Inborn Errors of Metabolism (continued) 965 966 Re-institution of dietary treatment in a PKU adult patient: cdinical and MRI Common point mutations in four patients with the late infantile form of improvement after one yer. (( E. Z h, A. Morronel, M.A DonatiI, E. galosialidosis. ((X.Y. Zhoul6, R. Willemsen2, N. Gillemans', A. Morroe3, Psquni', C Fonda2.)) 'Dept. of Pediatrica, University of Florence and 2Unit of P. Strisciuglo', G. Andria4, D.A. Applegarths and A. d'Azlzo.)) 'Dept. of Neuroradlology, Prato, Italy. Intro by: Luciano Felicetti Cell Biology and 2Clinical Genetics, Erasmus University, Rotterdam, The Retrospective and prospective studies Indicate deteroration of cognition and Netherlands; 3Dept. of Pediatrics, University of Florence, Italy; 'Dept. of neurpsyololcal performance in some PKU patients after treatment Pediatrics, University of Naples, Italy; and Dept. of Pediatrics, University of withdrawL. We report the results ofrestitution ofdiet low in pbenylalanine in Britiach Columbia, Vancouver, Canada. Intro. by E.F. Neufeld. a adult PKU patient with progreulve demyelinating clopathy. The dia of classical PKU was made at age of 4 years and d Uatment was Galactosialidosis is a lysosomal storage disorder caused by mutations in the sarted At 11 years the therapy was stopped: he was able to walk alone, to run, gene encoding the protective protein/cathepsin A. Patienta with the late to cycle, to climb stairs, to write. Since the age of 19 years be had seizures. At 21 infantile phenotype differ from early infantile or juvenile/adult types in that yeas he showed weakness, stiffness, dysarthria, difficulty in gait and swallowing. they have a better prognosis and no mental retration We have analyzed four Later ewas wheelchair-bound and his mother noted gradual deterioration in these his perforannce and behaviour. Al 30 years he came on our examination: he had of paties: one American, two Canadians and one Italian. em aery spastic eraple, ptural tremor of the head and bands, hyperrelexia with of their clinicl symptoms varies slightly, the American patient being the ks clonus CT and MRI of brain showed extensive demyelination of cerebral affected and the Italian the most. The paiens were found to be either homozy- henmspheres Serum p ylanine conentration was 1689 M. He was newly gous or compound eterozygous for two point mutons resulting in the ld on die low in phenylalanine (500 mg/die) One year lter he sbowed sbstitution of Phe42 to Val and of Tyrul to Am. TM American patient caris improvement or his performance and behaviour, decreased muscle tone, no the Auni amino acid change encoded by one allele and a single base deletion tremors; he was able to walk few metres, but spasticity was stifl apparent. MRI in the other, identfied as null allele by the absence of the c g showed a reduction of the extension and n in signal intensity of mRNA. Both Canadian piens have the A su o and one of them altered white matter are indicating partial re en The pomsibility of a pr ve demyelinig enbalopaty in adult PKU is a genetic compound for the two point mutations. The Val"2 amino acid patients without a trtd diet underlin the importance ofa lifelong dietary change is present in both alleles of the Italian patent. Analysis of the two treatment. Te re-institution of die therapy in adult PKU can avoid further mutant protective proteins in COS-1 cells de that the Asn mutati- brain damage or Improve, as our cme shows, reversible demyelination. Further on has a milder effect on the biochemical properties of the protin: the results studies on larger number of patients are needed to know if only certain patients might explain the clinical herety observed within this category of develope signcant abnormalities of cerebral white mater. An association galactosialidosis patients. between the genthype and the development of brain damage is probably 6 Address as from July 1, 1993: Dept. of Genetics, St. Jude Children's Re- search Hospital, Memphis, TN. Linkage Mapping and Polymorphisms 967 968 Mapping of a gene for rod monochromacy. ((K.L Anderson', R.A. Lewis', L Further evidence for a locus for familial juvenil nephronophthsis (NPHO Baird2, M.F. Leppert2, J.R. Lupskil)). 'Baylor College of Medicine, Houston, on chMosome 2p and evidence for genetic hetenIty. ((C Atignacl, M Texas, 2Unlversty of Utah Medical Center, Salt Lake City. Medhioubl, F. Benesayl, J. enn2, C Schroedr3, J. We 4, D. Cohen2, R. Habibl.)) IlqNISM U192, H6pltal Necker, Paris, 2CEPH, Paris, Rod monochromacy is Inherited as an autosomal recessive trait, 3Universty Hospital Ninegen, The Netherlands. }G;rthon, Evry, Prance. characterized by the total absence of color discrimination, photophobia, Intro. by: A. Munnich. nystagmus, and decreased visual acuity. The retinal cone photoreceptors do not develop or remain functionally defective and morphologically abnormal, NPH (or recessive medullary cystic kidney diseae) is an autosomal suggesting a developmental defect of the cone. This disorder has a recessive, chronic tubulo-interatitial disod, with the formation of cysts at prevalence rate of approximately 1 per 300,000 and is typically observed in the cortico-medullary Junction. NPH leads to end-stage renal filhre (13SRP) isolated sibships or In the offspring of consanguineous parentage. In this in adolence and counts for 15% of EMKIn children. NPH is associated study, 10 U.S. families were evaluated and DNA was obtained from 65 with Leber amaurodsi (termed Senior-bk.. SYd ) or with later onset Individuals (23 of these were affected and the rest were unaffected family retinitis pigmentosa In about 16% of cases. Using microsatellite marker members). Previously, we reported that a rod monochromacy patient with a AFMmze3 at the D2S160 locus which gave a lbd score of 4.77 atS - 0.05 In 18 14;14 Robertsonien translocation had maternal isodisomy for all portions of multilex NPH families, we hew recently mapped a gene for the purely renal chromosome 14 tested, suggesting that a genetic location for this disorder form of NPH to chromosone 2p (C Antignac et al., Nature Genet 1993). We maps to chromosome 14. A series of dinucleotide repeat polymorphisms have extended this study to four additional families with isolated NPH and have been characterized for chromosome 14 spanning the region from peforme linkage analysis with 6 polymorphic microsatelite markers closely 14q1 1.2 to 14q32.33. Flanking primers for 13 of these dinucleotide repeat linked to the NPH gene. Based on haplotype analyses and specific polymorphisms were obtained and conditions were established to develop a multiple recombination events, the following order of the lod was d : 2el - repeat-based PCR assay with a multiplex strategy to analyze the AFMI72xc3 - AFM262xbS - NPH/AFM220ze3.- AFMO87xa1 - AFM234te1 - genotypes for all these individuals for each of the 13 polymorphisms AFMO16yc5. This allow us to localize the NPH gene between AFM262xb5 and examined. These data were used for linkage analysis to localize this disorder AFM087xal, and therefore to narrow the NPH region to about 7cM. to a specific region of chromosome 14. Heterozygosity values for these Furthermore, the haplotype analyses show unequivocally that four families dinucleotide repeat polymorphisms range from 0.51 to 0.83, so that family are not linked to h om 2, although there is no clinical or patho Il members are fully informative for many of the polymorphisms examined. feature present in these families that could separate them from the families Results from the linkage analysis suggested evidence against linkage for linked to markers of the NPH region. This reveals significance evidence for each of the 13 loci examined to date, excluding approximately 50% of the genetic In the rnal form of NPH. chromosome 14 genetic map. hetogeneity purey

969 970 Angiotensinogen acandidate gene in d in pr-eclampsia? ((R. Arngrlmssont.4, J.J. Usher syndrome type I in the French Acedian population: fine mappiLg Walker2, F. Soubir3, R.T. ei 4, Y.U. K evtsev3, S. Purandarel, & Brnsson2, and haplotype analysis.((R. Ayyagari. R.J.H. Smith, E.C. Lee, V.J. H. BjWmsson5, J.M. Connor1.)) IDuncan Guthrie nte of Medical Genefics, Yortill, Kimberling, S.P. Daiger, IZ. Pelias, B.J.B. Keats, M. Jay, A. Glasgow G3 8SJ, Scoband, 2Glasgow Royal Maternity Hospital, Scotland, 31nserm U36, Bird, W. Reardon, M. Guest, and J.F. HejtmanciLk.)) National Eye Paris France, 4Dept. Obstetrics and Gynecology, National University Hospital, Institute, National Institutes of Health, Bethesda, MD 20892. Reykjavik, Ieland and 5 9ttistical Division, Agriculture Research Institute, Rekavik, Usher syndromes are a group of autosomal recessive disorders Iceland. characterized by congenital sensorineural hearing loss, progressive visual impairment secondary to progressive pigmentary retLnopathy There is strong evidence to suggest a genetic influence on the d of and sometimes vestibular involvement. Based on clinical symptoms three types of Usher syndromes have been described. Usher syndrome preclampsia (PE), but the mechanism of inheritanc has ben controvesial. We have type I has been mapped to three different locl: (1) Chromosome 14q thus studied 17 families where the proband had proteinuric PE and bive families with in a group of French families, (2) Chromosome llq in a group of eclampsia (E) from Icd and Scotland using affected sib pairs and the affected families from Scandinavian, Irish, SwedLsh, South African, American pedigree member method (APM). The affected relative were scored I.R.S and weighting and Brltish population and (3) Chromosome llp in familles of French factors for allle frequencies (1/sqrt(p)) and family size were used. Simulation studies for AcMdian origin. Fine mapping of the Usher syndrome type I locus on the datasets were caried outto estimate epirical p-values. the chromosome llp wys carried out with 16 mLcrosatellite markers. Positive lod scores were obtalned with markers D11S569(t.-1.79), Using angiotensinogen (C-An) microsatellites as genoty , the affcted sib pairs DllS419(Z-4.20), D118902(-6.44), DllS926(Z-1.45), D118921(Z-3.31), in PE and Efamilies shoed significant increase in albeh sharing (T1.28; p.0.02). The D118899(2-5 .46) at 1-0. The occurrence of critlcal crossover events APM showed a significant distortion of independent sgegaton of the marker and the between USH 1 and markers D115928 and D118861 loci establishes these disease in PE families. The distortion was more marked when the more homogeneu two markers as flanking loci posLtioning USH 1 gene at an interval group of proteinuric PE women were classified as affected (T.3.85; p<0.001, than when of approximately 6.0 ctl. Haplotype analysi reveals that all the women with PE without proteinuria were also included This affected indivlduals In our MedLan famllies liherited same (T451; p.0.014). distortion haplotype of alleles of the markers between the flanking markers was also seen in the combined E and PE family samples when proteinuric PE women D115861 and D01S928. The haplotype frequency analysis demonstrates were classifed as affected (T43.01; p0.007). These results wpporta ous inthe region existence of strong lLukage dLsequillbrlu lndicLatLng a founder of angotensinogen on c 1q being involved in the predisposition to pre- effect in the French Median population. eclampsia in these WaiO Supported in part by the UP foundation FLghtLng Bllndness. Linkage Mapping and Polymorphisms (continued) 971 972 Genome Scan for Unkage to Gilles de la Tourette Syndrome. ((C.L Barr', J. Association of Class II MA Genes and T cell receptor V-beta genes with Uvingston'. K. Wigg1, P. Sandor2, L-C. Tsui'.)) 'The Hospital for Sick Susceptibility to multiple sclerosis. ((S.S. Beall and M. Hockertz.)) Children and 2Toronto Hospital Western Division, Toronto, Ontario, Canada. University of British Columbia, Vancouver, British Columbia, Canada. It has previously been shown that susceptibility to multiole Gilles de la Tourette Syndrome (TS) is a familial, neuropsychiatric disorder sclerosis (MS) may be determined, at least in part, by inheritance of a characterized by chronic, intermittent motor and vocal tics. In addition to tics, 175 Kb region of the TcR beta chain locus with Class II 1IA genes (>all affected individuals frequently display symptoms such as attention-deficit et al, J. Neuroimunol, 1993, in press). To confirm these results, a hyperactivity disorder and/or obsessive compulsive disorder. Genetic second independent series of MS patients was tested. This series analyses of family data have suggested that susceptibility to the disorder is consisted of 92 unrelated, well-characterized, longitudinally followed most likely due to a single genetic locus with a dominant mode of MS patients and 308 of their relatives identified from the Vancouver MS transmission and reduced penetrance. In the search for genetic linkage for clinic from which peripheral blood lymphocytes and DNA was prepared. TS, we have collected 8 well-characterized pedigrees with multiple affected The study sample consisted of affected sib pair (N - 22) and parent- individuals on whom extensive diagnostic evaluations have been done. Our child pair (N - 7 ) families as well as simplex (ie. the MS clinic power analyses indicate that collectively the 8 families from the Toronto area patient is the only family member with MS) (N - 59) families. Control are sufficient to detect linkage assuming genetic homogeneity among the alleles consisted of alleles not passed to the proband (affected based families. In addition, 4 of the families could independently provide evidence family controls). Segregation of 722 lIA Class II DR beta and DQ beta alleles in 58 families confirms the reported association of DR2 with for linkage given that a closely linked, sufficiently informative marker is used. susceptibility to MS (p - 0.0009; relative risk (R.R. - 4.6). Our data, We are currently scanning the genome systematically using a panel of however do not support an association between DQ 1 and MS (p - 0.65t uniformly spaced (10 to 20 cM), highly polymorphic, microsatellite markers on R.R. - 1.21). Segregation of 1,286 TcR beta chain alleles at nine 5 families segregating TS. To date, 80 markers have been typed and 739 cM different loci in 48 families supports our previously reported associat- of the genome has been excluded summed over all the families tested (under ion of the 175 Kb region of the TcR beta chain complex and lIMA Class II the assumption of genetic homogeneity). No evidence for linkage has been genes with MS susceptibility (Beall et al, J. Neuroimmunol, 1993, in found at this time. The typing of 120 more microsatellite markers is in press). The data show an increased distribution of at risk TcR beta progress. Linkage to TS is examined first by pairwise analysis with each chain subhaplotypes (as defined in Beall et al, 1989; Beall et al, in marker. Once an entire mapping panel of markers has been typed for a press) in DR2+ individuals (p - 0.07; R.R. - 4) but not DR2- individuals chromosome, the inheritance pattern of the chromosome in each of the (p - 0.47; R.R. - 1.29). To increase the power of this study, we are families will be determined by examining meiotic crossovers. Co-inheritance continuing to test these associations on additional families and are of a particular set of markers in affected family members will identify the also testing TcR V alpha associations. region(s) of interest for more extensive analysis.

973 974 Localization of the gene for X-linked congenital stationary night blindness within Chromosomal assignment using an efficient monochromosomal hybrid the Xpl 1 region and candidate gene analysis using the dideoxy fingerprinting pooling strategy. ((J.S. Beck, LS. Powers, V.C. Sheffield and J.C. Murray.)) method. ((N.T. Bech-Hansen, LL Field, K. Gratton and W.G. Pearce.)) Dept of Pedarics and the Cooperave Human Unkage Center, UnIversity of Department of Paediatrics, University of Calgary and Alberta Children's Hospital, Iowa, lowa City, IA. Calgary Alberta, Canada. Both genetic and physical mapping efforts are facilitated by the ability to X-linked congenital stationary night biindness (CSNB1) is a disorder that reliably assign DNA markers, such as short tandem repeat polymorphisms includes impairment of night vision, variable myopia, reduced visual acuity, and (STRPs) and sequence tagged sites (STSs), to specific human congenital nystagmus. Electroretinography reveals a marked reduction of the b- chromosomes. Assignment can aid in the construction of genetic map by wave suggesting that individuals with CSNB1 have a defect in the bipolar layer serving to check the accuracy of subsequent linkng. analysis. We have used of the retina. In our original mapping of CSNB1 we linked the locus to DXS255 a method of chromosome assignment based on a monochromosomal cell line and subsequently placed it proximal to DXS7-MAOA,B in the Xpl1 region. We pooling strategy. Monochromosomal hybrid DNA was obtained from NIGMS have now extended our studies to include eight other CSNB1 families for linkage (somatic cell hybrid panel #2; Drwinga et a. Genomics 16:311). We combine analysis using markers spanning the region Xpl1.3 to Xpl1.22, from MAOAB to the individual cell hybrid DNA into eight pools, such that each human DXS255. We found tight linkage between the CSNB1 locus and the chromosome is present in a unique combination of two pools. PCR SYN1/ARAF marker (Zmax=e.93, theta=0.0) in these families and cross-overs in amplification using the pooled DNA as template results in amplification of four of the families were consistent with a location of the CSNB1 locus between human product in only two pools and consequently, accurate chromosomal MAOA,B and DXS255. Available markers have not allowed us to reduce this assignment of the marker. In cases involving highly conserved sequences critical region, which is estimated to span 14 cM. However within this region of where rodent PCR product is identical in size to the human product, we have the X chromosome maps the retinal gene synaptophysin (SYP), a possible identified the human product by DGGE or SSCP analysis. This chromosomal candidate gene for CSNB1. We have used a modification of the dideoxy assignment method can be used with either labelled nucleotide Incopoation fingerprinting (ddF) method of Sarkar et al. (Genomics 13:441-443, 1992) to or ethidium bromide staining. We have used this technique extensively with screen exons of the synaptophysin gene (SYP) for mutations. PCR products good results. Our primary application has been chromosomal assignment of corresponding to each of the exons of the SYP gene were used as templates in over 150 novel STRPS. We have also used the method to assign several PCR double strand cycle sequencing reactions using one dideoxy nucleotide to genes, and In one case to reassign a zino-finger gene, previously placed on a produce a partial set of nested sequence products. Products were analyzed as different ch rom e. We have observed the reported ctinain of the in single strand contormational analysis on nondenaturing gels. Analysis of the hybrid panel (Dubois and Naylor. 1993. Genomics 16:315). However, these SYP exons In individuals affected wtih CSNB1 from five different families contaminations result in ambiguities rather than misassignments. This technique offers advan-tage including simplicity, cost efficiency, and ease of detected no mutations, suggesting that SYP may not be the gene for CSNB1. interpretation.

975 976 Posibalocalization ofam sneforiiftip andpateo4q. ((S Begh Frequency and charrcterlzstlon of tetranucleotlde repeat polymorphisme T Faud, S Douhy, J Weber, D Bbdr, PM Connely and ME Hods.)) on chromosome 17 and Isolation of STRs from 17q21. ((P.E. Bennett- hidi UnvrstySScho Mdicine, napol, IN;' Marsheld RPesach Baker, S. Kiousis, J.F. Kukowska-Latallo, MA. Dojkca, and J.S. Chamberlain.)) Iodon, Marsheld.WI. Department of Human Genetics and Human Genome Center, University of Michigan Medical School, Ann Arbor, Ml 48109.0618. Cleft with orwo* cleft pskat CL(P), Is probably the most caonon birth p Tetranuciotide repeats are a class of short tandem repeats (STR) that are defeot In humns. Over 200 synxromes with CL(P) have been mre zd and potentially very useful for genetic mapping studies. We have been analyzing a theseremeedbyavarlety endelian, ch d anlaridwenirOn al variety of different tetranucleotide repeats on human chromosome 17 to explore factor. The majority of the mynsydromic of CL(P) are sporadi (75%) the utility of these sequences for genetic analysis of human disease genes. with about 2S% fmile.l Segregation analyse of nosydrmic CL(P) Oligonucleotide probes corresponding to 26 separate tetranucleotide repeat completed on various ouo indcate a aor gene is invoed hiat sequences were synthesized and used to screen cosmid libraries from lea som faes ent 19; Marazt et al, 196; Hect 1990; chromosome 17 under conditions designed to select for repeat lengths greater Hecf at al, 1991). than 24 bases (6 repeat units). These studies have enabled the relative report assimt of a CL(P) to dcomom frequency of each class of tetranucleotide repeat to be determined, revealing 4q in a sngle lrge Caucaslan fmly wih muliple ce dofcsyneromic that some repeats are much more abundant than others. Several such repeats, CL(P), hilly geneatis.oWe hav assumed th domlnrt deftn such as AAAT, AAAG, and MGG are often associated with ALU elements, and geo ha a pentrnc d 65% in fth mily. Usi mic repeat these sequences tend to be the most abundant class of tetranucleotide repeats. mark cover mor tn 30 cM of dcomoome 4q we hae obtained These STRs can be analyzed by PCR amplification with an end-labelled primer post LOD sors of gretr hn 2 wth 2 d th marke Ther ws no corresponding to the non-ALU side of the repeat. Many other classes of reombinati wih MFDB and MFD140 (Zma-2.10, tetranucleotides are moderately abundant and are frequently polymorphic. We (Zmax-2.44,ftht-0) have a number of from chromosome in d -0). Reombinan ha ben detectd wih othr mrksm We ae analyzed STRs 17, focusing particular on q21, and have examined correlations between the repeat sequence, its expanding the reuts to inh more markers in hes dat length, and the observed polymorphism information content (PIC value). In sugge at In famly, Wg for noyndiomic CL(P) contrast to [CA) repeat microsatellites we have not observed a direct correlation bicad In or rer the 4q31 ren between repeat length and PIC value, although many of the repeats display high PIC values and are useful for genetic analyses. In particular, the four base pair allele spacing and relative lack of stuttering during PCR amplification make this class of STRs particularly well suited for genetic mapping and loss of heterozygosity analyses. Linkage Mapping and Polymorphisms (continued) 977 978 Loca ization of X-Unked Charot-Marie-Tooth Disease to Xq13.1. A genetic map of chromosome 14q32.1 to qter. ((G. D. Billingsleyl, R. F. ((J. Bergoffen1.2, K. Chen2, B.W. Nieuwenhuljsen2, S. Cochrane3, N. Wintle1, N. P. Carter2, D. W. Cox1.)) 1.The Hospital for Sick Children and Fairweather4. A. Monaco4, N. Haltes3, K.H. Fischbeck2)). 1The Children's Univ. of Toronto, Ontario, Canada. 2.Department of Pathology, Cambridge Hospital of Philadelphia and 2University of Pennsylvania School of University, Cambridge, England. Medicine, Philadelphia, PA, 30xford University, England, and 4Aberdeen Royal Hospital, Scotiand. Genetic linkage maps for the distal region of 14q, which contain among other loi the immunoglobulin heavy chain gene cluster (IGH), the serpin gene Charoot-Marie-Tooth disease (CiMT). also known as hereditary motor and cluster and the first random segment to be regionally localized, D14S1, have sensory neuropathy, is a heterogeneous group of slowiy progressive, been reported. We have combined physical mapping and linkage analysis to degenerative disorders of peripheral nerve. X-linked Charcot-Marie-Tooth generate a high resolution genetic map of 22 Woi from 14q32.1 to qter. disease (CMTX) represents about 10% of the demyelinating or type 1 CMT Multipoint linkage analysis on data from 15 markers typed in 59 CEPH population. We have performed linkage analysis using DNA sampies from 10 reference pedigrees gave the following gene order with sex average multigeneration CMTX families from the United Sates and Europe. recombination fractions: Previously, we had localized CMTX to proximal Xq between PGKP1 (Xq12) Pi - 0.04 - MCT - 0.06 - D14S45 - 0.04 - D14S51 - 0.09 - D14S78- - 0.02 - and DXS72 (Xq2l). Phase known recombinants now allow us to further D14S13, D14S22** - 0.07 - CKB - 0.02 - AKT1V - 0.04 - D14S17 - 0.01 - narrow the locus to band Xq13.1 between markers DXS453 and DXS227. D14S1- 0.03 - D14S20, D14S19-- - 0.02 - D14S23 - 0.11 - IGH. O<1000:1 We estimate this segment to have a recombination distance of less than 2 cM odds, **<100:1 odds. and a physical length of less than 5 Mb. The linkage order of the most distal markers differs from previously published Yeast artificial chromosome (YAC) clones have been Isolated from linkage maps ( Science 258:67, 1992, Genomics 4:76,1989). genomic YAC libraries using Xq13.1 STSs. These YACS have been For physical mapping we have used Southem hybridization and PCR of arranged In a contig which spans the segment that contains CMTX. Genes STSs on human/rodent somatic cell hybrids, DNA from 11 patients with ring known to be located within the segment are being analyzed for peripheral chromosome 14 or other deletions of chromosome 14, and flow sorted nerve expression and alteration in CMTX patient DNA. The YACs are also chromosomes from patients with translocations or deletions. The linkage map being used to identify polymorphic simple sequence repeats and additional is supported by physical mapping data. Seven additional markers including ie genes in the region. the gene chromogranin A (CHGA), have been physically mapped. Our collection of derivative chromosome 14 and somatic cell hybrids allows 14q32.1 - qter to be divided into 6 physical mapping intervals. 1) PI to D14S45, 2) D14S51 to D14S18, 3) CHGA to D14S17, 4) D14S16 to D14S1, 5)D14S19 to IGHJ, and 6) IGHV to qter.

979 980 The Failial Dysautonomia gene maps to chromosome 9q31-33 and shows Improvement of the CA-repeat map of Human Chromosome 21. strong allelic association with D9S58. ((A.Blumenfeld$, S.A. ((A. Bosch, J. Guimera, S. Wiemanni, W. Ansorge', D. Patterson2 & X. Slaugenhaupt$, D.E.Lucente$, l Monahan$ F.B.Axelrod#, C.B.Liebert$, Estivill.)) Molecular Genetics Dpt., I.R.O., Hospital Duran i Barcelona. C.Iaayan+, J.L.Haines$, X.0 Brskefield$ and J.F.Gusella$.)) $MlGH and Reynals, Harvard Medical School, Boston, MA 02129. #NYU Medicsl School, New York 1EMBL, Heidelberg. 2Eieanor Roosevelt Inst., Denver. 10016. +Hadassah University Hospital, Jerusalem, Israel. Polymorphic DNA markers play an important role in human genome mapping, Familial dysautonomia (FD) is an autosomal recessive disorder allowing the ordering of different DNA fragments by genetic linkage analysis, characterized by developmental loss of neurons from the sensory end the identification of distances between them and the localization of linked autonomic nervous system. It is limited to the Ashkenazi Jewish (AJ) population, where the carrier frequency is 1 in 30. FD is the best genes. The genetic map of human chromosome 21 (HC21) has been known of the group of disorders termed congenital sensory neuropathles. considerably improved during the last two years. At the present stage, one oe We have mapped the DYS gene, responsible for FD, to the chromosomal the major tasks is the mapping to saturation. For that purpose, the markers of region 9q31-q33 (Blumenfeld ot &I. Nature Genetics 4(2):160 1993). choice are those that are both abundant and highly polymorphic such as CA- Thirteen DNA markers that map to this region yielded significant repeat polymorphisms, which seem to be uniformly spread along the human linkage to DYS. The maximum lod score of 21.1 with no recombinants was genome. To improve the genetic map of HC21 achieved with D9S58. The phase of all markers was determined in using CA-repeat dysautonomia families. Bsed on recombination events, D9S172 and microsatellites, 30 new CA-repeats isolated from a HC21 phage library D9S105, that are separated by approximately 6cM, were defined as the (LA21NS01) have been identified, and localized to specific regions of HC21 closest flanking markers to DYS. D9SS also showed strong linkage by somatic cell hybrids and the CEPH YAC panel, spreading over the long disequilibrium with DYS, with one allele present on 731 of all affected arm of HC21. Their lengths range between 8 to 26 dinucleotides, some of chromosomes compared to 5.41 of control AJ chromosomes (Z2-3142, 15 them being complex repeats. D21S411 and D21S369 seem to be the most d.f. p(0.0001). In order to narrow the candidate region, new GT microsatellite markers polymorphisms have been identified from a cosmid contig that surrounds pericentromeric from HC21 based on linkage analysis, D9S58 (see abstract by Slaugenhaupt at aI.). The new polymorphisms also with heterozygosities of 0.47 and 0.60 respectively, which could be very show strong allelic association with the DYS gene with about 701 of the useful for nondisjunction studies. 15 of them have been completely analyzed affected DYS chromosomes sharing a comon core haplotype. A related in the CEPH reference families with heterozygosities of between 0.47 and haplotype is seen in approximately 251 of the affected chromosomes, 0.83 and their genotypes are being included in the genetic map of HC21. The while the remaining 51 of the DYS chromosomes have completely different observed spontaneous mutation rate was between 0.1% and 0.2% per allele, haplotypes that share no lleles with the coimon haplotypes. These depending on the locus, but the overall mutation rate of 0.04% is consistent findings imply that although most of the FD chromosomes share a founder mutation, other mutations causing FD may exist. with frequencies reported previously for other dinucleotide repeat markers.

981 982 Optimal strategies for genomic searching using the affected pedigree Unkage disequilibrium and haplotype analysis among Polish families with member method of linkage analysis. ((D. L Brown1, M. B. Gonin 2, D. E. spinal muscular atrophy. ((LM Brzustowicz', D Matseoane', CH Wang', PW Weeksl.)) 1Department of Human Genetics, University of Pittsburgh, KbQyn', E Vitals', GK P adeh', I Hausmanowa-Petrusewicze, and TC Pittsburgh, PA, 2The Eye and Ear Institute of Pittsburgh, Pittsburgh, PA. Gllia'.)) 'Columbia University, Departments of Psychitry and Genetics and Development and The New York State Psychiatric Institute and 2Akademla The Affected Pedigree Member (APM) method of linkage analysis tests Medyam Klsla Neurologcn Warsawie, Warsaw, Poland. for linkage of a disease without making any assumptions about the mode of inheritance of the disease. We have invesged Spinal muscular atrophy (SMA) has been mappedto hom 5q112- optimal strategies for 13.3 in a number of studies examining different populations. To date, no searching the genome using the APM method. In a genomic search, one significant linkage disequilibrium with markers from this region has been typically first types marker spaosd evenly throughout the genome, reported. We have delped nine simpie sequence repeat markers which evaluates their APM statistics, and then examines regions with span the 0.7 cM region between the flanking loc D5S435 and MAPIB, and Interestingr APM statistics by typing additional markers. We define a have typed them In a series of 32 Polish families with SMA. so n search strategy in terms of the initial marker spacing, how many times to between SMA and marker alles was measured using Yule's association iterate the process of evaluating markers in a region of interest, the criteria coefficient, with non-transmitted parental haplotypes used as normal for Interesting APM statistics at each stage, and the final significance chromosomes. x2 tests were used to assess significance. As on threshold. An optimal strategy Is one which maximizes the power to values ranged from 0.088 to 0.91, with the disequilibrium at three markers detect linkage while minimizing the number of markers and keeping the reaching si ice (corrected p<0.05). Several of the repeats appear to overali false positIve rate below five percent. We have determined an be relatively unstable, with a loss or gain in number of repeats observed optimal search strategy based on simulated data invohring 1,891 markers within this small set of meiotic events. spaced every 2.5cM throughout the autosomal genome. In our simulation Extendedhaplotypeanalysisrevealeda predominant haplot passociated study, if we only typed a total of 243 markers every 20 cM, the power to with SMA. The apparently high mutation rate of some of the markers has detect linkage would be 25.6% with a false positive rate of 3.5%. In resulted in a number of hapypes at vary slightly from this predominant contrast, our optimal three-stage strategy obtains a power of 83.8% with a hapiotype, with the allels at one or two markers varying in size by 2 bases. false positive rate of 4.4% by typing an average of 305.4 markers. The predominant hapiotype and these closely related patterns represent approimately one third of the disease chromoso, but only one of the This work was supported by the University of Pittsburgh and grant non-transmitted parental chromosomes. This predominant haplotype is HG00719 from the National Center for Human Genome Research. present both in patlents with acute (Type I) and chronic (Types II and l1l) forms of SMA, and occurs twice In a homozygous state, both times in children with chronic SMA. Linkage Mapping and Polymorphisms (continued) 983 984 Unkage analysis with microselte markers close to SCA2 locus in 6 French Mapping of an X-linked gene for ventral midline defects (the TAS gene). ((R.Carmi, R. Parvari, J. Weinstein.)) famlis: evidence for a trd locus ADCA type 1. ((G. Cancel, G. Stevanin, A. Soroka Medical Center, Ben-Gurion University of the Negev, Durr, H. Chnerwels, E Le Guem, Y. Agid and A. Brice)) * Hopltal de la Salptrre, Paris, France and -Colfge de France, Paris, France. Beer-Sheva, Israel. Theoretical considerations, as well as clinical observ- Two foi responsibl fr autosomal dominant cerebellar ataxia type I ((ADCA) ations and accumulating data in developmental biology, have been idenid: SCA1 (spinal cerebellar ata 1) on dc 6p23-24 suggest that the human midline is a real biological entity and more recently CSA2 on 12q23-24. Six families with ADCA exhibiting the properties of a developmental field. It has type 1, prevIous excludedfrom SCA1 locus were genotyp with 4 microsatell- been suggested that the ventral midline, defined by the tea (D12S7?9D12S105.D12S84.D12S78) lnkted to SCA2 locus and ocalized In full spectrum of the Pentalogy of Cantrel, might present a the D12S58-PLA2 interval. Bipoint and multipoint analyses generated lod scores subset of the human midline fulfilling by itself the pre- below the threshold of -2 for the whole D12S79-D12S78 region in 5 families requisites of a developmental field. The X-linked dominant- ftereby excluding the respo fity SCA2 gene. In one family, slightly ly inherited Thoraco-Abdominal Syndrome (TAS) of ventral positive lcd saor values did not allow to conclude. Thes results demonstate midline defects is suggested to be the phenotypic result of that SCA2 is not the responsible gene in at least 5 of the 6 tested French a single mutated gene operating within the putative ventral families whereas whereas positive linkage to SCA1 was found in 4 others midline developmental field. It is speculated that this is Exclusion of and SCA2 loci in 5 families provide definite a type of an early developmental gene. We have undertaken families. SCA1 of the TAS gene in an extended family with the for a locus for type 1. the mapping evidence the existence of third responsible ADCA TAS syndrome. DNA samples were obtained from 14 affected individuals (2 males and 12 females) and 12 of their first degree relatives. A total of 45 X chromosomes were screened with highly polymorphic microsatellite (CA-repeats) probes along the X chromosome. Two-point linkage analysis between the disease locus and the X chromosomal markers excluded a location of the gene on Xp. Positive lod scores were obtained in the chromosomal region Xq22-q27. The best lod score (Zmax=5.11) was obtained for the NPRT locus (Xq26.1) at 0=0.042. Additional results indicate that the TAS gene is located between the DXS425 and HPRT loci (Xq25-q26.1).

