DOCSLIB.ORG

Inhibition of KRAS-Driven Tumorigenicity by Interruption of an Autocrine Cytokine Circuit

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Published OnlineFirst January 20, 2014; DOI: 10.1158/2159-8290.CD-13-0646 RESEARCH ARTICLE Inhibition of KRAS -Driven Tumorigenicity by Interruption of an Autocrine Cytokine Circuit Zehua Zhu 1 , 4 , Amir R. Aref 2 , Travis J. Cohoon 1 , Thanh U. Barbie 7 , Yu Imamura 1 , Shenghong Yang 1 , 4 , Susan E. Moody1 , Rhine R. Shen 1 , Anna C. Schinzel 1 , Tran C. Thai 1 , 4 , Jacob B. Reibel 1 , Pablo Tamayo 4 , Jason T. Godfrey5 , Zhi Rong Qian 1 , Asher N. Page 2 , 3 , Karolina Maciag 4 , 6 , Edmond M. Chan 1 , 4 , Whitney Silkworth4 , Mary T. Labowsky 1 , Lior Rozhansky 1 , Jill P. Mesirov 4 , William E. Gillanders 7 , Shuji Ogino1 , Nir Hacohen 4 , 6 , Suzanne Gaudet 2 , Michael J. Eck 2 , 3 , Jeffrey A. Engelman 5 , Ryan B. Corcoran5 , Kwok-Kin Wong 1 , William C. Hahn 1 , 4 , and David A. Barbie 1 , 4 CD-13-0646_PAP.inddDownloaded OF1 from cancerdiscovery.aacrjournals.org on September 30, 2021. © 2014 American Association for Cancer 19/03/14 11:15 AM Research. Published OnlineFirst January 20, 2014; DOI: 10.1158/2159-8290.CD-13-0646 ABSTRACT Although the roles of mitogen-activated protein kinase (MAPK) and phospho- inositide 3-kinase (PI3K) signaling in KRAS -driven tumorigenesis are well estab- lished, KRAS activates additional pathways required for tumor maintenance, the inhibition of which are likely to be necessary for effective KRAS-directed therapy. Here, we show that the IκB kinase (IKK)– related kinases Tank-binding kinase-1 (TBK1) and IKKε promote KRAS -driven tumorigenesis by regu- lating autocrine CCL5 and interleukin (IL)-6 and identify CYT387 as a potent JAK/TBK1/IKKε inhibitor. CYT387 treatment ablates RAS-associated cytokine signaling and impairs Kras -driven murine lung cancer growth. Combined CYT387 treatment and MAPK pathway inhibition induces regression of aggressive murine lung adenocarcinomas driven by Kras mutation and p53 loss. These observations reveal that TBK1/IKKε promote tumor survival by activating CCL5 and IL-6 and identify concurrent inhibition of TBK1/IKKε, Janus-activated kinase (JAK), and MEK signaling as an effective approach to inhibit the actions of oncogenic KRAS. SIGNIFICANCE: In addition to activating MAPK and PI3K, oncogenic KRAS engages cytokine signaling to promote tumorigenesis. CYT387 , originally described as a selective JAK inhibitor, is also a potent TBK/ IKKε inhibitor that uniquely disrupts a cytokine circuit involving CCL5, IL-6, and STAT3. The effi cacy of CYT387-based treatment in murine Kras -driven lung cancer models uncovers a novel therapeutic approach for these refractory tumors with immediate translational implications. Cancer Discov; 4(4); 1–14. ©2014 AACR. INTRODUCTION associated IL-8, CXCL1, and CXCL2 expression also pro- motes senescence ( 14 ), tumor cell survival, and angiogenesis Oncogenic mutations in KRAS and receptor tyrosine ( 15, 16 ). How oncogenic RAS activates these cytokines and kinases (RTK) drive tumor growth by engaging multiple their role in RAS-dependent cancers remains incompletely downstream mitogenic pathways, including RAF–MAPK and characterized. PI3K–AKT ( 1 ). KRAS also activates RAL–GEF ( 2, 3 ) and Activation of RALA and RALB by RAL–GEF enhances infl ammatory signals such