DOCSLIB.ORG

(12) Patent Application Publication (10) Pub. No.: US 2016/0053301 A1 RAYMOND Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(12) Patent Application Publication (10) Pub. No.: US 2016/0053301 A1 RAYMOND Et Al US 2016.0053301A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2016/0053301 A1 RAYMOND et al. (43) Pub. Date: Feb. 25, 2016 (54) METHODS FOR QUANTITATIVE GENETIC G06F 9/28 (2006.01) ANALYSIS OF CELL FREE DNA G06F 9/20 (2006.01) (71) Applicant: Clearfork Bioscience, Inc., Kirkland, G06F 9/22 (2006.01) WA (US) (52) U.S. Cl. CPC .............. CI2O I/6806 (2013.01); G06F 19/20 (72) Inventors: CHRISTOPHER K. RAYMOND, (2013.01); G06F 19/22 (2013.01); G06F 19/28 SEATTLE, WA (US); LEE P. LIM, KIRKLAND, WA (US); (2013.01); G06F 19/345 (2013.01) CHRISTOPHERD. ARMOUR, KIRKLAND, WA (US) (57) ABSTRACT (21) Appl. No.: 14/466,741 (22) Filed: Aug. 22, 2014 The invention provides a method for genetic analysis in indi viduals that reveals both the genetic sequences and chromo Publication Classification Somal copy number of targeted and specific genomic loci in a (51) Int. Cl. single assay. The present invention further provides methods CI2O I/68 (2006.01) for the sensitive and specific detection of target gene G06F 9/00 (2006.01) sequences and gene expression profiles. Patent Application Publication Feb. 25, 2016 Sheet 1 of 27 US 2016/0053301 A1 ROBUST DETECTION MAF Pos Calls 5 Y 0.5 - 25% 4/4 ill- 30. & BRAF1526T. 0.05% 3/4 BRAFE280 0.001 - ND - A CDHE243 A po O MYCNE2700 0.0001-1--------------------------------------------- 0,000 OOO1 0.01 O, 1 OBSERVE) FIG. 1 Patent Application Publication Feb. 25, 2016 Sheet 2 of 27 US 2016/0053301 A1 BRAF 1326 SNW A READS UNIQUE CONE FAMES 100000 M. M. M. 10000 10000 1000 2 1000 g ca É. A 00s % A st 100 C C is 'v's EG 3 a SG T O AT O O ZR-75-30 (%) ZR-75-50 (%) FIO, 2 Patent Application Publication Feb. 25, 2016 Sheet 3 of 27 US 2016/0053301 A1 chrx5F chrx5R chrx 69 chrx69R CYP2B6, CYP2D6R P3001830:18, KRASex KRASex R 48-05 385 2e--05 e-85 H mom 08:00 48-05- i 3e--05- variable off target 2-05- www.www. s ontarget e-85 - ------ 0800- “ 48-05 3e-5- W-VW--- 28-05 III - - - - forty sixty forty sixty forty sixty forty sixty forty sixty forty sixty forty sixty forty sixty forty sixty forty sixty Probellength FIC. 3 Patent Application Publication Feb. 25, 2016 Sheet 4 of 27 US 2016/0053301 A1 ~~~~?~ uo?sua?x89qoud ~~~~-{I}***~~~~ Patent Application Publication Feb. 25, 2016 Sheet 5 of 27 US 2016/0053301 A1 :96p19A0330uenbºspupMu04 Patent Application Publication Feb. 25, 2016 Sheet 6 of 27 US 2016/0053301 A1 & s (3. x. s 80 30 s s FIG 6 Patent Application Publication Feb. 25, 2016 Sheet 7 of 27 US 2016/0053301 A1 wribe readsci: res s Giffor red s r Situ ic s gas r i sein c 8 sposapaddoddgo# e-5 probe Patent Application Publication Feb. 25, 2016 Sheet 8 of 27 US 2016/0053301 A1 Patent Application Publication Feb. 25, 2016 Sheet 9 of 27 US 2016/0053301 A1 Patent Application Publication Feb. 25, 2016 Sheet 10 of 27 US 2016/0053301 A1 cf.N.A from kidney dialysis patients cf.NA library FIG 9B Patent Application Publication Feb. 25, 2016 Sheet 11 of 27 US 2016/0053301 A1 OyC FIG 9C Patent Application Publication Feb. 25, 2016 Sheet 12 of 27 US 2016/0053301 A1 2000 251 49 251 49 23185. 