985 986 Towards sequencing mitochondrial DNA polymorphisms by hybridization to DXYS156 is a polymorphic locus due to expansion of a (TAMA) a custom olgonuceotide probe array. ((M. S. Chee, M. S. Morris, X C. motif within a UNE repetitive element. ((H. Chen 1, W. Lowther 1.2, Huang, M. Dlgglemann, and S. Fodor.)) Affymax Research Institute, 3380 D. Avramopoulosa, S. E. Antonarakisl2.)) I Center for Medical Genetics and Central Exessway, Santa Clara, CA 95051. 2 Graduate Program in Medical Genetics, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21287-3914. Arrays of oligonuclotide probes corresponding to overlapping regions of a consensus human mitochondrial DNA (mtDNA) sequence were We report the Isolation and characterization of a polymorphic synthesized on derivatized glass slides. Fluorescently labelled PCR pentanucleotide repeat (TAAAA)n, which was mapped to human products derived from hair root DNA were hybridized to the oligonucleotide Y of DNA from a arrays. Detection was by confocal scanning laser microscopy. Known chromosomes X and (locus DXYS156) by PCR amplification polymorphisms between a set of cloned and sequenced mtDNA fragments commercially available monochromosomal somatic cell hybrid panel were detected as diftrences in fluorescence. (NIGMS panel 2). The (TAAM)n repeat of locus DXYS156 occurs within a In one design of array, a 1.3 kb region of mtDNA including the origin of human UNE element at a position where the consensus sequence contains replication was represented as a matrix of 289 overlapping probes varying a single TMM motif (This single TAAM sequence occurs at nucleotides in ength from 11 to 15 nucleotides. The probe array was 1 x 1 cm in size. 4284 to 4288 of the LINE sequence). In 72 unrelated CEPH individuals Sets of probes were designed to minimize cross hybridization and seven alleles were detected which ranged in size from 125 to 165 bp in 5 bp differences in predicted melting temperature. The synteis site for each intervals. The two largest alleles (160 and 165 bp) were only observed in different probe was specifically addressed by illumination of the slide males which suggests that they were amplified from the Y chromosome. The through a photolithographic mask, achieving selective deprotection (Fodor other 5 alleles were present in two copies in females, and in a single copy in et al. (1991) Science 251, 767-773). Nucleoside phosphoramidites males, which suggests that they were amplified from the X chromosome. bearing photolabile protecting groups were then coupled to the exposed Locus DXYS156 was polymorphic in CEPH families with an observed sites. Repeated cycles of deprotection and coupling were used to in females of 46% (27 of 59). Linkage analysis with DNA synthesize an the probes in parallel. heterozygosity The approach is very flexible. Using custom masks, arrays can be markers on the X chromosome revealed significant Iod scores for a location synthesized to represent any DNA sequence of Interest. The high density of DXYS156 close to markers DXS1002 (e=0.000; Z=8.43), DXYS1X (e of probes asowsa large amount of information to be obtained from a single =0.015; Z=17.3), DXS3 and PGK1 in the region of chromosome Xq13. It hybridization to a compact array. appears that the alleles from X and Y always stay specific to the corresponding chromosome, which suggests that there are no crossovers or exchange of genetic material between these regions of X and Y. unlike in the pseudoautosomal regions.

987 988 Identification of new polymorphic DNA markers closely Exclusion Napping of Complex Disorders: A Hatter of Priorities? Nancy Cox*, Carol Rempe+, Brian Suarez+. *Dept. of Medicine, U. of Chicago, flanking the BiA locus using homozygosity +Dept. of Psychiatry, Washington University, St. Louis, MO mapping.((O.Clermont, P.Burlet, L.Burglen, S.Lefebvre, Chicago, IL, F.Pascal, M.G.Lathrop, J.Weissenbach', A.Munnich and Conventional exclusion mapping of complex disorders with an unknown, J.Nelki.)) INSZRX U.12. H8pital des Enfants Nalades, non-Mendelian pattern of trasmission is controversial. To determine Paris. 1,INSERN U. 358,PARIS.2,Institut Pasteur et whether models allowing for appreciable heterogeneity could be more Genethon. Paris and Evry. useful in mapping complex disorders, we have utilized three models (a The gene for autosomal recessive forms of spinal dominant, a recessive and an intermediate, maximum penetrance 0.5) muscular ham recently been mapped to allowing for a high proportion of phenocopies (70% of those affected atrophy (SiA) have a non-susceptible genotype at the susceptibility locus). In chromosome 5ql3 within a 4cM region between the blocks two-point analyses with these models, we consider loci with a maximus AF1ll4ye7/ZF5.15 and MAP-IB/JK53. Among the 138 new lod score for any model (Zmax) > 3.4 (correction for using 3 models) to microsatellites assigned to chromosom 5 that were be linked to susceptibility loci; we consider loci to have no current generated by one of us (J. W) , 15 were mapped to the priority for additional study if lod scores for all models are < -2.0 5ql2-ql4 region. A total of 50 type I, II, and III SNA for theta < 0.15 and Zmax ( 0.40. The remaining loci would have families with at least two affected individuals and 29 priority for additional study dependent on Zmax. This strategy was inbred SMA families from distinct geographical region tested using data on nuclear families (2 parents, 4 children) ascertained through 2 affected sibs with disease susceptibility with one or two affected individuals were investigated. generated under a variety of complex models; each family member was Conventional haplotype analysis combined with "typed" at 100 fully informative marker loci, a minism of 4 and a homozygosity mapping identified two new highly maximum of 10 of which were linked to susceptibility loci (theta-0 or polymorphic microsatellites which are the closest 0 05). Heritability ranged from 50-%lOO and the number of families flanking markers to the Sal locus. These data are analyzed ranged from 200 to 350. General conclusions include: 1) For essential for the combined genetic and physical mapping diseases with l00% heritability and a moderate number of contributing loci (4-6), the strategy was quite successful at identifying of the disease locus in order to isolate the SMA gene at and demonstrate that homozygosity mapping using highly susceptibility loci and correctly "excluding" unlinked marker loci, sample sizes of 200 families. For diseases with 50 or markers may be the method of choice for 2) heritability polymorphic a large number of contributing loci (10), half of the contributing loci high resolution mapping of recessive autosomal were falsely "excluded". While loci cannot be formally "excluded" as disorders. contributors to complex disorders, it is possible to set priorities for additional studies based on results of analyses using models allowing for hetogMity. Linkage Mapping and Polymorphisms (continued) 989 990 Progress towards identification of susceptibility loci in schizophrenia: Search for genes prdisposing to bipolr disorder using microsateliites and Unkage analysis of chromosomes, 11q and 15ql5-21.3 and 22q in VAPSE's. ((A. De bruy&,, LA. Sandkuil', G. Raes', K Mendelbaum' D. British and Icelandic schizophrenic kindreds. ({D. Curtis, G. Kalsi, B. Sousry3', j. Meni and C. Van Broeckhven'.)) ' lAboItoy of Mankoo, R. Sherrington, G. Melmer, J. Brynjolfsson, T. Sharma, T. Neurogenetics, Born Bunge Foundation, University of Antwerp (UIA); 'Dept Sigmundason, T. Read, P. Murphy, H. Petursson and H. Gurling.)) of Clinical Genetics, Dljazigt University Hospital, Rotterdam, The Netherlands; Academic Department of Psychiatry, University College and Middlesex 3Dept of Psychiatry, Erasme Hospita, Univerit of Brussels (ULS), Beigium School of Medicine, Riding House Street, London W1 P 7PN. In 1987, linkage to I1pI5 was found in a large Old Order Amish pedigree Favoured loci for a schizophrenia susceptibility allele were studied by segregating bipolar disorder (BP). This finding, howver, has not been linkage with DNA markers In families with multiple cases of schizophrenia. confirmed in other families with BP. Unkage to Xq27-q28 was observed in A report of a cytogenetic abnormality linked to schizophrenia and the some, but not all, families without male to male transmission of BP. The localisations of the genes for the dopamine (D2) receptor and tyrosinase recent development of highly polymorphic microsatelite marke will enable to the long arm of chromosome 11 have suggested that susceptibility loci the search forgenes predisposingto BP and other related affective disorders. for schizophrenia might be situated in this region. Cosegregation has been Further, sequence variations affecting protein structure or expression reported In other families between Marfan syndrome and schizophrenia (VAPSE) have been described which can be identified by PCR-based and this were investigated by linkage with DNA markers at the Marfan methodology. VAPSE's will commonly be of physiological importance since locus on chromosome 15. Lastly reports of linkage near the telomere on they occur in functionally important regions of genes. At this moment, we are chromosome 22 prompted us to search for linkage at these genomic investigating two families with BP which are not linked to I1pI5. The regions. We failed to find evidence of linkage on regions of chromosome pedigrees comprise 65 individuals of which 29 patients suffering from BP or 1 1 q and 1 5q under a wide range of disease models for schizophrenia and related phenotypes. In each family, the BP spectrum diagnoses show an reiated disorders. autosomal dominant inheritance. Using age-dependent penetrances, different definitions of the affective phenotype and diagnostic stability scores weighing the stability of each BP phenotype, we tested linkage with microsatellites on chromosomes9, 11, 18, 19 and 21, including candidate genes such as the dopamine receptor genes. In addition, we examined a VAPSE in the dopamine D, receptor gene.

991 992 A conserved linkage group between human 16p13 and mouse chromosome 16. Genetic synteny of proximal Xq regions, including X-linked severe combined $(Z.M. Deng', M.T. Davisso, K. Johnson', D.F. Callen3, M.J. Sicilino'.)) immunodeficiency (SCID), in dog and man. ((S.M. Deschmnesl, J.M. Puck1l3, University ofTexas M.D. Anderson CancerCtr., Houston, TX. 2The Jackson Lab, A. Dutra3, R.L Somberg2, P.J. Felsburg2, and P.S. Henthom2.)) University of Bar Harbor, ME. 'Adelaie Children's Hospital, Adelaide, Australia PA Schools of Medidne1 and Veterinary Medicine2 and Children's Hospital of Philadelphia3, Phila., PA. The ientification of homologes between human and mouse chromosomes is essential for understanding chro l evolution and the development of Humans affected with SCIDX1 mutations have failure to thrive and experimental modelsforhuman disease. A homologowsegment between human persistent, severe infections due to profound defects in both T-cell and B-cell chl6p and mouse chl6 was Wnfed with the mapping of protanine (PRM1 and immune function. A unique, spontaneous, canine X-linked SCID has similar Here, the homology is expanded to a conserved clinical and immunological features. We have now found, using somatic cell PRAW loci to those two regions. hybrid analysis and methyiation differences in the androgen receptor (AR) linkage group by the comparative mapping of three additional markers (NOPA gene, that female dogs carrying SCID have the same lymphocyte-limited GSPT1 and AMYHl). NOP3Is a subdone of D16S237t GSPT1 a gene involved skewed X inactivation patterns as human SCIDXI carriers, further suggesting In the regulation of Gi to S phase transition; and M11 a human smooth that mutations in the same gene produce both disorders. For goneic analysis muscle myosin heavy chain gne Isolated by positional cloning of the p-arm of canine SCID, polymorphic markers were developed from genes iocated in inversion 16 breakpoint asso d with acute myeiomonocytic leukemia at the proximal Xq nea human SCIDX1. Canine genomic phage clos hybrdizing 16p13.12-13 reglon. Using a pnew of human-mouse hybrids that are informative to human choroideremia (CHM) and phosphoglycerate kinase (PGK1) for diferent portions of human 16, we have established the following order on sequences and to a poly-AC probe were subcloned and found to contain human 16p: telomere-NOP3-(PRM1, -2, GSPT1)-MfYH11--centromere. The poly-TG polymorphisms informative in the canine SCID colony. These plus a additional markers were assigned to the mouse chromosome 18 by a mouse polymorphic CAG repeat in canine AR were used to genotype >45 dogs Chinese hamster somatic cell hybrid panel informative for mouse chromosomes. informative for SCID. No recombination between any of the lod, SCID, AR, BAccryo linkage analysi indicated the following oder in mows: telomere- PGKI, or CHM, was observed; in contrast, canine SCID and DMD are 22cM Myhll-Guptl--Pml-NtpS--cr romere. This establishes a new conserved apart. Fluorescencein st hybridization mapped PGK1 and CHM to canine linkage group consisting of at at 5M in human and 20cM In mouse. Defining Xq13 and Xq21.1 respectively, identical to their map position on human X the extent of this linkage conservation ha signifiant biomedical mplatons These data provide direct genetic evidence that the dog and human X since that region of mouse genome contains the Sdd mutation and the human chromosomes are syntenic In proximal Xq and that mutations in the same cause canine and human SCID. The cloning of the canine homolog for 16p13 contains gens that are Involved in DNA repaiir, ceoi cycle regulation, gene - resistance as well as certain of human leukemia and other human SCIDX1, now identified as the gene for the Interleukin-2 receptor mulidrug types chain, IL2RG, will make it possible to study the role of IL2RG In lymphocyte disases such as Rubinstein-Taybi Syndrome an Tuberous Sclerosis. development and pilot strategies for gene therapy for human X-linksd SCID.

993 994 A NEW FORM OF X-LINKED HYPOPHOSPHATEMIC RICKETS WITH Set of short tandem repeat p orphisms for whole ge Fm linkage HYPERCALCIURIA (HPDR 11) MAPS IN THE XP11 REGION. screening. ((J. Dubov ', V. l, K. Buetow', G. Duy, J. Murray and ((M.Dovoto*A, A.Bollno, G.Enia, C.Zoccallo, G.Romooe)) J. L Weber'.)) 'M d Mediscal-Research Foudation, AMarsId, Wl; 'LabMolecular Genetics, Institute GGoasIlni, Genova, Italy; AColurnbI5 wa, Fox C University, Now York; Divisions dl Noerologla-CNR, Regglo Calabria, rty of Iowa City, IA; ChaCancr r, Phielphl PA; Italy. 'Harvard Medical School, Boston, MA. The X-linked dominant hypophosphatemic rickets (HPDR l) is characterized by low serum level of phosphate, hyperphosphaturia, abnormal vitamin D metabolism, and The recent devepn Of d of highiy inf ative short tanda rickets/osteomalacia. The gene has beers localized in Xp22.2-p22.1 region by linkage repeat polym (STRPs) along with coresponding nkage map ha analysis between DXS43 and DXS41. The mouse equivalent of the human mng of hypophosphatemia, the Hyp phenotype, segregates as an X-linked dominant trait and drrnatcly Improved the efficiency of initial age genes has a map position equivalent to HPDR 1. responsble hfordisease. Formimal effctvein in globalgWnome screening, A second X-linked hypophosphatemic gene, named Gy, has been identitied which well aacterized subsets of STRIPS which ar especially ihnfmativ, evenly maps closely linked to Hyp. In addition to rickets and hypophosphatemia the Gyro postioned alng the linkage maps, and easy to analyze ar needed. Our mouse is characterized by hypercalciuria. normal vitamin D metabolism, and circling current whole genome screning set of STRP contsain 368 maricra with an behaviour. The X-linked human equivalent of the Gyro mouse has not been yet average sex-equal spacing of 11 cM. Number of markers per crmoswome identiled. In an Italian tour generation pedigree a new form of X-linked recessive c hypophosphatemic rickets (HPDR 11) homologous to the Gyro phenotype is present in range from 29 on rosome 1 to 8 on chromoo e22. 94.8% of the 6 affected males who show hypophosphatemia. hypercalciuria. and normal vitamin D markes edinuclotide STRPs, and 4.9%arettranuclooide STRPs Averge metabolism. hetarozygosity of the current set Of Markers Is 76.4 ± 2.1%. In order to demonstrate that HPDR and HPDR 11 are caused by mutations in two The screening sets are being cninuly u As the numbers of different genes on the X chromosome. we have performed two point and muliipoint available markers increase, reater attention Is being paid to marke aty In linkage analysis between HPDR It and 7 RFLPs from the HPDR region. The whole of round f on rate region between 16D/E and DXS92 can be excluded with lod scores of less than -2, tms amplification strength, ent, low n aNd including the interval between DXS43 and DXS274 where HPDR has been mapped smrpiyIn scoring. Because ofgreatiyreduced tslippage, Itetr clecide. (Econs et al; J Clin Endocrinol Metab 75:201-206,1992). STRPs are generally easier to score than dinucleotde STRPs. Hulndre Of Two point and mullipoint linkage analysis with markers from other regions of the X new teanucltde STRPs de ped wiin the Coopertie Humn Linkage chromosome allowed us to exclude 11 intervals with signilicant lod scores of less than Center (CHLC) are being incorporated it the s n e CmbinationrS -2. Positive but not significant lod scores have been obtained in the interval of 6 cM of 34 markers within the screening sets which can be sImultaneously amplfied between SYP and DXS1 in the Xpi1 .22.ql 1.2 region using traditional RFLPs. In order are a subset of to increase the informativity of markers in this candidate region we analyzed the and facinoned by ectophoreis being identified, along with segregation in the same pedigree of 8 microsatelitie sequences (Wessnbach et al; about 100 more widely spaced markers which can be used hrstpsssin screens. Nature 359: 794-801. 1992 and unpublished). The microsatellite marker AFM119 xdS The screening ets wi ass tos choosing Ime forcoup"ntous yields a significant lod score value of 2 which assigns the new gene HPDR 11 to an dyes and mor genrafly those planning new linkage poects. interval of 5% of recombination traction around the same. Linkage Mapping and Polymorphisms (continued) 995 996 Mapping cloned sequences in the mouse by SSCP analysis of RI strains and Hlrschsprung disems mapping of a domInant gene closely lInked te the itrpcfccrosse.RE ((H. Dushkinl, D. TobinI, D.J. Sussman2, and D.R. Beierl.)) sontepoialogamochoooeO.(PEdrSth 'Genetics Division, Brigham and Women's Hospital, Harvard Medical School, LontRynET.lou AonlMblMeproxmal~ errlogArm.PitPofWchromosom.FnofC10C(.~olFktJi Ed~eksy, J. Boston, MA; 2W. Aiton Jones Cell Science Center, Lake Placid, NY. Welssenbach3, A. Miunnich.)) Dept de P6dlatrloeat Unlt6 INSERM U 12. We have utilized analysis of single-stranded conformation polymorphisms HV e rineMlds Pal. WU INSRM U 194, puts, 2.UnIv. of (SSCP's) as a mesns of identifying polymorphisms between inbred strains Westemn Ontario, London, Ontarbo, Canada and 3G6n~fton, Prance. and between mouse species. By analyzing regions that are potentially loes subject to sequence conservation (i.e., intron and 3' untranslated regions), we have found that SSCP analysis is a relatively efficient means of detecting HrcarnHl ugdsae(SR~es HC)isafeunfein ogntldarecaatdeogntldsre ahie polymorphisms, with a frequency comparable to that found for microsatellite by the abeence of paayp theti ntrinsicgangllon cell of the h~ndgut (1 In repeat sequences (40% of tested sequences are polymorphic between inbred 0 nwos)Rentwehv cazda9nofrHCbtenld strains and 85% are polymorphic between mouse species). This technique can be readily used to determine the strain distribution pattemn (SDP) in an RI 5IS000D028adDOlS(.Loweanewb IOms).Recenlywe9 haettaNtralocNatuzedaGenetiforeeisHICnps)betweenoc series or interspecific cross, and is a simple and rapid means to obtain a map Thereafter, 4 novel polymorphic DNA markers have bean mapped to this position for cloned sequences. We have mapped over 50 loci using this Interval. The stud of 16 independent HSCR kindreds originating from strategy, and are now employing this approach to generate additional markers by mapping expressed sequences from a tissue-specific cDNA libraries. By Westemn Europe (54 affected Individuals) showed maximumn palrwlse lod characterizing the expression patterns of these clones in various tissues, we score of 6.39 at 0-0% with mifcrosate111te sTCL-2, allowing the paeetOf hope to more efficiently correlate mapped genes with candidate mutations based on phenotypes. Since it may be feasible to identify polymorphisms inteHCthHCRgnat(rcoeo)heETlusmuipntodsre75.oea o ls o h E a mlpitldsoo75) almost any cloned locus, SSCP analysis can serve to complement the on- Genetic heterogeneity could not be detected, especially when HSCR families going characterization of the mouse genome by facilitating the high-resolution were split into 2 groupe. according to the length of the segment. mapping of regions for which polymorphic microsatellite markers have not aganllonlo been obtained. We have used this approach (in collaboration with G. Duyk) to These results allow to refine the loCaization of ths gene on the proximal long generate a detailed map of the distal region of mouse chromosome 4, in arm of chromosome 10 (IlOq 112) and to establish close Enkage to the RET which synteny is conserved with human chromosome Ip. Additionally, this locus. Both physical and analyses towards the approach is especially 5uited to testing linkage of candidate genes to specific appmoches candikdat gene mutations in an appropriate cross. identification of the HSCR gene are currently under process.

997 998 The gene for Machado-Joseph disema map to human chromosome 14q. Partitioning the differences between male and femnale map distances In ((IK Endo', H. TWsks' Y. Tadyams', M. NhzwaS. Kaweahlms', H. Salkamoto, Y. human gene mapping. ((Cathy S.J. Fann, Jurg Ott.)) University of lowe, KmaWue' H. Shimzeld' M. Soulome', M. Voehidae, T. Vuses' V. Horikawa. K. Oyvi, lowe City, and Columbia University, New York. H. Nagal. T. Kondo'. M. Segawa' V. NomweO E. Voehda', N. Sakural"o, T. huniaW, 0. Onodra, S. Te#' )) 'Dept of Neuo". 'Dep of Neuropeit, Brain PAW kiL, Nilgala univ.. NMOatW Jape. 'Dep of Neual.. Jic Med. School, Tochlgi, .iape. a3pt ofo a fi1ld(fn+Iloi( nevl)nevassvrlhpteeeerlhptee o e Neural., Facult of Med., Toky Med. aid Dent Univ., Tokyo, Japm. 'Dept of Neoci., differences btenmale and femnale map distances are generally Shlfwakuen Hoep.. Monkss Jepan. 00ept of Neual., Sufber Hoep., NigaWe Jepe. 'Dept. distinguished: H6:R1-R1~- 1 (equal male and female recombination rates); JW.% for R (fixed ratio R In each Interval) and 0 ratio in 'DepNci. NeuaL, Tota MmWHeodHe., . KesuaaJp."Dp.oga. Japan. "Dept Neura,srL Fault*ocis H:R1-RN1- H2:R F1 (different Med.XoNagroya ni Naoya, Mod, Neq~~~~a UnW., Nq)Wa. each interval), where N, Is the ratio of femaele to male map distance In the JW~~~~~n.I-h interval. This Paamnetrization Is unsatisfactory In that H, vs. Ho Machdo-Jsephdlsesm (MID) is an aulosomal dominst mlIsyte, involves only one df, but H2 differs from H, by n-I df. The objec Is to neurodegenerative dhsorder invovirg predominantly cerebellar. pyramidal, partition the n-fI df between H2 and H,. extrPraid. motor neuron arid oculomoto sydteml. Although lt was first With x1 being the map position at the midpoint of the /-th Interval, we reported In famliee of PotgieAorea descent, D ha Wmbe es bI assume R C+cxcx cx5+..an ditgusaseeceo in non-Azoree familiss from varicue countries, being one of the modt comrmonC +2q+A+.,additnus euneo where the of the to isrditry plncerbelaregeeraion.. Pevius ffotsmto mpap Ote gne or AJDhypotheses G." G, specifies highest degree polynomial havm aldtphowsignbicant PrevioaseffWrtsh devefopeWd be s. Each test of G, vs. G,+ I has one df, and all df's of H2 vs. H0 can be 'ncimlmill' DNAIJ p RmRPIji we pelno detlle gewf linkge an.a9y partitioned into single dfs. Go versusG., teats whether an overall deviation on 36 members of 6 families including 14 affecte individuale mainl from, NlIigft from R -1 exists, G, versus G0 teats for a linear trend In R, G2 versus G, prFecueJpa.We have found a aignifficantly high lod acores to aevere tests for a quadratic trend, etc. mtolraelltlee on the chroooe14q (014842, D14S43. 014853, 014555, A maximization algorithm (Powell method) wee used to estimate the D14848, 014845. D14851). The UNKMAP (UNKAGE) poogiar was Lodt different orders of the polynomial, at the lowest order. A the starting shaHl calculate lod acore for varbios locationis of MD gene relaitive to fixed positionis. pormwswitn hc ssteCA rga salklho The highest Wo cacre of 3.614 wae obtained at 2.2 centI oga(OfMo) cnprogr amcu wasinwrouitten, whaiich usesthe CMAP programen asda likelaihoo to D14855. Abeence of recombinetion events involvng D14S48dD14S55 ari Onacltn otn.O natfca dt e ihsvnlc n udai presence of ik~age dise quilbriurm at DI14848 J~te sup h lclmo of th relationship between N and xi, our procedure correctly Identifies absence MJDWmgn. Since iusierecbtination events were obresved retween toe WDu of linear and cubic terms and prmsnce of quadratic term. locus anid DI14853, and bestween the MD locus and DI14S45, the gen for tie MJD is located In the region of 29.1 cWo from DI14853 and DI14S45.

999 1000 4q3 DNA resrngements detected by probe pl3E-1 I in the affected Filling In the gape of the genetic map of human chromesome 21 subjects oftl5 Italian families with FaciecPulanramuascular by Alu-CAIGT PCR of YAC centigs. ((J. J. Fuentes, A. Bosch & X. dyurph.((L.Fdicetti, S.Cacurri, Ofleidda, N.Piamz, ILas Ceaaand Estivill)) Molecular Genetics Dpt. I.R.O. Hospltal Duran Reynais, Barcelona. P.Gmisanti)) Institute ofCell Biolog, CNRRotn, Italy. Facoecpuolaierlmuiscular dystrophy (FSHMD) is a deeeaieThe genetic map of human chromosome 21 (HC21) has been vastly disemse Ofn clswhich affects specic Mauscular. districts and diisplays a improved during the las few years, but several gaps exist in some regions of great Variety of phenotpi epaun._ The FSMDM locus has been the chromosome, with few highly informative markers available. To mappeid by knkag analysi to the 4q35 region ofthe haita lioOi accomplish the saturation of the HC21 map, markers could be deveioped 4. Recently a probse pl3E-I1I (D4S810) has been aiimn to detect DNA from YAC contigs of these regions. We have analyzed 6 YAC clones (814C1, reaWrang~mjents in the affected sabjecta ofboth sporadic and Suitd caes 232C7, 760H5, 860G3, 574CS and 850C6) from the CEPH HC21 YAC panel We hawe analyzed Eco-RI resticted DNA saniples derived frmafc from the 21q22.1 region. 4 independent Alu-CN/GT PCR were perored: and uuaffected nielithersP- of IS1 Italian FSHMD fainihes- by Soutithil 5'Alu-CA. 5'Alu-GT, TAlu-CA and 3ANu-GT. For each PCR several bands b~lotting and hbizaonwith P32-labeled pl3E-11. 4q35 rearranged weeobtained (S on avrge.PR pout eesbindit ecit fiRSgment in the range 14 to 28 kb wlr searhed fo, wihteamo Primers contained restriction site tails for specific suboloning Into SaA (Alu) identi g abnorial finents eg- with tie disease. In ailo and Nod (CA/GT), allowing sequencing from the CAIGT repeat regions in SO% of t aiies, shottened famets in dteh e 14 to 23 each subcione. Combinations of pairs of primers from opposite sequences detected which ae tgly associated with the diseas an we abdeit in produced PCR products in about 50% of cases, which avoided furthe noumal dimduas. Iin the reniiming fauithes fraunta ranging in other and 28 were with one . suboloning and sequencing of these CA/GT repeat regions. For the between 23 kb obesn~ed, only cansehiowinig a a second PCR was out using the two Alu and a primer fragment larger than 28kb. In one famly (FSH 03) the diseas sen t ciones carried prim with kb fraent. 3-B is but flanking the repeat. Complex and simple CANGT repeats were obtained. The bye associated a*26 Subject affected, d isolation of these new markers allows the characterization of the YAC clones not allow the rearranged fragmenti suggesfting a -prongins n from the point of view of chimaerism, the ordering of the contig by YAC occur between probe p13E-I1 and the dase locus, Ina the fatiiies fingerprinting and the physical mapping using pulsed field gel sue the is n correlatio bm the s fthe rearranged and the diease phenotpe. electrophois. Linkage Mapping and Polymorphisms (continued) 1001 1002 Saturation cloning of Short Tandem Repeat Sequences: Towards developing An X-.Hnked locus with a peoyeof hypohidrotio ectodermal d~ysplasla comprehensive screening sets for new diseases associated with trinucleotide and immunodefiolency with hyerlM; apparently distinct from both the repeat expansion. ((J. M. Gastier. J. Pulido, T. Brody, and G. M. Duyk.)) EDA and HIGMI Woc. ((lJ. Gal.2S. Orlow. 3L Schneider. 3R. Fuleihn, Department of Genetics/HHMI, Harvard Medical School. Boston, MA. 4B. Pober. IM. Jones, I M. Utt. and IJ. Zonana.)) 1) Oregon Health Sciences Univ., Portland; 2) York York; Boston Short tandem repeat (STR) sequences serve as the basis for thte construction Cide' A New Univ.. New 3) of high resolution genetic maps. Rapid expansion of trinucleotide repeats has optl )Dp fGntcYl nvNwHvn T been determined to be the underlying mechanisms for several genetic diseases Hypohidrotic ectodermal dysplasia (EDA) maps to Xql2.q13.1, and and RIt s likely that this mechanism will be associated with other hereditary knmunodeficiency with hyper IgM (HIGMI) locus to Xq26, with no clear diseases. Our group has developed efficient methods for near complete evidence for a second X chromosome locs In either disorder. Recently, ascertainment of each class of STRs. This method, termed marker selection. abnormalities of the CD40 lgand have been demonstrated In multIple has allowed us to analyze STRs from eight of the ten classes of trinucleotide patients with HIGMI. We have studied two families, each with a pair of repeats. For each of these classes we have been able to determine their affected sons having the same mother but two different fathrs, with frequency reprpsentation within the genome, the extent of their association with hypohldrosis, hypodontia, and hypotrichosis. They also had an Alu elements, and their utility as genetic markers. We are attempting to immunodeficlency with a deficiency of in~munolbn excep for elevated assemble large sets of STSs based on tninucleotide ciasses associated with levels of 1gM. The segregation of alleles frm23 polmophic marker loci disease genes. For example, we have sequenced 300 [CAG~n (repeat spanning the X-chromosome were analyzed in both sets of brot~hers, with associated with Myotonic Dystrophy. Huntingtons Disease and Kennedys partlcuiar emphasis on markers at or near fth EDA and HIGM1 loci. In Syndrome) with the goal of developing 100 STSs. Each of these STSs will be family EDA 1136. the brothers had discordant alleles at multIple loci mapped at least to the level of an individual chromosome, and its association exedn rmX2.2(XS7 oX~. D52,icudnth with a transcribed sequence will be tested by RT-PCR. The average size of the exedXS73 lrous Infamil EDAS1082 disordant. allels7)weredetectheda [CAG~n repeat is nm5-7. Most of the trinucleotide repeat markers are not highly both3thecHPRP and CDmiO EgAnd08lo scioq)dand studies ofr CDtectedatd polymorphic. In an early sampling of the [CAG~n class 60%/1 have one allele, expesioinhte T i of4 theaffctd maleswerean normal. NofC4mlecuar 30% have 2 alleles, and 10% have 4 alleles. DNA's from small families affected delpetions werteobseeled In etherafamidmly. Therefnorei the muttons in by diseases with unusual pattemns of phenotypic expression will be tested for bolthailiesaereobseredic nthedsrerfaisycauedefbyeafthmutationatalou trinucleotide repeat expansion. These sets of trinucleotide based STSs should distincfromile aeither theEdAordeHIGs lauedb and has pheotypeata provide a resources for the construction of genetic maps as well as specific loci ovelapingtfrmthateroduced sepaoratl by mutaion atdthese led Thenmostyp for disease gene searches. Ascertainment of a large number of repeats will also likelyoatpiongnfrtifo lrodthis lcsIcusIseiartherybihrinteX2.-25oInutheonaXq s.q25TorX mos2.te provide important resources for determining the mechanism of repeat riegi ons. q82qe expansion. rgos

1003 1004 Llmkageiapplageofaerpmprata etoeIprefitelMadsereee lmlamprtrLinkage end Crossover Analysis in Tuberous Sclerosis (TSC) (C.R.. preta. gtes. [[J We ma' s K .2~ AJ Pakstie, s A~mmr3 ad KK Kiddjj Gilbert', 1.5. Kandt2, F. Lemnon', R.J.N. Gardner3, A.D. Rosesi, Nt.A. 'West Haven DVAMC; Psychiatry 116A; Weet Haven, CT'; 'Yale University School Pericak-Vance1)) 'Duke University Medical Center, Durham, MC; aVake Forest of of Medicine, New Haven, CT'; 'Vollum Institute, Orgo Heabth Sce sUnvriy New Zealand.University, Vinston-Salem, MC; 'University Otago, Dunedin, Portland, OR Tuberous Sclerosis is a heterogeneous disorder with confirmed loci Abnorimslities in seotonergic and n %oradergic neurotrsansuission have been on chromosomes 9 end 16. Ve have analysed 16 multiganeration TSC implcatein athohysilog ofafciedarershzprnapanic iodrn families for linkage end homogeneity. The peak ch9 score (We)) othr pychatrc dsoder.Nrepneprie tansortr poten NET alowsnarnawas 1.03 at 0 - 0.30 for D9S64; for a 7.93 at e 0.10 for D16S283. Admixture analysis of the twochi6,pointsCO)lod scores gave to retrieve norepinpriethat has benreleased into a synapse; scrtonin trnsporter significant evidence for heterogeneity for the markers, D16S283 protein (HSI) seavesthesaoe function forserotonin. (Both aronouninetrasaporter (p40.001), D16S281 (P40.001) and D9S64 (p40.001). A combined ch9 and Proteins and both have been cloned recenly.) NET and HST are sites of action for chl6 test for heterogeneity supported the two point findings with se~veraldrugswithCNSeffects,includingboththerapeuticagents(e~g.antidpeats odds >58,000:1 supporting linkage end heterogeneity over and drugs of abuse (e.g. cocaine). NET was previously unmapped. For we homogeneity. 701 of families were estimated to be chl6 linked with NET, ramainder being ch9. There was no evidence in our data idenifididentflednRFLusingcDN~robeandmspedtegmeochrooaoml~bysupportinganRFL usigacDN proe, nd mppe th gm o r nooe 1 bythe the existence of a third locus. Analysis of crossover linksgeanalyskI.nCEPH, Z,.-9.2withDI6S65(e00.04)(usingLIPED);NEfthus data identified 4 key crossovers in affected individuals, one in a maps near I6q21 flanked by Dl6S71 (cetoeicaly) and D16S65 (telomerically). chl6 linked family and one in a ch9 family. The chl6 crossover HIST had previously been physically mappedto chomosome 17 (Ramamnoth et al., individual showed 1D16S283-D165281 1 M0 ITSC-D16585-D165841, thus 1993). For HST, we used a PCR product correspondfing to the 3' utaslated region defining D16S281 as the closest known proximal flanking marker to ofthegeneas aprobeto identifyan RFLP, which we then usedto map HST closeto TSC on chl6. For ch9 the following crossover was detected, D17S58 and D17S73 between those two marker on l(ASS-D9S64-ABO-DBHt) 10 This single (Z,,.-16.1 multipoint:analysis (b event defines DBH(TSC-D9S10/D9S66/D9s1l4)1.as the most proximal flranking marker to L1NKAP)LR&MP) sinuingfrmdatromata twwo nn-CPHno.CEP etenddextnde kinred),Wne&),confmingthecrossovercnfimingtheTSC on ch9. Two crosses in affected siblings have caome to light in previous mepping. These data should be useful for linkage studies ofneroechiatric supposed ch9-linked family that exclude the entire candidate region. disorders; for example, we have, so fa, excluded close linkag between bipolar, Similar data has been observed in myotonic dystrophy (Taylor et al, afiectve disorder and NET'. ASHO, 1993) and Huntington Disease (Pritchard at al, 1992), both Spoted2 in part by NIMH SDA-C grant MH00931 to .ro an the VA National disorders are defined by trinucleotide repeat mutations. Ve have 4 new families under investigation. These results as CAN$fbrin,PrSD,SchizphreniaPTSD,CentersandurAlcohlismanResearch.presentlyAlcoholsm archwell as detailed data on crossover individuals will be presented.