as NF-κB ( 4–6 ). Although concur- cancer cell proliferation and survival ( 17 ). A specifi c RALB– rent MAPK–PI3K pathway inhibition is under clinical evalu- SEC5 complex engages the innate immune signaling kinase ation, multiple approaches are likely necessary to identify Tank-binding kinase-1 (TBK1) to promote cell survival ( 18 ). effective KRAS -targeted therapy. TBK1 is required for transformation by oncogenic KRAS, Oncogenic RAS induces infl ammatory cytokines that acti- sustains KRAS -dependent cancer cell viability, and regulates vate NF-κB and STAT3. For example, KRAS -driven non– basal autophagy ( 18–22 ). The TBK1 homolog inhibitor of small cell lung cancers (NSCLC; ref. 7 ) and pancreatic ductal IκB kinase ε (IKKε; encoded by IKBKE) also promotes NF-κB adenocarcinomas (PDAC; ref. 8) engage cell autonomous activation downstream of KRAS ( 23), substitutes for AKT interleukin (IL)-1 signaling. Similarly, oncogenic RAS- to drive cell transformation (24 ), and is induced by RAS- induced IL-6 promotes both oncogene-induced senescence associated cytokines such as IL-1 and IL-6 ( 25 ). Thus, TBK1/ ( 9 ) and cell transformation ( 10 ), and STAT3 is required IKKε signaling is coopted by oncogenic KRAS and facilitates for Kras -driven PDAC development in mice ( 11–13 ). RAS- tumorigenesis. Following viral infection, TBK1 and IKKε amplify IFN-β production via an autocrine loop ( 26 ). Here, we identify a Authors’ Affi liations: Departments of 1 Medical Oncology and 2 Cancer Biol- similar circuit involving CCL5 and IL-6 required for KRAS - ogy, Dana-Farber Cancer Institute; 3 Department of Biological Chemistry driven lung tumorigenesis and potently suppressed by 4 and Molecular Pharmacology, Harvard Medical School, Boston; Broad CYT387, a novel TBK1/IKKε and Janus-activated kinase Institute of Harvard and MIT, Cambridge; 5 MGH Cancer Center, 6Center for Immunology and Infl ammatory Diseases, Massachusetts General Hospital, (JAK) inhibitor. Charlestown, Massachusetts; and 7 Department of Surgery, Division of Biol- ogy and Biomedical Sciences, Washington University, St. Louis, Missouri Note: Supplementary data for this article are available at Cancer Discovery RESULTS Online (http://cancerdiscovery.aacrjournals.org/). TBK1-Regulated Cell Survival Involves Autocrine A.R. Aref and T.J. Cohoon contributed equally to this work. CCL5 and IL-6 and STAT3 Signaling Corresponding Authors: David A. Barbie, Dana-Farber Cancer Institute, 450 Brookline Avenue D819, Boston, MA 02215. Phone: 617-632-6049; Fax: Expression of Tbk1 is required for transformation by onco- 617-632-5786; E-mail: [email protected] ; William C. Hahn, William_ genic KRAS ( 18 , 20 , 21 ). Although Tbk1 −/− mouse embryonic [email protected] ; and Kwok K. Wong, [email protected] fi broblasts (MEF) proliferate in standard culture, we noted doi: 10.1158/2159-8290.CD-13-0646 marked impairment of Tbk1 −/− MEF proliferation in a clono- ©2014 American Association for Cancer Research. genic assay compared with wild-type (WT) littermate control APRIL 2014CANCER DISCOVERY | OF2 CD-13-0646_PAP.inddDownloaded OF2 from cancerdiscovery.aacrjournals.org on September 30, 2021. © 2014 American Association for Cancer 19/03/14 11:15 AM Research. Published OnlineFirst January 20, 2014; DOI: 10.1158/2159-8290.CD-13-0646 RESEARCH ARTICLE Zhu et al. A E –/– F 1,600 Tbk1 MEFs 35 