25.85 254O6. 23406. 234.07 25.407 frog frag frag frag FIC 10 Patent Application Publication Feb. 25, 2016 Sheet 13 of 27 US 2016/0053301 A1 Patent Application Publication Feb. 25, 2016 Sheet 14 of 27 US 2016/0053301 A1 6?fiq---------------------------------------------------------------------------------------------------------------{q}g ||| | 29d1 Patent Application Publication Feb. 25, 2016 Sheet 15 of 27 US 2016/0053301 A1 R of .0 = perfect agreement 1500 qPCR underestimates E OOC G X S-al NG-GO c 9. *r St. 500 s s O O 500 OOO 500 qPCR estimated inputs -- FIC 13 Patent Application Publication Feb. 25, 2016 Sheet 16 of 27 US 2016/0053301 A1 ~?~ Z -----------?? #10Ç ====== Patent Application Publication Feb. 25, 2016 Sheet 17 of 27 US 2016/0053301 A1 OOOOO 1000 10000 1000 H. 100 s 3. F. s 100 - li 22- . ... 2 10 : 3. O y 1 : \ & E. :: 2. W S r & S N M × 8 & x, \ |\ W sy & SS SS All Au AF AIR Aly BARBAF BARLB s' NS is $ $ $ gDNA genA gDNA g|NA FIG, 15A FIC, 16B Patent Application Publication Feb. 25, 2016 Sheet 18 of 27 US 2016/0053301 A1 3000 2500 2000 1 500 1000 500 O ACA2 assay Alu assay FIG 16 Patent Application Publication Feb. 25, 2016 Sheet 19 of 27 US 2016/0053301 A1 • Patent Application Publication Feb. 25, 2016 Sheet 20 of 27 US 2016/0053301 A1 of DNA NA. N-8 FIG 18 Patent Application Publication Feb. 25, 2016 Sheet 21 of 27 US 2016/0053301 A1 20 OO 80 2 Expected KXXXx: Observed 60 40 20 O 0.97 0.09 N:H2228 N:H2228 10:1 2O: 50:1 000: FIC. 19 Patent Application Publication Feb. 25, 2016 Sheet0701100100x00001000007017010001001001°19?10ww10y?ylwww101071011110010701010101W 22 of 27 US 2016/0053301 A1 Patent Application Publication Feb. 25, 2016 Sheet 23 of 27 US 2016/0053301 A1 60 50 40 / Expected K. Observed 30 - , k X pure H2228 NH2228 4:1 NH2228 0: 20: 50: 1000: FIG 21 Patent Application Publication Feb. 25, 2016 Sheet 24 of 27 US 2016/0053301 A1 90 80 70 60 8.7 5.98 2 3.45 3.01 2.81 pure H69 NH69 NH69 NH69w NH69Z. NH69E. NH69E. NH69E. 4:1 10: 20: 40:1 100: 200: 500: FIC 22 Patent Application Publication Feb. 25, 2016 Sheet 25 of 27 US 2016/0053301 A1 Patent Application Publication Feb. 25, 2016 Sheet 26 of 27 US 2016/0053301 A1 GSVÅBDYiy Patent Application Publication Feb. 25, 2016 Sheet 27 of 27 US 2016/0053301 A1 US 2016/0053301 A1 Feb. 25, 2016 METHODS FOR QUANTITATIVE GENETIC 0008 Thus, the vast potential of molecular diagnostics for ANALYSIS OF CELL FREE DNA genetic diseases; fetal testing; paternity testing; predicting response to drug treatment; diagnosing or monitoring a medi STATEMENT REGARDING SEQUENCE cal condition; mendelian disorders; genetic mosaicism; LISTING pathogen screening; microbiome profiling; and organ trans plant monitoring; has yet to be realized. To date, existing 0001. The Sequence Listing associated with this applica molecular diagnostics approaches lack efficient solutions to tion is provided in text format in lieu of a paper copy, and is clone and amplify individual DNA molecules, as well as hereby incorporated