1005 1006 The human %-aminobutyric acid receptor subunit p3 and a5 TWO-LOCUS MODELS OF DISEASE: COMPARISON OF ULIKELIHOOD AND gene cluster is rich in highly polymorphic (CA)n repeats. NON-PARAMETRIC UNKAGE METHODS. LR. Goldin and D.E. Weks, K. Glattt, D. Sinnett"2, M. Lalande1*2 . Genetics Clinical Division, Children's Hospital, 2Department of Pediatrics, NeWuo Branch, NIMH, Bethesda Md, Universiy Poitsbur Harvard Medical School, Howard Hughes Medical Pittburgh, PA Institute, Boston NA. For be ra disorders and otr complex diseae, more than one We are constructing a physical map at the GABJA disease locus is needed to account for family, twin, and popon dat. receptor P3 (GABRB3) and aS (GABRAS) subunit gene cluster Given a nearly complete genetic marker map, it Is worth deterining If disee in chromosome l5qllql3. This region has been found to lod can contain several chromoomal rearrangement breakpoints sustibty be detected using linkage analysis. Pedigree daft for from Angelman Syndrone patients. In screening 135 kb seral two-locus epistatc and heterog models were simulated, with one within a 260 kb interval extending from within GABRB3 to of the bd linked to a marker locus. Replicat samples of 20 pedigrees (16 the 5'end of GABRAS, 10 new (CA)n repeats have been individue/pedigree) were sim d and then ascer for having at eat identified. Five of these have been analyzed in detail 6 affected individuals. The power to dect e for Ikelihood and nonr and found to be highly polymorphic, with polymorphism peamtrC [(Haseman.ElStOn (H-E). Affected-S-Pair (ASP), and MActed- information content (PIC) ranging from 0.7 to 0.9s and methods were compared on the simulated data. with heterozygosities of 70% to more than 90%. In the Pedigree-Member (APM)] GABRB3/GABRA5 region, therefore, the frequency of (CA)n The power of linkage detection caiuated under the correct two-locus model with PICs >0.7 is at least 1 per 25-30 kb. Previous was only slightly higher than under a single lou model with reduced estimates of the density of (CA)n with PICa above 0.7 in Pener . The non-parametric method had lww power ta the led score the human genome have boen approximately 10-fold lower. metod, even though the led criterion was corrected to take into account The GABRB3/GABRA5 region appears, therefore, to be multiple analyses. The HWE method uses data on both affecteds and enriched for highly informative (CA)n. This met of unads and had the higst power among the onparaetric methods. closely-spaced and short tandem repeat polymorphisms will The of the was than the be useful in the molecular analysis of Prader-Willi and power APM method lower other nmetod, largely due Angelman syndroms and in high resolution studies of to the fac th marker genopes from unaffected individuals are not used. genetic recombination within this region. For many mapping studies, the sinje locus led score will be the most practical anayi method given it's power relative to other methods. None- theless, sbi- methods provides a fast way to scrn marker Woc. especally to avoid ca i ld score under a M number of genetic hypo . Linkage Mapping and Polymorphisms (continued) 1007 1008 REESIE MITl19 PI -N FXCLUIONIS OF THE GENE EQB solon of (CA)t repeat ad chariaeaio of the pbeuienmr region of 15q. (L Guide ', P.K Ro , C vat, S. Schwar', R.D. Nholls".)) Uni. Of nuiussR.(1). Baye M.(1), 8 (1). GSlnb) D.(l), ViaglU.(l), M-artn L(1). Pen vaSootLn., H"e y; Univ. Pitsbu¢r, PA; Cm WeOrn ithay 8.(5), Ayuao C.(3), Benflts J.(3), Ramos MA (4) Solars T.(2), del Rio E.(2) wad Florida,Gainevll& BalgetM.(2) Reseve Univ., Cleveland, OH'. (1) D0partunsat de GenteciUnlv. di Bacilona (2) op de Is Sot Cru I Sant Pau. uSelonat; (3) Fund. Jbnp nszF Diaz, Mad Spain;(4) Hioplid Virgin del Cinino, Piplons. Spin and (5)lnls of OpCiu ,lly. London, U.K. The peientmic region of dchroosom 15 has an unuul chromosomai constiion, as k cioc polymorphi, anddspaysap d meotcchiaum which isnot usuy Retiniis pigento (RP) is one of the wr causof heditary vliual piwnnt Sen tso the co ere of human chromosome. In aditon, d niaion of the and blindness in the western societies. Its molecular basis is poorly understood. J insitomy15asweilashiuniarerIal deorny (UPD)h Priner According to a lats survey coveting more than half of the Spanish area, the autosomal meiolicstageofnIsJunct recessive form of retinit pigmentosa accounts for th majority of the cases. We have WMi(PWS)andhgam (AS)syndrme depends onlowingt poslonof tn usd the candidate gins appoch to undertaks the search for the gene(s) responsible vnt nearto th cereoroere. The ci thighly polymorphic marerto the centromre is for ARRP. This technkqus consist in the study of genes lkwn to have a role in the atadiste eofabo 12cM (D15S 1, IR4Q3R; averagedfromtwosde), and uswe haw biochemistry of light aignal treneduction In the rod cols of the retina, either by linkage or mutation analysi. Ho goa mapping is another strategy specisily efficient for iod made from yeast artla chr lom (YAC) done A124A3 whch as D15S18 mapping genes causing c trats In cons ino pedigrees. It is bed in the (IR39d, the most proximal euchron maker known on 15q. fact ta in a chid with a receselve disem whose parents are related, a region of several Five cnes (83 nt - 183 nt hi langh) have bn isolated from A124A3 using PCR and AM centirnorgans on either d of the disease gene will nearly always ba horozyg by plus (CA), pfrmars. Onecdom ths a (TG),,(CA),2AA(CA)b repeatlfnked cloely by two descent. The b subunit of the cGMP phoephodistrase gene Is a good candidate to ba Mu the cau of the disem since a mutation in this gene results in retinal degeneration in the sequeres: PCR alis ofa smatic cell hybrid pnl using uiqu prim Oonfimred mous. a icalouition to chromsm 15. Another clns contais a (TG)," repea (wih atI of We have used four closely lned markers (048111, W4S127, D4WS5 and W4S227) 153nto Grron onesand). Wearecureny i cone sepwningtohr dd ofthed and studied 21 Spanish affectd families to perform linkage and honozigositY analyses. i the bter andtwoothercas. These marker e being uedforgn- The oll results allow us to exclude the PDEB gene in th majority of these ARRP (CA), repeat (CAL families. Therefore, we conclude that this gne is not the main locus responsible for the ceuromre mapping on a pan of ovarian atons own mmstc origin, and for disease and that it may account for no morethan 10% of the cas nondisucton analysis ma panel of 56 PWS UPD and G AS UPD pat. Ther are two pedigrees (B-4 and M-71) In which all markes studied show RFLPs for two pI repets (canes IR19 and C136) and othr 15qllq13 hr g and cosegregation with the deae. Mutation analysis in the PDEB gene of cd menbe these families is markers hve been isoed and analyzed for segregaon in 3 thre grtion pedigrees. d currently being parformed. Analy crosvers in 2 meroses ( paernal a aternal s) showd crosoves (n) betwn probes as folls: IR19 (a-Wt), WHY2(C136), IR39d -(1)- IR43R, 189.1, 34, 3-21-(3)R1O-1-(3)CMW-1-(5HR2g1-(8)-DP151 or MSI-14. olculr and FISH analys wih pericetroein clones are i progres.

1009 1010 A linkage study of affective disorder with DNA markers for the ABO- _Like disequIlbrim betus te ti m dsease matatim AKI-ORM linkage group near the Dopamine Beta Hydroxylase gene. ((H. ad the 8451o marker is prodce by as _u1sma VUU. ((R. Outridge, T. Vo, B. Withers, J. Haddad, and L. Carlock.)) Wayna Gurling, R. Sherrington, D. Curtis, J. Brynjolfsson, E. Moloney, L. Rifkin, state Univ., Detroit, mi. and H. Petursson.)) Academic Department of Psychiatry, University College and Middlesex School of Medicine, Riding House Street, London A nuaber of studils have shown that the 4p16 3 sarker D48180 WIP 7PN. contains a rare Sai allele in strong disequilibrlum with the Huntington diasase mutation. Since this diiequilbrium could be Data from a number of studies has provided weak evidence for a produced by a local l-ipecifi¢c iutation, we examined tha genomic susceptibility allele for affective disorder near to the ABO-AK1-ORM iegment enccapasiLng the D48180 polymorphlim. These studiei locus demonstrated that tne previously deicrined polymorphlc aite ia region on chromosome 3q34. The dopamine beta hydroxylase gene contained within a VMT which actually encoapasies two poly- is also at 9q34. Five multigenerational families with bipolar and unipolar morphic Saat aites separated by approximately 1 kb. Southern affective disorder were analysed for linkage with highly polymorphic blots identified a large number of allelsa at this locus with a microsatellite markers from the candidate region. The segregation of the subset of intarnal DasaH polymorphim. Sequence analysai est- illness in these families was compatible with an autosomal dominant ablished that the VNTa is composed of a S3bp core sequence, with susceptibility allele. Linkage analyses using conservative parameters the two polymorphic sites reptreenting rae point mutations in provided strong evidence against a major susceptibility allele in this the consensus sequence. axaminIng the Gen~ank database establish- ed that the 53bp core squence has significant homology to a region, which includes the candidate gene dopamine beta hydroxylase, number of rscombinagsnLc DIA sequences scattered throughout the in these families. genome, including the direct repeats found at the boundaries of a pusudogene duplication event in the -globln gen locus. The recent identification of the expanded trlnucleotlde repeat in the IT15 gene poaitiona this VNT within 300kb of the HD mutation and imdiately proximal to the 3' and of the IT1S gen. PCR analysis ia being used to determine if specific alleles in the VIR are associated with predisposition to expand the IT15 repeat, in a pattern analogous to the predilpoaition for expanded llleis in the myotonic dystrophy gsne on chrlmoeomea which contain an adja- cent insertion polymorphim (Mature Genetics, V4, pp72-76, 1993).

1011 1012 A secoad Wasrdesibrg Sy m ge chron oso 13q? L Handig', G. Mme peeaor probbilty of linklge ((ER. Haueer and M. Boehnlk)) Van Camp', M.N. Van Tienen', B. Van Roy', A. Read' and PJ. Willems'. Department of o a i, Uniesyof Michigan School of Public 'Dep. of Medical Genetics, University of Antwerp, Belgium. HeIU Ann Arbor. 21Dep. of Medical Genetics, University of Manchester, United Kingdom. Techniques for caiculating the posterir distribution of the recombination Waardenburg Syndrome (WS) is an autosomal dominant disorder with fracton, 8, previously have been de pd for autosornal traits. These sensorineural deafness and pigmentary dist es such as heterochromia methods use eiter an estimate of the prior deibution of 0 applicable to a irides, white skin patches, a white forelock and premature graying. WS has genorne search assuming randomlyplaced markers (Eleton and Lange 1975; been classified in tpe I and H on the basis of the presence or absence of Tal 1989) oran estimate based on fe number of autosomes (Ott 1991). We dystopia canthorum. Linkage analyis has localized a WS gene on the distal describe a Bayesian approach to calculate the posterior distibution of the part of chromosome 2q, and in some WSI and WS11 families, mutations have dlatance between atrat and a marker given the observed data using different been found in the human homologue of the Pax-3 paired box gene located in assumptions about the prior density of 0. We apply this approach to this region. However, there is significant genetic heterogeneity in WS with estimating the posterior probabilityof linkage fora trait and a candidate gene. some families of type I and type H not being linked to chromosome 2q. We compare the posterr probability of detecting linkage for different We report here a de novo interstitial deletion of chromosome 13 in a boy amounts of prior hifrmaton ranging from a prior which gives no additional with features of WSIL including unilateral segmental heterochromia of the wet to the location of the candidate gene (Elston and Lange 1975; iris, sensorineural deafess, and a linear skin depigmentation. The patient Edwards 1987; Renwick 190) to a prior which has very high probability at also has mild psychomotor retardation. There is no family history of WS or the location of t candidate genes. We analyze the critical value for mental retardation. These findings suggest that a second WS gene is located determining inkage in terms of posterr probabilitles and examine the prior in the deleted region on chromosome 13. Cytogenetic analysis using high probabilt required to give posterior pobits of (1-x) for a given evl of resolution GTBban defined the deleted region as 13q21-q32Z The patient e e for linkage. We have con ed analytically phase-known and and his parent were typed with hi informative microsatellite markers from phase-unknown double matings and discuss generalization of this this region, and the cytogenetic deletion was confirmed by the absence in the method to hlnas of multlgenratin p . We plan to extend patient of the paternal allele of marker-locus D13S144. Linkage analys using this approach to determining the posterior pbity of linke for several microsatellite markers spanning the deleted region of chromosome 13 is other situations icludig testing linkage to a known disease gene in the being performed now in WS families not linked to the WS locus on prsnce of genetic h n , X-linkage, or undeti a total chromosome Z autoomal gnme search. Linkage Mapping and Polymorphisms (continued) 1013 1014 Evidence for the existence of a fifth gene cawing Linkage of the 'purem recessive familial spastic paraplegia to familial hypertrophic cardiomyopathy. chromosome 8 markers and evidence of genetic iocus heterogeneity. ((C. Hns1en l. P. Charronl, JS _ 2, J. Welssenbach3, ((A. Hentati'4, M. A. Pescadc-Vance2, W-Y. Hung1, S. BelaP, N. Laing4, R. Ianad M. Komjd4, K. Swart1)). 1INSERM U127, 2CEPH, R. M. Boutanl2, F. Henta, M. Ben Hamlda3 and T. Siddlques.)) 31nadtut Paur4Gdn , 4Hopia PMSalprr, Pans, Fra . 1Northwestem Univ. Med School, Chicago, IL 2Duke Univ. Med. Center, Durham. NC., 1nstitut Naional de Neurologle, Tunis, Tunisia., 4Queen Familial hypertrophlc cardlomyopathy (FHC) is transmitted in an Elkzbeth 11 Med. Centre, Nedlands, Westem Australia. autosomal dominant fashion. Previously, mutations in the p-myosin heavy chain- (p.MHC) gene, encoded on chromosome 14q1, have Pure familial spastic paraplegia (FSP) is a common neurodegenerave been identffied and cause the disorder in approximately 20% of as an dominant or autosomal recessive families. Recently, loc on chromosome 1q3, ch ome 11p13- disease inherited autosomal q13, and on chromosome 15q2 have been Idented. (RFSP) trait. It Is the most common form of famlbWl spastic legia Methods Six families with typical FHC were examined using highly The primary defect and the chromosome location(s) of FSP is unknown. polymorphic microsatelite markers specifically recognizing and We analyzed DNA samples from 43 individuals (Including 16 affected covering the above mentioned ioci. Age-dependant penetrance was individuals) from 5 RFSP famIlies. These families fulfilled the diagnostic used for two-point (MLINK) and multipoint (LINKMAP) calculations. criteria of pure RFSR Microsalite markers were tested for inkage to the Results In two of these families the potential invovment of p-MHC RFSP locus. Significant lod scores (Z) for linkage were obtained with gene as wel as the chromosome 1 and 11 lci could be excluded. chromosome 8 markers D8S260 (Z-7.30 at 0.0.05), DSS166 (Zm5.12 at For one of these families the role of the chromosome 15 locus was 0.0.10), PLAT (Z-3.63 at 0.0.05) and D8S285 (Z3.40 at 0.0.10). also excluded. Markers D8S268, ANKi, D8S279 and D8S84 gave positive lod scores Concluslon In one family none of the markers identifying the four without reaching the significance for linkage. Cosegregatlon between the known loci cosegregated with the disease. These results therefore RFSP lous and chromosome 8 haplotypes was observed In 4 of the 5 imply evidence for the existence of a fifth locus causing the disease. families analyzed. One family did not show such cosegrion and gave FHC is thus genetically much more heterogeneous than previously negative lod scores with the markers tested. The test of heterogeneity tught. was positive In favor of both linkage (0.01< p < 0.001) and het (0.01< p < 0.001) with markers D8S166, D8S285, D08279 and D8S84. We thus conclude that the locus for the upure RFSP In 80% of the families maps to the pericentric region of chromosome 8.

1015 1016 Compue s a famies with Gill. de In Teurefte syndrm An index flage map for human chromosome 12. ((M. Holt, P. Kafalenos, D. Raines, B. Ellis, T. Stbru and H. DonisKeller.)) Washington Peor Heutin Des J.M. yam de Watern, Adrew J. Pikd', Roger Kud', Pal Unversity School of M De ent of Surgery, Division of Human Sandor, Eric J. Devoe, De A. Ootra', Lodewijt A. Sandilj'. Moleculr Genetics, St Louis, MO. 'D t. of aieal cased Dqeunt of Pychiy. hm Ualuiy R _asri, no Nushselm . Dsputmet mfH Osm Yal Uoiveray Mo of MYduid.i Now N1m, We are currently cpig cnstruction of as index linkage map of Cr. 'U aiu df Red SMod of Mics. mi Dwhoy, Roths, Nw Yk. X human ch s 12 Vt consists of markers with heteroygos of at Dswm of Pyeaty, UmiWy of Iw&., I lY. WW,6 USA s Dqmm_ of Pyciy. east 70%, intermarker spacing of no greater than 15 cM, and genotypic 11 Tomb }ospitm mi Udvqoky of Toato, C _. data gathered on the primary (40 family) CEPH pedigree resource. Our In a linkae stdy it is importut ha ascertain family mat powerl enough to deect preiminary map, consotucted using the program package CRI-MAP. a lin . h stical powr of th aained funfles cm be detrmined with ikxues 24 highly informative micbroateli markers. The sex-average slnlatlon shudies. Power caiculatlons for sdiml Mendelian diseases ws reladve map spans 201 cM and includes a telomere marker for 12p that was straightfo rd. For complex tais addiional genedc peramnetrs as reduced identified from a 900 kb YAC cione This YAC has also been localized to pane, pen es and vbke ersion of the phenotype bave to be take no the teiomere by FiSH analysis. Correlation's between the linkage and accout cylogetic maps have bee made using physically localized polymorphic Gilla de la Toure syndrome (GTS) Is a neurkc disorder by markers. chronic, harnilment meltiple motor and vocal tics the folow a and waning cus. During rcent years a misber of research groups ha staered lnkg shudis on GJS In a oolI ffoet to determine h dhomosoal l of de responsbbl gene(s). A large set of fmilies is available wIhin hs c Unil now h pwer of thes fanilies to det a lIhn was not systematical investigated. We repot here t resules of an extensive smmiaton shady perfordt e these fainlies. We conclude ta he available family materil is powerfol enough to det a linkage en in th cm of extive geneic heanalysis on the most powef famly revealed h iportance of clinical di ddefition of the phope. Furthr revealed tha for GS te 1tsting of mkltlp diagnostic modeInstead of usIng a narowy defined phenotype gives t best cces of detecin nag1e. The sinsation spadles ;Presnte her ae generally applicable for other conpiex disorders ad faclieats th planning of a lnkge sady and the Ierpretation of the results obtaind from such a study.

1017 1018 GENETIC LINKAGE ANALYSIS IN LATE ONSET ALZHEIER'S DISEASE. Use of Interval mapping for Identification of major genes Involved in bipolar ((H. Houldenl, R Crook2, F. Crawford2, NM Rossorl, J. Hady2 and M. Muiln2.)) disorder. ((C. lan1icola, L E. Bemard, S. Baharico, RF M. Myers and D. F. I ofBiochemisty and N robgy, St Marys Hospital Medical school, Cox.)) Depa of Genetics, School of Medicine, Stanord University, CA. London, UK. 2Depatent ofPsychiatry, UniversityofSouth Florida, Tampa, Florida. Intro. by: R Tanz. A sysmatic sarch for genes responsible for complex disords is now possible, since a genetic lBink map comprising highly polyopI DNA markers cowerin the entire genorme is currently available. In theory, by The etiology ofAlzbeimer's die (AD) is udoued diver although clinically using completely I bnf markers spaced at 20cM distances and and patlgically the disease is homogeneous. The only li causes of AD assuming an om dominant mode of ranmission, Interval mapping beig mntaons I the amyuoid pr s protein gene (APP) on ch ome 21. wi only four phase-nown meose would cize a disease gene within Recently a _mber of i studiesidentified a second locus on ch e 12% of the human genome with a 96% probability. In addition to pinpointing 14 that is tightly linked to most early onset families without a lesion at the APP ge. regions containing potential disease gene(s), this approach provides an The majority of cases of AD am of the late onset type. We have id i 1S efliclent method for detecting genetic heterogeneity within and between pede with at at 3 idiids with late onet AD. For affected individuals the families. We have used an Interval mapping approach to identify genomic NINCDS criteria ware used to diagnose posb, probable or definite AD, Intervals liy to contain genes predilposdng to bipolr disease. We used op acorm n in at least one affected indivual was avihb in 8 191 markers with an average heteozygosiy of 0.77 and an average Inter- ofthe IS fmil Utiliz geneic link ewe analed the iegregation ofa asmber marker distance of 19.6cMA to divide the genome into 169 Intervals. These of polmorpi (CAnrpe markes in our ate onset markers were used to genotype six inrmative meloses segregating for ighly pedigrees. Initially bipolar disease In a lrge Old Order Amish kindred. Assuming no genetic SSCA p med mxom 16 and 17 of the APP gom that excluded known heterogeneity within this indred, our results define Intervals comprising 1/3 mtations.Linkage analy with m rear(D21S210, D21S221 d D21S214) at the of the genome as the most likely location for a major bipolar gene in the Old APP locus pmduced significant exclusion, LOD <-2 ata reconbination frtion of Order Amish. Although this result is In agreement with theoretical >0.05. Analysis at the second AD lows with 4 makers (D14S48, D14S53, D14S43 expectations for markers with an average heter of 0.77, it and D14S77) also poduced sgnifica exclusion data LOD <-S at a recom_natko repes aS fold reduction in the power expeced with fuly Infrmative fration of >0.05. Si on stuies on comparative lpoec pedigrees markes Genetic maps of higher resolution including even more informative confiRmed that the APP gne d cn e 14 lo am not the caue of lte markers are therefore required to realize the theoretical power Inherent in onset AD. We ha as produced on at other candida genes incldi the the Interval mapping approach. Further tudies with additional families will IL-1 receptor complx Cuntly we am analy-ing the s of the Apo E be required to determine which, if any, of the genetic intervals Inclded in polymorphismin Our ate o pedigrees, as this lows has produced sigificant our study contain a major gene for bipolar disorder. association in anumber offamily set Linkage Mapping and Polymorphisms (continued) 1019 1020 aplotype analysis in oc tos pdigres evidence or a based camon haplaty and a gene location telomeric of NLA-A. High through-put fuoc techniques for linkage mapping. ((A.E. ((30 JaawLinka, SC Lee, WR Pyper, S1 Webb, NJ Iurt, 3W Balliday, Jedlicka, M. Kiser, R.C. Levitt)). Johns Hopkins Med. Inst. Baltimore, MD LW Powell)). Liver Unit, Queensland Institute of Medical The efficiency of linkage has Improved with the use of esearch, rilbane, Australia. (Intro, bys Dr 0 Chenevix- mapping dramatically Trench) PCR-based highly polymorphic simple sequence repea (SSR). The prospect of further substantial increeses in efficiency for linkag mapping, including Uemochrcmatosie (3C) is a ccmnon disorder in iron metaboliem automation by the application of fluorsIcence-based methods, has prompted inherited an an antoecl recessive trait. To refine the us to develop high methods for location of the gen on 6p we have examined four markers (ILA-A through-put linkage applications. Real time and thre dinucleotids repeats) all closely linked to the tl ge detection, greater sensitivity, and computerized data collection and analysis in 21 30 pdi , 62 unrelated 0 patients and 82 controls. of fluorescent products are desirable attributes. SSR markers were selected, The most lly order for these markers ist centrcmere- LA-A - or ollgos designed to produce PCR products (alleles) in 7-8 size ranges temed 100kb- 6pS5 -200kb- WA-V -

1021 1022 Linkage of Palmar-Plantar Hyperkeratosis to chromosome 1 2q in the region A simpl~fied method for amplification of polymorphic dinucleotde of the Type II keratin loci. ((V.E. Kimonis, S.J. Bale, 'J.J.DiGiovanna, J.G. repeats fro microdlesected mo ((J. F. Knops, J. Han, A. J. Compton.)) Laboratory of Skin Biology, NIAMS, 'Dermatology Branch, NCI, Carroll, and W. H. Finley.)) Univiversity of Alabama at Birmingham, NIH, Bethesda, MD. Birmingham, AbMsd Palmar-Plantar Hyperkeratosis (PPH) is a group of inherited disorders, The use of simple eqnc repe regions to detect polyopims in characterized by thickening of the epidermis of palms and soles. PPH is poptions has become inacrsingly popular in the field of genet We have clinically similar to epidermolytic hyperkeratosis (EH) of the palms and soles. developed a simpld method for amplification of polymorphic rep regions from as few as five to ten microdsrtedce. Co are which has characteristic histopathology. Since EH has been shown to be due lifted from to mutations in KRT1 (a type I keratin; 12q1l-q13) or KRT1O (a type 11 cygnt prepo and Pci ditl in PCR buffer complW keratin; 1 7q1 2-q21), the keratin loci w rer Nest primers with eaxernal primers employed in e frs round were obvious candidate genes for PPH of amplification and internal primers in a subsequent round, are used to as well. Studies in three families have shown linkage of epidermolytic increm the amount as wei as the specificity of the produact hyperkeratosis of the palms and soles to chr 1 7q and Implicated the type I We have successfully amplified and detected alleles from five diffnt keratin loci in disease etiology (Reis et al., 1992; Matsumura et al., 1993). dinuclotIde repat oi, DIS158, DIS103, D19S75, D19S49, and APOC2. We have Investigated a 3-generation family, with 10 living, available, affected Differnt t of specimen preparation as well as various age Wpreaations members. Histology in 2 affected individuals showed a thickened stratum have ben used. corneum without the histologic features of EH. Unkage studies using the This technique is currenty belng used to ascertai the paret of origin keratin 10 gene (KRT10), DI 7S579, and D1 7S800 allowed exclusion of this for Specific somatic rasoca s found in eukemias Parentl origin of de region, and thus the type I keratin gene complex. We then tested for linkage novo chromosomal rerrangeents in children with clinical abnormales to the type 11 keratin locus on chromosome 12q. While polymorphisms in could also be determined using this technique. Unkage analysis where KRT1 and the linked markers D12S14 and Dl 2S17 were uninformative, three cylogene preption are t only material avaiable might also be possible microsatellite markers in the region were highly informative. Maximum lod with this technique. scores with D12S8 were 1.9 at 8.o; with D12S96, 2-3.0, 8-0; with D1 2S103, 7 = 2.6, 9-0, support the hypothesis that a keratin locus in this region is etiologically involved in PPH in this family. Both keratin 1 and keratin 2 are candidate loci for this disease as they are the primary type 11 keratins expressed in palmar-plantar epidermis.

1023 1024 Gare linkage analysis of panic diorder ((JA. Knowles, V.J. Vieland, A.J. Localization of Krabbe disease gene (GALC) on chromosome Fyer, G. Heiman, H. Rasnk, LD. Fine, T.L Austin, P. Adams, S.E. 14 by multipoint linkage analysis. ((R.G. Knowlton, J. Hodge, D.F. Klein, J. Ott, M.M. Weiesman, and T.C. Gilliam.)) Columbia Zlotogora, D.A. Wenger and R. Oehlmann.)) Thomas UnIversityiNew York State P I nstitute, New York. Jefferson University, Philadelphia, PA. The gene responsible for Krabb- disease, an Panic disorder is charaterIzed by spontaneous and recumrrnt panic autoscual recessive disease caused by deficiency of attacks, oftn by afamlil loading, galactocerebrosidase (GALC), was mapped by multipoint conco e rales in twins, and transmisio pattema In famlies suggest a linkage analysis on chromosome 14. Eight mapped gweic org for the iess. We have gotyped up to 16 families in which dinucleotide repeat polymorphisms were tested for panic disorder Is segregatig, with ovwr 370 DNA markers. Over 50,000 linkage to GALC. Two-point linkage analysis go have bee on these families of and demonstrated close linkage of GALC and D14S48, with Zmax geneated (as May 1993) the - 13.7 at e of zero. Nultipoint analysis yielded strong data have been analyzed under both a dominant and a receesive model. support for this finding, with maximum likelihood for Roughly half of the markers have yIelded LOD swores < 2.20 for 0 2 0.01. GALC located within 1 cM of D14848. This analysis also One marker gave a LOD score of 2.6 at 9-0 with no evidence of genetic identified markers that clearly flank the GALC locus, as hetergen , when summd over 16 families. Mu" strategies were the map order of D14g53 - GALC - D14S45 is favored by used to d Ine if this was a false positive result, includin genoyig of odds greater than 10 1. Additional support for close si and g on a rww mi Oratet linkage of GALC and D14848 comes from the apparent flankdng markers, d marker fom linkage disequilibrium between these two loci in a YAC clones whih were tusn the originalmarkWer. Thes dat were consanguineous Druze community in Israel. anal dusing both muitpt m ods and hapote coding. Our reult sU support Unag but ar inonlue. We have exted our use of micte--t markers to screwn t autosomesM.byusin ordeed sets of markers at5.20cM spacing. Asof May 1993, data for chromoeomes 1,6, 14,17, and 22 have bee geneated. Linkage Mapping and Polymorphisms (continued) 1025 1026 Localization of genes for non-specific and syndromal X-llnked mental RefInIng th region of Branch to-renal syndrome n retardation: ((H. Kremer', B. van den Helm', A.P.T. Smits', B.C.d. Aqby Ic amd phydical pn ((S. Kua Jamborkwl C Hamel', W.F. Arts2, E. Wesby-van Swaay', B.A. Oostra3, S.M. van der Connol aSS. TW KI T. A and Maarel', E.C.M. Mardman, H.-H. Ropers'.))'Dept. Human Genetics, C.W.J.Creme, ) Tt of Genetics, Center or Hdtary & University Hospital Nljogen, 2 Dept. Neurol., Westeinde Hospital, The Communicatio Dsorers, oys Tw National Research Hosp, Omaha. Hague, 3Dept. Cell Biology and Genetics, University Hospital Dljkzigt, NE 68131, Molecular gy Research Lbor s, The Rotteranm, The Netherlands University of Iowa, owa USA, eparnt of Otorl University Hospital Nijmegen, The , Apart from the common fragile X mental retardation syndrome, numerous other iol for non-specific as well as syndromal forms of Branchic-oto-renal syndrome (BOR) is an autosomal dominant mental retardation (XMR) have been mapped to specific regions of the disorder. The syndrome is characterized b ear maltomaons, cervical fistulas, hearing loss and renal a ls. The of BOR X-chromosom (Ner et al., Am. J. Med. Genet. 43:373,1992). In order is and it has been occur in XMR as a for syndrome approxlmatelY 1:40,000, reported to to distinguish Individual forms of and prerequisite their about 2% of profoundly deaf children. The clinical features of the BOR molecular elucidation, we have recently initiated systematic clinical and syndrome vanes significantly from one family to another. Several families In with XMR. Here we on linkage studies 30 famIlies non-fra(X) report have been described with branchial anomalies, p rlar p, and one of these familIes and on another family with a syndromal form of hearing loss with no renal dysplasia (Branchio-oto (BO) . The XMR. In the latter, affected persons suffer from MR, hypotonia, ataxia, phenotypic expression of the branchial arch, audiog and renal areflexbs, nystagmus, hearing defect and io of vision. Male patients die development can be quite variable even within the same family. at two years of age, while female carriers have no obvious symptoms. The gene for autosomal dominant branchio-oto-renaJ me has We performed linkage analysis with 25 highly polymorphic repeat been mapped to chromosome Sq. The distance b n the earlier markers randomly distributed aiong the entire X-chromosome. In family 1 reported flanking markers D8S87 and PENK, for the BOR gene, was the most likely localization of the responsible gene is Xq21.1-q22 approximately 15 cM. This region has been further Investigated using between the iocl CHM and COL4A5. A lod score of 3.0 was obtained Genethon and CEPH markers to narrow down the genetic interval in the with the marker DXS3 (Xq2l.3). This region overlaps with the locations BOR region. The multipoint analysis was carried out using markers for MRX1, 5, 7, ard 8 (Neri et al.,1992). The gene in family 2 has been D8S255, D8S285, D8S260, D8S165, PENK, D8S166, D8S279, D6S286, mapped to the region Xq21.3-q25, between DXS3 and DXS424. A D8S275, and the localization is further refined to a distance of maximal lod score of 5.4 was obtained with the marker DXS1105. approximately 9 cM. We are aleo in the process of using microdissection Interestingly, several symptoms in this disorder are reminiscent of library to develop STS markers and isolation of YACs from the BOR region. Peizaeus-Merzbecher disease, which is due to defects of the PLP gene This will enable us to develop microsatellite polymofphic markers to reduce and maps to the some region (Xq2l.33-q22). the genetic interval of the BOR region and define the new genetic borders.

