS, Museum National d’Histoire Naturelle, 57 Rue Cuvier, CEDEX 05, 75231 Paris, France; [email protected] (N.B.); [email protected] (A.G.); [email protected] (V.J.); [email protected] (M.R.) 2 Genomics Core Facility, Département de Biologie, Institut de Biologie de l’ENS (IBENS), École Normale Supérieure, CNRS, INSERM, Université PSL, 75005 Paris, France; [email protected] (C.B.); [email protected] (J.H.) * Correspondence: [email protected] † Co-first authors, alphabetic order. Abstract: Background: Most work in endocrinology focus on the action of a single hormone, and very little on the cross-talks between two hormones. Here we characterize the nature of interactions between thyroid hormone and glucocorticoid signaling during Xenopus tropicalis metamorphosis. Methods: We used functional genomics to derive genome wide profiles of methylated DNA and measured changes of gene expression after hormonal treatments of a highly responsive tissue, tailfin. Clustering classified the data into four types of biological responses, and biological networks were Citation: Buisine, N.; Grimaldi, A.; modeled by system biology. Results: We found that gene expression is mostly regulated by either Jonchere, V.; Rigolet, M.; Blugeon, C.; T or CORT, or their additive effect when they both regulate the same genes. A small but non- Hamroune, J.; Sachs, L.M.
    [Show full text]
  • Cep-2020-00633.Pdf
    Clin Exp Pediatr Vol. 64, No. 5, 208–222, 2021 Review article CEP https://doi.org/10.3345/cep.2020.00633 Understanding the genetics of systemic lupus erythematosus using Bayesian statistics and gene network analysis Seoung Wan Nam, MD, PhD1,*, Kwang Seob Lee, MD2,*, Jae Won Yang, MD, PhD3,*, Younhee Ko, PhD4, Michael Eisenhut, MD, FRCP, FRCPCH, DTM&H5, Keum Hwa Lee, MD, MS6,7,8, Jae Il Shin, MD, PhD6,7,8, Andreas Kronbichler, MD, PhD9 1Department of Rheumatology, Wonju Severance Christian Hospital, Yonsei University Wonju College of Medicine, Wonju, Korea; 2Severance Hospital, Yonsei University College of Medicine, Seoul, Korea; 3Department of Nephrology, Yonsei University Wonju College of Medicine, Wonju, Korea; 4Division of Biomedical Engineering, Hankuk University of Foreign Studies, Yongin, Korea; 5Department of Pediatrics, Luton & Dunstable University Hospital NHS Foundation Trust, Luton, UK; 6Department of Pediatrics, Yonsei University College of Medicine, Seoul, Korea; 7Division of Pediatric Nephrology, Severance Children’s Hospital, Seoul, Korea; 8Institute of Kidney Disease Research, Yonsei University College of Medicine, Seoul, Korea; 9Department of Internal Medicine IV (Nephrology and Hypertension), Medical University Innsbruck, Innsbruck, Austria 1,3) The publication of genetic epidemiology meta-analyses has analyses have redundant duplicate topics and many errors. increased rapidly, but it has been suggested that many of the Although there has been an impressive increase in meta-analyses statistically significant results are false positive. In addition, from China, particularly those on genetic associa tions, most most such meta-analyses have been redundant, duplicate, and claimed candidate gene associations are likely false-positives, erroneous, leading to research waste. In addition, since most suggesting an urgent global need to incorporate genome-wide claimed candidate gene associations were false-positives, cor- data and state-of-the art statistical inferences to avoid a flood of rectly interpreting the published results is important.