by reference into the specification. The Solutions to efficiently target sequencing to specific genomic name of the text file containing the Sequence Listing is loci, with sensitivity sufficient to discriminate true positive CLFK 002 00US ST25.txt. The text file is 117 KB, was test results from false positive signals that arise during sample created on Aug. 22, 2014, and is being Submitted electroni processing. cally via EFS-Web. BRIEF SUMMARY BACKGROUND 0009. The invention relates generally to compositions and 0002 1. Technical Field methods for improved compositions and methods for the 0003. The invention relates generally to compositions and genetic analysis of cfloNA. methods for the quantitative genetic analysis of cell free DNA 0010. In various embodiments, a method for genetic (cf DNA). In particular, the present invention relates to analysis of cell-free DNA (cf DNA) is provided, comprising: improved targeted sequence capture compositions and meth treating cflNA with one or more end-repair enzymes to generate end-repaired cf NA; ligating one or more adaptors ods for the genetic characterization and analysis of cf. DNA. to each end of the end-repaired cflNA to generate a cf)NA 0004 2. Description of the Related Art library; amplifying the cf. DNA library to generate cf. DNA 0005. It is becoming increasing clear that most, if not all, library clones; determining the number of genome equiva of the most common human cancers are diseases of the human lents in the cf.NA clone library; and performing a quantita genome. The emerging picture is that Somatic mutations tive genetic analysis of one or more target genetic loci in the accumulate during an individual’s lifetime, some of which cf. DNA library clones. increase the probability that the cell in which they are har 0011. In a particular embodiment, the method further bored can develop into a tumor (Vogelstein et al., Science comprises isolating cf)NA from a biological sample of a 339(6127): 1546-1558 (2013)). With just the wrong combi Subject. nation of accumulated mutational events, a precancerous 0012. In an additional embodiment, the cf)NA is isolated growth loses constraints that keep uncontrolled proliferation from a biological sample selected from the group consisting in check and the resulting cell mass becomes a cancer. The of amniotic fluid, blood, plasma, serum, semen, lymphatic constellations of mutations that are necessary and Sufficient to fluid, cerebral spinal fluid, ocular fluid, urine, saliva, stool, cause cancer are often collectively referred to as “driver muta mucous, and Sweat. tions.” One of the themes that have emerged from recent and 0013. In a certain embodiment, the one or more adaptors intensive molecular analysis is that cancer, once thought of as comprise a plurality of adaptor species. a single, tissue-specific disease, is in fact a group of related 0014. In a particular embodiment, the one or more adap diseases, each with a unique molecular pathology. The human tors each comprise a primer binding site for amplification of genome project laid the groundwork for genome-wide analy the cf)NA library.