1027 1028 A new nonsyndromc X-linked sensorineural hearing loss inked to Xpl 1.3-21.1. ((A.K. Lalwani, R. Blister, J. Fox, K.M. Grundfast, B. Ploplis, T. San Agustin, H. at WA om If22 ((. 1ne, P. Concen N. mlU nr, Y. Gatti.)) Skarka, E.R. Wilcox.)) Laboratory of Molecular Biology, National Institute on Department Pathology of Deafness and Other Communication Disorders, NIH, PHS, Bethesda, MD. Los s CA; Virginia Maon Revrch Center', Seattis, WA; and D'h t'y, Cancer Instie,of Tokyo, Japan.U(4A School Nonsyndromic X4iinked mixed healing loss with stapes fixation (DFN3; Eighteen probesp wwe map to dIrolN 1¢ b perilymphatic gusher-deafness syndrome, McKusick No. 30440) has been anaysis of c h cRegn Hum previously inked to Xq13-q21.l. Congenital sensorineural deafness (McKusick We have pevoul Si gemeforU';(-T)Am..).doe I Genet| 50:56,199A- No. 30450) is also mapped to the Xq13-q21.1 region. A now family is identified witin an Mm flanked by the markers and D11424(CJ77). IIof vth new y procs to a nl of DNA from herein with X-linked recessive hearing loss that is inked to Xp. I sensorineural noh-1Ia- tseinhe I S2regIon w used to The auditory impairment In this family was congenita, bilateral, profound, idett markr oftpuh fephA" six thso sensorineural affecting all frequencies, and without evidence of radigraphic were loclzed by e nteCEPH pdre.One marker abnormality of the temporal bone. mapped cnc vren;Dlus70i mpd Eighteen commercially available polymorphic markers from the X between D11S384(Th193) 11S424. chromosome, generating a IO to 15 cM map, were initially used as a basis for refined by its pcement on a pd field gd hs identification of a linkage region. DXS997, ocated between Xp11.3 and Xp22.3, (PFGE) map ival D 8384 to CRYa2 (Urharlat al, this meeting). D115560(c:lll-411) was localized ben D11S132 and D11S144 generated a LOD score of 2.2. Additional markers from the Xpl 1.3-22.3 region I dta and linkage an*ysis. PFGE da ed withI 170 1 bn hslfih generated LOD scores > at 0-0, but were not as informative. All markers from of DRD2. fhree m , DIIS586"c1-481, D-I)5I(cll and the Xql3-21.1 region demonstrated negative linkage. D11S590(cCIl-508), did not lcelize betw SMY D114. It is likely that this family represents a new locus on the X-chromosome which results on D11S597(cCl-530) are s onclusivo alo gh the data u when mutated results in nonsyndromic sensorineural hearing loss. This new th it maps between CRYa2 and DRD2. In addition to the coernids locus is distinct from the heterogeneous group of X-linked hearing loss that have above, we studied the markers D11S897, D11S927, D1138 and been described. D116 1(1C2) to further define the A-T region. Pelimnr likag anaysis In previously A-T families suggests th A-T is between D1ISBII and D11S27, a distance spaing 2.5cM (male specific).

1029 1030 Unkage disequilibrium mapping in Progressive myoclonus epilepsy of Power and sensitivit analysis of a large family with bipolar affective disorder, Unverricht-Lundborg type. ((A.-E. Lehesjokil, M. Kosklnlemi2, R. Noro3, P. potentially linked to the marker PFKL (21q22.3). ((T. Lehner, R. E. Straub, J. Sistonen4, E. Lander5 and A. de la Chapelle1 .)) 1Depts. of Medical E. Loth, J. R. Alexander', Y. Luo, W. Shao, L. Sharpe, R. Simon, M. Gibbon, Genetics and 2Virology, Univ. of Helsinki, 3Dept. of Medical Genetics, The B. Lerer', J. Endicott, T. C. Gillam, J. Ott, M. Baron.)) Columbia Univrsity Finnish Population and Family Welfare Federation, Helsinki, 4Finnish Red and the New York State Psychiatric Institute, Now York, Now York and Cross Blood Transfusion Service, Helsinki, Finland, SDept. of Medical 'Hebrew University, Hadassah Medical Center, Jerusalam, Israel. Genetics, Whitehead Institute for Biomedical Research, Cambridge, MA. As reported by Straub et al. (abstract this meeting) we have Identified Progressive myocionus epilepsy of Unverricht-Lundborg type is an a potential linkage between bipolar affctive disorder and markers in region autosomal recessive Inherited disorder, which has a high incidence in 21q22.3 in one large family. Here we describe analyses of the power and Finland. The underlying biochemical defect Is unknown. The gene, EPM1, sensitivity of this finding. This family Is a three generation family of 72 has been assigned to human chromosome 21 band q22.3 by linkage individuals (45 genotyped; 10 afected). Simulating under th assumption of analysis in Finnish families. Analysis of recombination breakpoints in 12 a 9 allele marker (heterozygosity H=72.5%, true recombination fraction 0.0), multiplex families from Finland and 1 multiplex family from United States we calculated an average expected lod score of Z=2.58 at 0.0 and a has allowed us to narrow the localization of EPM1 to a 5 cM interval probability of 38% to exceed a maximum lod score of Z=3 (using SLINK and between loci CBS and CD18 . A maximum multipoint lod score of 11.77 is The linkage with the real a reached at loci (PFKL,D21S154). To further refine the localization of the MSIM). analysis date yielded maximum lcd score EPM1 gene we applied linkage disequilibrium mapping In 38 Finnish of Z=3.41 at 0=0. families comprising 26 with a single affected child. Significant linkage We also analyzed the snstivity of the results to changes in the disequilibrium was detected with lWi D21S141, PFKL, D21S154, D21S25, diagnostic status of single affcted Indivhials (Xis and Ott, 1991). The D21S171 and CD18 supporting the hypothesis of a major contribution of maximum lod scores for at family ranged from Z=2.45 to Z=3.41, In three one founding EPM1 mutation In Finland. Based on existing knowledge instances reducing the maximum lod scores belowZ=3. We are in the process about the structure and history of the isolated Finnish population we of reassessing the original diagnosis of these three indduals. adopted a simple population model and estimated genetic distances based We will report other potential problems in the linkage analysis of a on strong linkage disequilibrium of EPM1 to several marker loci. We found complex genetic trait and their potential impact on our findings such as that EPM1 lies ls than 0.3cM from ci PFKL, D21S25 and D21S154. As uncertainties in marker allele frequencies and varying phenotype this genetic distance translates Into a likely physical distance of 300 kb or claifications. ls, these data provide a basis for highly focused attempts to clone EPM1. Linkage Mapping and Polymorphisms (continued) 1031 1032

Clinical evaluation of autmal inant. po deafness and a Linkage disequilibrium between the juvenile NCL gone (CLN3) and marker 14 on chromosome 16pl2.1. genetic map odthe DFNA1 of 5q31. ((P.E. H. R.K. ((T. region Leon1, Ravents1, Lerner1l2, R-M. Boustanf', E. Schultz1, K. D'Arigo1, K. Jaclder2. R.W. Sweetow2, J.E. , E.D. Lyncd3, M-C. Ki3.)) 1Univ. Schlumpf1, J. GUsella1' ,and J. Raines1 2.)) 1Molecular of Costa Rica, San Joe; 2Unfv. of California, San Franciso; 3Ufiv. of Neurogenetics Unit, Massachusetts General Hospital, California, Berkeley. Charlestown, MR; Ijept. of Neurology, Harvard Medical School, Boston, MA; Division of Pediatric Neurology, Duke In order to clon the gne for primary deafness (now renamed DFNA1) in University Medical Center, Durham, NC; 4Dept. of Genetics, th Monge kindred of Costa Rica, we created a genetic map for 50 cM of Sq. Harvard Medical School, Boston, MA. i ng a high density map of the 7cM region between 1L9 and GRL. Juvenile neuronal ceroid lipofuscinosis Markers were ordered based on 300 Informative meloses In (JNCL; Batten the Monge disease) is an autosomal recessive disorder characterized kindr: can - FIBB5- IL9 - 0SS89 - D55398 - DSS414 - D5S352 - [FGFA - by the accumulation of autofluorescent lipopigments in the D5S1781 - [GRL - DSS701 - [D5S210- D0S2071 - D5S436 - D0S402 - neurons and other cell types. Clinically, this disorder [DSS119 - D5S2091- D5S410 - D5S413 - D0522 - 5q telomere. is characterized by progressive encephalopathy, loss of examiaton of three members of the Monge kindred, who were vision, and seizures. CLN3, the gene responsible for ide as deaf by pure audiometry and who carry the linked allele JNCL, has been mapped to a broad region flanked by the for DFNAI, Indicates severe bilateral hearing loss in adults. The 8-year-old marker loci D16S148 and D16SSO on human chromosome -16. child tested had milder hearing loss, with appropriate stapedial reflexes and We have now used highly informative dinuclootide repeat otoacoustic emisslone at high frequencies and normal auditory evoked markers mapping within this target region to refine the potentials with normal latency between waves. All three Individuals had localization of CLN3. Our study provides evidence for normaltdr nmeies and vestibular function. Normal tomographic scans significant linkage disequilibrium between CLN3 and the excluded osseous malfomations as the cause of deafness. of dinucleotide repeat loci D16S288 (X2246.5, df-8, < 005), Eniargement D16S298 the vestibular aqueduct, oftn asociated with sensorineural hearing loss, (X2226.47, df-7, p<.005), and D16S299 (X -73.80, df-7, and also an RFLP marker at the D16S272 was not observed. Radogcaly, this deafness falls in the category p..005) locus of These markers all to cochbosaccula dylas wih (X225.7, df-l, p<.02). map 16pl2.1. anomalies apparently limited to the The D16S298/D16S299 haplotype 5/4 is highly over- mmranous sdructures of the Inner ear. The DFNA1 mutation probably represented, accounting for 54% of CLN3 chromosomes as affects a sensorlneural process or structre specific to the cochiea. compared to 8 of control chromosomes (X -117, df-l, Ex son f DFNA1 In this kindred is limited to deafness. It is not a p<.001). The allelic association between this haplotype syndrome involving multiple abnormalities. Thus, DFNA1 must direcUy and CLN3 predicts that CLN3 lies very close to these influence hearing ls. markers in 16p12.1.

1033 1034 Refined mapping of the gene causing familial Mediterranean fever. ((E. Genefc he e in Benign Neonatal Epilepsy: Identification of Levy', E. Pros',1. Aksentijevich', L. Prosen', P. Swain2, T. Keith2, Y. Shen3, a now locus on chromosome 8q. ((T.B. Lewis', S.G. Ryan', K R.I. Richards, M. Dean", M. Pras, D.L. Kastner'.)) 'ARB, NIAMS, NIH, Ward2. P. OKConnell', RJ. Lech'.))'The University of Texas Health Bethesda, MD; 2Collaborative Research, Inc., Waltham, MA; 'Adelaide Science Center. San Antonio, TX and 'University of Utah Medical Children's Hospit-al, North Adelaide, South Australia; 4Laboratory of Viral Center, Salt Lake City. UT. Carcinogeness, NCI, FCRDC, Frederick, MD; and 'Hellerlnstitute for Medical Research, Sheba Medical Center, TeiHashomer, Israel (Intro. by: C. Aros). The syndrome ofBenign Neonatal Epilepsy (also known as Benign Familial Neonatal Convulsions) is a rare autosomal dominant Familial Mediterranean fever (FMF) is a recessively inherited disorder disorderchaCtezed by unprovoked seizures In the irtfew weeks characterized by attacks of fever and serositis; patlents may also develop of life. One locus (EBN1) has been mapped to chromosome 20 In systemic amyloldosis. The gene causing FMF (designated MEF) is located several pedigrees, butwe have excluded linkage to chromosome 20 on chromosome 1 6p. In order to define the location of MEF more precisely, in one large kindred. In order to Idenfy this novel locus, 21 highly we genotyped 51 non-Ashkenazi Jewish FMF families (324 individuals, 162 polymorphic marker distributed throughout the genome wer used affected) for 11 markers on 16p. Two families did not show linkage to any to screen for linkage. Weak evidence of linkage was detected with of the markers for which they were informative, while the remaining 49 fam- a chromosome Sq marker, prompting anaWys of this region with 14 lis demonstrated linkage to chromosome 1 6p. Using a biallelic RFLP de- addition markers. Maximum pawise LOD score of 4.43 wer fined by the cosmid CRI-0327, we found 4 recombinant families that estab- obtaIned with markers D6S284 and D8S256. Mulipoint analysis lished D16S63 as the cemromeric end of the MEF interval. We have placed the EBN2 locus In the interval spanned by D8S198 - D8S274. recently identified a highly informative (AC), polymorphism within the 0327 This study established the presenceofa new EBN locus which maps cosmid; preliminary typings of the recombinant families confirm the to chromosome Sq. The existence of two EBN loci suggests a aforementioned gene order. A single recombinant family placed D 16S246 possibl expnatn for the cnical heterogenei thst has been (p21 8EP) at the telohmric end of the MEF Interval. For 3 loci telomeric to observed in this disorder. Two additional families have been D 16S246, we have observed strong linkage disequilibrium among Moroccan idetied In which the EBN1 lous has been excluded. Them but not non-Moroccan Jewish families, indicating a founder effect in the families are being studied to determine the extent of genetic Moroccan population. At D16S246 we observed substantial linkage heterogeneity of this disorder. disequilbrium In both groups, reflecting the proximity of MEFto this locus. Based on the tVpings of CEPH families for these flanking RFLP markers, we have now localized MEF to an interval of less than 1 cM.

1035 1036

T he M mu fer ge dyseryuhrepeletl anemi ty Ill (CDA II), A gene for autosomal dominant episodic ataxia/myokymia maps to chromosome with mnolnalm gWamep m mYGni I l ialized en 12p. ((M. Litt, P. Kramer, T. Phromchotikul, S.T. Gancher and J.G. Nutt)) Oregon ehremmm 16q21. Health Sciences University, Portland OR. ((L Undl*2, C Smm6sim3, H Sansrm4, A Wahin4, M Eriksson5, Nliieon, Epilsodc ataxla (EA) Is a rare, familial disorder producing stereotyped attacks G HoimrenlJ.)) Deptnt of Applied Cell & Molecular Biology1, Clinical ofgeneralized ataxia, with normal ornear-normal neurological functioninterictally, Genetics2, Medical G Internal Meddcne4, Onoology, Blood and I.e., between attacks. Families with autosomal dominant EA represent at ieast TrsuslonS, University of Ume, Ume, Sweden. two distinct clinical syndromes. The first group (MIM #108500) Includes affected Individuals who have episodes of ataxia and dysarthria which last hours to days, A SwadIsh naily with Congenital dyserythropoleft anemia type Ill precipitated by stress, exercise or excitement. Onset occurs no later than (CDA I)has ben s ed. The d is Inhetd In an autosomal adolescence and generally persists through adulthood and penetrance is nearly dominant fashion and could be traced bak to a couple born in nohern complete. Most patients with this syndrome respond to acetazolamide and many Sweden In the 19th conlury. The affcted members of the family display mild have interictal nystagmus. The second clinical type of EA (MIM #160120) to modeate anemla mullinucearerythroblasts and elevated lvels of serum includes individuals who have episodes ofataxia and dysarthria lasting no longer thymidine kInem. A significant number of the afflcted Individuals also show than a couple of minutes. In addition, Interictal myokymia (twitching of small mysioma or monoca gammop , conions which has not been found muscles; diagnosable by EMG) is evident. Nystagmus is absent in this syndrome. In un ed laves. The basic defect in this type of EA appears to affect both the peripheral nervous To perorm Inkge analysis on the bmily blood was extracted and DNA system, producing myokymia, and the central nervous system, producing ataxia. prprd bfom atotal of 48 Indva ncludng 9 spoes of family Phenytoin Is partially effective in lemning the myokymia but does not control the ataxda and the patients generally do not respond to acetazolamide. K+ members), 24 of which were affected CDA Ill. At first standa Since by channel are candidate for we hematolgloal markers ware teod without findng any linkage to the genes genes EA, tested markers near known K+ but when DNA was tesed with markers channel genes for linkage. Using a group of Genethon markers from one such dease, lsolalsd ciatellte chromosome we inkege to markers on chromosome 15q21 were region- 12p- found evidence of linkage in three EA/myokymia The highest lod families. A maximum combined multipoint lodscore of 6.2 was obtained midway scores ware obtained with the markers D15S125 (6.3) and D1SS114 (6.0). within the 7 cM interval between markers D12S99 and D12S100. In a large Indicaing that the CDA Ill locus Is situated betwen thm two DNA markes. acetazolamide-responsive EA kindred, we have excluded linkage to the 12p So farn canddate gene for CDA Ill he. been idnfied in the reon. markers. This establishes that the clinical heterogeneity seen In EA reflects genetic heterogeneity and supports, but does not prove, the idea that a K+ channel gene Is defective in the 12p-linked families. We are testing this hypothesis by scanning the known 12p-lnked K+ channel genes (KV1.1, KV1.2, and KV1.5) for mutations. Linkage Mapping and Polymorphisms (continued) 1037 1038 of recessive Duchenne-like Characterization of a highly polymorphic in hormone sensitive lipase Sublocalization autosonal (GT),, Muscular Dystrophy (DLUD) to a 5 cM region of D. (UIPE); evaluation ass gren candidate In malignant 13ql2.(( hyperthermlasnsceptiblllty K. ban Othmanel C ben Ramida,2K. S. (MHS). ((Z.F. Uu', H. Mohrenweiser2, E. Taylor', D. A. Meyers', A. Olckers , Loeb,I Speer,I Carter,' H. Issacs4, J.E. Fletcheb, H. Rosenberg", R.C. Levitt')). 'Johns Hopkins Med. A.M. Bowcock,3 S. Blel,2 F. Hentati,2 A. D. Roses,I M. ban Kamida2, M.A. Pericak-Vance and J. M. Vance. ))I Division of Inst., Baltimore, MD, 'Lawrence Uvermore National Lab, Uvermore, CA, Neurology, Duke University, Durham, NC.2lnstitut National de 'Univ. of Pretoria, Pretoria South Africa, 4Univ- of Witwetersrand, Neurologie, Tunis, Tunisia 3Dept. of Pediatrics, University Johannesburg, South Africa, 'Hahnemann Univ., Philadelphia, PA. of Texas Southwestern, Dallas, TX. DLND is a severe childhood disorder clinically UPE is crucial In mobilizing free fatty acids from stored triglycerides and is indistinguishable from X-linked Duchenn muscular regulated by hormonal and neuronal factors. Free fatty acid metabolism is dystrophy. DLMD should account for many cases of the abnormal in the autosomal dominant disorder MHS. Although, MHS In the pig Duchenne phenotype in females or cases vith normal is explained by a single founder defact in the ryanodine receptor (calclum expression of dystrophin in muscle. We have previously release channel), linkage studies in humans suggest MHS is heterogeneous. reported linkage of 3 highly inbred DIED families to the MHS maps to the same region of chromosome 1 9q as UPE in approximately chromosome 13q12 markers D138115, D138143 and D13S120 vith 25% of the MHS families we have studied. Therefore, we have suggested D13S115 z (0)-9.5 at 0-0.03. The nearest (15cd) distal UPE as a gene candidate in MHS. We isolated and sequenced a partial human flanking marker vas D13S120. We have tested four UPE cDNA that was used to identify 3 cosmids by hybridization that have additional markers for linkage to DIED, HFVBA57 (D13S182-), been mapped to 19q13.1. Two of thes cosmids (20027 and 26710) gave D13S221, D13S171 and D13S175. HFBBA57 is a brain specific ye a a very strong signal after hybridization to (GT)1e but not to (TA),O, or (GA)oe cDNA that have demonstrated contains trinucleotide Isolation and direct sequence analysis of a 1 kb fragment from a Pat 11 repeat polymorphism (PIC 0.74). Raplotype analysis I/Pvu reveals a recombinant with 5FBBA57 reducing the flanking digest of 26710 identifies a (GT)n in an intron 257 bp upstream of an Intron- DLD region from 15 cM to < 5cK. Studies are underway to exon junction In the UPE gene. Using PCR twelve alleles (166-190 bp) were establish a 1000:1 odds map of all markers into a single detected in 122 chromosomes of unrelated individuais including 20 CEPH genetic map. A frovisional map places Ct-D13S175-d13S115- parents (heterozygosity 82%). No recombinants were identified between DLED-HFBBA57-D13S221-D13S120-D13S171-t-l. Additional MHS and UPE in 5 families potentially linked to chromosome 19q generating markers are being identified to closely flank the DIED a maximal LOD of 3.65. No recombination between UPE and RYR1 was gene. detected by 2 point analysis with a maximal LOD of 4.05. This UPE marker and cosmid can now be used to place this gene In the melotic and physical maps of chromosome 19q and further evaluate UPE as a gone candidate in MHS.

1039 1040

A directed serch for a major locus underling manic depressIve disorder. Characterization and mapping of the mouse muscle yphosphorylase kinase UR.B. Lu, A.J. Pakstis, M.M. Hanczyc, F.M. Chang, H.C. Rosenbaum, E.L. gene. ((A.J. Maichele1, and J.S. Chamberlain1.2.)) IDepartment of Human Thomas, J.R. Kidd, and K.K. Kidd.]] Yale University, New Haven, CT. Genetics and 2Human Genome Center, University of Michigan Medical School, Ann Arbor, Ml 48109.0618. Finding major bci for complex disorders may be speeded up, by selecting as linkage markers, loci cloned BECAUSE they differ between affected and Phosphorylase kinase (Phk) is a key regulatory enzyme in the unaffected members of a family (Lisltsyn at al., 1993, Science 259:946- glycogenolytic pathway that is expressed at varying degrees In most animal 951). We have results of a preliminary study of linkage for manic depressive tissues. The holoenzyme is comprised of four copies each of the subunits a. py, and . A variety of tissue specific Phk enzyme deficiencies have been described illness in the Old Order Amish with 27 markers selected in this way. Two in humans and other mammals, but the existence of multiple genes or Isoforms selection regimes were used. The first (described in Usitsyn et al., 1993) for each of the Phk subunits has slowed the identification of the molecular compared an affected individual with an unaffected sibling; the second defects In these disorders. We have isolated and characterized Phkg, the gene compared a pool of DNA from eight affected relatives (in three generations) encoding the muscle specific isoform of the catalytic y-subunit. Phkg spans 16 with a pool of eight of their unaffected close relatives who had passed kb and is comprised of ten exons. In some strains and species of mice the final through their risk period for developing bipolar disorder. To date we have exon contains a B2 insertion and additional rearrangements that alter the iength results on 16 markers from the first regime and 1 1 markers from the second. and sequence of the 3' untranslated region. Phkg exhibits multiple transcription Though most of the markers show the segregation bias imposed by the start sites and is expressed predominantly In skeletal muscle, cardiac muscle selection regime, neither set of markers was fully concordant with the and brain. We have identified four short tandem repeat (STR) polymorphisms regime. None of the new polymorphisms selected from the pooled samples within the Phkg locus, including a highly polymorphic pentanucleotide repeat. has shown complete concordance with illness in those samples. No marker Analysis of these STRs in interspecific mouse crosses and in recombinant has shown evidence of linkage to manic depressive illness when typed on inbred strains of mice has localized the Phkg gene to mouse chromosome 5 the entire kindred; nine markers show significant exclusionary lod scores of between Epo and Afp, near Gus. Analysis of the mouse Epo gene on chromosome S also revealed the presence of a novel STR useful for mapping In lss than -2 (assuming a dominant model for illness, cf. Pakstis et al., 1991, the distal portion of this chromosome. In addition, the homologous region of the Human Genets 87:475-483). The new markers were also screened for human EPO gene also contains a polymorphic STP. We have previously linkage with over 300 loci previously typed on the Old Order Amish pedigree. reported that human PHKG maps to chromosome 7. Mouse chromosome 5 Strong evidence for linkage has been obtained for 5 of the new markers. shares a conserved region of synteny with human 7 that includes the EPO and Suggestive linkage evidence for 5 others is being followed up in additional GUS genes, suggesting 7q21q22 as the most likely location for human PHKG. families. (Supported in part by MH39239 to KKK.)

1041 1042 Genetic and molecular analysis of families with hereditary neuropathy with The I1q21-22 region In preliminary linkage studies of schilzophrenia (SZ) Iability to pressure palsies. (E. Mariman, A. Gabrel-Festen', S. van and bipolar pedigrees (BP) of Eastern Quebec: methodological Implications. Beersum', P. Jongen', F. Gabredb' and H.H. Ropers )) Departments of ((C. M6rette', M. Martinez.'12, V. Raymond' and M. Maziade'.)) Human Geneticso and Neurolog, Academic Hospital Nljmegn, P.O. Box 'Centre de recherche Universit6 Laval Robert-Giffard, Beauport (Quebec), 9101, 6500 Hi Nmegen, The Netherlands. Canada. 2 INSERM 155, Paris, France. Hereditary neuropathy with Iability to pressure palsies (HNPP; MIM Several large and mid-size pedigrees of Eastern Quebec densely affected 162500) is an autosomal dominant disorder wIth an Increased susceptibility by either SZ (N - 86) or BP (N - 129) were submitted to a blind consensus of peripheral nerves to traction or compression resulting in transient palsies best estimate diagnosis (Maziade et al, 1992) and are currently being and sensory dysfunctIon. Asymptomatlc carriers can be traced by eieto- genotyped on a panel of 5 candidate markers lcated in the 5q and 11 q21- physiological examination, while morphological studies reveal focal 22 regions, suggested by St-Clair et al (1990) as a promising candidate thickenings of the myelin sheets (tomacula), segmental de-(and re-) region. The preliminary linkage analysis on 4 SZ pedigrees with marker myelinatlon and to some extent, de a of axons. By linkage analysis D0 1 S35 (1 1 q22) revealed, at hierarchical level 1 defined as definite DSM-I1- of a lerge family with HNPP we have mapped the underlying gene to the R SZ diagnoses only, a maximum lod score of Z - 2.4 at 9 - 0 only in proximal part of chromosome 17p (Madrman et al., Human Genetics (1993), pedigree 255 (N-36, 9 definite DSM-I11-R SZ), through a predetermined In press). With markers DI 7S122 and D17S261 an irregular segregation of recessive model (f - .95, pheno. rate - .30, p - .20). Simulation studies alleles was observed conSistent with loss of heterozygosity In affected under tight linkage estimated the probabilities that Z exceeds 3 and 2.4 of members. Indeed, further examinatIon confirmed the presence of a deletion, respectively 10% and 19%. Under the assumption of gS linkage between which is in keeping with the findings of Chance et al. (Cell 72:143.151 SZ and 011S35, the latter probability is .0005. Given the effect of (1993)) in three unrelated families with HNPP. The deletion includes the blindness on diagnosis (Maziade et al, 1992), the analysis was repeated gene for PMP-22, which is duplicated in most patients with Charcot-Marie- using the unblind phenotype definitions and yielded Z - 2.7. Model Tooth IA, Indicating that HNPP and CMT1A may be caused by the same maximization (f - .95, pheno. rate - .004, p - .20) raised the lod score to gene. Surprisingly, neither the loss of haterozygosity nor a deletIon of the 3. A sensitivity analysis (changing, one at a time, each affected Individual PMP-22 gene was observed in patients of a second family with HNPP. to 'unknown') resulted in an average lod score of 2.6. Methodological Threpoint linkage analysis seem to exclude the defact from the region implications will be discussed in terms of a) of the phenotypic distinctions between D17S122 and D17S520. These findings indicate that HNPP Is of the DSMIIIR SZ in pedigree 255, b) the dependence on the model in use, genetcaly heterogeneous (Prinses Bestrix Fonds grant nr. 91-3276). c) the effect of blind vs unblind phenotype definitions. The extension of pedigree 255 and other BP and SZ pedigrees are ongoing. Linkage Mapping and Polymorphisms (continued) 1043 1044 Mapping of newly identified polymorphic lci together with genes for Searching for DNA markers near the SMA locus. ((M. McLean, N. Roy, M. Mitochondrial acetoacty-conzyme A thiolase (ACAT), Glutamate Salih, A. Besner, Z. Yaraghi, R. Komeluk, L. Surh, J.-E Ikeda and A. Receto 4 (GLUfR4), and Interleuidn Ioc ting enzyme (IL1PCE) ce MacKenzie.)) Children's Hopsital of Eastern Ontario, Ottawa, Canada. to thoblo for ataxia telangiectesi on homoe 11q22-23. ((C.M McConvilie, P.J. Byrd, H. Ambrose, T. Stankovic, Y. Shiloh', J.O. The spinal muscular atrophies (SMA) are a group of Mo~omers2, T. Kuw1haa3, end AM.R. Taylor.)) Dept of Cancer Studies, neurodegenerative disorders characterized by failure of the anterior horn Medical School BIrmingham, U.K., VD Human Genetics, Tel Aviv Univ. cells of the spinal cord. We are working to obtain unique sequence, cDNA Israel., 2Duke Univ. Medical Center, Durham, N.Carolina, 3Dept of and microsatellite repeat (MSR) DNA markers from an approximately 1 Pediatric, Glfu Univ. School of Medicine, Japan. Mbp region of 5q13 defined by D5S435 and D5S351 that contains the gene involved in SMA. These markers will be used to generate genetic, The high resolution mapping of th ataxia t (T) ocus physical and expression maps of the region in our search for the SMA on chromosome 11q22-23 requires the generation of now polymorphic gene. markers specifically within the segment of 11q22-23 to which th locus has A collection of cosmids from a chromosome 5 library selected with been assigned. We have made use of a library of Aiu-PCR clones, plasmid clones from a 5q13 manual microdissection library were screened amplified from a radiation reduced somatic cell hybrid containing the for unique sequence and MSR markers. This resulted in the itfication relevant chromosome 11 segment, to generate sequence tagged sites of a (CA)n microsatellite from cosmid H7 that has been genetically mapped (STS) within the the 11q22-23 region and have used YAC clones to extend to the interval between D5S435 and D5S351. A bidirectional cosmid walk the loci identified by these STSs. The identification of paired from H7 has yielded more cosmids as further resources for DNA markers. polyrnorphisms (from Alu-PCR and the asociated YAC derived cone), Several YACs have been isolated from the DSS351 locus which which am physically inkd, but which show minimal linkage disequilibrlum, extend into this region, and we are near the completion of a contiguous set provides a highly hinfative hapope for use in genetic linkage analysis of YACs (see abstract by Roy et al.). The PCR of these YACs with Alu in A-T families. We have chactersed 2 such polymorphic loci, DI 1S535 element and (TG)n primers has identified additional (CA)n MSR markers. and DI 1S611, 4.1 cM apat, which map between existing flanking markers. These YACs are also being used to select cDNAs from this region that We have aiso mapped ACAT, IL1pCE and GLUR4 to this region of 11q22- correspond to transcripts from several human tissues (in particular spinal 23 using linkage analysis and/or radiation hybrids. ACAT is very closely cord, brain, and muscle) as well as from porcine tissues. cDNAs which linked to D11S535, and GLUR4 and ILIPCE map between D 1S611 and map within the region will be tested as candidate genes. ACAT/D11S535.