WT MEFs WT 1,400 30 1,200 25 1,000 Tbk1–/– MEFs 800 20 600 15 ** 400 –/– 10 Tbk1 MEFs # Colonies Tbk1–/– 200 5 * CCL5 levels (pg/mL) 0 0 EGFP EGFP CM IL-6 MEFs –/– CCL5 –/– WT CM TBK1-KD CXCL10 TBK1-WT WT MEFs Tbk1 CCL5+IL-6 TBK1 Tbk1 B Conditioned β-Actin CCL5+IL-6+CXCL10 media WT Tbk1–/– G12V + + G KRAS –/– –/– –/– H Tbk1 MEFs Tbk1 MEFs WT MEFs Tbk1 MEFs WT Tbk1–/– Serum: 0 h 0.5 h 1 h 4 h 0 h 0.5 h 1 h 4 h Serum: 0 h 1 h 0 h 1 h pSTAT3 pSTAT3 (Y705) (Y705) STAT3 STAT3 C TBK1 KRAS –/– WT Tbk1 TBK1 CXCL10 CCL5 CXCL10 CCL5 β-Actin β-Actin D 1.2 I WT Tbk1–/– Tbk1–/– + CCL5 EGF 1 Ccl5 (min): 0 5 10 20 30 60 90 120 0 5 10 20 30 60 90 120 0 5 10 20 30 60 90 120 Cxcl10 pSTAT3 0.8 Il6 (Y705) 0.6 STAT3 0.4 TBK1 0.2 β-Actin Relative mRNA expression Relative mRNA 0 WT Tbk1–/– Figure 1. Autocrine CCL5 drives TBK1-dependent clonogenic proliferation. A, crystal violet stain and phase-contrast images (×10) of WT or Tbk1 −/− MEFs cultured in a clonogenic assay for 10 days. B, crystal violet stain of Tbk1−/− MEFs cultured clonogenically in conditioned medium from WT or Tbk1 −/− MEFs. C, cytokine antibody arrays of conditioned medium from WT or Tbk1 −/− MEFs. D, mRNA levels of Ccl5 , Cxcl10 , or Il6 in WT or Tbk1 −/− MEFs. Relative expression normalized to WT MEF mRNA levels, mean and SEM of triplicate samples shown. P < 0.001 for each comparison by t test. E, CCL5 levels by ELISA 72 hours after enhanced GFP (EGFP), TBK1-WT, or TBK1-KD reexpression in Tbk1 −/− MEFs. Mean ± SD of duplicate samples shown. TBK1 and β-actin immunoblot below. F, colony number following media supplementation of Tbk1 −/− MEFs, mean ± SEM of six replicates shown. **, P < 0.001 and *, P < 0.01 for comparison with untreated Tbk1 −/− MEFs by t test. G, immunoblot of Y705 phospho-STAT3 (pSTAT3), STAT3, TBK1, and β-actin levels in WT or Tbk1 −/− MEFs serum-starved overnight and stimulated with 10% serum for the indicated times. H, immunoblot of Y705 pSTAT3, STAT3, TBK1, KRAS, and β-actin levels 48 hours following KRAS G12V expression in serum-starved and stimulated WT or Tbk1 −/− MEFs. I, WT or Tbk1 −/− MEFs ± CCL5 (10 ng/mL) stimulated with EGF (100 ng/mL). Immunoblot shows Y705 pSTAT3, STAT3, TBK1, and β-actin. MEFs ( Fig. 1A ). To assess the role of cell contact versus a MEFs (Fig. 1D ), whereas others such as Cxcl1 were increased secreted factor, we plated Tbk1 −/− MEFs in the clonogenic assay (Supplementary Fig. S1C and S1D). Reintroduction of WT with conditioned medium from WT or Tbk1 −/− MEFs propa- but not kinase-dead (KD) TBK1 restored CCL5 production gated at high density (Fig. 1B ). Conditioned medium from by Tbk1 −/− MEFs, revealing kinase-dependent regulation of WT but not Tbk1 −/− MEFs rescued colony formation, revealing this chemokine ( Fig. 1E ). that Tbk1 regulates secreted factors that promote cell prolif- To examine the contribution of CCL5, CXCL10, and/or eration and may contribute to KRAS -driven tumorigenesis. IL-6 to TBK1-regulated survival, we supplemented media Because TBK1/IKKε regulates cytokine production, we with each factor and measured Tbk1 −/− MEF colony for- assessed conditioned medium from WT or Tbk1 −/− MEFs mation.
Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
  • Localization of Ralb Signaling at Endomembrane Compartments and Its Modulation by Autophagy Received: 14 January 2019 Manish Kumar Singh1,2, Alexandre P