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Hidden Targets in RAF Signalling Pathways to Block Oncogenic RAS Signalling
    G C A T T A C G G C A T genes Review Hidden Targets in RAF Signalling Pathways to Block Oncogenic RAS Signalling Aoife A. Nolan 1, Nourhan K. Aboud 1, Walter Kolch 1,2,* and David Matallanas 1,* 1 Systems Biology Ireland, School of Medicine, University College Dublin, Belfield, Dublin 4, Ireland; [email protected] (A.A.N.); [email protected] (N.K.A.) 2 Conway Institute of Biomolecular & Biomedical Research, University College Dublin, Belfield, Dublin 4, Ireland * Correspondence: [email protected] (W.K.); [email protected] (D.M.) Abstract: Oncogenic RAS (Rat sarcoma) mutations drive more than half of human cancers, and RAS inhibition is the holy grail of oncology. Thirty years of relentless efforts and harsh disappointments have taught us about the intricacies of oncogenic RAS signalling that allow us to now get a pharma- cological grip on this elusive protein. The inhibition of effector pathways, such as the RAF-MEK-ERK pathway, has largely proven disappointing. Thus far, most of these efforts were aimed at blocking the activation of ERK. Here, we discuss RAF-dependent pathways that are regulated through RAF functions independent of catalytic activity and their potential role as targets to block oncogenic RAS signalling. We focus on the now well documented roles of RAF kinase-independent functions in apoptosis, cell cycle progression and cell migration. Keywords: RAF kinase-independent; RAS; MST2; ASK; PLK; RHO-α; apoptosis; cell cycle; cancer therapy Citation: Nolan, A.A.; Aboud, N.K.; Kolch, W.; Matallanas, D. Hidden Targets in RAF Signalling Pathways to Block Oncogenic RAS Signalling.
    [Show full text]
  • Download (Pdf)
    Invivoscribe's wholly-owned Laboratories for Personalized Molecular LabPMM LLC Medicine® (LabPMM) is a network of international reference laboratories that provide the medical and pharmaceutical communities with worldwide Located in San Diego, California, USA, it holds access to harmonized and standardized clinical testing services. We view the following accreditations and certifications: internationally reproducible and concordant testing as a requirement for ISO 15189, CAP, and CLIA, and is licensed to provide diagnostic consistent stratification of patients for enrollment in clinical trials, and the laboratory services in the states of California, Florida, foundation for establishing optimized treatment schedules linked to patient’s Maryland, New York, Pennsylvania, and Rhode Island. individual profile. LabPMM provides reliable patient stratification at diagnosis LabPMM GmbH and monitoring, throughout the entire course of treatment in support of Personalized Molecular Medicine® and Personalized Based in Martinsried (Munich), Germany. It is an ISO 15189 Molecular Diagnostics®. accredited international reference laboratory. CLIA/CAP accreditation is planned. Invivoscribe currently operates four clinical laboratories to serve partners in the USA (San Diego, CA), Europe (Munich, Germany), and Asia (Tokyo, Japan and Shanghai, China). These laboratories use the same critical LabPMM 合同会社 reagents and software which are developed consistently with ISO Located in Kawasaki (Tokyo), Japan and a licensed clinical lab. 13485 design control. Our cGMP reagents, rigorous standards for assay development & validation, and testing performed consistently under ISO 15189 requirements help ensure LabPMM generates standardized and concordant test results worldwide. Invivoscribe Diagnostic Technologies (Shanghai) Co., Ltd. LabPMM is an international network of PersonalMed Laboratories® focused on molecular oncology biomarker studies. Located in Shangai, China.
    [Show full text]
  • IDH2 Mutations—Co-Opting Cellular Metabolism for Malignant Transformation Eytan M
    Published OnlineFirst November 9, 2015; DOI: 10.1158/1078-0432.CCR-15-0362 Molecular Pathways Clinical Cancer Research Molecular Pathways: IDH2 Mutations—Co-opting Cellular Metabolism for Malignant Transformation Eytan M. Stein Abstract Mutations in mitochondrial IDH2, one of the three isoforms function that catalyzes the conversion of alpha-ketoglutarate to of IDH, were discovered in patients with gliomas in 2009 and beta-hydroxyglutarate (2-HG). Supranormal levels of 2-HG subsequently described in acute myelogenous leukemia (AML), lead to hypermethylation of epigenetic targets and a subse- angioimmunoblastic T-cell lymphoma, chondrosarcoma, and quent block in cellular differentiation. AG-221, a small-mole- intrahepatic chloangiocarcinoma. The effects of mutations in cule inhibitor of mutant IDH2, is being explored in a phase I IDH2 on cellular metabolism, the epigenetic state of mutated clinical trial for the treatment of AML, other myeloid malig- cells, and cellular differentiation have been elucidated in vitro nancies, solid tumors, and gliomas. Clin Cancer Res; 22(1); 16–19. and in vivo.MutationsinIDH2 lead to an enzymatic gain of Ó2015 AACR. Background Interestingly, in a screen of 398 patients with AML, TET2 and IDH2 mutations were mutually exclusive, suggesting that these Isocitrate dehydrogenase (IDH) catalyzes the conversion of two mutations have a similar function. Wild-type TET2 demethy- isocitrate to alpha-ketoglutarate. IDH occurs in three isoforms, lates DNA, and mutations in TET2 lead to increases in 5-methyl- IDH1, located in the cytoplasm, IDH2 located in the mitochon- cytosine similar to those seen in patients with IDH mutations. It dria, and IDH3, which functions as part of the tricarboxylic acid has been suggested that elevated levels of 2-HG caused by mutant cycle.