1045 1046 An investigation of genetic heterogeneity and linkage disuilibrium with Genetic mapping of myd, a possiblq mouse model fo: facioscapulohugpral 161 spinal nmscular atrophy families. ((C. MIrette , L. M. Brzustowicz', muscular ¶lystrophy. 1((K.A. Mills K.D. Mathew', K.H. Buetow ,R. R. J. tanies, K. E. Davi"s3, T. C. Gilliam1 J. Melk14, M. A. Pericek- Schmalzel , H. Bailey 1, W. Nichol 1, J.H. Nadeau , and J.C. Murray1J) Vanca, T. Siddque5, B. Wirth7 and J. Ott .)) 1 Dept. of Psychiary, 1 Unwersity of lowa, Iowa City IA, Fox Chass Cancer Center, Philadelphia Gen s & De p and 2 Dept. of Psychiatry, Columbia Univ., New PA, Jackson Laboratories, Bar Harbor, ME. York, NY, 3 Inst. of Moleculer Medicine, John Radcliffe Hospital, Oxford Facioscapulohumeral dystrophy (FSHD) has been genetically mapped to U.K., 4 INSERM, H6pital des Enfants-Malades, Pais, France, 4q35. One approach to gone localization is the genetic characterization of Northwe Univ., Chicago, Duk Univ. Medical Center, Durham, North the homologous region of the mouse genome. A possible mouse model, Carolina, 7 intitutn fOr Humangenetik der Univer Bonn, Germany. the myd mutant, maps to mouse 8B, which by in situ localization of the gone F1 1 is the 4q35 homologuo. The mWd mutation is recessive and We pformed characterized by progressive muscle weakness, dystrophic-appearing linkage analysis of 161 spinal muscular atrophy (SMA) muscle and hearing loss. We have generated a map of mouse families whereaffected indivldualssuffer from the intermediate or mild form chromosome 8 from 126 interspecific backcrossed mice with 17 of the disease (types 11 or ll). Meirkers for 6 bci spanning the chromosome polymorphic markers comprised of dinuclhotide repeats, RFLPs, and SSCPs 5ql 1.2-13.3 region were typed. The best map location for the disease including F11. Myd hoterozygotes were bred producing 38 homozygous locus was found to be between D5S6 and D5S112/MAP1B. The corres- myd offspring (confirmed by muscle histology). These mice have been ponding 1-unit support interval (logI) is confined to this interval and spans genotyped with six of the availabi markers that are polymorphic. Mice 0.5 cM. The data highly the hypothesis of heterozygous for myd have aiso been crossed with the wild species, M. sqpported linkage heterogeneity cestaneus, and the F1 offspring backcrossed to generate another mapping (likelihood ratio-1.14x1 0'), with 5% of thefamilies unlinked. Among the panel for the myd mutation; it is expected to be polymorphic at any Woi of 7 families with the lowest probability of being of the linked type, 3 show interest. To date, we have obtained 11 myd homozygotee from these crossovers in unaffected Individuals, 2 show crossovers in affected cross. Analysis of recombinants suggests the following order of D8MIT Individuals that do not contradict the above map location, while the markers and myd: am umption of a gne between D5S6 and D5S1 12 is Incompatible with the cen- 16-4-46-(25 rayAd -33- 14-eel egregation of SMA In 2 other families. Diagnostic verification will be The map distance between the markers D8MIT48 and D8MIT33 is 11 cM. In addition, we are screening an adult mouse diaphragm cDNA library carried out in orderto determine if reduced p a nd/or phco with DNA fra isolated from cosmids in the FSHD candidate region could be the confounding factors creating a spurious effect of genetic of human 4q35. This work is expected to faciltae gone localization and heterogeneity. A likelihood approach to test for linkage disequilIbrium understanding of the pathophysiology of FSHD or another human revealed no igfcn departure from H-W equilibrium with any marker. dystrophy.

1047 1048 Genetic mapping of the Batten disese locus (CLNS) to the Unkage of familial holoprosencephaly to chromosome 7q36: clinical and Interval D1m - D16883 by walyels of haplotypes and molecular studies. (M. Munke, F. Gurriel, D. Yn, C. Say, A.L Collinel, V.P. allelle e Johnson2, R.C.M. Hennekarm3, G.B. Schaefr5, J. Weik, M.S. Lublnk, S. ((H M Michison', AM O'Rawe', AD Thompson2, M Knight, D F Daack-Hershs, J., C.A. Mo7, W.B. Dobyns, J.C. Murry6, and R.A. Price) Cellen', N A D1gget, R M Gardiner', S E Miol'.)) 'Depa ent U. of Pennsya PhiladelphIa, PA, IPrincess Ann Hospital, Southampton, of Pedets, UCL Medical School, London, UK. 'Centre for U.K., 2U. South Dkot, Vermilion, SD, 3U. of Amsterdam, NL, 4U. Nebraska. Medil Genetcs, Department of Cytognetics and Mioecular Omaha, NE, "Chldren's Hospital, Milwaukee, WI, SU. of we, iowa City, IA, Women and Children's Australia. 7C.D.C., Atianta, GA, SU. Minnesoa, innespolls, MN. Genelics, Hospital, Adelaide, Hopocephly (HPE) s an etolgcaly heterogeneous developmental 'Centre for Human Genome Studies and Life Sciences Dhivsion, defect Invoeling the brain and face. Evidence for genetic factors In HPE Los Alamos National Laboratory, New Mexico, USA. comes from faniUal occurrence and non-random structural chromosome anoalies Involng 18p, 7q36, 3p, 2p21, and 21q22. We have hypothe- We recently described genetic linkage analysis localising CLAM, szed that these regions contaln genes necessary for normal brain develop- the gene for juvnile-onset neuronal ceroid 1ipofuscinosis or ment (AJMG 34 237,1989). Previously we have defined the HPE critical re- Batten disease to chromosome 16p between D16S297 and gions In 2p2t (HPE2) and 7q36 (HPE3) (CCG 56:1871, 1991; NG 3247, D16SS7. We have further refined the locaiisation of CLN3 by 1993). Here we report results of studies In familial HPE. We have clinically hapiotype analysis using two new microsatelite markers from loci examined over 100 individuals from 10 families with autosomal dominant D16S383and SPNin the D16S297-D16S57interval with a family (AD) HPE. The phenotypic features in affected individuals varied from the resource which included an additional 8 Batten pedgrees. most severe forms with single brain ventricle and cyclopia to milder forms Crossover events in 3 maternal meloses define new flanking with ocular hypotelorism and midfcal hypoplasia to clinically unaffected markers for CLN3 and locale the gene to the interal at carriers. Genetic linkage studies were permd in these 10 famllieswith 16p12.1-11.2 between D16S288 and D16S3 which probably polymorphic DNA probes from the HPE critical regn in 7q36. The data were corresponds in size to ne more then 3.2 meg-b-ase. analyzed using the computer program LINKAGE. A model-free analysis treated unaffected disease phenotypes as unknown and a dominant model Haplotype analysis of alleles in association with CLN3 indicates with 67% utilized information. that within that region, CLN3 is in closest proximity to loci penetrance aUl phenotype Under the most and D16S298. conservative model-free analysis linkage between AD HPE and D7S22 D16S29 demonstrated a combined lod score of 7.2 at e a 0.0 with one family Independently presenting a lod score of 3.0 at a*0.0. Our data suggest that AD HPE is Inked to HPE3 and possibly due to alterations in this putative gene in 7q36. Linkage Mapping ancd Polymorphisms (continued) 1049 1050 Ipimoerebellar atexia tpe 2 (SCW)s flaskiag markers n chromso Fine mapping of the Best's disease locus and mutation analysis of the 12 emd eviemce for esticipatiom. ((A. Iechiporukl, S. Starkman2, S.- M. Pulstl.)) 1cedars-Sinai Medical Center, 2Center for the Health candiae gene ROMI. ((B.E. Nichols1, RA Bascom2, M. Litt3, ft McInnes2, Sciences, UCLA School of Medicine, Los Angeles, California C.M. Taylor1, V.C. Sheffieid4. and E.M. Stonel.)) The University of Iowa The autosal dominant epinocerebellar ataxias (SCAU) are a clinically Depts. of Ophthalmology1 and Pediatrics4, University of Toronto Hospital for and genetically heterogeneous group of neuro nerive disorders Sick Chiidren2, and Oregon Health Sciences University Dept of Molecular characterized by progressive ataxia. At least two gene loci have been and Medical Genetics3. Ldentified: SCAl on CUR6, and SCA2 in a single Cuban pedigree on CHR12. We have now identifLed a second pedigree with linkage to CRl2. Best's disease Is an autosomal dominant macular disease The phenotype in this pedigree is unusual in that it shows strong characterized by bilateral egg-yolk-like accumulations of lipofuscin within evidence of anticipation that can be observed in four generations. and beneath the macular retinal pigment epithelium. In addition, affected Linkage to the SCA1 locus was excluded, but strong evidence for have a linkage was detected with 10F1 (max: 3.0, theta-0.05). To establish patients characteristically abnormal electro-oculogram. RePnt, we closer flanking markers for SCA2 we ordered microsatellite markers in and others reported linkage of Best's disease to markers on I q13. ince the region as cen-D128101-D12958-IOFl-D12878-D128105/584-D12579-tel this initial linkage, we have included two additional 5-generation families with odds >1,000: 1. Multipoint analysis resulted in a maximum lod affected with Bests disease in the analysis. In all three famides, thirty-eight score of 3.7 and established 1F01 and D12879 as likely flanking patients had macular lesions consistent with the diagnosis of Bests disease, markers. Age of onset analysis in 15 parent-child pairs indicated and an additional seventeen patients had distinctly abnormal electro- that in 14 pairs the disease occurred earlier than in the parent (Chi- oculograms and were also considered to be affected. Twenty-six patients square-112, p<0.001, average anticipation for the 15 pairs: 11 had normal ophthalmoscopic exams and normal eolctro-oculegrams, and years). Asymptceatic gene carriers with late onset of the disease say were considered to be unaffected. Using these three familes, the blc for potentially bias this analysis. To exclude this possibility we used Best's disease was narrowed to the 10cM region flanked by markers DIIA markers flanking the SCA2 locus to determine the number of D 1S871 and PYGM. Marker D 1 S956 demonstrated no recombinants asymptomatic individuals that were at >9S% risk to carry the SCA2 with Best's disease in these families and resulted in a lod score greater than mutation. Only one individual was found to be at >95% risk. Although 18 In a this person is still significantly younger than the age of disease (5m0). addition, polymorphism within the ROM-1 gene also onset in the parent, we included this person in a repeat analysis as a demonstrated no recombinants with the disease phenotype and resulted In second pair with later onset in the child. This did not change the a lod score of 10 (m0.). Exhaustive analysis of the coding sequence of the conclusions regarding anticipation (p<0.002). candidate gene ROM-1 failed to reveal any seence changes in affected Conclu-son-s The location of the 8CA2 gene was narrowed to the region members of these three families, or in 8 additional unread patients with between la1l and D12879. The recognition that mutations in the SCA2 Best's disease. Thus, although ROMI remains a a , it s unlikely that gen can cause anticipation may focus the search on genes containing coding sequence mutations in this gene cause Bests disease. DIA repeats and may thus greatly facilitate cloning of the SCA2 gene.

1051 1052 Binary Search: An efficient method to localize a new marker in an Tightly linked flanking microsatelite markers for the Usher Syndrome Type I existing genetic map. ((N. K. Ning and A. G. Menon.)) Univ. of locus on the short arm of chromosome 11. ((N. Nouri', M. Utt2, M. Z. Pelias', Cincinnati, Cincinnati, Ohio. P. L Deininger', and B. J. Keats1.)) 'Louisiana State University Medical Center, New Orleans, and 2Oregon Health Sciences University, Portland. In a given span of n ordered markers, commonly used procedures such as sliding window method require an overall multipoint evaluation Usher Syndrome Type I is an autosomal recessive disease characterized by time to the order of n, i.e. 0(n) so as to localize a new marker in a single profound congenital hearing impairment and vestibular dysfunction followed by scan through all the ordered markers. As new markers are generated, the onset of retinitis pigmentosa in childhood or early adolescence. The gene their correct placement amongst multiple existing markers in genetic causing this disease in the Acadian population of southwestem Louisiana has maps becomes essential, and the development of computational time been mapped to I1p. Thirteen Acadln families with 32 affected members (at saving procedures becomes increasingly important. least 2 per family) were analyzed forsix microsatellite markers assigned to the Based on the fact that the order of markers Is preserved when 11p15.2-p14 region. Three of these markers (D11S921, D1 S419, D11S899) considering different subsets of markers among them, we describe a showed no recombination with the disease locus, while recombination was binary search algorithm which iteratively loates the next smaller interval observed with Di IS861 and DI1S928. Analyses of these markers in the CEPH that contains the new marker according to the location scores obtained data paced D11S861 about one centimorgan distal to D11S921, and D11S928 by four-point analysis. This scheme yields an evaluation time of O(lg2 about 4 centimorgans proximal to D11S899. The Acadian Usher Syndrome n) which dramatically reduce the overall computing time. A quasi-binary Type I locus (USHIC) is therefore within the 5-6 centimorgan region flanked by search Is an extension to the binary search algorithm by Including no less Di IS861 and DI 1S928. To refine this interval, the data set was expanded to than four markers in each multipoint evaluation. Further calculation include a further 22 Acadian families with one affected offspring. Haplotype shows that the timing is (m-2)-log(,,2) n where m is the number of analyses showed that the 54 affected chromosomes canied the same alleles for markers entered in each evaluation. It is minimized at m = 5 for fixed n D 1S921 and D 1IS419. Among the unaffected chromosomes, 10 had this when the whole span of markers are equally polymorphic and haplotype and 40 did not. The association between this haplotype and the informative, while binary search (mm 4) is scarcely less optimal if the disease allele is highly significant. On the other hand, 20% of the affected time difference between one four-point evaluation and one five-point chromosomes had an allele other than the most common one at the Di 1S899 evaluation is ignored. The efficiency of this method is demonstrated locus. These resuits suggest that Di1 S899 may be a proximal flanking marker through computer simulation and the algorithm can be incorporated into for USHIC placing the disease gene in a 2-3 centimorgan interval. YACs from existing linkage analysis software package such as UNKAGE. this region are being screened to find microsatellite markers that further refine the location of USHIC. and lead to a contig containing the disease gene.

1053 1054 A Microsatellite Genetic Map for Chromosome 3. Multiple epiphyseal dysplasia maps to chromosome 19. ((P. O'Connell', D. Rains', D. Garcia', N. Matsunami.2, ((R. Oehlmann, G. Yeh, G.P. Summerville, E.J. Weaver, H. Albertsen2, P. Wilkie3, J. Weber', J. Weissenbach4, S. S.A. Jimenez and R.G. Knowlton.)) Thomas Jefferson Shermans, R. White2, S. Naylor'.)) University, Philadelphia, PA. 'UTHSC San Antonio, TX, 'Univ. of Utah, Salt Lake City, UT, 'Marshfield Medical Res. Found., Marshfield, WI, We have studied a family with an autosomal dominant 4Institute Pasteur, 75724 Paris CEDEX 15, France, form of multiple epiphyseal dysplasia (NED) segregating 'Emory University, Atlanta, GA 30322. through at least five generations. The common characteristic of affected relatives is bilateral Oligonucleotide primers for 99 microsatellite deformity of the hips with subsequent degenerative genetic markers have been assayed by polymerase chain arthritis. Abnormalities of the knees, shoulders and reaction (PCR) in the CEPH reference family panel. The ankles are also noted in some individuals. Affected average heterozygosity of this marker set was 74.8%. joints show changes consistent with epiphyseal dysplasia. 55 of these markers were genotyped in the bulk of the The size of the family permitted genetic linkage CEPH 40 family panel, and data for 42 markers typed in analysis to map the NED mutation, Several candidate a subset of eight families was extracted from the CEPH genes encoding components of the cartilage extracellular DataBase v6.0. For this analysis, data for matrix (COL2A1, COL6A1, COL6A2, COL6A3, COL9A1 and CRTL) grandparents were deleted as errors in scoring these were excluded by discordant RFLP inheritance. Over 130 individuals imposed incorrect phase combinations on DNA polymorphisms have been analyzed to determine the the data set. Genetic data were analyzed with the chromosomal location of NED; these data excluded MED from LINKAGE analysis programs LODSCORE, CMAP and CILINK. large sections of each autosome. Strong evidence for 57 markers were linkage of MED to markers on chromosome 19 has now been found to define a total of 45 uniquely obtained. ordered loci (>100:1 against local inversion) that span The highest LOD score is observed for D19S199 241 cM. The 38 additional loci could be positioned by (Zmax - 4.67, e - .09). D19S49, located at 19q12 and 7.4 CMAP into confidence intervals. 3 loci could not be cM distal to D19S199, gives a Zmax of 2.15 at e - .16 uniquely placed on this map. The high density, high with MED. Linkage data from these markers suggest that heterozygosity and PCR format of this sapped set of MED is located close to the centromere of chromosome 19. markers will accelerate the genetic and physical Analysis of other microsatellite markers from this region mapping of chromosome 3, and aid in mapping and will permit more precise localization of NED and positional cloning of new chromosome 3 genes. correlation with candidate genes. This region includes the gene for TGF-beta-l, an important cytokine in cartilage metabolism, but the data available suggest that TGFB1 (19q13.1) is distal to the likely location of MED. Linkage Mapping andIPolymorphisms (continued) 1055 1056 Ataxia-telangiectasia: allelic asociation with 11q22-23 markers in Homozygosity mapping places the Friedreich's ataxia gene centromeric to Moroccan-Jewish patients. ((R. Oskato, A. Bar-Shira, L. Vanagaite, Y. D9S5 locus. ((F. Ziv. Shai Ehrlich, 6. Rotman, C.". McConvillel, A. Chakravarti2 and Y. Palaul, E.donr6sl, J.Caflizares2, N.D. Nolt62, N. Pan- Shiloh.)) Oept. Human Genetics, Sackler School of Medicine, Tel Aviv dolfo3, R.de Frutos2, and F.Prietol)). lHospital La Fe and 2Facultat de Univ., Israel, lDept. Cancer Studies, Univ. of Birmingham Medical Biologia, University of Valencia, Valencia, Spain, and 3Istituto Neuro- School, Birmingham. UK and 20ept. Human Genetics, School of Public logico C. Besta, Nilano, Italy. Health, Univ. of Pittsburgh, PA 15261. USA.)) Friedreich's ataxia (FRDA) gene was assigned to chromosome 9q Ataxia-telangiectasia (A-T) is an autosomal recessive disorder after demonstration of close linkage to involving cerebellar degeneration, immunodeficiency, cancer predispo- marker loci D9S15 and D9S5. sition, chromosomal instability and radiosensitivity. A-T is A linkage group was defined as D9S5-GS2-D9Sl5-GS4, aligned from heterogeneous, with four complementation groups designated A, C, 0 and the centromere to the telomere in 9q. However, position of the E, of which the ATA and ATC groups account for more than 802 of the FRDA locus was unknown in relation to the linkage group. Recently, patients. Among Israeli Jew, A-T is confined to the Moroccan-Jewish analysis of five recombinant families and disequilibrium linkage community. Several Moroccan-Jewish patients have been assigned to studies orientate the gene mapping towards the D9S5 side. complementation group C. The group A and group C mutations were Along with linkage analysis we have used localized by linkage analysis to chromosome 11q22-23. Further linkage homozygosity mapping studies of British and Israeli A-T families showed that a major A-T to place correctly the FRDA locus. Three inbred Spanish families locus in this chromosomal region is located 1 cM proximal to the marker were available for haplotype analysis. Extended haplotypes including locus 011S535. Allelic association (linkage disequilibrium) was tested the above mentioned markers and recently described micromatellites, between A-T and markers spanning and flanking the A-T locus, in 16 ordered (cen-AFN120o)-LSl-FDI-D9S5-CA3GS2-D9Sl5.GS4-AF1224-tel, were patients representing all the affected Moroccan-Jewish families found constructed. We postulated that patients had to be homozygous for in Israel, and in 32 random individuals of the eas community. the mutation and, therefore, for the linked Significant association (p(O.02 - p(O.001) was observed along the haplotype. Loms of 0115384-DIlS535-0115927-0115424 region, declining at flanking markers. homozygosity would be interpreted as result of a recombinant event The region showing allelic association partly overlaps and extends 1 cM in a former ancestor. In one family, homozygosity was mantained distal to the interval containing the major A-T locus according to for all markers but D955 and CA3, suggesting the gene is not located linkage analysis. This indicates that in noroccan-Jewish A-T patients. between these markers. In the other two families homozygosity was (group C?) the responsible mutations might be located distal to those only mantained for MILS1 and AFM120, excluding the region which causing the disease in other ethnic groups. One D11S384-011S424 spans haplotype accounted for 27 of the 32 mutant chromosses studied. from AFN224 to FD1. We conclude that the FRDA gene is located suggesting that one mutation sight be responsible for most A-T c beyond D9S5 and FD1 towards the chromosome 9 centromere. among Moroccan Jews.

1057 1058 An index linkage map of chromosome 14. ((S. D. Pandit, J. Wang, S.K. Mishra and H. Donis-Keller.)) Washington University School of Medicine, Evoludon of a repetve spqusnc in the paradthyrld horn re dPeptide Department of Surgery, Division of Human Molecular Genetics, St. Louis, Wg in primt ((Z Pauo, K. Morgan, T.M. Fupwara, D. Goltzmsn and GN.Hendy.)) MG Urersiy Nd Royal Victoria Hospital, MoWn , Qusbe MO. Caneda. We are currently in the process of constructing a framework linkage map of human chromosome 14 that will consist of markers with We previously dmnshtled ta a repetiive sequence, which is located ust heterozygosities of at least 70%, intermarker spacing of no greater than 15 dowIet oM axon VI ofthepslpryroldhomoe* l peopdP (PTHrP)gn, cM, and genotypic data gathered on the primary (40 family) CEPH Wpolymorphic In human (Genois, 1N%,hI Pre). The polymophismis ol'the pedigree resource. Our preliminary map, constructed using the program VNTR type, end the rope ut has the genra sequen G(rA),C who n package CRI-MAP, consists of 32 highly informative markers (38 systems) qsia 4 to 11. Inthe present Study, hi order to chaactrize the evuton y that meet the criteria of 70% minimum heterozygosity. Twenty-six of the history of this repeive sequenc I the PTHrP gn, we carried out a markers are PCR-based microsatellite polymorhisms. In addition to compI analysis hI prlmats Human PTIrP ge sequence genotyping markers developed in our laboratory (including a 14q telomere primers were used to mplify nnhmanprimate genmi DNAs. POlYm microsatellite at the locus D14S82, developed from a YAC cione that dha reacon (PCR) produts were obtained In Gret Apes, Old World Monkey defines the 14q telomere, NIH/CEPH, Science, 258,6786,1992), and New World Mnkey. genotypic data has been collected using previously described The band smes in Grea Apes and Old World Monkrs microsatellites (e.g. the Genethon collection, Weissenbach, J., etal., were sinml to ta of the smalles human allele (750 bp). The PCR products in Nature, 359, 794801,1992 and the Marshfild collection, Wang, ZI and NowWorld Monkeys were smaller, bcd*nga230 bp ofthe sequerne. Weber, J.L, Genomics, 13, 532-536,1992). The sex-average map is 154 Tho lous appeared to be onomphic i the nonhum primates tested cM in length and includes 25 markers uniquely placed with odds of at least S nce analysis d New World Monkeys lecod th petive 1000:1. The female map is 193cM in length and the male map is 122 cM. sequence mid approximately 80 bp of the 3' untransted region. Howvr, The largest gap in the sex-average map Is 23.5cM (the Interval D14S24- repeiiv se were present in Old World Monkeys and Gret Apes and D14S63). Correlation's between the linkage and cytogenetic maps have were all besed on a TA-dkxcloolde ropet sequenc as follows: baboon (TA)4; been made using physically localized polymorphic markers. macaque (rA),; afrbngreen morkeyG(TA),T: orangutan (TA),AA^rA),CA(rA),; gorilla (TA),(CA dchip e (rA),(CA),4: human [G(TA).C] where n oqus 4 to 11, and N eui 3 to 17. Thus the uctural chage occurring during evoluton ae chaacterzd by elongation and hicreasd omplexlty of the Al repettsequence. Emganeolahigro rderperiodiciy-supermpos onthe in huan I..q sequenc ssoad with aldeic v . at ma

1059 1060 a Resolution Map of 3p25 Sigh Microsatellite-based linkage analysis in a family with Van der Woude syndrome ((N. Pillet, S. Fokstuen, J. Hohlfeld G. Pescia and D.F. Schorderet.)) Division autonome Z"V0_mu-vafee aw, Loeb Mr0 LuL NO, Whivennt 5', Taoka LU, Smith DIO, Drab~iu, Vac JItb degdn6tu m6dicale, Unit6 degenetique mol6culaire and Id6partement de chiure pddiatrique, CHUV, Lausne, Switzerlnd. buke university, Durch, MC, U5g Oayns State University, Detroit, Michigan, USau foniversity of Colorado Cancer Canter, Denver, Colorado, USA. Van der Woude syndrome is a form of inherited deft lip/palate syndrome of we have constructed a high reolutioa genetic sap thehm associat with mucous cysts of the lower hp. Linkage studies perfomned by Murray region IBPISR (Landr et aI., Te iltal ap was 3p25 asing 1967). et al. (AmJ Hum Genet, 46:486.491,1990) have mapped the VWS gene proximal to establLahed using regionally mpped dinucleotlde ragmats of Jones et aI. (1992) and our collaborators (Y. hiamnent,p.A. Drabkin). A the renin gene (REN). Using microsaelites priously mapped to chromosome 1, we greater than 1000.1 odds anchor mp of p-tr-0D321038-D38651-D32656- analyzed a 3-genemrion family in which all the children (4) and grandchildren (4) D3S110-D381255-cn was found (PerLcak-Vance et al., Md Genet 1993). were affected. For a secod generaILon makp, additional arkers frm this region were added. cleotlde repeat mrkers wer identified and in our laboratory (D351360, D3S100, and D351479) frm cosmids (o.j. SaLth). These comida map to the radiation hybrid R711- 6SI (D3e1360,D3s100) or a2.5 _egabase yac coatig (D351479) surrounding D3S720. Additional makrs mapped ware D35357 l7X111 (N.A. Drabkin).pter-D3J1035-D3D351-D355S5-D3S1110-D3100-R7KlllDSl2SS-D3S357-A 1000:1 odda mp wa constructed with the reaulting order D351360-on. xxtenaive checking for error waa done, facilitated by the program c IOC (Raines, 1992). The overall error rate for the mp was 0.2%. The Smnethon makers, D3S1263 and D3812S9, regionally mapped (1000:1) between 035656 and the region dlital to 0351035. This map *pens a genetic distance of 19.1 cM in feales and 14.4 cM in males with an average distance of 16.C cM.

We did not find any recombination between REN - D1S255 - DISS9 and D1S103. However, we found recombination in three mcioses between DISIS8 and VWS- REN, confirming the location of VWS to that particular region in our family. According to Engelstein et al. (Genomics 15:251-258,1993). DIS1S8 and REN are separated by19 cM (sex average distance). We are currently extending our mapping analysis, using microsatellites and probes located between these 2 markers. Linkage Mapping and Polymorphisms (continued) 1061 1062 Eight new dinucleotide repeat polymorphisms on human chromosome 22. Identity-by-descent mapping of Hirschsprung disease in a large Mennonite and J. C. Porter and J. M. PuckJ. Department of Pediatrics, Chiidren's Hospital of kindred. ((E.G. Puffenberger, E.R. Kauffman, S. Balk, M. Angrist, T.C. Matise, Rhiladelphia and Univ. of Pennsyivania School of Medicine, Philadelphia, PA k Chakravart.)) Dept of Human Genetics, U. of Piltsbugh, Pitsugh, PA. Short tandem repeat polymorphisms (STRs) are valuable tools for genetic Hirschsprung disem (HSCR) is a congenital disorder of the gastrointestinal mapping because they are highly informative, abundant in the human tr characterized by a ack of Intrinsic ganglion cells in the distal gut. We have genome, and readly assayed by PCR. We have previouly Identified 15 poly- identified a brge, inbred Mennonite kindred segregating HSCR. Sixty-one nuclear TG STSa on CH22, and have now characterized 10 additional ones. A flow familles with one or more affected individuals have been ascertained; blood sorted Ch22 phag Eibrary, LL22NLO2 (ATCC 57779), was suboloned as samples have been collected from 37 families, representing 42 affected BstYl fragments with average size of 1 kb and was screened with a synthetic Individuals. Extensive genealogies, prepared from published and private records, poly-TG probe. Ten positive lones were sequenced; each poly-TG target was identified a single common ancestral couple for all 122 parents of affected identified, and flanking primers were choen to construct an STS. PCR was individuals. The average kinship coefficlent for the parents in each nuclear family carried out in 25 ul using 0.1-1 ug genomic DNA and 13 pmoles of primers, was 0.01178. Segregation analysis ylded a segregation ratio of 12% for males with a S min Initial denaturation follwed by 25 cycles of 950 for 1 min, 620 for and 6.2% for females with a mean segregation ratio of 9.1%. I min, and 720 for 1.2 min, in 0.25 mM dNTPs; 10 mM Tris, pH 8.3; 50 mM A genetic linkage study has been initiated to identify the gene(s) involved in the KCI; 1.5 mM MgCI2. Amplification of genomic DNA from CEPH indivduals development of HSCR in this extended pedigree. Since the parents of all affected demonstrated polymorphisms with Mendelian inheritance in 8 of the 10 STSs; individuals descend from a common ancestral couple, we are searching the the remaining 2 were not polymorphic. PCR of DNA from a human/rodent genome for regions of chromosomes demonstrating identity-by-descent (16B). hybrid mapping panel confirmed the localization to CH22 and provided a High resolution linkage maps of published microsatellite markers were regional assignment for each clone. The number of dinucleotides found constructed for each chromosome using the computer program, MulIMap. Thes ranged from 12-28. Heterozygosity was 25% to 85%. Regional localization by maps were used to choose appropriately spaced markers (5-15 cM apart) on hybrid mapping panel indicated that the new markers come from each of the each chromosome. Three nuclear familles, each with two affected children and regions 22q11.1-q12.1, 22q12, and 22q13. These new markers, combined one with an affected father, were typed for greater than 100 markers on with our previously developed CH22 poly-TGs, provide strong evidence that chromosomes 4, 9, 10, 13, 20, 21, and 22. Each chromosome was typed in toto I) the degree of heterozygosity correlates directly with length of the TG repeat; and haplotypas for each Individual were constructed using the computer program, and Ii) complex imperfect repeats are less informative than perfect TG HAPLO. Several chromosomal regions demonstrated concordant inheritance repeats. We continue to find a higher concentration of TG repeats (16 of 25 within each nuclear family. Further haplotype analysis in thse regions using 34 total) in the giemsa dark band 22q12 than elsewhere on CH22. additional nuclear families excluded IBD for a dominant or a recessive HSCR locus. No recessive B8D regions were identified on the 7 chromosomes studied.

1063 1064 A potential linkage for schizophrenia on chromosome Genetic mapping of chromosome 8q22.3-qter with short tandem repeat 22ql2-ql3. ((A. E. Pulver1, Karayiorgou2, P. polymorphisms. ((R. Riley1, L. Neison', J. LuW. B. Oterud3, M. Robton9, WolyniecL, Antonarakisl, D. Housman2, L. Kaschl, M. Leppert2.3, K. Ward.2)) Department of Obstetrics and Gynecology1, H. Kazazian1, M. Lsaczl, V. K. Lassatorl J. McGrathl, Human Geneticis, and the Howard Hughes Medical Institute3, University of D. Meyersl J Nestadtl, J. ott3, E. Ramu, M. Lake Utah Kimberlandi, R. Babbl, N.DeMarchi1, B. ChildaL.)) Ithe Utah School of Medicine, Salt City, Johns Hopkins University Medical School, Baltimore Maryland, 'Massachusetts Institute of Technology, A total of 26 short tandem repeats were isolated from a flow-sorted Cambridge, Massachusetts; 3Columbia University, Now chromosome 8 specIfic cosmid library obtained from Los Alamos National York, NMw York. Laboratories (Gene 79:9-20, 1989). Using a hybrid cell panel (Genomics 10:114-125, 1991) these markers were physically mapped to the 8q2.3- Using a collection of 39 families having two 7 or more individuals affected with schizophrenia, we Bqter region of chromosome 8. These markers include dinucleotide performed linkage analyses to identify loci that confer repeats (CA)n and 19 tetranucleotide repeat (GGAT, AAAG, AAAT or susceptibility to schizophrenia. The majority (85%) of AGAT)n. 32 CEPH families were selected for mapping according to overall the families were ascertained through an epidemiologic- informativ. The 26 STRs are being analyzed In these 32 families. 3 of genetic search of schizophrenia in a systematic sample these markers (D8S343, D8S348, and D8S315) have been placed on the of patients admitted to 15 Maryland hospitals over a 1000:1 odds alt orders period of 6 years. The model used for linkage is CEPH map with greater than against using complex incorporating certainty of the diagnosis and the ILINK multilocus linkage analysis program. Intedocus intervals represent age-of-onset. A 2-stage strategy for searching was sex-averaged recombinaton frequences. developed using simulation studies of the given family structures. After 240 DNA markers were analysed, a cen - D8S343-.11 - D8S32 -.06 -DS200-.06- D8S85 -.07- D8S199- was observed lod 1.54). The potential linkage (maximum - - .06 - -.07 - D8S32 - - - random search also continued with 430 markers now .02 D8S198 DS348 c-Myc D8S315 qter analysed on the most informative families. 22ql2-q13 region remains the most positive for linkage. An effort Partial typing of four others markers (D8S341, D8S300, D8S342, and has been made to maximize the lod score for the region D85321) allows a preliminary loaliatin as follows: DWS341 le between by varying parameters in the model, and the maximized 08343 and D8S85, D8S300 between D8S32 and D8S85, D8S342 model gives a lod of 2.82 for the 39 families. A between D8S85 and D8S198, and D8S321 between DS5348 and D8S32. collaborative effort is underway to try to verify the Multi locus mapping analysis is currently underway to place the other finding. markers which have been localized to 8q22.3-qter on the map.