    Localization of Ralb Signaling at Endomembrane Compartments and Its Modulation by Autophagy Received: 14 January 2019 Manish Kumar Singh1,2, Alexandre P

    www.nature.com/scientificreports Corrected: Publisher Correction OPEN Localization of RalB signaling at endomembrane compartments and its modulation by autophagy Received: 14 January 2019 Manish Kumar Singh1,2, Alexandre P. J. Martin1,2, Carine Jofre 3, Giulia Zago1,2, Accepted: 30 May 2019 Jacques Camonis1,2, Mathieu Coppey1,4 & Maria Carla Parrini1,2 Published online: 20 June 2019 The monomeric GTPase RalB controls crucial physiological processes, including autophagy and invasion, but it still remains unclear how this multi-functionality is achieved. Previously, we reported that the RalGEF (Guanine nucleotide Exchange Factor) RGL2 binds and activates RalB to promote invasion. Here we show that RGL2, a major activator of RalB, is also required for autophagy. Using a novel automated image analysis method, Endomapper, we quantifed the endogenous localization of the RGL2 activator and its substrate RalB at diferent endomembrane compartments, in an isogenic normal and Ras-transformed cell model. In both normal and Ras-transformed cells, we observed that RGL2 and RalB substantially localize at early and recycling endosomes, and to lesser extent at autophagosomes, but not at trans-Golgi. Interestingly the use of a FRET-based RalB biosensor indicated that RalB signaling is active at these endomembrane compartments at basal level in rich medium. Furthermore, induction of autophagy by nutrient starvation led to a considerable reduction of early and recycling endosomes, in contrast to the expected increase of autophagosomes, in both normal and Ras-transformed cells. However, autophagy mildly afected relative abundances of both RGL2 and RalB at early and recycling endosomes, and at autophagosomes. Interestingly, RalB activity increased at autophagosomes upon starvation in normal cells.
  • The Role of Rala and Ralb in Cancer Samuel C

    The Role of Rala and Ralb in Cancer Samuel C

    University of South Florida Scholar Commons Graduate Theses and Dissertations Graduate School 4-7-2008 The Role of RalA and RalB in Cancer Samuel C. Falsetti University of South Florida Follow this and additional works at: https://scholarcommons.usf.edu/etd Part of the American Studies Commons Scholar Commons Citation Falsetti, Samuel C., "The Role of RalA and RalB in Cancer" (2008). Graduate Theses and Dissertations. https://scholarcommons.usf.edu/etd/232 This Dissertation is brought to you for free and open access by the Graduate School at Scholar Commons. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Scholar Commons. For more information, please contact [email protected]. The Role of RalA and RalB in Cancer By Samuel C. Falsetti A dissertation submitted in partial fulfillment Of the requirements for the degree of Doctor of Philosophy Department of Molecular Medicine College of Medicine University of South Florida Major Professor: Saïd M. Sebti, Ph.D. Larry P. Solomonson, Ph.D. Gloria C. Ferreira, Ph.D. Srikumar Chellapan, Ph.D. Gary Reuther, Ph.D. Douglas Cress, Ph.D. Date of Approval: April 7th, 2008 Keywords: Ras, RACK1, Geranylgeranyltransferase I inhibitors, ovarian cancer, proteomics © Copyright 2008, Samuel C. Falsetti Dedication This thesis is dedicated to my greatest supporter, my wife. Without her loving advice and patience none of this would be possible. Acknowledgments I would like to extend my sincere gratitude to my wife, Nicole. She is the most inspirational person in my life and I am honored to be with her; in truth, this degree ought to come with two names printed on it.
  • Association of Gene Ontology Categories with Decay Rate for Hepg2 Experiments These Tables Show Details for All Gene Ontology Categories

    Association of Gene Ontology Categories with Decay Rate for Hepg2 Experiments These Tables Show Details for All Gene Ontology Categories