    [Show full text]
  • Product Data Sheet
    Product Data Sheet ExProfileTM Human AMPK Signaling Related Gene qPCR Array For focused group profiling of human AMPK signaling genes expression Cat. No. QG004-A (4 x 96-well plate, Format A) Cat. No. QG004-B (4 x 96-well plate, Format B) Cat. No. QG004-C (4 x 96-well plate, Format C) Cat. No. QG004-D (4 x 96-well plate, Format D) Cat. No. QG004-E (4 x 96-well plate, Format E) Plates available individually or as a set of 6. Each set contains 336 unique gene primer pairs deposited in one 96-well plate. Introduction The ExProfile human AMPK signaling related gene qPCR array profiles the expression of 336 human genes related to AMPK-mediated signal transduction. These genes are carefully chosen for their close pathway correlation based on a thorough literature search of peer-reviewed publications, mainly including genes that encode AMP-activated protein kinase complex，its regulators and targets involved in many important biological processes, such as glucose uptake, β-oxidation of fatty acids and modulation of insulin secretion. This array allows researchers to study the pathway-related genes to gain understanding of their roles in the different biological processes. QG004 plate 01: 84 unique gene PCR primer pairs QG004 plate 02: 84 unique gene PCR primer pairs QG004 plate 03: 84 unique gene PCR primer pairs QG004 plate 04: 84 unique gene PCR primer pairs Shipping and storage condition Shipped at room temperate Stable for at least 6 months when stored at -20°C Array format GeneCopoeia provides five qPCR array formats (A, B, C, D, and E) suitable for use with the following real- time cyclers.
    [Show full text]
  • Src-Family Kinases Impact Prognosis and Targeted Therapy in Flt3-ITD+ Acute Myeloid Leukemia
    Src-Family Kinases Impact Prognosis and Targeted Therapy in Flt3-ITD+ Acute Myeloid Leukemia Title Page by Ravi K. Patel Bachelor of Science, University of Minnesota, 2013 Submitted to the Graduate Faculty of School of Medicine in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Pittsburgh 2019 Commi ttee Membership Pa UNIVERSITY OF PITTSBURGH SCHOOL OF MEDICINE Commi ttee Membership Page This dissertation was presented by Ravi K. Patel It was defended on May 31, 2019 and approved by Qiming (Jane) Wang, Associate Professor Pharmacology and Chemical Biology Vaughn S. Cooper, Professor of Microbiology and Molecular Genetics Adrian Lee, Professor of Pharmacology and Chemical Biology Laura Stabile, Research Associate Professor of Pharmacology and Chemical Biology Thomas E. Smithgall, Dissertation Director, Professor and Chair of Microbiology and Molecular Genetics ii Copyright © by Ravi K. Patel 2019 iii Abstract Src-Family Kinases Play an Important Role in Flt3-ITD Acute Myeloid Leukemia Prognosis and Drug Efficacy Ravi K. Patel, PhD University of Pittsburgh, 2019 Abstract Acute myelogenous leukemia (AML) is a disease characterized by undifferentiated bone-marrow progenitor cells dominating the bone marrow. Currently the five-year survival rate for AML patients is 27.4 percent. Meanwhile the standard of care for most AML patients has not changed for nearly 50 years. We now know that AML is a genetically heterogeneous disease and therefore it is unlikely that all AML patients will respond to therapy the same way. Upregulation of protein-tyrosine kinase signaling pathways is one common feature of some AML tumors, offering opportunities for targeted therapy.