1065 1066 Inkage mapping of form (RP1) of dominant o Genetic linkage heterogeneity In myotubular myopathy. ((*F. Samson, M. to 8q11-q21 and exclusion of cndidate gees. ((LA Sadler', S.H. Bl2, Heimburger, * L. Mesnard, *J.J. Mercadler, +A. Hanauer, ++N. Feigold, R.A Cottinghsm3, C.M. Crat, A. SwWop, M.J. Wagner, J.R. H +J.L Mandel; #M. Fardeau.)) *CNRS URA 1159, Le Plessis Robinson; S.P. Dailgr')). 'The Univ. of Tan HSC at Houston; 2Univ. of VIrgna, INSERM +U184, Strasbourg, #U153 and ++U155, Paris, France. Chadottsvllie; %Bylor Collig of Medicine, Houston, TX; *The Univ. of Tea Med. Ctr, Da; Uv. of Michin, An Arbor, Univ. of Houston, Myotubular myopathy is a severe congenital myopathy which Is Inherited TX; and 7Juls Stsin Eye lnst, Univ. of Cailfomna, Los Angeles. as an X-linked disorder (XLMTM): McKusick N" 31040. it has ben localized to the Xq27-28 region (Thomas et al., 190). Snificant linkage reporte kikg of the RPI to DNA marer inthe pericentric has been established for the linkage group DX8304, DXSlS, DXS52, Earierwe evidence renof chro some The gene is found in an extended, n er DXS305 and FVIII. Initially, published linkage studis no a thr g i Kenucky family with ovr 200 ivg, ffeced hmily members. To dase we hae for heterogeneity in XLMTM. The present study reports not to Xq28 probe. In this tetd markers from chromosome 8 for to the RPI locus In family with apparently typical XLMTM linked 25 DNA lWkage family the proband was a male who died In th neonatal perIod with severe family. Of the, 12 show satil sgificant evidence for linkage, two hypotonla and met the clinical and hlstopathoogcal criterla for XLMTM. (D0S108 and 08S185 at 0% mbn with max;mum lod scor of 3.8 and Carrier status of the mother and of possible hetrozygot females was 9.9 respetive. Using CEPH ltkagp dat we can paet 12 markers in ascertained by muscle biopsy. Because of its histological similarities with order from Spli through S2 with an average distance of 4 cM between XLMTM and the possibility of complete lack of penetrance in some cacaoIt Lnkage anaysis p theRPeI locus In the region 8q11-q21, individuals carrying the myotonic dystrophy gne (MD), congenital a span of approximtely Unkage analysis wa facilitated by an myotonic dystrophy (CMD) has been excluded by searching for the CTG ion UNKAGE run nin 40 tim faster tan previous version. expansion demonstrated in MD.The results show that while the prsno of We hae elmiatd sevea ge n the cau of RP1. Stucur greatly expanded allele was detected In CMD, no expansion was found in cd eikmatd by lkage exi in cude ANK1, CA2, CRH, GPT, LPL, PENK the proband affected from myotubular myopathy, excluding the possbity and PLAT. Two c a, NATI/NAT2 and cutr, map to Spr-p and of missdlagnosis. Furthermore, all individuals were resampled to confirm dstal Bp r Faly, a cvhrmosme 8 osd wih sequenc simiry marker results. Unkage study for 10 markers of the Xq27-q28 region was to a retina-derIved, SRY-reltd cDNA from dchrmosoe 3 ha boen mexud performed: DXS105, DXS98, DXS548, FRAXAC2, DXS296,IDS, DXS304, byliagetesing. Curet wearetestin two drvdc Nsthatmap DXS3OS, DXS52 and FVIII. Seven markers of these 10 were informative. to rionb and addital cDNAs frm a specc libr . Multiple crossovers Involving these markers were detected suggesting absence of linkage in this family. These data raise the posslity of genet Supportd by gran om te Natoa RP Foundation, the George Gund heterogeneity In myotubular myopathy which will have Important Foundion and from NE-NIH. applications for genetic counselling. Linkage Mapping and Polymorphisms (continued) 1067 1068 MicrotIllito based fine mapping QJ Van der WNude Syndrom,,pn 1 q. ((1 A. X-chromosoml Retinitis pigmenlosa: Genetic mapping and cloning Cander, T. Scherpbler-Heddema, 'KBuetow, R. Schmeizle, 4J. Murrgy)) ((MR Ca , A MoindlT SbomB MowB Wl_, Clinic of Oral-Maxillofacial Surgery, University of Hatburg, Germany; Fox (. SantosCrvaih A. Meni,TSrmB r BM. Rosa" aNd Chase Cancer Center, Philadelphia, PA 19111, USA; Department of T Mene b fnrPed.GenetikY Kdmrpol d sr chen, 'inst. fK Pediatrics, University of Iowa, Iowa City, IA 52242, USA. Hu nk, Mntr, , r Rsc Fund, London, UK Since Fogh-Andersen's study (1942) clefts of the primary and secondary LOCU hetro has been dfe d or X-Nnked retnis pigmeniosa palate are considered to have differing etiology. The autosomal dominant four probes on the short X crmnosome arm, DXS14, DXS7, DXS84 and DXS2B, Van der Woude syndrome (VWS) reprmsents the most frequent form of define three intervals conft the lod RP2, RP3 and RP6 r y. In order syndromi cleft lip/cleft palate and is one of the rare disorders in which to refine the candidate regions for the XLRP genes we de d new genetic clefting of the primary and secondary palate may be seen to segregate as mariers for analysis. Four newly idend around components of the ame gone. The gons has been localized to 1q32-41 of linkage CAepeat mapping chromosome 1 by two studies using RFLP markers (Murray at al. 1990, OTC and TIMP were used for linkage analysis in combination wIth 8 Sander at al. 1993). TGFB2, a strong candidate gone for cleft palate mar covering all ree irvals. A h o test in 24 RP famlies with the mapping to this region, could be excluded as being causative (Sander at al. program HOMOG shows no t evidence for heroney ad prvdes a 1993). likelihood es t r maxmwum theoof te e lcon 1 cM to OTC Sige To determine the location of VWS more precisely and to narrow down th rcmbxinantseiooInants bestween diseaselocusatinde chmarkerhave bee fOund for gene-containing interval, 19 additional families (a total of 84 affected beween te die kcus and each nr haw bow toW for individuals) were analyzed in a linkage study using exclusively PCR-based every marker except for OTC (51 Normative meoses). A location of RP3 proximal short tandem repeat polymorphisms (STRa) with high heterozygosity. A set to OTC cannot be excluded. Nine of the reconbinants occured around the OTC of 12 STRs covering a length of at east 32 cM distal to the F13B locus locus and urther genicmars should alow to refine e RP3nerval. i an was selected primarily from two maps (Weissenbach et al. 1992; Engelstein attempt to characterize the OTC in the RP3 we at al. All markers reached region inorvall isolated YACs from 1993). lod 3 support. Analysis of recombinant te ICRF-YAC library A YAC contig e r te CGD and OTC kW and a chromosomes from individuals affected with VWS verifies a localization for the kCRregAo iy g encoepas the CGD and YTC a the disease locus distal of DISB65-REN and therefore, more distally than 250 kb reln extending to te comere was obd wi thee YACs SindSigl previously suggested. Close linkage was found for D1 S249 (Zma 15 52 copy probes from cosmids derived from the YACs were used for the generation ato - 0.03), DIS245 (Zma 19.33 atO - 0.016) and D1S205 (Zma of a genomic nap of the region around the OTC locus. Cosmids frm the 19.74 at 0 - 0.01 3). A multipoint linkage analysis integrating the markers characterized YACs containing mapped rare cutter sites are currently used for of the two maps places the gone within the interval D e249-Di S320. finer localization of VWS to the interval Dl1 249-Di1 S205 is supported byAda OkSqec agdsie (STS)SS weegnrtdfog d om recombination event in an unaffected individual. cosmnids as well as from YACs by Alu-PCR. They will be usefi for sabsequent efforts aimed at getc fine mapping and cloning the RP3 gene.

1069 1070 Linka and homogeneity tasting: Localization of Tuberous Sclerosis Variblity of cuaeus meli _cr lm ad I ae nals in X-liked on chro 9 and 16. ((S. Schluapf(l), P.J. Vilson(l), V. ocubr al*bnisnL ((RE Schnur1.2, PA Wickl, MI Edwards3, RL Nusu2.)) Guilleaettt(l), M. Sytsma(l), C.M. Bove(l), D.J. Kviatkovski(2), H.P. 1.Children's Hospital of Philadelphia, 2.the University of Pennsylvania School of Short(l), and J.L. Hainas(l).)) 1). Massachusetts General Hospital, Medicine, 3.Newcsde We Sub W Boston, MiA; 2). Brigham and Vomen's Hospital, Boston, MA. Hoital, _ratah, Australia. One for Tuberous Sclerosis 119 individuals from 11 families with X-linked ocul albiniam (OA) were nsudied gene (TSC) has been localized to In a4 chromosome 9q34 and a second gene has bean localized to 16p13 (Kandt genaton Australian family, 2 affected males and an obligatory carrier lackd at al., Nature Genetics, 1992). Va have examined 31 families for cutneous mel macro (MMGs); ocula features wer identical to ths of linkage and homogeneity. To chromosome 9 markers shoy significant Neuleship Falls OA. P to obtaining skin biopsy results, linkage analyulapredicted evidence for linkage: ASS (lod-4.54 en0.20) and D95122 (lod-6O00 a normal male fetw in an "at risk" pregnancy and was with l n of 5.0.15). No other markers a lod score than the disease to Xp22.3. All OA families we aed t DXS16, DXSS, DXS143. generated greater 3.0. " Examining the crossovers in chromosome 9-linked families, our results STS, DXS452, and fora CArpeat po at- S ep rate two suggest a placement of the gene distal to D9S64 and proximal to analyses were performed for. -6 with by-proven atMin a N9567, a region spanning 14cM. It should be noted that 2 crosses least 1 affected mnle; gr=B-4 families who werenot bi m C-theMMG- exclude this candidate region. Similar results have been seen vith negative family (15 samples). DXS143 showed only 1 rombintion in a Group A myotonic dystrophy and Huntington disease, suggesting that the affected male. KAL recombined with OA in 4 phse unknown meioses, (2-Group chromosome 9 TSC gene may be a trinuclootide repeat mutation. On A;2-Goup C). An additionalcrossoverin Group tplad DXS452 distal to STS. chromosome 16, analysis of D16S283, D16S291, D16S292, and KG8 yielded no scores than lod greater 1.06. Chromosome 9 and 16 markers vere -z -0 -(d individually tested for homogeneity using tvo point and multipoint DXS16 .05 2.14 .05 2.45 analysis, but homogeneity could not be rejected. Hovever, a combined .25 0.10 .08 4.48 multipoint (ASS--D9S122/KGB--D16S291--D16S283) provided strong DXS8S .15 0.59 .00 3.26 .00 0.15 .05 3.56 evidence against homogeneity vith log 0 odds being 3.38. The DXS143 .05 4.34 .00 4.25 .00 1.26 .02 9.56 estimated proportion of chromosome 9-linked families is 0.73. Since KAL .10 3.31 .00 7.01 .25 0.07 .06 9.31 nine families could not be definately assigned to either chromosome, STS .10 2.65 .05 1.52 .15 0.56 .09 4.71 the possibility of a third locus cannot be eliminated. DXS452 .05 4.85 .05 5.92 .25 0.35 .07 10.48 Differences in the 3 groups wae not significant with this daet. Assuming a singe OA locus, combined multipoint analysis (LINKMAP) suggested the order SMS- DXS143-OA-DXS8S-DXS16 with a maximum lod score of 15.38. This was 73 times more likely than the next most likely order. However, more complete clinical evaluation of new OA families, including skin biopsies of affected males, will be need to definitively exclude genetic, a well asphenotypic heterogeneity.

1071 1072 Extended multipoint identity-descent models for the analysis of complex v stain detecton of shor tandm repeat loc ad raid human quantitative traits. ((N. J. Schork.)) Departments of Medicine and dhe u inescent analysis of VNTR led. J.W. Schumm. CJ. Epidemiology, The University of Michigan, Ann Arbor, Michigan. Sorecher. A. Un. and C. Puars. Promega Corp., Madison, WI. Goldgar (American Joumal of Human Genetics 47:957-967; 1990) introduced a novel marker-based method for partitioning the variation of a Nonisotopic detection of polymerass chain reaction-amplified loci quantitative trait into specific chromosomal regions. Godgar's method such as short tandem repeats and microsatellites has been does not rely on the estimation of statistical quantities associatedwith each achieved using silver stain detection of amplified DNA products. locus thought to affect the trait of interest (e.g., allele frequencies, No modified penetrances, etc.). As such Goldgar's method avoids many pitfalls radioactivity, primers, or expensive equipment is associated with traditional linkage-analysis based techniques for required for rapid detection. Allefic ladders containing a mixture of quantitative traits. In this paper, a number of exensionrs to Goidgars basic amplified alleles were constructed for several STR systems to allow model are described which make it more powerful and flexible. These rapid and precise scoring of their respective allels. In addition, the extensions include allowances for non-linear covariate effects, shared- alelic ladders allow simple interpretation of several amplified environmental x factors, gene environment interactions, and multivariate samples of the same locus loaded sequentially in a single lane. phenotypes. In addition, Goldgars method can be made relatively 'robust' statistically and can convenlently take advantageof recent, novel molecular Rapid nonisotopic detection of VNTR allels was also achieved in genetic breakthroughs such as genomic mismatch scanning' (Nelson et les than seven hours following gel electrophoresis of restricted al Nature Genetics 4:11-18; 1993) for testing purposes. Theoretical genomic DNA. We have demonstrated an efficient method for one studies pertaining to power, sample size requirements for relevant hour Southern transfer, combined it with rapid hybridization of hypothesis tests, and estimation procedures for the proposed extended alkaline versions of Goldgars method are described. These studies suggest that directly conjugated phosphese-oligonucleotide probes, extensions of Goldgar's method may provide novel and practical and chemiluminescent detection. Several probes which detect alternatives to traditional locus-based linkage methods for the study of highly polymorphic loci (including D2S44, D1 OS28, and D17S26) complex quantitative phenotypes in humans, and as such may provide were constructed and can be used for genetic analyses such as appropriate methodologies for the analysis of traitswhose genetic bases confirmation of to accompany inheritance of are to be patemity genetic currently thought too difficult to be characterized. disease loci, analysis of bone marrow transplantation, and forensic applications. This approach could also be broadly applied in linkage analyses. Linkage Mapping anid Polymorphisms (continued) 1073 1074 Renpenning syndrome: Evidence for pericentric location of the gene In two Accuracy of genotyping using fluorescent multiplex techniques versus families. including the original Renpenning family. ((C.E. Schwartz 1, L. Ouzts1, radlolabeling. ((D.A. Schwengel', A.E. Jedlicka', J.L. Weber2, R.C. Levitt')). A. Gibson2, R. Cadle3. J.F. Arena4. E. Boyd1, B. Hall3, H.A Lubs4. R.E. 'Johns Hopkins Med. Inst., Baltimore, MD; Marshfieid Med. Res. Foundatlon, WI. Stevenson1.)) 1 Greenwood Genetic Center, Greenwood, S.C.,2Dept Pediatrics, Marshfleld, Univ of Saskatchewan, Saskatoon, Canada,3Div of Genetics, Univ Kentucky College of Medicine, Lexington, N.Y.,4 Mailman Center, Univ Miami School of The challengeof mapping major genesforcomplex genetic disorders demands Medicine, Miami, FL. more sensitive, accurate, and efficient techniques. Automated fluorescence technology provides real time detection, and links gel Information directly to In et al (Can Med J a computer databases. Fluorescent labels also provide improved sensltivity as 1962 Renpenning Assoc 87:954) reported Canadian to PCR can be family with mental retardation. The affected males were described as compared autoradlography. Multiple products elactrophoresed X-lnked in the same lane of a gel and distinguished on the basis of color. We have having no definitive features apart from prominent ears and small head combined 24 highly polymorphic simple sequence repeats (SSR) per lane. circumferences. However upon restudy, Fox at al (Am J Med Genet 7:491, Although multiplexing with fluorescence is highly efficient, no one has 1980) thought the affected males differed in enough respects from other males compared the accuracy of genotyping by this approach compared to In the family that the authors suggested they represented a distinct clinical entity radiolabeling. ThreeSSR mfd 1(176-196 bp), mfd 59 (175-195 bp), and mfd (MIM:309500). The clinical presentation was severe mental retardation, head 154 (186-204 bp) were chosen forstudy whose PCR products overlap In size. circumference two standard deviations below normal, testicular size ranging One oligonucleotide of each marker was labeled with fluorescence at the 5' from very small to normal, and a tendency toward short stature. end (mfd 59-FAM, mfd 154-JOE, mfd 1-TMR) or by 32P. Each individual from Restudy of this family has confirmed the clinical findings and suggests linkage 5 CEPH families (884, 1331, 1332, 1333, and 1362) was amplified by PCR. to lWi located in the proximal region of the short arm of the X chromosome. No Radioactive products were separated by conventional eictrophoresIs and recombination was observed with DXS84 (Zmax = 1.66), DXS14 (Zmax = 1.24). scored manuallyusingautoradiography. Fluorescent products were separated Recombination was observed at the DMD and AR loci. We have also recently on an ABI 373 scanner and analyzed using GENESCAN 672 software. A total analyzed a second family (K8240) with the same triad of clinical findings. of 5 typing discrepancies were identified between the two techniques, one Preliminary linkage analysis in this family reveals tight linkage (theta=0.00) at was a recording error in the database. There was < 1% discrepancy when DSX255 (Zmax-2.74) in Xpl1.2 and AR (Zmax=1.97) in Xq12. comparingthe two genotypingtechniques (4/462 alieles). Discrepancies were attributed to one technique or the other by repeated sampling. No 'cross Further analysis are in progress utilizing loci in the pericentric region of the X talk" was detected between the dyes. The incorporation of fluorescent chromosome In both families in order to see If they exhibit fight linkage to similar Internal size standards provided more precise sizing of allee as compared to markers. We have also obtained archival material on four deceased males in radiolabeling. Our data support the use of high through-put high effiincy the Renpenning family and are continuing the linkage studies. genotyping for linkage studies using fluorescence-based techniques.

1075 1076 Genetic mapping of familial open angle glaucoma to chromosome Iq21-q31 Modeling a 'natural mapping unction. ((Y.Y. Shugart, C.SA. Fann, and J. and analysis of candidate genes. ((V.C. Sheffield1, B.E. Nichois2, W.LM. Alward2, A.V. Drack3, A.T. Johnson4, LM. Streb2, and E.M. Stone2.)) The Ot)) Columbia University, New York, Univ. of Iowa, Iowa City. University of Iowa Dept. of Pediatricsl and Ophthalmology2, Emory University3, and the University of Mlchigan4. A genetic mapping function is defined as a mathmat ialtransformetion between recombination fraction and map distance. Many such functions have Glaucoma is the second leading cause of blindness In developed countries, and the leading cause among African-Americans. We have been derived under different, potedally uwaraed assumpts about the recently reported Inkage in a single family with autosomal dominant juvenile true nature of interfec. We devlped an approxmate method for dering open-angle glaucoma (JOAG) to markers on chromosome iq (Nature a free functIon, in which no assumions about Genetics 4, 47-50). This region harbors two genes that are candidate genes parameter map prior for this disorder. atrial natriuretic peptide receptor-A (ANPR-A) and laminin reo are required. For a number, n, of inked ordered markers on chain B2 (LAMB2). Atrial natriuretic peptide is Involved In the (ANP) a we iitially take the Inter-marker recombination fractions to be regulation of blood pressure, electrolyte balance, and extracellular fluid volume. ANP and its receptors are expressed in the aqueous humor and the map distances. For each of the n(n-1)12 pairs of loci, we ed the diary body, respectively. The ANPR-A gene has been localized to bands recombnatlwon fraction Uand te map distar xbetween te two oci, wher q21-q22 on chromosome 1. We used SSCP analysis to locate a polymorphism in this gene. Genotyping In CEPH families places the ANPR- x is simply te sum of the map distances in all irnervals between the loci. A gene close to marker D1S305. Since this marker Is approximately 30cM Using statislical mehods of curve fitng (poloares pice outside of the genetic region of the glaucoma locus, mutations within the linear regression) we find a first approximation to our map function ANPR-A gene cannot be responsible for glaucoma in this family. Laminin is O6RYX). an extracellular adhesion glycoprotein. Structural molecules play an Based onXt, the ntermarkerr ecbinationsfraction arem baormed to map important role in the proper functioning of the trabecular and the meshwork, distances and the above procedue is re d, which leads to an updated genes which encode these proteins are candidate genes for glaucoma. The laminin 82 chain gene has been localized to chromosome 1q31. An map Huntion. This, in turn, is used to obtain updated values of intermarker intragenic dinucleotide repeat polymorphism demonstrated two map distances. etc. This approach provides a way of d putative recombinations in affected individuals In our family with JOAG, excluding it genetic nterferenc in a of the gne as a disease-causing gene. Furthermore, LAMB2 lies approximately 5cM operating given segment map. centromeric to D1S191, the closest previous flanking telomeric marker, refining the region which contains the glaucoma gene.

1077 1078 gnotic linkage yound X-linkqd re tinosoiis (RS) Unkage disequclIbriun between certain chromsome 5q markers and 2C [P.A.Sie-ing, Z.Binghay, -Z.ZhuangA,-JLRichards, ch~dhood-onset spirl musctla atrophy SMAM in the French Canadian IP.Boome, K-.Cvapenaar, J.T.den Dunnen, IL.Lunetta, populaton. ((1L. R. Simard, G. Prescott, C. Rochette, K. Morgan', S. B. 2K.Boehnke]]. LUniversity of Michigan, Ann Arbor, MI; Melangen and M. Vanea.)) SteJust Hospital and Univ. of 2Dept. Human Genetics, Leiden University, The Netherlands; Montreal, 3institute for Molecular oenetics, Baylor, Houston, TX. 'McGill Univ., Monta, Qu.bec Canada.

We are attempting to refine the gnetic intervals for Chlldhood-onet SMAIsan aosomal rece i eropethy of the lowr RS and have tested a dinucleotide repeat microsatellite motor naurona resulting from Vie selective d r of the antr hon marker at ss841i (Wapenar et al, ¢enomics, 1992). This celsothef p in cord. Despiteextenslvclinical rgeneitythgenefor (CA)n marker was scored against 100 X-chromosomes from 50 SMA has been initial in Vi unrelated females outside of the RS families and ehowed 11 localized to ql1.2-13.3. Our linkage studies alleles of 142-164bp with PIC -0.84a and heterosygosity Frenh Canadian popadon tpreny a total of 17 famIlies incldlein 28 -O.J56. The marker was highly iformativ p nine affected i lhave bean extndedto include moroatlitmerkereat unrelated RB families and gave Z-22.8 with _0-.02. Vie DUS125. D5S351, D5S435.KS,3CA1/2 and MAPIBlood. We observed Recombination data from affected individuals suggest that linkage between Oe diesm and ol of the new makers studied. this marker lies outside the interval of DX541-DX543 which Analys of ecombinstoneventsprovidesevkdnoefor d followinggenetic flank RS in our large families (Sieving et al, Am J Hun rnp: cn-D5S6-D5S125-D5S351)-D5S435-MAP1B-(JK53CAI Genet, 1990). We are currently ordering this (CA)n marker /2-DS39)- with respict to DX541, DX89, DX843 and DX816. DMS78-ter. Keyrecominstionevem piostSMLAgenbetwenD5S435 We are continuing to test multiple markers against our and D5S78. The disributi of alees for each of th loc wee analyzed for 34 unrelated RS pedigrees and 6 isolate RS affected sales. atotalot42norml(obligate to gotesland32SMArcbeomN We Thus far only four 35 pedigrees are informative wth RCS Idnti signifkican meo ations between SMA an specific th (DM59), but these show no recombination&, giving I-6.15 and D5S435 and JK53CAI/2 Mdi. These dat the e-0.0. One RS carrier and one normal show recombination DSS125, provide with pD2 (DM843). CRI-L1391 (DM3274) has not been evldnosoflinigediaqulcibetween Sqnmwarandchldhood SMAs. informative genetically in our families thus far, but a Hapeianalysis for D58125-D55435-JK53 revealed 19 dIffent SMA preliminary genomic long-range restriction map places chomosmes suggstin tha -m mutations caus Oth~ disem. DM5274 tely 2500kb centromeric of DXS9. The Nonthles.#two hplotypeacountfor30% ofml SMAhromosomesinthe Washington Unirity YAC library was screened using RC8, Frewnculnapopu yrrsettwo w roimoomes. and several clones were obtained that are being used for further physical mapping and genetic studies. (Supported by the National RtLnitis Pigmentosa Fdn, Baltimore, MD.) Linkage Mapping and Polymorphisms (continued) 1079 1080 Genetic analysis of additional families with Genetic analysis ot ten new polymorphisms In 11q13 between CD20 North Carolina macular dystrophy (MCDR1). and INT2 ((C.M. Smith, E. Lawrence, S.W. Wells2, and D.S. Gerhard.)) ((KW Small', AR Sanchez1, KC Kelleyl, G Gallardo2, C Garcia2, Depts. of Genetics and 2Surgery, Washington University School of J Weber3. E Corder4. M Pericak-Vance4)).University of Florida, Medicine, St. Louis, MO. Gainesville, FL1; University of Texas, Houston, TX2; Marshfield Medical Research Foundation, Marshfield, WI3; Duke University, Durham, NC4. Multiple endocrine neoplasia type I is an autosomal dominant disease that predisposes individuals to neoplasms of the pancreas, pituitary, and North Carolina Maculardystrophy (MCDR1) is an autosomal dominant trait parathyroid. The disease has been localized to a 7 cM region between with highly varible expressivity and is similar to age related macular pepsinogen A and a polymorphic marker D11S146 on chromosome degeneration with the exception of the early age of onset. t was the first 1 1q13. The number of polymorphic loi in this region is low, therefore the macular specific gene mapped (6q by Small et al). The original dataset genetic localization is fairly crude. consisted of a single large family (# 765) from North Carolina. The We generated a chromosome 11 specific recombinant bacteriophage purpose of the present study was 1) to fine map the MCDR1 locus by library and mapped the new markers by somatic cell hybrids. We have determing flanking markers to the disease In anticipation of cloning the identified ten restriction fragment length polymorphisms and one gene and 2) to use these markers to further decipher the nosologyof the microsatellite repeat in the region bounded by CD20 and INT2. The clinical spectrum of MCDR1-like families. We ascertained and sampled average polymorphism information content of any one marker is 0.37. A two new unrelated families (# 768 in Texas, # 1292 in Maryland) with the Venezuelan reference pedigree of 244 indIviduals was used to orderthese MCDR1 phenotype. We tested the markers D6S251-D6S252-D6S249- markers in 2-point and multipoint analysis. Previously mapped loci, D6S283-D6S301 for evidence of linkage in the 3 families and found a including CD20, PGA, PYGM, and INT2 were used to orient our new maximum estimated LOD score - 23.57 at theta..024. There was no markers. The most likely order for these markers is: CD20-D11S820- evidence for genetic heterogenity with all families Inking to the MCDR1 D 1S823-(PGA-D11S817-p863.9)-D1 S819-D11S816-D1 1-822-(PYGM- region on chromosome 6. Thus, these data are useful in desceming the p768.7)-INT2-p341.6-D1 S84-DI 1S821. MCDR1 phenotype; family #1292 was originally thought to be 'central In addition, markers D 11S819, D 11S821, and D11S823 have multiple retinal pigment epithelial dystrophy' because of the lack of peripheral enzyme polymorphisms that may be haplotyped making these loci more retinal drusen. These data also refine the genetic localization of the Informative. Five independent MENI pedigrees were also genotyped to MCDR1 region . Based on these studies It is apparent that MCDR1 is determine the recombinants that exist between the disease and these new more common than previously realized. In addition they demonstrate markers. linkage analysis as a useful tool for clinical classification of new dystrophies. Supported In part by NIH,NEI EY00313 (KWS), Jules and Doris Stein RPB Professorship (KWS), NINDS P01 NS26630 (MPV).

1081 1082 EPclusion map for th second iow of matosomal pycatic Evidence for genetic heterogeneity in the domi ant form disease (ADPKD2). ((S. Somlol, D. Rlynfodsl V. Torre2 S. Tb2, G. of limb-girdle muscular dystrophy. M.q. Speer , L.H. Romeo, L Cscchri, J. Morgn4, P. Parfyh, P. W. Yamaokal, J Gilchrist2 C Westbrook , J.M. Stfjich, P.C. Gaskell , A.D. Roses Pericak-Vance. A t instin Coag ofMed., Bronx, NY1, Mayo Cinic, Rocheter, MN2, t. , M.A. 'Duke University Medical Center Durham, NC; 2Rhode Island G. Gasi Genova, ItW3, Memorial University of Newundland, C 4, Hospital, Providence RI; AUniversity of Chicago Medical Colodo Univ. Helth S. Clr., Dvr5 and Boys Town Nail. Re& Hosp., Center, Chicago IL. Omm NE6. Limb-girdle muscular dystrophy (LoHD) represents a clinically heterogeneous group of disorders and is a ADPKD resalta from matationa in at least two geneticaly distinct ADPKD2 catch-all diagnosis for myriad proximal muscular dystrophies. In addition to clinical accounts for -15% of ADPKD. This disease is dinicaly fom heterogeneity within the LGMD classification, genetic heterogeneity is also ADPKDI although suiva analysis studies_have suggested an overa mi present, with known dominant and recessive forms. Locus course for ADPKD2. Th esbli of linkge to a second would heterogeneity has been shown within the recessive form of kicilitate i in affected families and would provide a starting LGND (Beckmann et al., 1992) with one locus known to poi in the search for the mtated ene. We have gathered 5 laW ADPKD2 reside on chromosome 15q and the locus(i) for the remaining families unknown. indreds with over 250 meicesOand mbarked on a Seome-wide search for We recently localized the gene for a single large, autosomal dominant linkae We hav selected -200 miirosatellte markers with >.80 LGMD (LGH1) family (family 39) to chromosome 5q. Two other dominant spaced at itervalsof<30 cM for this study. Most ofthe markers ae derived from families have been ascertained and studied for IL-9 the Genethon map (-150) with the remainder selcted from the NIWCEPH map to and D5S178, markers which flank the LGM1 locus on cover regio not wel represented in the former. To date, we have analyzed over chromosome 5 and limit its location to a 7 cO region. 50 of tbeh narkr, ofte nuli two at a time, and, in combination with Evidence for genetic heterogeneity is significant using - the multipoint LOD scores and a likelihood pio tudiSa, have excluded 50% of the gnome for linkage to ADPKD2. gives ratio of U >2000:1 in favor of The clinical Tbe ar abityofthes iSy informative linkge markers and of sufficiently heterogeneity. I! presentation of the disease is similar amongst the three fmilies to the conf inke Eu preclude deffecs of possible o y families with the sole difference being an unusual, nasal a the divery of inkage for this disem in short order and make quality to the speech in a majority of affected family U possible efforts to clonethis ene by the available paradigms. members in family 39. To our knowledge, this is the first report of genetic heterogeneity within the dominant form PI.i of LGMD. Elucidation of the genetic location for other dominant LGMD families will assist in categorizing and q defining this broad group of muscular dystrophies. en S

1083 1084

A index linkage map for human chromosome 8. ((T. Steinbrueck, C. Read eneIc htaregenelty In X4-nead hydocephialus; lInkage of HAS2to and H. Donis-Keller.)) Washington Univesity School of Medicine, ms In Xq273.((L Strain, D.J.H. Brock and D.T. Bonthron.)) Human Department d Surgery, Division of Human Molecular Genetics, St. Louis, G Unit,University of Edinburgh, Western General Hospital, Edinburgh, MO. U.K.