    Supplementary Table 1: Association of Gene Ontology Categories with Decay Rate for HepG2 Experiments These tables show details for all Gene Ontology categories. Inferences for manual classification scheme shown at the bottom. Those categories used in Figure 1A are highlighted in bold. Standard Deviations are shown in parentheses. P-values less than 1E-20 are indicated with a "0". Rate r (hour^-1) Half-life < 2hr. Decay % GO Number Category Name Probe Sets Group Non-Group Distribution p-value In-Group Non-Group Representation p-value GO:0006350 transcription 1523 0.221 (0.009) 0.127 (0.002) FASTER 0 13.1 (0.4) 4.5 (0.1) OVER 0 GO:0006351 transcription, DNA-dependent 1498 0.220 (0.009) 0.127 (0.002) FASTER 0 13.0 (0.4) 4.5 (0.1) OVER 0 GO:0006355 regulation of transcription, DNA-dependent 1163 0.230 (0.011) 0.128 (0.002) FASTER 5.00E-21 14.2 (0.5) 4.6 (0.1) OVER 0 GO:0006366 transcription from Pol II promoter 845 0.225 (0.012) 0.130 (0.002) FASTER 1.88E-14 13.0 (0.5) 4.8 (0.1) OVER 0 GO:0006139 nucleobase, nucleoside, nucleotide and nucleic acid metabolism3004 0.173 (0.006) 0.127 (0.002) FASTER 1.28E-12 8.4 (0.2) 4.5 (0.1) OVER 0 GO:0006357 regulation of transcription from Pol II promoter 487 0.231 (0.016) 0.132 (0.002) FASTER 6.05E-10 13.5 (0.6) 4.9 (0.1) OVER 0 GO:0008283 cell proliferation 625 0.189 (0.014) 0.132 (0.002) FASTER 1.95E-05 10.1 (0.6) 5.0 (0.1) OVER 1.50E-20 GO:0006513 monoubiquitination 36 0.305 (0.049) 0.134 (0.002) FASTER 2.69E-04 25.4 (4.4) 5.1 (0.1) OVER 2.04E-06 GO:0007050 cell cycle arrest 57 0.311 (0.054) 0.133 (0.002)
  • Targeting the Hippo Pathway in Prostate Cancer: What's New?

    Targeting the Hippo Pathway in Prostate Cancer: What's New?

    cancers Review Targeting the Hippo Pathway in Prostate Cancer: What’s New? Kelly Coffey Solid Tumour Target Discovery Laboratory, Translational and Clinical Research Institute, Newcastle University Centre for Cancer, Faculty of Medical Sciences, Newcastle University, Newcastle upon Tyne NE2 4HH, UK; [email protected] Simple Summary: Prostate cancer is the most commonly diagnosed cancer in men in the UK, accounting for the deaths of over 11,000 men per year. A major problem in this disease are tumours which no longer respond to available treatments. Understanding how this occurs will reveal new ways to treat these patients. In this review, the latest findings regarding a particular group of cellular factors which make up a signalling network called the Hippo pathway will be described. Accumulating evidence suggests that this network contributes to prostate cancer progression and resistance to current treatments. Identifying how this pathway can be targeted with drugs is a promising area of research to improve the treatment of prostate cancer. Abstract: Identifying novel therapeutic targets for the treatment of prostate cancer (PC) remains a key area of research. With the emergence of resistance to androgen receptor (AR)-targeting therapies, other signalling pathways which crosstalk with AR signalling are important. Over recent years, evidence has accumulated for targeting the Hippo signalling pathway. Discovered in Drosophila melanogasta, the Hippo pathway plays a role in the regulation of organ size, proliferation, migration and invasion. In response to a variety of stimuli, including cell–cell contact, nutrients and stress, a kinase cascade is activated, which includes STK4/3 and LATS1/2 to inhibit the effector proteins YAP and its paralogue TAZ.
  • (12) Patent Application Publication (10) Pub. No.: US 2003/0082511 A1 Brown Et Al

    (12) Patent Application Publication (10) Pub. No.: US 2003/0082511 A1 Brown Et Al

    US 20030082511A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2003/0082511 A1 Brown et al. (43) Pub. Date: May 1, 2003 (54) IDENTIFICATION OF MODULATORY Publication Classification MOLECULES USING INDUCIBLE PROMOTERS (51) Int. Cl." ............................... C12O 1/00; C12O 1/68 (52) U.S. Cl. ..................................................... 435/4; 435/6 (76) Inventors: Steven J. Brown, San Diego, CA (US); Damien J. Dunnington, San Diego, CA (US); Imran Clark, San Diego, CA (57) ABSTRACT (US) Correspondence Address: Methods for identifying an ion channel modulator, a target David B. Waller & Associates membrane receptor modulator molecule, and other modula 5677 Oberlin Drive tory molecules are disclosed, as well as cells and vectors for Suit 214 use in those methods. A polynucleotide encoding target is San Diego, CA 92121 (US) provided in a cell under control of an inducible promoter, and candidate modulatory molecules are contacted with the (21) Appl. No.: 09/965,201 cell after induction of the promoter to ascertain whether a change in a measurable physiological parameter occurs as a (22) Filed: Sep. 25, 2001 result of the candidate modulatory molecule. Patent Application Publication May 1, 2003 Sheet 1 of 8 US 2003/0082511 A1 KCNC1 cDNA F.G. 1 Patent Application Publication May 1, 2003 Sheet 2 of 8 US 2003/0082511 A1 49 - -9 G C EH H EH N t R M h so as se W M M MP N FIG.2 Patent Application Publication May 1, 2003 Sheet 3 of 8 US 2003/0082511 A1 FG. 3 Patent Application Publication May 1, 2003 Sheet 4 of 8 US 2003/0082511 A1 KCNC1 ITREXCHO KC 150 mM KC 2000000 so 100 mM induced Uninduced Steady state O 100 200 300 400 500 600 700 Time (seconds) FIG.
  • Phosphorylation of Ralb Is Important for Bladder Cancer Cell Growth and Metastasis