    [Show full text]
  • Targeting the Hippo Pathway in Prostate Cancer: What's New?
    cancers Review Targeting the Hippo Pathway in Prostate Cancer: What’s New? Kelly Coffey Solid Tumour Target Discovery Laboratory, Translational and Clinical Research Institute, Newcastle University Centre for Cancer, Faculty of Medical Sciences, Newcastle University, Newcastle upon Tyne NE2 4HH, UK; [email protected] Simple Summary: Prostate cancer is the most commonly diagnosed cancer in men in the UK, accounting for the deaths of over 11,000 men per year. A major problem in this disease are tumours which no longer respond to available treatments. Understanding how this occurs will reveal new ways to treat these patients. In this review, the latest findings regarding a particular group of cellular factors which make up a signalling network called the Hippo pathway will be described. Accumulating evidence suggests that this network contributes to prostate cancer progression and resistance to current treatments. Identifying how this pathway can be targeted with drugs is a promising area of research to improve the treatment of prostate cancer. Abstract: Identifying novel therapeutic targets for the treatment of prostate cancer (PC) remains a key area of research. With the emergence of resistance to androgen receptor (AR)-targeting therapies, other signalling pathways which crosstalk with AR signalling are important. Over recent years, evidence has accumulated for targeting the Hippo signalling pathway. Discovered in Drosophila melanogasta, the Hippo pathway plays a role in the regulation of organ size, proliferation, migration and invasion. In response to a variety of stimuli, including cell–cell contact, nutrients and stress, a kinase cascade is activated, which includes STK4/3 and LATS1/2 to inhibit the effector proteins YAP and its paralogue TAZ.
    [Show full text]
  • Reprogramming of Isocitrate Dehydrogenases Expression and Activity by the Androgen
    Author Manuscript Published OnlineFirst on May 8, 2019; DOI: 10.1158/1541-7786.MCR-19-0020 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. 1 Reprogramming of isocitrate dehydrogenases expression and activity by the androgen 2 receptor in prostate cancer 3 4 Kevin Gonthier1,2, Raghavendra Tejo Karthik Poluri1,2, Cindy Weidmann1, Maude Tadros1, and 5 Étienne Audet-Walsh1,2,3 6 7 1 Endocrinology - Nephrology Research Axis, Centre de recherche du CHU de Québec - 8 Université Laval, Québec City, Canada 9 2 Department of molecular medicine, Faculty of Medicine, Université Laval, Québec City, 10 Canada 11 3 Centre de recherche sur le cancer de l’Université Laval, Québec City, Canada 12 13 Keywords: steroid; metabolism; glioma; nuclear receptor; castration-resistant prostate cancer, 14 IDH1, oncometabolism 15 16 Abbreviated title: Reprogramming of IDH activity by AR in PCa 17 18 Corresponding Author: Étienne Audet-Walsh, Centre de recherche du CHU de Québec, 2705 19 Boulevard Laurier, room R-4714, Québec City, QC, Canada, G1V 4G2 20 Phone: 1-418-525-4444 ext. 48678 ; e-mail : [email protected] 21 22 Disclosure statement: the authors declare no potential conflicts of interest. 1 Downloaded from mcr.aacrjournals.org on September 24, 2021. © 2019 American Association for Cancer Research. Author Manuscript Published OnlineFirst on May 8, 2019; DOI: 10.1158/1541-7786.MCR-19-0020 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. 23 Abstract 24 Mutations of the isocitrate dehydrogenase genes IDH1 and IDH2, key enzymes involved in 25 citrate metabolism, are important oncogenic events in several cancer types, including in 1-3% of 26 all prostate cancer (PCa) cases.