Construction of an 'index map' for human chromosome 8 that includes X-linked ew (HSAS) accounts for 7% or more of hydrocephalus In markers with minimnum heterozygosity of 70%, intermarker spacing of no males, with a birth prevalence of at east 1 n 20,000. Patog ,it is by stenosis or of the of more than 15 cM, and geping on the 40 family CEPH resource Is acted oblitebraton aqueduct Syvus. Previous genetic linkage studies of have the nearing completion. We have also reported a comprehensive baseline HSAS1 suggested likelihood of genetic map for this chromosome (Science, 258:67, 1992) and have continued to homogeneity, with linkage to DXS52 and FCin Xq28. The LCAM genebetween add microsatellite markers (e.g. from the Genethon collection, thes markers is mutated In some HSAS famils. Weissenbach et al, Nature 359:794 1992) and further define index marker We inseda family with typical auopsy-confirmed X-lnked aqueductal stenosis, in which are four females. four candidates. Our current map has a sex-average distance of 237 cM and there obligate caner AN affected males had severe ocephalus, and three died The structure was constructed using genotype from the CEPH pedigree resource and perlnatally. family was verified by multilocus The distal markers the program package CRI-MAP (odds for order are 1000:1). Nineteen of fingerprinting. Xq28 (DXS52, FOC) linked to HSAS1 gave negative LOD scores the 20 markers that are uniquely loalized are microsatellites with in thi family. However, linkage was established to the Xq27.3 tociDXS548 and repeat), with two-point haterozygotis of at at 70%, A microsatellite marker Is being FRMXA (CGGn Znmax2-O54 at Expansion or instabiyof the were developed to replace the single RFLP on the map (at the NEFL locus). z0O. CGGn repeat excluded. Therearecurrently 6 intervals with spacing greater than 15 cM, but the Multipoint calculation using UNKMAP indIcated a likely location for the gene maximum interval length is only 23.3 cM. We have closed the 8p terminus (HSAS2) in this family between DXS105 and DXS2S6, with a peak LOD scoreat FRAXAdXS548. of the map with a RFLP marker from a telomere clone (D8F69S2), Since ventricula dilatation in HSAS may occur late in confirmed its localization to 8pier by FISH mapping, and are continuing only pregnancy or potnatly, ultrasound diagnosis is unsati y, and with efforts to identify a microsatellite marker that would serve as the 8p prenatal testing linked Xq28 markers has been advocated. The lack of linkage to Xq28in our endpoint for the map. For the lngarm of the chromosome D8S161 family suggests caution, unless linkage or mutation studieswithin an currently defines theq terminus (D8S161 maps below D8S139 which has indvduIlfamily support involementof Our also that previously been mapped to 8q24.3 by ki situ hybridization. HSAS/LlCAM. experience suggests clinical criteria do not distinguihgenetic typesof X-linked hydrocephalus. Linkage Mapping and Polymorphisms (continued) 1085 1086 Cartilage-hair hypoplasia gene maps to chromosome 9 in Finnish and MULTIPLE SCLEROSIS SUSCEPTIBILITY AND THE TUMOR NECROSIS Amish families and Is very closely inked to D9S163. ((T. Sulisalo1, C. FACTORS. Sean M Sumr & Gorge C Ebers. Duke University Schoo of ic, Durham, NC & d Scienc, University Franoomano2, J. MahW2, P. Slstonen3, V. McKusidc2, A. de la Chapels1 Hosptal, London, ON, C and 1. Iltiia1.4.)) 1Department of Medical Genetics. University of Helsinki. Finland. 2Johns Hopkins University School of Medicine. Baltimore. MD. The search for gen loci which inflen MS suceptibility has largely 3Finnish Red Cross Blood Transfusion focused on cfic c e known to reglte the immune response. Service. Helsinki. Finland. To date, the only un ocaon is wvith oor 4Department of Medical Genetics. Helsinki University Central Hospital. coHnl/x(MPHCloTypis a vr bstyp MS incldigHLA Finland. A3/137 D1! 5,DDw Z) h and a weaker aocin with the HLMA/B8/D --'-e udsdhaftpincudiinD Cartilage-hair hypoplasla (CHH) or McKusick type metaphyseal our own, hpM e evidence f cwea from twin crody is an autosomal recessive skeistal dysplasla of unknown fi stes h ohe genes are ir.lwved genes for tumor necrosis pathogenesis leading to short-limbed stature. Plelotropic associated factors (rNF) are'plb candde loi. TNF is increased in MS lesions, in features include cerebrospinal fuid (CSF) from MS patients, and is directly toxic to hypoplasla of hair, abnormal cellular immunity, deficient OIIQdhridrOQIIS. Furhermore, evels ofsecretion of TNF are Infuenced by erythrogenehs, increased risk of malignancies, and Hhpru diasm. albl variaton whn the MHC. We have recently assigned the CHH gene to chromosome 9 by linkage We examined assoaon at the TNF in 56 analysis In 14 Finnish families. We have now ailelic ocus sibing pairs with studied 26 Amish and 15 MS, c ewith age, sex and l mahed controls. Hap e Finnish CHH famiites and show a very close linkage of the CHH gene to a sharing in the sb pairwas also evidence of likage. We used a marker locus D9S163 (maximum lodscore 21.65 at zero recombination 13 alle mc sl po (TNFa) (HET-0.861) located 3.5 kB fraction). There Is strong aleli associat between CHH and D9S163 n upstream of TNF-*. We d tht TNFa alble 11 Is associatd with, the Amish famiwies (pm 0000002) and a weaker assoclation in Finnish and is in niWeyS diseqgbliurl with DR2 whih is an MHC mrwker for families (p=0.05). No evidence for heterogene was observed in these hyposft d TNF. TNFa ale I1 therore forms part of the extended farrilies nor was there evidence for reduced penetrance that has been W hapkp. TNFa allele 2 is associated with, and is in linkage previously suggested. These results provide a starting point for physical diseq > ian wth D* awnd DR4 whh ware MHC markers for hypersecretion of mapping, cloning, and characterization d the CHH TNF. We found that patients who were TNFa allele 2/11 heterozygotes were gene. increased in our MS popon v. controls (p<0.001). This suggesed a role for the TNF cytokine cascade in the pt e of famIial cases of MS. However, hplotype saing showed no evdNc for linkage.

1087 1088 The gene for Machado-Joseph disease maps to human chromosome I4. Linkage analysis of a new Wnrome ot audsm are ve early ont alxis ((Y. Taklyarna', H. Tanaka', S. Kawashimar, H. Sakamoto', H. Shimazaki' led wth h _uinmia ((H. TM', FL KMM', T. Yues, K Uskawa' It Y. Kanbe', M. Soutome', K. Endo', Y. Mizuno', M. Yoshida', S. Tsuji', M. FR elra, Y. TO N. TT !, K lebucti7, S. Hanr, T. HOl, H. MldO', K Nishzawa' HUyeml", S. Ta'.)) 'Det Neufl., ain RAeIsL, Miet U., J., )) 'Dept of Neurol., Jichi Med. School, Tochbi Japan. Dept Me Dt of Neurol., Brain Res. Inst, Niigata Univ., Nilgata, Japan. -Dept of Neurol., DpLdNeuioL, Tokyo and MMv., Tokyo, Japan, N C Ham The of Phyel~ Oled Taakira-So, Kuninoto, Japan, 4p N l., e Snei Faculty Mod., Juntendo Univ., Tokyo, Japan. Sogel Hoop., NMOMe Jaa, 'Dep o Neural, Na. Senri Nh-Olly Has.. Ig, - r,Trrrhn School and Hoap. Nagoka Rylku, Nll Jan, dt of Macher-Joseph dieae (MJD) is an autoaomei dominant, Neurapea., P PyciiRae ind d Takyo, Tokyo, jaM RahalonI neurodegenerative disorder Involng predominantly cerebellar, pyramidal, Cnr, Kenagswa. Jaa, Noaoak Hoap., Kochd, apan, ofdeyhofP edKN Med. xapyidal, motor neuron and oculomotor systems. Especially In Japan, Schoon. Koh Jpn, "Onocane Div., Ne Canor RAe ns, Tokyo. JlepL MWD is one of fe most common hereditary spnocbel dnoratons. We have a new of Using of poly rp identifie syndre auiosomal receslve early oane alei highly microsatellits DNA polyrsms we undertook eocated wih hypoebuminei (EOAHA). The clinical fat of Mu nrw genetic linkage analysis in a single large Japanese MD family of 5 sdrome anre c rad_ by early cldhood , cerebelar _axis, gen ions. wa arfisds DNA obtained with informed consent from 41 indlvduals perdihei neuropathy, ayoalbumine, and absence of cardiac i ol . Including 19 alected persons. Pairwise and multipodnt lod soores were Camplete o-segregation of hypoabim and Mu EOAA In o mt calculated using MUNK and UNKMAP proam, respetively. sd posVW iky that Mu new syn1rome Is a reult Of abnorma of a new We fbund that the MJD ocus Is tightly linked t chromeome 14q DNA gene. Since Mu EOAHA has clical features ovapping with ihoes obsrved in markers D14S48 and D14S55. The maximal led score between MJD and Fridrelh'J alaxia (FRDA) mapped to q13-21.1, we pefm D14S48 was 4.43 at a recombination *action = 0.0. Multpolnt detelied gentc tage al" tot bocus. Utlf 46 member of 10 fOilli lnkage incdig 21 afected idvickals, we hav wuanyzed likgs bWeten Mu locus for analysis gave an even higher likelihood of linkage at D14S48 (Zmax a 6.96). EOAHA and 8 Recombinatlon events between the MJD locus and D14S48/D14S55 were not Mu mcatelte plyorpiam on u short arm of dchrmo observed in this 9 (095161, DGS4DS15/GS2 (9q13-21.2), DBSIeS, AFM331VHMDs175, aNd family. D0S153). Altho 3 riombinaton evente betwe Mu disase locus and Our data detate that e JD locus is on th long am of GS4D915/GS2 were obeerved, Mu nmaxnmu pairwbse lbd score of 3.434 Pn0.10) chromomrne 14. AS multiple cbinaton events were found between th is aband. MURoi b*a analyst showd a maial bd score of 4.0 at MJD locus and both D14S53 and D14S45, the gene for MJD is thus located 10 c~o cantomeic from DOSisl, and a led score of 3.117 we cbtained betn in the 29 centMorgan region beween D14S53 and D14845. D0S161 and DOS15. The result ries a posbifty Mut Mu EOAA gene is to be caused by as yet tined gene aclacri to FRDA en, sio Mu FRO gene has bee meatated to be exbremely close to 09815 ih 1 cMo).

1089 1090 Use of the simultaneous search method to detect linkage ((E.W. Taylor, J.F. Haplotypes in Wbon dee:Implications for mutational analys. ((G.R. Xu, D.A. Meyers.)) The Johns Hopkins University School of Medicine, Thomas, E.A. Roberts, P.C. Bull, and D.W. Cox)) Research Institute, The Baltimore, Maryland. Hospital for Sick Children, Toronto, Ontario, Canada. The purpose of this study was to determine the power to map additional loi WilSOn deem (WND) is an inhertd diorderof oppertransport whih for a disease with known genetic (locu) heterogeneity. Examples of such has been ssigned to Mu rgionof 13q14.3, between the merers D13S31 disorders are Alzheimers disease (AD) and Malignant Hypothermia and D13S59. We hav studied the segregaon Of markers In Mu 13q14.3 Susceptibility (MHS). The Importance of including family marker data for the ron In 52 famlie with WND. We hav fundsnifntalic known mapped loi when searching the genome for additional lci was iation between WND and D13S31 aswen as two c e determined by computer simulation. Samples of 100 pedigrees were polymorphism s, D13S228derived from a yeastartificial co simulated using structures ranging from affected sib-pairs (parents deceased intified by D13831, and caEHR4, derived from theSnd of t same YAC. as often occurs in AD) to a 3 generation pedigree (autosomal disorder such The d of plotypes of thm three made is ao gnicntly as MHS). The basic design of the study was an autosomal dominant diferent between noma and WND chromosomnes disorder with incomplete penetrance and 2 known mapped iod. Various We have studied two othe highly polymorphi m_crosatete repeat proportions of linked families were simulated for the first two known- markers pomorpis (cI and cG2) derived from a YAC cofg In the 13q14.3 as well as the third marker. Four allele region ( Bull et al, this meeting). Both of thm Markers show markers were simulated with 1% with linktage recombnatlon to the 2 known mapped lociand 5% to the new diequiNbflum WND, making Mum usWeul In rem.pbomatic daodis. locus tested search at recombination Additionallythm two mares, in conjuncon with D13831, D13 2 and being (genome 10cM Intervals). The mean LOD for 3 caEHR, define hap which are fund independent loc (LOD(3-iocifl was compared to the mean 2-point LOD Predominantly on WND obtained for just the new marker assuming genetic chromosomes, someof which e ethnic cTh p of peiic and LOD2 for affected heterogeneity (LOD2). haptypes suggest the exisence of a number of d mutons whih LOD(3-iocl) sib-pairs were not significantly different. cameWND. However, in general, the proportion of linked families was overestimated for These LOD2, and LOD(3-ci) provided a more accurate estimate. For the 3 mcrosallitee have also been usd to furer deine Mu location when 40% of of WND through thr segregation in families with meiotc recobination generation pedigree families are linked to the first known locus, even in the 13q143 region. The segeaton 15% are linked to the second known locus and 25% are Inked to the of caEHR4 has elminated marker tested are now the D13S31 derived YAC from consideraion forcandidete gene, and the being (20% unlinked), a mean LOD(3-i-oc) of 23.78 vs. segregation ofc h minate afur ds to 19.11 for LOD2 was obtained with similar estimates for the proportion of r500kb D1331. linked families. The in obtained from known increase power including data for linked lociwhen searching for additional Inked loiis dependent on the family structure and proportion of families linked to each of the leo. Linkage Mapping and Polymorphisms (continued) 1091 1092 Cerebral autosomal dominant arteriopathy with subcortical cenetic heterogeneity In 22 families with lon QS syndrome. ((J. A. infarcts Taps to chr nosome 19ql2. ((3E. Tournier-Lalserve Towbin, B. Siu, J. Robinson, A. Moss, R. Ayyagari, and J. F. A. Joutel 1J. Melki ,5J. Weissenbtch , G.M.Lath~op Hejtmsncik.)) Baylor College of Medicine, Houston, TX, UlRochester, Rochester, N.Y., and National Eye Institute, N.I.H., Bethesda, MD. H. Chabriat ,7J.L. Mas , A.1Nibbio , E.I. Cabanis , 8 M. Baudrimont , J. Maciazek , M.A. Bach and M.G. Bousser )) Long QT syndrome (UITS) is an autosomal dominant Inherited 1. Lab. Pathologie Immunit6. Faculte Medecine Necker. Paris Wave France. disorder characterized by QT interval prolongation and T abnormalities on ZCG, syncope triggered by stress, and fatal Cerebral autosomal dominant arteriopathy with sub- ventricular arrhythaias including torsade de pointes. Keating and cortical infarcts and leukoencephalopathy (CADASIL) is coworkers localized a gene responsible for I4TS in 7 families to characterized, in the absence of hypertension, by recurrent chromosome llp at the Harvey-ras-l (H-ras-1) locus (llpl5) (Science 252:704,1991). No heterogeneity for LQTS was detected in their stroke-like episodes, starting in early or midadulthood, and evaluated 22 families with from a mixed in some to dementia. Brain families. We have ULTS leading patients magnetic American population using a conbination of VNT and microsatellite resonance imaging shows deep small infarcts and a diffuse at the H-ras-l locus was found to be a non- markers. The VNU marker T1B-2 leukoencephalopathy. This condition is underlaid by to in this at I - 0.23 and - 3.26. The non Several families linked LQTS population 2 atherosclerotic, amyloid angiopathy. linkage results were further subjected to the admixture test using the affected by the same disease have recently been reported by program HOHOG. Significant evidence for heterogeneity was found (max. other groups under different names such as chronic familial loL for H2 - 13.1801, for H1 - 2.875; X for H2 vs. HI - 20.608, for vasculopathy, hereditary multi-infarct dementia. H2 vs. HO - 26.36) with a - 0.55 (950 confidence interval .2-.8) with We performed genetic linkage analysis in 2 unrelated p < .0001. For the linked *st of femilies, I - 0. There are no families and assigned the locus to chromosome 19ql2, within obvious phenotypic differences between the linked and unlinked set of the interval D19S221-D19S215 without evidence of hetero- families with regard to penetrance, length of the QT interval, or geneity. The locus assignement for CADASIL will be extremely occurrence of sudden death. We have confirmed the linkage reported useful to describe all possible phenotypes of this recently by Ksating et al. snd further demonstrated locus heterogeneity in identified vascular condition and to estimate its incidence ILTS. We conclude that LQTS is linked to the H-ra-l locus on and prevalence. It is also the first step towards the chromosome llpl5 in slightly over half of our families. Localization identification of the gene which is responsible for CADASIL of other genetic loci responsible for this disease is in progress, as and may also be a susceptibility gene for other vascular fine of the UITS locus on chromosome conditions. is mapping llp.

1093 1094 A linkae study Of Mahado-Joseph Disease - exclson of the splnoosrebelr Relative Efficiency and Power of Lod Score and Sib-Pair Methods of atexis locus 2. ((E. C. Twist, L A. Frrer', P. M. Macocf, J. RadvanyJ, R. N. Linkg Analysis (( J.L.A. Uro and M. Boehnke.)) Department of Bio- Rosenberg', G. A. Rouesu.)) Cenre for Rlsearch in Neurosc, MoGill Univ., statistics, Univerity of Michigan, Ann Arbor, Michigan 48109-2029. Montreal, Canad Dept Neurol., Boston Univ.'; Dept. Pediatrics, Queen's Univ., Ontario, Cnd, Nolo Hospitl srelita Albert Einstein, Sao We compare the maximum lod score, the Two.Allele Test, and the Mean Test Paulo, BrazV. Dept Neol, Univ. Tex Health Sdonos Centre, Texas. baed on (1) expected information measured as expected maximum lod score or its equivalent; and (2) statistical power, both computed by completeenumeration ofan Machado-o eph diseae (MJD) is an autosomal dominant cases I possible of&eZCted sib-pairs shaneither 0, 1, or 2 marker genes ideAtical by neurdsgenersativeataorginallyd escribed fammilsdofAzorean-Porhe decent for a given number of sib-par. We consider the cas of a rare autosomal descen AhclghdlclyMJD manifestsief In a number ofdlfferentforms, It is belived to be due to te mutation of a single, as yet, unidntifled gene. fully-penetrant dominant or recessive trait, in the presence or absence of linkae The aim of this study is o ntfy the chromoeomal location of this gn. heterogeneity, and for a range of values of the true recombination fraction. We Blood was collected and DNA isolated from 21 divdu Including 91 further assume that the trait is present in n four-person nuclear families with two affected persons, who are par of 7 AT.-IiPUSo and I Brazlian affected sibs and either zero (recesive cae) or one (dominant case) affected parent kindred. aP were with pomorphicc DNA markers includng the (where n = 10, 20, 50, 100). highly hin mati markr (CA)n dinucod rpt polymorphisms. Unkage Based on the two criteria mentioned above, the Two.Allele Test performed best between the MJD locus and the markers was analyzed using ft computer among the three tests in the cae of a rare autoomal fully-penetrant n programmes, UPED and UNKAGE. disem without heterogeneity. Its performance was the worst in the cae of a rare To date, approxmately 60 DNA markers have been teed resulting in the &utosomal fully-penetrant dominant disease with or without hetergeneity The Iwclusion of 600 cm is, 21% of the genome. We have previously detemined lod-score method did best in the presence of linke heterogeneity. The Mean that MJD is not aegl wih sphiocerebellar ataxia I (SCAI) which is becaed Test was better than the Two-Allde Test in the case of a rare autosoml fully- tochromnoemep. Recntly, a second ocusforspi o srataxla(SCA2) dominant diseae with or has been assigned to chromosome 12q, flanked by te markers D12S58 and penetrant without heterogeneity but was the worst among PLA2. We have now excluded the WD locus from an interval Wpenng the three tests in the case of a rare autosomal fully-penetrant recessive disease with pproIately 70cM, which Includes th oi. In conclusion, the WD locus or without linkage ho ty These results are consistent with those obtained epresents a3rd SCA ous provin evidencefor genchiterogaewithin by simulation in previous studie. tim disoarders

0 1095 1096 N of the autocml d&mkn¶~ amT q in Upregm of The affected pedigree member method of Inkage analysis for X4nked W g Vtae (CaManO r traits ((T. 1. Valeppl and D. E. Weks)) Department of Human Genetcs, cot 2p05-36.36. ((7K(fX ,Xm" . Bw l_ a X.DqN LT. f PA. R ldm', uLrsit, IC* Wtulkeon F.Iinu yN. |=1 University Pittsburgh, Pittsburgh, JJl. Stajid P.C. 1lrnl,l A.D. , T II.A. The Affeced Peree Member (APM) method of Inkege analysis of C it,3ifiam Cpi. dstscts kng. by tsing for increased marer similarity among the Iautb*tmte 3ssmely , ffected members of ech pedgre. The API method isa model-fe method Inth It mekne no assumptions about the mode of inheritance of Urn two Jr ft s of mutomal daiznwt 140~Ibi-7buth the deesse. The original APM m od was d pd for autosomal dim (GM am OMA with slo wi om .bm valcoitim (aMiL' traits. We have developed an APM static for X4nked trats. We or am iWt presw rd-V mnd paU31ogin ealimamul In ted null dirbution of ts tatistIc by simulation, veiyng that I -rn aticn. thizq aim af ts, in mulymed six IaxW am th simulated dion match the drition. ti.limaa id yzcslded evidh~ ftr llziW mid herzog writy to 5 When we eppled our new statistic to pubhd dat on X-Inked reinitis =Z.t (01816, M0170, WM.44, M.228 mad 08199) In daz a pigmentoss, the null hypodhesis of Independent segregation of deeas 23g5-36. Omn fily K662 gmv .ozt lcd ecea > 3.0 fW 038225 mad 038199. TN . mz= mulsigmie si M* and mrk Is strongly rejected, as expected. evim fW litimgsanmd beteVRogmuiDty fw allU m l,-zltloizt mualymia in=Wccthe ba~pcIzt dh Vite adds of 4169:1 This work was upportd byth University of Pittsburgh and grant In tai of lizimg mid l'- I a ofty vm lizdwga andkg ri. HG00719 from the NatIonal Centerfor Human Genome Research. 2rn f=ilM bW pm tar 4I sbr ftifi 0.57 of belzq liaisd to dinin Ip wie11e p0.0005 I_ the an finW. Miltpoizt Amdysis mauf Urn 0IL 9gm isas t lilmLy located bebmyn Urn lad228. Ue data to that am2, lic. Ont~is b top. -W with cmr locmr (CNA) localized to d o P35-36. To att~m1to rmmzw Urn CNZ2& region am lrn initiated a 00:1 a in themcmUn v m pe swith all n in Utsrnsgai.n A mi~crdimsci~on likazy of 3p6 1a been aeqilatd to gm nmaat Inza In ftis zeqime mid f=a busA 3p35-436 qwaific -- IC mM&Ikaz Uhrn Mditicrnl frnil las bern colledcted mid mre oiztybelai typed -c linlag stabs. Ipfttxd -gir miA IInkg data will be pIs tedI Linkage Mapping and Polymorphisms (continued) 1097 1098 Mapping of multiple exostosis to chromosome 8q24, and further evidence Linkage studies in nail-patella syndrome. ((D. Watkins', E. Campeau', GA of linkage heterogeneity. ((K. Wardl.2, L. M. Nelsonl.2, J. Carey3, B. Rouleau', R. Babu#, JA Buchanan3, W. Meschino3 and V.M. Der Horsthemke5, M. Leppert2.4.)) Department of Obstetrics and Gynecology', Kaloustian2.)) 1. Montreal General Hospital Research Institute and McGill Department of Human Genetics2, Department of Pediatrics3, Howard University, Montreal, Canada; 2. Montreal Children's Hospital and McGill Hughes Medical Institute4 University of Utah School of Medicine, Salt Lake University, Montreal, Canada; and 3. North York General Hospital, North City, Utah; Institut fOr Humangenetik5, Essen, F.R.G. York, Canada. Hereditary multiple exostosis (HME) was thought to map to the Langer- The nail-patella syndrome (NPS) is an autosomal dominant disorder Giedion syndrome (LGS) deletion region of chromosome 8 due to the characterized by dysplasia of nails and patella, subluxation of the head of the overlapping clinical features of HME and LGS. The published data radius, iliac horns and nephropathy. While it is known that NPS maps to the concerning the LGS region is conflicting with LeMerrer et al reporting a distal portion of chromosome 9q, its precise localization has not been reported. location score of -6 and Cook et al reporting a location score of +8 (with We have investigated linkage of NPS to dinucleotide repeat markers on 9q33- evidence of heterogeneity in their population). We present data from our 13 q34 (GSN, D9S60, D9S61, D9S65, D956, D9563, ASS, ABL and D9S66, in largest HME families in which we sought to identify whether they were order from centromere to telomere) in three families with NPS. Linkage linked to this region. analysis detected recombinations between the disease phenotype and GSN, Linkage studies using 6 short tandem repeat markers ( D8S85, D8S198, D9S60 and D9S66. Significant positive LOD scores were obtained at e -0 for D8S199, D8S300, D8S342, and D8S348 ) all gave LOD scores over 2.7. 4 markers: D9S61, D9S62, D9S63 and ASS. Haplotype analysis allowed D8S199 showed the highest degree of linkage with a maximum LOD score detection of a recombination between NPS and ASS in one family. These of 5.14 at a theta of 0.15. results allow assignment of the NPS gene to an interval on chromosome 9q Analysis of our data suggested linkage heterogeneity. HOMOG analysis spanning 9-13 cM, bounded centromerically by D9S60 and telomerically by ASS. of the data for D8S199 suggests that only 6 of the 13 families show It has been suggested the COLSAI gene, which encodes the @1 procollagen significant linkage (>90%). Excluding the 7 unlinked families the maximum chain of type V collagen and maps to chromosome 9q, is a candidate NPS gene. lodscore for D8S199 was 8.15 at a theta of 0.02. However, results of the present study place the NPS gene centromeric to Based on this data we are continuing to explore fine mapping of the region COL5A1, which has been mapped to 9q34.3, eliminating COLSA1 as a near D8S199 as well as looking for linkage to other chromosomes in the candidate gene. unlinked families.

1099 1100 Refined localization of the gene causing Best's macular dystrophy Detection of tandemly duplicated genetic markers and implations for (BMD) ((B. Weberlt2, D. Walker3,.L Mar2, B. MtUIle4)) Univ. Warzburg, Insitut linkage analysis. ((D. E. Weeks, T. C. Matise, A. Chakravart.)) fflrHmgenti, Biozentnnml; Univ. ofBrizish Columbia, Dean ofMedical Department of Human Genetics, University of Pittsburgh, Pittsburgh, PA. Genetcs2 and Ophthalmology3. Vancouver Ludwig-MaximiliUniv. D The first demonstration of a human diase caused by a lare P~diatrische Gtik4. MUnchen. segmental trisomy was in 1991 for Charcot-Marle-Tooth diseas type 1A Bess maculardystrophy (BMD) is anautosomal dominantjuvenile-osetdisaoni Ed (CMT1A). The fact that some chromosome 17 markes which are Inked is chamaterzd by a mem ardegermtnultimatelyresultinegins evar to CMT1A are in a tandem duplication region induced false recombinants centl loss cn tornal pigment thelium atophy ordhoidal and misdirected and impeded investigators In search of the disem gene. Although BMD displays a Drable variaon in exmon Motivated by this, we studied the effects of marker duplication in disease almostall paets can be deteced by aspecific est gene linkage studies on analysis of transmission probabilities, lnikage (d _ EOG). analysis, and on tests of homogeneity. We demonstrate that the Previous linkage studies in a Swedish (Graffet aL Gin. Genet.42, 156-159, 1992) undetected presence of a duplication distorts transmission ratios of marker and American BMD family (Stone et al. Nature Genet.l, 246-250,1992) have alioels, hampers fine localization of the disease gene by creating false loclized the defective gene inthe on al region I qI3 by genetic linkage to evidence of heterogeneity when none markers at DI 1S871,Dl 1S534, and INT2. However, due to the lack of recombinants, and increases is r conbinations between the disease locus and the markers tested the exact location of actually present. In addition, we have devised a ikelihood-based test for the BDM gen has not been determined unambiguously. detecting the presence ofa tandemly duplicated marker. We test our In order to refine the locus ofthe Beses discase ;ene, we have analysed thre Wl method through computer simulations and on CMT1A pedigrees that were unrelatedfmil affected with BMD by usingeight micrsaeitemarkersfzm the genotyped at several chromosome 17p markers. Our method for 1 ql3 regon. Pairwise linkage analysis revealed significant linageofthe BMD gene detection of duplicated markers successfully identified the region of to markers at the loci D lIS871, D1I S905, D1I1S903, PYGM, DM, D1IS534, and duplication involved in CMT1A. Thus, our method could be used to DI1S913. Locus D lS903 is tighty linked to thedisease with a lod scare of 8.0S at a identify duplicated markers in any region of the genome during disease Wracmbination faction of0. Multilocus linkage studies indicate that the BDM gne liea gene linkage studies. between DI1S871 and PYGM with odds of 100:1 favoring this most likely location over the second most likely ocation proxial to Dl S871. A tol of nine recombnation events involving the BDM chromosome have been identified in our thee families These recombinant c omes ode proximal and distal boundaries for the BDM gene and, therefore, define a inimum candidate region forthe Bests disease gene. Theestimated size ofthe mininum candidate region makes itfeasibleto apply further positiol cloning strategies for the isolation ofthe BDM gene.

1101 1102 High-resolution physical and genetic map of 5q31: probe ordering by FISH An index linkage map for human chromosome 6. ((A. J. Whelan, M. Chen, helps to identify CEPH database errors. ((C.A. Westbrook', M.M. Le Beau', L Uu and H. Donis-Keiler.)) Washington University School of Medicie, L. Yamaoka4, R. Espinosa Ill', W.L. Neuman', M. Kelnanen, R. Williamson2, Department of Surgery, Division of Human Molecular Genetics, St. Louis, M. Muflan2, K Buetowl)). Univ. of Chicago', Chicago, IL, St. Mary's MO. Chase Cancer Center3, Hospital Medical School2, London, UK, Fox We are currently completing construction of an index linkage map for Philadelphia, PA, Duke Univ. Medical Center', Durham, NC. human chromosome 6 that consists of markers withiheterozygosites of at Chromosome 5, band q31 contains many interesting loci including least 70%, intermarker spacing of no greater than 15 cM, and genotyplc LGMD1, postingual deafnm, and a tumor-suppressor gene of isukemia. data gathered on the primary (40 family) CEPH pedigree resource. Our To map 5q31, eight RFLP-containing cosmids were ordered by 2-colr FISH preliminary map, constructed using the program package CRI-MAP, on metaphme and lnterphasm celis; and a 37-cM genetic map was prepared includes 28 microsatellite markers uniquely placed with odds of at least FISH was 10,000-fold less 1000:1. The sex-average map spans a distance of 261 cM with average with CEPH data. The physical order by (a) marker spacing of 9.3 cM. There is a single gap of 22.7 cM and three of likely than the best multipoint linkage map, (a): the markers have heterozygosities greater than 60% but lass than the Marker ordar log 10 NUkalhood 70% criteria. The map incorporates markers adjacent to 6 gene ioci, 4 of ts). DSS15-05D5156-DS147-DSS178-D5102-D5S1 55-DS151-DS156 117.6 which are microsatellites. Although telomere markers have not yet been (bi. DSS150-D5166-0D51 78-D5162-D0S1 55-D5S151-D5S147-D5S156 122.7 found for this chromosome, we estimate that approximately 90% of the Statistical analysis was used to determine If this discrepancy reflected physical lngth of the chromosome is included in the map. This PCR- typing errors In CEPH families; thm can lead to map expansion and based linkage map should prove valuabie for chromosomal localizatin of incorrect orders for high resolution maps. Examination of family-specific gene oci responsible for inherited diseases. excess recombination showed significant heterogeneity with loi D5S178 and D5S147 in 4 of 15 pairwise comparisons, suggesting likely errors. To test map expansion, each locus was removed from the linkage map as ordered by FISH (a); average map expansion of 3.62 cM Indicated an error rate of about 1.8%, but the expansion with D5S1 78 alone was 7.3 cM, consistent with a 15% error. Re-typing of D5S178 (CA repeat) gave a recombination rate of 13% from the original RFLP late, but did not resolve ael the Inconsistencies, suggesting the need for additional error correction. These studies demonste the utility of physical ordering by FISH to verify high-resolution genetic linkage maps and to identify CEPH database errors. Linkage Mapping and Polymorphisms (continued) 1103 1104 Rapid, high resolution separations of small DNA molecules Further characterization of the Gorlin syndrome locus. and analysis of tetranucleotide repeat loci using MetaPhor' C. J. Berkman1, H. Sharpe2, K. B. J. agarose. ((H. W. White, M. M. Dumais, and I. Skare.)), Wickingl, Negus1, Wainwright1 FMC BioProducts, Rockland, Maine. (Intro. by: Ivan and G. Chenevix-Trench2 Balazs) Centre for Molecular Biology and Biotechnology, University of Queensland1 and Queensland Institute of Medical Research2, The widespread use of the polymerase chain reaction Brisbane, Australia. (PCR) amplification has dramatically increased the need for high resolution electrophoretic separation of small DNA Gorlin syndrome or nevoid basal cell carcinoma syndrome molecules (100-800 bp). When very fine separations of this (NBCCS) is an autosomal dominant disorder characterised primarily size range are required, polyacrylamide gels have previous- by a predisposition to basal cell carcinomas of the skin, in addition to ly been the method of choice. We have found that MetaPhor"' a diverse range of developmental anomalies. The for agarose gels are able to give separations that are compa- gene NBCCS rable to those in polyacrylamide gels. MetaPhor agarose has been mapped to 9q22.3-q31, and loss of heterozygosity of gels run in vertical or horizontal formats coupled with in- markers in this region has suggested that the gene is a tumour creased voltage gradients (8-15 V/cm) yield very fine sepa- suppressor. We have confirmed linkage to this region in 15 ration of small DNA molecules, differing in size by as Australasian families using four microsatellite markers (D9S12, little as 1i, and allow the use of short run times (0.33- D9S127, D9S109 and D9S53). Multipoint analysis suggests that the 2.5 hours depending on gel size and voltage gradient). gene could lie on either side of D9S1 2, but combined with other data MetaPhor agarose gels have been used to analyze PCR the most likely location for the NBBCS gene is distal to D9S12, amplification products from several tetranucleotide repeat between this marker and D9S109. We are currently analysing microsatellite loci (D21S221, and D4S243). Allelic sizes additional microsatellites in this region (D9S196, D9S180, D9S176). can be estimated both by visual comparison to size markers In addition we have analysed markers in a bank of matched blood and by preparation of standard curves based on the size and tumour samples, and detected loss of heterozygosity in 50% markers. Analysis of >20 unrelated individuals has shown (15/30) of sporadic basal cell carcinomas but in only 17% of control allelic frequencies that correspond well to published lesions. In every tumour in which one locus showed allelic loss, all values for all loci tested for which such data was avail- other informative loci showed loss of heterozygosity. able. In an attempt to further map the region which contains the gene involved in NBCCS we have produced a range of radiation-reduced hybrids which will be used to generate new markers across the region.