    [Show full text]
  • Iκb Kinase Ε and TANK-Binding Kinase 1 Activate AKT by Direct Phosphorylation
    IκB kinase ε and TANK-binding kinase 1 activate AKT by direct phosphorylation Xiaoduo Xiea, Denghong Zhangb, Bin Zhaoa, Min-Kan Lua, Ming Youc, Gianluigi Condorellib, Cun-Yu Wangd, and Kun-Liang Guana,1 aDepartment of Pharmacology and Moores Cancer Center and bDepartment of Medicine, University of California at San Diego, La Jolla, CA 92093; cCancer Center, Medical College of Wisconsin, Milwaukee, WI 53226; and dLaboratory of Molecular Signaling, Division of Oral Biology and Medicine, University of California Los Angeles School of Dentistry, Los Angeles, CA 90095 Edited* by Jack E. Dixon, The Howard Hughes Medical Institute, Chevy Chase, MD, and approved March 8, 2011 (received for review October 27, 2010) AKT activation requires phosphorylation of the activation loop The noncanonical IκB kinase ε (IKKε) has been demonstrated (T308) by 3-phosphoinositide-dependent protein kinase 1 (PDK1) to play an essential role in Ras-induced cell transformation, which and the hydrophobic motif (S473) by the mammalian target of requires activation of both the Raf-MEK-ERK and PI3K-AKT rapamycin complex 2 (mTORC2). We recently observed that pathways (20). Of particular interest is the observation that IKKε phosphorylation of the AKT hydrophobic motif was dramatically can functionally replace the requirement of AKT to support cell elevated, rather than decreased, in mTOR knockout heart tissues, transformation, which suggests that IKKε may act as an AKT indicating the existence of other kinase(s) contributing to AKT regulator or effector. Consistently, IKKε was found to be ampli- phosphorylation. Here we show that the atypical IκB kinase ε and fied in several types of human cancer, including ovarian cancer TANK-binding kinase 1 (IKKε/TBK1) phosphorylate AKT on both the and breast cancer (20, 21).
    [Show full text]
  • Supp Material.Pdf
    Supplemental Material STRESS-INDUCED H3S28 PHOSPHORYLATION MODULATES LOCAL HISTONE ACETYLATION LEVELS Anna Sawicka, Dominik Hartl, Malgorzata Goiser, Oliver Pusch, Roman R Stocsits, Ido M Tamir, Karl Mechtler, Christian Seiser Supplemental Methods Supplemental Figure Legends Supplemental Tables (SUPPL. TABLES 1-2, 4-5) Supplemental Tables (SUPPL. TABLES 3, 6-9, provided as txt files) References Supplemental Figures (SUPPL. FIGURES 1-21) Supplemental Methods Histone peptides used for the pull-down assay and mass spectrometry analysis: H3unmodified (3-20): H2N-TKQTARKSTGGKAPRKQLC-CONH2 H3S10phK14ac (3-20): H2N-TKQTARKS(ph)TGGK(Ac)APRKQLC -CONH2 H3unmodified (19-36): H2N-QLATKAARKSAPATGGVKKC-CONH2 H3S28ph (19-36): H2N-QLATKAARKS(ph)APATGGVKKC-CONH2 Histone peptide pull-down assay For histone peptide pull down assays, 0.1 mg of synthetic peptides (peptide sequences are given above), corresponding to amino acids 3-20 and 19-36 of histone H3 (numbered from N-terminus of histone H3) with a C-terminal cysteine added were coupled to 40 µl (bed volume) of SulfoLink Coupling Resin (Thermo Scientific) according to the manufacturerʼs instructions. Peptide-coupled resin was incubated overnight at 4oC on a roller with 500 µg of nuclear extract (isolated from proliferating HeLa cells treated with 188.5 nM Anisomycin for 1 hour) diluted to 0.5 µg/µl in the binding buffer (20 mM Tris-HCl pH 8.0, 135 mM NaCl, 0.5% NP40, 10% glycerol). The beads were washed 3 times 20 mM Tris-HCl pH 8.0, 135 mM NaCl, 0.5% NP40, 10% glycerol, followed by two washes with 200 mM NaCl, 50 mM Tris-HCl pH 8.0, 0.1 % SDS, 0.1% NP40, 0.5% sodium deoxycholate.