    Phosphorylation of Ralb Is Important for Bladder Cancer Cell Growth and Metastasis

    Published OnlineFirst October 12, 2010; DOI: 10.1158/0008-5472.CAN-10-0952 Published OnlineFirst on October 12, 2010 as 10.1158/0008-5472.CAN-10-0952 Therapeutics, Targets, and Chemical Biology Cancer Research Phosphorylation of RalB Is Important for Bladder Cancer Cell Growth and Metastasis Hong Wang1, Charles Owens1, Nidhi Chandra1, Mark R. Conaway2, David L. Brautigan3,4, and Dan Theodorescu5 Abstract RalA and RalB are monomeric G proteins that are 83% identical in amino acid sequence but have paralogue- specific effects on cell proliferation, metastasis, and apoptosis. Using in vitro kinase assays and phosphosite- specific antibodies, here we show phosphorylation of RalB by protein kinase C (PKC) and RalA by protein kinase A. We used mass spectrometry and site-directed mutagenesis to identify S198 as the primary PKC phosphorylation site in RalB. Phorbol ester [phorbol 12-myristate 13-acetate (PMA)] treatment of human blad- der carcinoma cells induced S198 phosphorylation of stably expressed FLAG-RalB as well as endogenous RalB. PMA treatment caused RalB translocation from the plasma membrane to perinuclear regions in a S198 phos- phorylation–dependent manner. Using RNA interference depletion of RalB followed by rescue with wild-type RalB or RalB(S198A) as well as overexpression of wild-type RalB or RalB(S198A) with and without PMA stimulation, we show that phosphorylation of RalB at S198 is necessary for actin cytoskeletal organization, anchorage-independent growth, cell migration, and experimental lung metastasis of T24 or UMUC3 human bladder cancer cells. In addition, UMUC3 cells transfected with a constitutively active RalB(G23V) exhibited enhanced subcutaneous tumor growth, whereas those transfected with phospho-deficient RalB(G23V-S198A) were indistinguishable from control cells.
  • MRT67307 Kinase Inhibitor; TBK1 and Ikkε Inhibitor Catalog Code: Inh-Mrt for Research Use Only Version 19E07-NJ

    MRT67307 Kinase Inhibitor; TBK1 and Ikkε Inhibitor Catalog Code: Inh-Mrt for Research Use Only Version 19E07-NJ

    MRT67307 Kinase inhibitor; TBK1 and IKKε inhibitor Catalog Code: inh-mrt https://www.invivogen.com/mrt67307 For research use only Version 19E07-NJ PRODUCT INFORMATION CHEMICAL PROPERTIES Contents CAS Number: 1190378-57-4 (free base) • 10 mg MRT67307 (hydrochloride) Formula: C26H36N6O2 . x HCl Molecular weight: 464.60 g/mol (free base) Storage and stability Solubility: 15 mg/ml H2O - MRT67307 is provided as a dried powder and shipped at room temperature. Upon receipt, store product at -20 °C. METHODS - Upon resuspension of MRT67307 prepare aliquots and store Preparation of stock solution (10 mg/ml) at -20 °C. Resuspended product is stable for at least 3 months when 1. Add 1ml of endotoxin-free H O properly stored. 2 2. Use immediately or store aliquots at -20 °C - Avoid repeated freeze-thaw cycles. 3. Prepare dilutions using sterile endotoxin-free water Quality control Working concentration range: 1 - 20 µM (for cell culture assays) - Purity: ≥95% (UHPLC) - Inhibition of TBK1/IKKε by MRT67307 has been confirmed using Inhibition of TBK1/IKKε by MRT67307 in a cellular assay cellular assays. Below is a protocol using InvivoGen’s THP1-Dual™ cells for studying - Absence of bacterial contamination (e.g. lipoproteins and endotoxins) specific inhibition of the IRF pathway by MRT67307. These cells has been confirmed using HEK-Blue™ hTLR2 and HEK-Blue™ hTLR4 cells. express both an inducible Lucia luciferase reporter and an inducible secreted embryonic alkaline phosphatase (SEAP) reporter to measure PRODUCT DESCRIPTION the activation of the IRF or NF-κB pathways, respectively. Changes in MRT67307 is a potent, reversible kinase inhibitor, and a derivative the Lucia expression levels upon inhibition can be readily assessed by of BX7951.
  • Mechanisms of IKBKE Activation in Cancer Sridevi Challa University of South Florida, Challasridevi@Gmail.Com