    [Show full text]
  • MRT67307 Kinase Inhibitor; TBK1 and Ikkε Inhibitor Catalog Code: Inh-Mrt for Research Use Only Version 19E07-NJ
    MRT67307 Kinase inhibitor; TBK1 and IKKε inhibitor Catalog Code: inh-mrt https://www.invivogen.com/mrt67307 For research use only Version 19E07-NJ PRODUCT INFORMATION CHEMICAL PROPERTIES Contents CAS Number: 1190378-57-4 (free base) • 10 mg MRT67307 (hydrochloride) Formula: C26H36N6O2 . x HCl Molecular weight: 464.60 g/mol (free base) Storage and stability Solubility: 15 mg/ml H2O - MRT67307 is provided as a dried powder and shipped at room temperature. Upon receipt, store product at -20 °C. METHODS - Upon resuspension of MRT67307 prepare aliquots and store Preparation of stock solution (10 mg/ml) at -20 °C. Resuspended product is stable for at least 3 months when 1. Add 1ml of endotoxin-free H O properly stored. 2 2. Use immediately or store aliquots at -20 °C - Avoid repeated freeze-thaw cycles. 3. Prepare dilutions using sterile endotoxin-free water Quality control Working concentration range: 1 - 20 µM (for cell culture assays) - Purity: ≥95% (UHPLC) - Inhibition of TBK1/IKKε by MRT67307 has been confirmed using Inhibition of TBK1/IKKε by MRT67307 in a cellular assay cellular assays. Below is a protocol using InvivoGen’s THP1-Dual™ cells for studying - Absence of bacterial contamination (e.g. lipoproteins and endotoxins) specific inhibition of the IRF pathway by MRT67307. These cells has been confirmed using HEK-Blue™ hTLR2 and HEK-Blue™ hTLR4 cells. express both an inducible Lucia luciferase reporter and an inducible secreted embryonic alkaline phosphatase (SEAP) reporter to measure PRODUCT DESCRIPTION the activation of the IRF or NF-κB pathways, respectively. Changes in MRT67307 is a potent, reversible kinase inhibitor, and a derivative the Lucia expression levels upon inhibition can be readily assessed by of BX7951.
    [Show full text]
  • Mechanisms of IKBKE Activation in Cancer Sridevi Challa University of South Florida, [email protected]
    University of South Florida Scholar Commons Graduate Theses and Dissertations Graduate School 1-29-2017 Mechanisms of IKBKE Activation in Cancer Sridevi Challa University of South Florida, [email protected] Follow this and additional works at: http://scholarcommons.usf.edu/etd Part of the Biochemistry Commons, Biology Commons, and the Cell Biology Commons Scholar Commons Citation Challa, Sridevi, "Mechanisms of IKBKE Activation in Cancer" (2017). Graduate Theses and Dissertations. http://scholarcommons.usf.edu/etd/6617 This Dissertation is brought to you for free and open access by the Graduate School at Scholar Commons. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Scholar Commons. For more information, please contact [email protected]. Mechanisms of IKBKE Activation in Cancer by Sridevi Challa A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Cell Biology, Microbiology, and Molecular Biology College of Arts and Sciences University of South Florida Major Professor: Mokenge P. Malafa, M.D. Gary Reuther, Ph.D. Eric Lau, Ph.D. Domenico Coppola, M.D. Date of Approval: January 12, 2017 Keywords: EGFR, Olaparib, resistance Copyright © 2017, Sridevi Challa DEDICATION This dissertation is dedicated to my kind and courageous mother. ACKNOWLEDGMENTS I would like to acknowledge Dr. Cheng for trusting me with completion of the projects. I would like to thank him for giving me the freedom to explore any aspect of research and always willing to provide the necessary resources and guidance for my projects. I want to also acknowledge Ted and the Cheng lab personnel for their support.