    [Show full text]
  • Molecular Mechanisms Underlying Innate Immune Kinase
    MOLECULAR MECHANISMS UNDERLYING INNATE IMMUNE KINASE TBK1-DRIVEN ONCOGENIC TRANSFORMATION APPROVED BY SUPERVISORY COMMITTEE Michael A White, Ph.D. Melanie H. Cobb, Ph.D. Lawrence Lum, Ph.D. John D. Minna, M.D. DEDICATION This work is dedicated to my mother and Arlene for their love and support. ACKNOWLEDGEMENTS I am very grateful to my mentor, Dr. Michael White, for his continuous support and guidance through the entire study. I really appreciate his inspiration, patience, and generosity. I would also like to thank my committee members, Dr. Cobb, Dr. Lum, and Dr. Minna, for their invaluable advice and discussion. I thank all the White lab members and my friends for their help, suggestion, and discussion. Particularly, I would like to thank Rosie, Michael, Brian, Tzuling, and Malia for their long-term support and collaboration. I would also like to thank my friends, Veleka, Pei-Ling, Jen-Chieh, Shu-Yi, Chih-Chiang, Jen-Shuan, Yi-Chun, and Yu-San for their friendship. I am grateful to Drs. Rolf Brekken, Zhijian James Chen, Xuetao Cao, Philip Tsichlis, Charles Yeaman, William Hahn, Keqiang Ye, and Shu-Chan Hsu, Bing Su, Dos Sarbassov, Mark Magnuson, David Sabatini, Thomas Tan, and Bert Vogelstein for many of the reagents used in these studies. Finally, and most importantly, I would like to thank my mother and Arlene for their unending support and encouragement. MOLECULAR MECHANISMS UNDERLYING INNATE IMMUNE KINASE TBK1-DRIVEN ONCOGENIC TRANSFORMATION by YI-HUNG OU DISSERTATION Presented to the Faculty of the Graduate School of Biomedical Sciences The University of Texas Southwestern Medical Center at Dallas In Partial Fulfillment of the Requirements For the Degree of DOCTOR OF PHILOSOPHY The University of Texas Southwestern Medical Center at Dallas Dallas, Texas April, 2013 Copyright by YI-HUNG OU, 2013 All Rights Reserved MOLECULAR MECHANISMS UNDERLYING INNATE IMMUNE KINASE TBK1-DRIVEN ONCOGENIC TRANSFORMATION Publication No.
    [Show full text]
  • BMK1 Kinase Suppresses Epithelial–Mesenchymal Transition Through the Akt/Gsk3b Signaling Pathway
    Published OnlineFirst January 26, 2012; DOI: 10.1158/0008-5472.CAN-11-2055 Cancer Tumor and Stem Cell Biology Research BMK1 Kinase Suppresses Epithelial–Mesenchymal Transition through the Akt/GSK3b Signaling Pathway Runqiang Chen, Qingkai Yang, and Jiing-Dwan Lee Abstract Epithelial–mesenchymal transition (EMT) plays a crucial role in the development of cancer metastasis. The – jun mitogen-activated protein (MAP) kinases extracellular signal regulated kinase, c- -NH2-kinase, and p38 have been implicated in promoting EMT, but a role for the MAP kinase BMK1 has not been studied. Here, we report that BMK1 signaling suppresses EMT. BMK1 elevation augmented E-cadherin–mediated cell–cell adhesion, downregulated mesenchymal markers, and decreased cell motility. Conversely, BMK1 silencing attenuated E-cadherin–mediated cell–cell adhesion, upregulated mesenchymal markers, and stimulated cell motility. BMK1 depletion dramatically increased the accumulation of endogenous Snail in the nuclear compartment. Snail accumulation was mediated by Akt/GSK3b signaling, which was activated by a modulation in the expression of the mTOR inhibitor DEPTOR. In support of these observations, BMK1 depletion promoted metastasis in vivo. Together, our findings reveal a novel mechanism of EMT control via mTOR/Akt inhibition that suppresses cancer metastasis. Cancer Res; 72(6); 1–9. Ó2012 AACR. Introduction that control cancer progression. The majority of mitogenic/ – The process of epithelial–mesenchymal transition (EMT) oncogenic signal activated signaling pathways stimulate is critically involved in the progression of human diseases, EMT(2).Inparticular,3ofthe4mitogen-activatedprotein such as cancer metastasis and fibrosis (1). EMT involves (MAP) kinase pathways described to date (namely, Erk, JNK, profound phenotypic changes that include loss of cell–cell and p38; ref.
    [Show full text]