    Mechanisms of IKBKE Activation in Cancer Sridevi Challa University of South Florida, [email protected]

    University of South Florida Scholar Commons Graduate Theses and Dissertations Graduate School 1-29-2017 Mechanisms of IKBKE Activation in Cancer Sridevi Challa University of South Florida, [email protected] Follow this and additional works at: http://scholarcommons.usf.edu/etd Part of the Biochemistry Commons, Biology Commons, and the Cell Biology Commons Scholar Commons Citation Challa, Sridevi, "Mechanisms of IKBKE Activation in Cancer" (2017). Graduate Theses and Dissertations. http://scholarcommons.usf.edu/etd/6617 This Dissertation is brought to you for free and open access by the Graduate School at Scholar Commons. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Scholar Commons. For more information, please contact [email protected]. Mechanisms of IKBKE Activation in Cancer by Sridevi Challa A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Cell Biology, Microbiology, and Molecular Biology College of Arts and Sciences University of South Florida Major Professor: Mokenge P. Malafa, M.D. Gary Reuther, Ph.D. Eric Lau, Ph.D. Domenico Coppola, M.D. Date of Approval: January 12, 2017 Keywords: EGFR, Olaparib, resistance Copyright © 2017, Sridevi Challa DEDICATION This dissertation is dedicated to my kind and courageous mother. ACKNOWLEDGMENTS I would like to acknowledge Dr. Cheng for trusting me with completion of the projects. I would like to thank him for giving me the freedom to explore any aspect of research and always willing to provide the necessary resources and guidance for my projects. I want to also acknowledge Ted and the Cheng lab personnel for their support.
  • Cep-2020-00633.Pdf

    Cep-2020-00633.Pdf

    Clin Exp Pediatr Vol. 64, No. 5, 208–222, 2021 Review article CEP https://doi.org/10.3345/cep.2020.00633 Understanding the genetics of systemic lupus erythematosus using Bayesian statistics and gene network analysis Seoung Wan Nam, MD, PhD1,*, Kwang Seob Lee, MD2,*, Jae Won Yang, MD, PhD3,*, Younhee Ko, PhD4, Michael Eisenhut, MD, FRCP, FRCPCH, DTM&H5, Keum Hwa Lee, MD, MS6,7,8, Jae Il Shin, MD, PhD6,7,8, Andreas Kronbichler, MD, PhD9 1Department of Rheumatology, Wonju Severance Christian Hospital, Yonsei University Wonju College of Medicine, Wonju, Korea; 2Severance Hospital, Yonsei University College of Medicine, Seoul, Korea; 3Department of Nephrology, Yonsei University Wonju College of Medicine, Wonju, Korea; 4Division of Biomedical Engineering, Hankuk University of Foreign Studies, Yongin, Korea; 5Department of Pediatrics, Luton & Dunstable University Hospital NHS Foundation Trust, Luton, UK; 6Department of Pediatrics, Yonsei University College of Medicine, Seoul, Korea; 7Division of Pediatric Nephrology, Severance Children’s Hospital, Seoul, Korea; 8Institute of Kidney Disease Research, Yonsei University College of Medicine, Seoul, Korea; 9Department of Internal Medicine IV (Nephrology and Hypertension), Medical University Innsbruck, Innsbruck, Austria 1,3) The publication of genetic epidemiology meta-analyses has analyses have redundant duplicate topics and many errors. increased rapidly, but it has been suggested that many of the Although there has been an impressive increase in meta-analyses statistically significant results are false positive. In addition, from China, particularly those on genetic associa tions, most most such meta-analyses have been redundant, duplicate, and claimed candidate gene associations are likely false-positives, erroneous, leading to research waste. In addition, since most suggesting an urgent global need to incorporate genome-wide claimed candidate gene associations were false-positives, cor- data and state-of-the art statistical inferences to avoid a flood of rectly interpreting the published results is important.
  • Involvement of Inhibitor Kappa B Kinase 2 (IKK2) in the Regulation of Vascular Tone