    [Show full text]
  • MAP2K4/MKK4 Expression in Pancreatic Cancer: Genetic Validation of Immunohistochemistry and Relationship to Disease Course
    8516 Vol. 10, 8516–8520, December 15, 2004 Clinical Cancer Research MAP2K4/MKK4 Expression in Pancreatic Cancer: Genetic Validation of Immunohistochemistry and Relationship to Disease Course Wei Xin,1 Ki J. Yun,4 Francesca Ricci,2 ing patterns were also evaluated among unresectable pri- Marianna Zahurak,3 Wanglong Qiu,4 mary and metastatic cancer tissues from autopsy specimens, Gloria H. Su,4 Charles J. Yeo,5,6 indicating intact Mkk4 immunolabeling in 88.8% of the unresectable primary carcinomas as compared with 63.3% Ralph H. Hruban,4,5 Scott E. Kern,4,5 and 4,5 of distant metastases (P < 0.001). Our data indicate that the Christine A. Iacobuzio-Donahue loss of Mkk4 protein expression in pancreatic carcinomas 1 Department of Pathology, The University of Michigan Medical may be more frequent than suggested by the rates of genetic Center, Ann Arbor, Michigan; 2Department of Pathology, University La Sapienza, Rome, Italy; and the Departments of 3Biostatistics, inactivation alone and that MKK4 loss may contribute to 4Pathology, 5Oncology, and 6Surgery, The Johns Hopkins University disease progression. The correlation of MKK4 genetic status Hospital, Baltimore, Maryland with immunolabeling patterns validate this approach for the evaluation of MKK4 status in routine histologic sections and ABSTRACT may provide useful information regarding patient prognosis. MKK4 (MAP2K4/SEK1) is a member of the mitogen- activated protein kinase family, originally identified as a INTRODUCTION kinase involved in the stress-activated protein kinase path- The mitogen-activated protein (MAP) kinase cascades are way by directly phosphorylating c-Jun NH -terminal kinase. 2 multifunctional signaling pathways that are evolutionally well MKK4 genetic inactivation has been observed in a subset of conserved in all of the eukaryotic cells.
    [Show full text]
  • (Continued) Linkage Mapping and Polymorphisms
    Inborn Errors of Metabolism (continued) 965 966 Re-institution of dietary treatment in a PKU adult patient: cdinical and MRI Common point mutations in four patients with the late infantile form of improvement after one yer. (( E. Z h, A. Morronel, M.A DonatiI, E. galosialidosis. ((X.Y. Zhoul6, R. Willemsen2, N. Gillemans', A. Morroe3, Psquni', C Fonda2.)) 'Dept. of Pediatrica, University of Florence and 2Unit of P. Strisciuglo', G. Andria4, D.A. Applegarths and A. d'Azlzo.)) 'Dept. of Neuroradlology, Prato, Italy. Intro by: Luciano Felicetti Cell Biology and 2Clinical Genetics, Erasmus University, Rotterdam, The Retrospective and prospective studies Indicate deteroration of cognition and Netherlands; 3Dept. of Pediatrics, University of Florence, Italy; 'Dept. of neurpsyololcal performance in some PKU patients after treatment Pediatrics, University of Naples, Italy; and Dept. of Pediatrics, University of withdrawL. We report the results ofrestitution ofdiet low in pbenylalanine in Britiach Columbia, Vancouver, Canada. Intro. by E.F. Neufeld. a adult PKU patient with progreulve demyelinating clopathy. The dia of classical PKU was made at age of 4 years and d Uatment was Galactosialidosis is a lysosomal storage disorder caused by mutations in the sarted At 11 years the therapy was stopped: he was able to walk alone, to run, gene encoding the protective protein/cathepsin A. Patienta with the late to cycle, to climb stairs, to write. Since the age of 19 years be had seizures. At 21 infantile phenotype differ from early infantile or juvenile/adult types in that yeas he showed weakness, stiffness, dysarthria, difficulty in gait and swallowing. they have a better prognosis and no mental retration We have analyzed four Later ewas wheelchair-bound and his mother noted gradual deterioration in these his perforannce and behaviour.
    [Show full text]