    Involvement of Inhibitor Kappa B Kinase 2 (IKK2) in the Regulation of Vascular Tone

    Laboratory Investigation (2018) 98:1311–1319 https://doi.org/10.1038/s41374-018-0061-4 ARTICLE Involvement of inhibitor kappa B kinase 2 (IKK2) in the regulation of vascular tone 1 1 1 1 Youngin Kwon ● Soo-Kyoung Choi ● Seonhee Byeon ● Young-Ho Lee Received: 6 November 2017 / Revised: 22 March 2018 / Accepted: 23 March 2018 / Published online: 21 May 2018 © United States & Canadian Academy of Pathology 2018 Abstract Inhibitor kappa B kinase 2 (IKK2) plays an essential role in the activation of nuclear factor kappa B (NF-kB). Recently, it has been suggested that IKK2 acts as a myosin light chain kinase (MLCK) and contributes to vasoconstriction in mouse aorta. However, the underlying mechanisms are still unknown. Therefore, we investigated whether IKK2 acts as a MLCK or regulates the activity of myosin light chain phosphatase (MLCP). Pressure myograph was used to measure vascular tone in rat mesenteric arteries. Immunofluorescence staining was performed to identify phosphorylation levels of MLC (ser19), MYPT1 (thr853 and thr696) and CPI-17 (thr38). SC-514 (IKK2 inhibitor, 50 μM) induced relaxation in the mesenteric arteries pre-contracted with 70 mM high K+ solution or U-46619 (thromboxane analog, 5 μM). The relaxation induced by SC-514 + 1234567890();,: 1234567890();,: was increased in the arteries pre-contracted with U-46619 compared to arteries pre-contracted with 70 mM high K solution. U-46619-induced contraction was decreased by treatment of SC-514 in the presence of MLCK inhibitor, ML-7 (10 μM). In the absence of intracellular Ca2+, U-46619 still induced contraction, which was decreased by treatment of SC-514.
  • The Small G-Protein Rala Promotes Progression and Metastasis of Triple- Negative Breast Cancer Katie A

    The Small G-Protein Rala Promotes Progression and Metastasis of Triple- Negative Breast Cancer Katie A

    Thies et al. Breast Cancer Research (2021) 23:65 https://doi.org/10.1186/s13058-021-01438-3 RESEARCH ARTICLE Open Access The small G-protein RalA promotes progression and metastasis of triple- negative breast cancer Katie A. Thies1,2, Matthew W. Cole1,2, Rachel E. Schafer1,2, Jonathan M. Spehar1,2, Dillon S. Richardson1,2, Sarah A. Steck1,2, Manjusri Das1,2, Arthur W. Lian1,2, Alo Ray1,2, Reena Shakya1,3, Sue E. Knoblaugh4, Cynthia D. Timmers5,6, Michael C. Ostrowski5,7, Arnab Chakravarti1,2, Gina M. Sizemore1,2 and Steven T. Sizemore1,2* Abstract Background: Breast cancer (BC) is the most common cancer in women and the leading cause of cancer-associated mortality in women. In particular, triple-negative BC (TNBC) has the highest rate of mortality due in large part to the lack of targeted treatment options for this subtype. Thus, there is an urgent need to identify new molecular targets for TNBC treatment. RALA and RALB are small GTPases implicated in growth and metastasis of a variety of cancers, although little is known of their roles in BC. Methods: The necessity of RALA and RALB for TNBC tumor growth and metastasis were evaluated in vivo using orthotopic and tail-vein models. In vitro, 2D and 3D cell culture methods were used to evaluate the contributions of RALA and RALB during TNBC cell migration, invasion, and viability. The association between TNBC patient outcome and RALA and RALB expression was examined using publicly available gene expression data and patient tissue microarrays. Finally, small molecule inhibition of RALA and RALB was evaluated as a potential treatment strategy for TNBC in cell line and patient-derived xenograft (PDX) models.