1105 1106 Grade ofmembership analysis diish linkage from allelic association at the The use of automated linkage analysis in genetic mapping of apolipoprotein E locus. ((M.A. Woodbury,1 EM. Corder,2 A.M. Saunders,2 WJ. autosomal recessive retinitis pigmentosa (ARRP) and Bardet-Biedl (BB) StrittmateerI D. Schmechel,2 P. Gaskell,2 G.W. Small, 3 A.D. Roses,2 J. syndrome genes. ((A.F.Wright, D.C.Mansfield, D.K.Green, K Mooney, lCenter A. Brown, M. Fossarello, M.Jay, S. Jeffery, M.A.Patton, N.Tommerup, Haines, and M.A. Pericak-Vance.2)) forDemographic Studies, Duke R. Rise, A. Schinzel and HJ Evans)). M.R.C. Human Genoics Unit, University and 2Joseph and Kathleen Bryan Alzheimer's Disease Research Center, Wester General Hospital, Edinburgh, UK; Cinia Oculsta, Duke University Medical Center, Durham, NC; 3University of California, Los University of Cgkari, Caglri, Italy; Dept. of Cinical Ophthalmology, AngelesCA; and, 4Massachusettes General Hospital, Boston, MA. University of London, London, U.K; Dept of Cinical Genescs, St George's Hospita AWcal School, London, UK; Dept. of MedcW The apolipoprotein E (APOE) locus is located on chromosome 19 in a region Genetcs, University Hospit, Oslo, Norwy; Instite of Medcal previously linked with Alzheier disease (AD) (Pericak-Vance et al, 1991). Genetics, University ofZurich, Zurich, Switzerfand. E allele 4 (APOE4) is associated with late onset > Apolipoprotein significantly (age Automation of genetic linkage analysis is necessary to fully exploit the 60) familial and sporadic AD (Strittmatter, 1992). Here we use grade ofmembership potential of microsatellite markers. We have developed additional analysis (GoM) (Clive & Woodbusy, 1978) to distinquish linkage of the APOE locus software for an automated laser fluorescence sequencer that will with AD from the allelic associato ofAPOE4 with AD while simultaneously accurately size and process alleles for direct entry into linkage on-sidering the possible linkage of nearby markers on chrosome 19, sex, age at programmes, making use of information on pedigree structure, internal onset ofAD in affected subjects, and age at evaluation in unaffected subjects among and external standards. The process is interactive to ensure optimal 445 members of46 AD families. We optimally found three GoM types which were use of the data. Amplification reactions are set up by a robotic sample characeize as old and affected with I or 2 APOE4 processor, loaded manually onto gels and the results obtained in the young (Y), (0), (A). Subjects form of lod scores with a minimum of interaction. The use of this U allels aged 51 to 78 were assigned to group A; affected subjects with 0 APOE4 system is illustrated in excluding 'candidate regions * for autosomal I! alleles aged 79 to 91 and unaffected subjects aged < 70 were assigned to type 0, and, recessive forms of retinitis pigmentosa. Eleven Sardinian families with EU unaffeted subjects < 70 years of age were assigned to type Y. The APOE locus was ARRP and 17 families with BB syndrome have been typed for a total of less infrmative as were nearby previously linked markers. We conclude that the 79 markers (48 for ARRP and 31 for BB). No definite evidence of U numberofAPOE4 alleles rather than linkage to the APOE locus is related to the risk linkage has so far been obtained but several candidate regions have for AD. been excluded. q dI.-

1107 1108 i Testing linkage disequilibrium between a disease gene and marker Interval mapping in the genetic linkage study of complex disorders: a and J. Ott.)) Columbia York. simulation study. ((J.F. Xu, E.W. Taylor and D.A. Meyers)) Johns Hopkins loci. ({X. Xle University, New University. Baitimore, Maryland.

We have developed a computer program, EH, which teats and Genetic linkage studies of complex disorders have proven to be difficult due estimates linkage disequlibriumbetween markerioci using a randomsample to lack of precise mode of inheritance, genetic heterogeneity, incomplete of unrelated individuals. It also can be used for case-control sampling, in penetrance, phenocopies and misclassification. Interval mapping, where one which one compares the allele frequencies in unrelated affected Individuals tests whether a putative locus lies between two flanking markers, thus has been proposed as a more powerful robust to detect In with those in normal Individuals. and method linkage. this study, we used simulation methods to compare interval mapping with 2- a the allele for each Without disease gene present, frequencies point LODs for (1) the power to detect linkage under heterogeneity; (2) the marker are estimated under Hardy-Weinberg equilibrium, and the haplotype probability of false positive finding of linkage; and (3) the impact of frequencies are estimated both with allelic association (H1) and without misspecifying penetrance or phenocopy rate and misdiagnosis. allelic association IHO). For the second case of a disease and control A dominant disorder with decreased penetrance and phenocopies was sample, hapiotype frequencies are estimated subject to known marginal considered. The disease locus was simulated in the middle of two flanking allele frequencies and penetrances at the disease locus. We then markers (4 alleles each) 10 cM apart. Unkage was tested assuming heterogeneity and LOD2=3 was used as a significance value for linkage. All distinguish two alternative hypotheses: H1 allows for association among the results are based on 1000 replications. markers but not between disease and markers, while H2 allows for associa- For the various pedigree structures, consistently fewer families (about 1/3 tion among all loc. fewer) are needed to find linkage with interval mapping compared to single The EH program provides the log likelihood, chi-square and the marker method. The distributions of LOD2 under null hypothesis for the two method were very type errors both number of degrees of freedom under the hypotheses Ho, H1 and/or N2. similar (especially for LOD2>0), and I for (See Terwilliger and *Handbook for Human Genetic Johns method were virtually zero. Missspecifying penetrance (range 0.5-0.9), Ott, Unkage,' phenocopy rate (range 0.01-0.3) and false positive and negative diagnosis in is in Hopkins Univ. Press, press). The EH program written Turbo Pascal (range 5-20%) consistently had smaller or similar impact on interval mapping and is available in a version running under DOS. The OS/2 version will be than on single marker method when heterogeneity was included. available soon. Support by grant HGO0008 is gratefully acknowledged. These results suggest that interval mapping is a powerful and robust method. With the decrease in sample size of -1/3 families and availability of highly informative SSRs markers throughout the genome. it is praical to carry out linkage analysis for complex disorders using interval mapping. Linkage Mapping and Polymorphisms (continued) 1109 1110 Molecular Genetic Analysis ofSimpson-Golabi-Behmel syndrome: an Autosomal dominant muscular dystrophy (LGM1): A genetic map of chromosome 5q31 and refining the location of LGM1 Overgrowth Condition Associated With Wilms Tumor by multipoint analysis. ((L.H. Yamaoka', C.A. Westbrookl, Y. Xuan, R. A. Bener, X Kwag, J.-E. Ikeda, A. MacKenzie.)) N.C. Speer , J.M. Gilchrist3, E.W. Jabs4, J.M. Stalich', ((J. HughesBenzie, C.P. Gaskell', A.D. Roses, and N.A. Pericak-Vance)) Division ofGenetics, Children's Hospital ofEastern Ontario, the Deprt entof 'Duke University Medical Center, Durham NC; 2University Pediattics, and Biochemistry, University ofOttawa, Ottawa. of Chicago Medical School, Chicago IL; Rhode Island Hospital and Brown University, Providence, RIs; 'Th Johns Hopkins University School of Medicine, Baltimore MD. Snponolabi-Behml (SGB) syn ome is are X-linked gigantsm ome Limb-girdle muscular dystrophy is a genetically and ch eize primarily a dtive facies and somatic overgrowt Other clinically heterogeneous group of disorders. We by previously localized, using a large single family, an findings include renal dysplasia, embryonal umors, cardiac defects and skeletal autosomal dominant form of the disorder (LGMl) to aormalities. We have studied a in whom the syndrome is chromosome 5q22-q31 by linkage analysis (Speer et al., Dutch1Caadian family 1992). Updated two-point analyses show that the most associate withan increased risk for embryonal tumors. Three of 18 affected tightly linked markers are IL9 (LOD-19.21 at 0-0.03) and have renal tumors (see Hughes Benzie et al, D5S178 (LOD-12.57 at G-0.05). A genetic map of the individuals developed embryonal this region was developed using the CEPH reference pedigrees. meeting). Linkage analysis on this family has demonted close linkage with the The map order is qter-D5SI19-CSFlR-D5S210-D5S178-IL9- Xq26 locus HPRT O -0.0). Analysis ofrecombinats has FIB5-cen which is supported with odds >1000:1 over the (Zak7-5, next most likely order. Using sultipoint analysis, we idetified the make defining the SOB interval as DXS52-DXS424, mapping the have refined the original localization to a 7 cM region gene to Xq244q28. We hope to refine this interval with furhe analysis of between IL9 and D5S178. This placement is supported over the next most likely placement, proximal to IL9, micrsatellit polphims from thisregion. Idication ofthe gene with odds slightly greater than 1000:1. These results for the SOB in the elucidation ofthe will assist efforts to localize and ultimately identify responsibl syndrome may help pathogenesis the gene for LGM1. ofembryonal tumors.

1111 1112 Sm prim es i: an efficiet meod for s n meat's macular dgration (mID): Linkage and roml repeats. ((H. Yang, N. Udar, S. Dendekar, T. LUng, N. (Jhrhamme, G.J candidate gene sequencing. Samara S. C u , X Chen, Y. Huo, N. Pae, A. Dorian, R.A. GaN.)) C(Z.Zhuang, J.L.Richards, L.Bingham, J.L.A.Uro, M.Boehnke, Department of Patholoy, UCLA School of Medicine, LOS Angeles, CA. P.A.Sieving]j]. University of Michigan, Ann Arbor, MI. Short tdm rep ) ha been shown to be a poweri too in Linkage for Best's macular degeneration was studied Wng l. Several m hawe been pubied for the Isolation of in a large autool dominant American family of Irish ST but most then e not sultable for DNA f . extraction that showed macular scarring of the retina. We he developed a method based on eension of aCA)1 prir to scren DKA was obtained from 23 affected and 12 unaffected for repeats from lr fragme , such as A Ybra members, and 5 spouses. Visual acuity of middle-age containing fra ents in t r o ev hundr base b was affected members was 20/70-20/100, and acuity was worse established from a Wr The pooled DNA from t w for older affected members. Markedly reduced emplilled using the vector primers. The PCR amplifaon produs we electrooculogram (ZOO) Arden ratios in affected members annealed tO the (C~) rimer and Kiowfragmenht was used to extend, In the were consistent with a BMD phenotype. prse of nuc o. The ex n poduct was then bound In this family significant linkage was found with (Dynel). After highly siothe b s,o* microsatellite ropeat markers near lIgl3: th.X~agments oontalrIn te products COWhd be LOCUS POSITS eluted from them. Uradli~cnteing ve pr ie were hn used to PCR Ill12 11q13 5.78 0.06 amplify and the product ws cned nto pAMPL plad (BRL ua D11S534 11q13 4.55 0.09 DNA glycos (UDG). This rethod ws found to be h f nt for D118533 11q13.5 3.06 0.13 ScreeT frm b D118527 11q13.5 2.68 0.15 lgW DNAfragme wih leor no %goound. D113871 11 2.93 0.06 crossovers in this pedigree suggested the order D115871- mD-INT2-D118534/D118533-D118527, which is consistent with the most likely location for the gen prsnt by Stone et al (1992) and Foremen et al (1992). A candidate gene 301 ("rod outer mbran one" protein), which is expressed in retinal photor ptorsis near l1q13. Sequencing of the 3011 coding region is 92* completed for this MM family, and thus far no mutation has been found. (Suporte by the National Retinitis Pignto Foundation, Baltimore, MD.)

1113 Linkage analysis of a novel form of X-linked arthrogryposls. ((R.T. Zorl ', J.L. Gardner2, M. Mulln', S. Roberts', M.R. Wallace' , T.P. Yangi 23)). Division of Pediatric Genetics, 2 Dept. of Biochemistry and Molecular Biology, 3Center for Mammalian Genetics, University of Florida College of Medicine, Gainesville, FL; 'Dept. of Psychiatry, University of South Florida, Tampa, FL Arthrogryposis is a heterogeneous congenital disorder characterized by multiple joint contractures. Three clinically distinct X-linked types have been described that include a lethal form, a moderately severe form, and a mild resolving form. All three X-linked forms are manifested by contractures of both the upper and lower extemities. We have studied a large family with a novel form of arthrogryposis that Is inherited In a manner consistent with an X-linked recessive disorder. The pedigree includes ten affected males over three generations. Affected males are born with a mild form of arthrgryposis that is non- progressive and restricted to the lower limbs. These patients do not manifest other neurological symptoms or birth defects. Carrler females exhibit no clincal symptoms. We have analyzed genomic DNA from members of this family for linkage to a variety of X-linked RFLP and microsatellite markers. Two-point linkage analysis excluded linkage between the disease locus and markers in proximal Xp (Xpl 1) and proximal Xq (cen-Xq22). However, positive LOD scores (maximum LOD score of 2.60 were obtained by analysis with markers in the distal long arm. These data suggest the most likely location of the gene associated with this novel form of arthrogryposis is In the region Xq24- Xqter. We are currently refining the map location of the disease locus by analysis with additional markers from this region. Molecular Applications in Clinical Genetics 1114 1115 Detection of Neurofibromatosis type 1 (NFl) gene deletions by A Fourth Example Suggests Premature Termination Codons In hemygost at intragenic microsatellits markers. ((PJ Ainsworth and Dl the COL2A1 Gene Are a Common Cause of the Stickler Rodenhiser.)) Child Health Research Institute and Department of Syndrome. Analysis of the COL2A1 Gene by Denaturing Padts, Chidren's Hospil of WesWrn Onio and Univ. of Western Gradient Gel Electrophoresis. Pertti Ritvaniemi1, James Hyland1, Onterio Lan Can&W Jaakko Ignatius2, Karl I. Kivirikko1, Darwin J. Prockop3.4 and Leena Ala- Conderable ft are undsrway in a number of iaborato to Kokko1.3. 1Biocenter and Department of Medical Biochemistry, University identify mutations in the gene responsible for the autosomal dominant of Oulu, Oulu, Finland; 2 Department of Medical Genetics, University of diesm Newoibromatosis type 1 (NFl). While no common mutation has Helsinki, Helsinki, Finland; 3Department of Biochemistry and Molecular been kietfd, Keyes et al (1992; J.Med.Genet 29:688) and Upadhyaya Biology, Jefferson Institute of Molecular Medicine, Jefferson Medical (1992; Hum.Mol.Get. 1:735), hav described a variety of patients who College, Thomas Jefferson University, Philadelphla, PA 19107. carry deletions In the NF1 gne. We have developed PCR-based aesays for several tagenic, bbalslfc and polyallblic markers which, while important A series of oligonucleotide primers were designed so as to generate for NF1 Nnkage analyses, are now being used in our lab to identify polymerase chain reaction (PCR) products that contained exons 6 to 49 of igenic deleti at thes lod by detection of hemizygosity. The most the human gone for type 11 prooolagen (COL2A1) and that could be used to usl markers have proved to be an (AAAT)n repeat prevIously described detect sequence variations by denaturing gradient gel electrophoresis by Xu et al (1992; NAR 19:3764; observed h z oy (Ho) 0.60), (DGGE). To improve the sensitivity of the analysis, GC-clamps were togr with a polyaliello (CA)n repeat (Ho = 0.63) detected in the NFl introduced into one primer of each pair. The procedure successfully sequence from the Genbank database (accession number L03723). detected ten neutral single-base variations in the gene. In addition, the Characterization of this (CA)n repeat in 50 unrelated individuals reveals procedure detected a single base deletion in exon 43 that introduced a alleles ranging from 16 - 22 In number. Of 20 families subected to linkage premature termination codon in exon 44 and caused the Stickler syndrome analysis, thrse were found to have an affected offspring displaying (arthro-ophthalmopathy) in one family. The mutation is the fourth mutation hemizygosity. In one cas the 60 bp deletion was a local event within the in the COL2A1 gene shown to cause the Stickler syndrome. The mutation intronic (AAAT)n repeat. In the two other affected indhvduals hemizygosity is similar to the first three mutations causing the disease in that it also iniially idet at the (MAT)n repeat was albo detected at the CA repeat introduced a premature termination signal. Since only one mutation locus, inferring the presence of deletions of at last 26 kb. Southern blot introducing a premature termination codon was found in the course of analyses aroe undrway to determine the extent Of thm deletions. These defining 120 or more mutations in type I and III procollagens, the results particular polyallelic markers provide another tool with which to identify suggest that such mutations may have a special relationship to the Stickier patirtPocWM NF1 mutations, whih to dae, hav bn so elusive. syndrome. (Funded by the Ontario Ministry of Health and the Foundation of the Supported In part by grants from N.i.H. (39740), and the Lucille P. Markey Childre's Hospital od Western Ontario). Chartable Trust.

1116 1117 Applicain of Anals of Multbo Hiy Ht us STR Lcd to Pareta Testing Paternal isodisomy for chromosome 5 in a child affected with Spinal usig Mutlex PCR ((R. L Afrdl, H.A. Hammond, and C. T. Caskey2)). Iinsltut for Muscular Atrophy. ((B.A. Allittol, L.M. Brzustowlcz2.3, S. Chatkupt4, E. Molecular eVW Howad Hge Mec insti, Cog of Medcne, Sugarman1, L. Mchaudi, B. Silven', G. Landes', R. Theves2, L. Suslak4, Bayo M.R. Koenigsberger4, T.C. GiIIlan2.3, B.L. Handelin'.)) 'integrated Houston, TX, USk Genetics/ivigen, Framingham, MA; 2Columbla University, Departments of Psychiatry and Genetics and Development, New York, NY; The New York Cureny, pareae anai and personal W ON b DNA a ssing Var11e State Psychiatric Institute, Now York, NY; 'University of Medicine & number Wtam repest (VNTR) nod Is both rels and powerl. However, this Dentistry of New Jersey, Department of Pediatric Neurology, New Jersey mhod is reve slow and bor inensieherey malgtte tciqus eneto Medical School, Newark, NJ. We have tad 25 re cue, prvUly anyd by VNTR mthods ung nine A 2 1/2 year old male presenting with abnormal gait, difficulty arising to STh bd ouhotth huan gnoe. These nine short dm repesTR)lN d incld standing and climbing stairs was diagnosed as having Spinal Muscular HPRT, FABP, CD4, CSF, THO, PLA2A1, F13AOI, CYAR04, and LIPOL These STR Atrophy, Type Ill. No dysmorphic features were noted. Early deve ntal lhd were a id In multWox PCR reacion, chracon conrtining th lod. milestones were unremarkable. The family was studied using DNA probes In each cu, th xu isin datawe in complet agrmontth t VNTR linked to the SMA gene region on chromosome 5q13. Six markers which in b a span approximately 7cM and flank the SMA gene region, show the child to data. edtion, STR mod lustd te obti both compare por be homozygous at ai markers lacking and lacking a maternal contribution at of exclusIon end pariy indextothat obtd wit chn usng four VNTR bcd. three markers. High resolution cytogenetic analysis revealed a normal male The suessfld pplication of STRhanelis to parenitae tesin and the valid of the karyotype with no visible deletions. FISH probs within and flanking the pows o luion end paey di ha owed tie ds mnofamore rapd and SMA region confirmed the presence of two chromosomes 5. Further cot efctivtn for msment of patnity. oletion of t analysis with seven dinucleotide repeat markers spanning 5p15.3-15.1 to d beofbenl bo to n sutu andto forenic analysis. 5q33.3-qter also revealed the child to be homozous for paternal alleles at all markers. This data is consistent with child having inherited 2 identical paternal number five chromosomes. Isozygosity +/- imprinting are alternative mechanisms for expression of SMA in this proband. Isozygoit (disomy) has previously been described In CF (Spence et al. 1988, Am.J. Hu. Genet. 42:217, and Voss et al. 1989, Am. J. Hu. Genet. 45:373). Thus isozygosity +1- imprinting may be more common etiologies for recessive disease than previously appreciated.

1118 1119 The relationship between trinucleotide (CAG) repeat length and clinical identification of a point mutation in Cu/Zn superoxide dismutmse gene In a features of Huntington dieae. ((S. E. Andrew1, Y. P. Goldberg1, B. Japanese patient with familial amyotrophic lateral sclerosis. ((M. Aoki', M. Kremer1.2, H. Teienius1, J. Thellmann1, S. Adam1, E. Starr1, F. Ogasawara2, Y. atuba, K. N awa2, S. Nakamura', Y. itoyamal and KI Squitieri1, B. Un1, M. A. Kalchman1, R. K. Grahaml & M. R. Abel.)) 'Department of Neurology and 2Department of Biemical Genetics, Hayden1r2.)) 1Department of Medical Genetics, U.B.C., Vancouver, Tohoku University School of Medicine, Sendai, Japan. 2 B.C. and Neurodegenerative Disorders Centre, U.B.C., Vancouver, Amyotrophic lateral sclerosis (ALS) Is a neurodegenerative disorder B.C. characterized by selective damage to the neural system that mediates voluntary movement. According to linkage studies, famillal ALS (FALS) gene Huntington disease (HD) is associated with expansion of a CAG was mapped on chromosome 21 in some families and Cu/Zu SOD (SOD1) trinucleotide repeat in a novel gene. We have assessed 360 HD was proposed as a possible candidate gene. Recently mutations In the affected individuals from 259 unrelated famiries and found a highly SOD1 gene were identified in about 10% of Caucasian FALS families. We significant correlation (p.10-7) between the age of onset and the examined the SODI gene in affected members of five unrelated Japanese FALS families, whose inheritance is an autosomal dominant trait, by repeat length, which accounts for approximately 50% of the variation in each of five A the sequencing exons. Histidine43 (CAT) to Arginine (CAT) age of onset. Similar significant associations were found between substitution (H43R) was identified in a patient. The presence of H43R was repeat length and age of death and onset of other clinical features. A confirmed in the other affected individual of the family by allele specific predictive model for estimating age of onset based on repeat length was oligonucieotide hybridization. The mutation was the same substitution developed and validated. Sib pair and parent child analysis revealed recentiy reported in a Caucasian family (Nature 362: 59-62, 1993). It is that the repeat demonstrates only mild melotic instability and that intriguing that the same mutation was identified In the two families with variations in repeat length account in part for significant differences in different racial background, because H43R is not located at 'mutation hot age of onset between family members. spot', such as CpG dinucleotide. The inve on of the prevalence of H43R among FALS from different ethnic groupe may be required to elucidate the origin of the mutation. Molecular Applications in Clinical Genetics (continued) 1120 1121 Molecular genetic diagnosis of mucopolysaccharidosis type 11 (Hunter A 17q inversion involving the NF1 locus in a family with neurofibromatosis syndrome) using automated sequencing and computer-assisted analysis. type 1. ((A. Asamoah', K. North2, J. Wagstaff', B.R. Korf')) Children's ((EL. Aronovich, J.J. Jonsson, S.E. Braun, C.B. Whitley.)) University of Hospital, Boston, MA' and Children's Hospital, Sydney, Australia'. Minnesota, Minneapolis, MN. Hunter syndrome Is an X-linked recessive disorder constituting a spectrum Neurofibromatosis type 1 (NFI) is a dominantly inherited disorder of mild-to-severe clinical phenotypes resulting from defective iduronate-2- characterized by neurofibromas, multiple cafe-au-lait spots, Iis hamartomas, sulfatase (IDS). Characterization of the specific molecular defects should learning disabilities, bony abnormalities, and an increased risk of malignancy. establish genotype-phenotype correlations allowing assignment of prognosis The gene responsible for NF1 is located on chromosome 17. Gross for newly diagnosed patients. However, the vast heterogeneity of mutations rearrangements that have been reported to produce the NF1 phenotype have identifled by initial studies has demonstrated the need for a more efficient and involved translocations between chromosome 17 and chromosomes 1 and 22, powerful approach to molecular diagnosis than manual strategies currently in respectively. Other rearrangements and/or mutations have Included deletions, use. We therefore developed a method for rapid sequencing of the entire IDS an A/u insertion, and point mutations. We report a family with a coding region. IDS cDNA was obtained by reverse transcription of total cytogenetically detectable paracentric inversion of 1 7q and NF1. The proband cellular RNA from leukocytes (10 mL blood) or lymphoblastoid cell lines and and her father fulfill diagnostic criteria for NFl with cafe-au-lait spots, skin- amplified by two sequential PCR. The coding region was determined by direct fold freckles, and subcutaneous neurofibromas. Neither has dysmorphic cycle sequencing of amplicons using Taq polymerase and fluorescent features. The father's mother was said to have had neurofibromas, but she dideoxynucleotides. Sequence and tracings were read by an AB 373A had died of a brain tumor. Chromosome studies were performed because of instrument, transferred to a SUN computer, and compared with the normal a history of four spontaneous abortions in the proband's mother. Both father sequence using the Staden sequence analysis program. Complete analysis and daughter with NF1 have an identical was accomplished within a week of receiving specimens. In the first chromosome anomaly: patients and daughterqwith To ve an identica chromosome Nomaly: studied, 6 new mutations have been identified: C685-*T, H229Y (severe inv(1 7)(ql 2.2;q25.1). To verify that the inversion disrupts the NFl gene, phenotype); C1073-+G, P358R (severe); C1165-+T. Q389X (severe); pulsed field gel electrophoresis wee carried out using NFl cDNA. Aberrant G1403-+A, R4680 (in a patient with coexistent chromosomal translocation); fragments are found in both family members with NF1 and the inversion using C1406-+A. P469H (mild); and one patient with skipping of exon 3 (severe two probes at the 3' end of the gene (probe P5 and AE25), but not with a phenotype). In addition we observed C438-+T (silent T146T sequence probe located more 5' (FB5D). No aberrant fragments were seen on variation), a presumed polymorphism, in 2 patients. This sensitive and conventional Southern blots using these probes. Our results support the relatively rapid approach has proven to be an excellent diagnostic method to notion that this inversion is responsible for NF1 in this family, making this the identify mutations in patients with Hunter syndrome. (Supported by Ronald third case of a gross chromosome change involving the NF1 gene. McDonald Children's Charities and Daniel Molinaro Foundation).

1122 1123 5p- in an individual without clinical features of cri-du-chat syndrome who MuatCons in both the haeedomain and the opir PAX3 cause has a molecular deletion in the critical region. ((J. F. Atkin and J. Wardsnug Syndrms Type L ((C. T. Bfldwin, N. R. Up*ky, C. F. Hoth, W. Overhauser.)) Morristown Memorial Hospital, Morristown, NJ and Thomas Mamu and A. LUneky. )) Center for Human Genetics and the DepL of Jefferson University, Philadelphia, PA. Pediatrics, Boston University School of edicine, Bosn, MA, USA A 3 year old male was evaluated by the genetics center for developmental delay. He was born at term to a healthy G1 29 yo mother without prenatal We an Syndrcsl (CVS-) Is m do dior complications by C-section for failure to progress. Apgars were 8/9, bw d id by sn deafness, dopla can pigmentay 8-11, and neonatal course was uneventful. The infant cry was felt to be and other dewelopmental defects. Many famies with WS have entirely normal. Developmental delays were noted in the first year of life and in the human PAX3 gen Vt came their disease or show lnkage to the patient currently has global delays functioning in the range of 40% of th PAX3 locus on human choosome 2q35 while other famiNes with WS chronological age. His growth has continued to be good with height, weight, appear not to be due to mutations in PAX3. PAX3 is a transcrIptkon factor and OFC all in the 50th%ile. There are mild facial dysmorphic features with containfg both a paired-domain and a hom n DNA binding motif and is mongolian lids, epicanthal folds, esotropia, prominent nasal tip, and maxillary sed dur early m n . Here we describe two mutations in the prominence. He has no birth defects. human PAX3 gene associated with WS4. One mutation is a deletion affcting Chromosomal studies revealed a deletion at the terminal end of 5p the 25 bpof PAX3 oon 2 andthefrst 3 bp ofiron 2. R isexpectedt involving all of band p15.3. Parental chromosomes were normal. Molecular this deletion results in skipping of own 2 during mRNA processing of PAX3. studies using multiple DNA probes previously localized to the 5p region This would introduce a premature stop codon in axon 3 since the 5 end of 2 revealed that both the p15.3 and almost the entire p15.2 bands were deleted 3 own contis a splt c-rin whi O and con s a conybb cadn. The rs including the critical region for cri-du chat. Clinical correlation with molecular cni codon w t3e a c l The studies of over 50 cases with 5p- has mapped the critical region for cri-du- pr wodaopltlck bo e p - adans t Oo odon DNAreulingbd chat in band 15.2 and the region for larynx malformation in the proximal area mot. The second mlutatio is a subit convering Arg 223 to a of band 15.3. This is the first patient studied who has deletions in these ein codon in th hig conserved homeo-dmaln of PAX3. This Is the critical areas without the predicted phenotype. fi d nimuft*Mg- of a mutation in the homeo domain DNA binding motif of Explanations include 1 )mosaicism in other tissues-no evidence of PAX3 aEsociated with WS 5nd suetsta PAX3 requires both a functional moseicism in blood by cytogenetic or molecular studies(skin biopsy studies paired-domain and a homeo-domain DNA binding motif. in progress). 2)genomic imprinting(parental molecular studies in progress- will be evaluated with other cases).

1124 1125 Myotonic dystrophy: Association of mutational state of parent and outcome Application of quantitative X chromosome inactivation analysis to carrier of transmission of disease gene in a large French-Canadian population. ((J.M. detection in X-linked agammaglobulinemia. ((J. W. Belmont'23, R.C. Alien', R. Barcel6, M. Pluscauskas, M. Narang, C. Ang and R.G. Korneluk.)) Children's G. Nachtman'", and H. Rosenblatt2)) Institute for Molecular Genetics and Dept Hospital of Eastem Ontario and University of Ottawa, Ontario, Canada. of Pediatrics, Baylor College of Medicine, and Howard Hughes Medical Institute, Houston, TX. Myotonic dystrophy (DM) is a neuromuscular autosomal dominant genetic disorder with a global incidence of approximately 1/8000 and 1/500 in some X-linked agammagiobulinemia (XLA) is a recessive genetic disorder of B regions of Canada. The mutation consists of an unstable CTG trinucleotide lymphocyte development. It is caused by defects in the cytoplasmic tyrone repeat sequence in the 3' untranslated region of a gene encoding for a kinase, btk(ruton's yrosinekinase), encoded in Xq22. Asymptomatic female protein kinase. Its instability is generally manifested as an intergenerational carriers of XLA have skewing of X inactivation in their B cells due to increase in the number of repeats in conjunction with the increase in severity preferential growth of precursors bearing a non-mutant active X chromosome. of DM phenotypes. We analyzed the transmission of the mutation in a large We develped a quantitative assay for X inactivation using flnurescrnc PCR group of DM families comprising 360 DM parent-DM child pairs. The large at the human androgen receptor (HARA) locus. We found a close correlation number and size of the families allowed the extensive study of the outcome of X inactivation pattern in the B cobs and T celis of normal controls. of transmission from a wide spectrum of parental allele sizes. Correlations Approximately 5% of controls showed skewing of X inactivton of >85%, of different degrees were seen between the number of repeats inherited and probablyarising bya stochastic mechanism duringthe procesofX inactivatin the sex and number of repeats in the parent transmitting the mutation. or lineage allocation. Ffty-six at risk females in 23 hoinpendent XLA families Stable or close to stable transmission was observed at a high frequency were studied. Twelve obligate carriers were confirmed. Of 39 potential carriers when the number of repeats in the transmitting parent was low (under 80). 12 were found to be arriers. All carriers manifested >95% skewing in the B In general, mutations containing high numbers of repeats were more cells but not the T cells. Four individuals were noninformative for the HARA unstable. Intergenerational reduction of the number of repeats occurred at polymorphism. One individual gave an indeterminant result because of a relatively high frequency when the number of repeats in the parent was skewing in the T cell population. All results were congruent with linkage high (over 500); especially when the transmitting parent was a male. Our analysis conducted in the extended pedigrees. The androgen receptor method study of the dynamics of this mutation allow us to conclude that within the is a highly reliable and quantitative tool for the identification of XLA carriers. as yet unknown mechanism(s) underlying its instability the number of Carrier testing is especiaily useful in cas in which there is no family history repeats followed by the sex of the perent transmitting the mutation are two of XlA Combined with analsi of the btk locus, it is now possible to design determinant factors. Apart from their biological significance these findings an integrated approach to molecular diagnosis of XLA based on primary carrier have implications for the genetic counselling of families with this disease. testing, inkage analysis, and mutation detection. Molecular Applications in Clinical Genetics (continued) 1126 1127 Anew OWLANclwih*f3Z271niA DNApou Correlation of cyclic AMP production with length of FMR-1 amplification mutation. (( G. B er, J. Sh nr,&S. G. Pavlakis, A. E. Kauin, mutation in lymphoblastoid cells (LCLs) from patients with fragile X syndrome S. Teichber and M. Misthos.)) NorhShore UniversityHospital-Cornell (fra X). ((E. Berry-Kravis and M. Hicar.)) RUSH-Presbyterian-St. Luke's Medical Unersivoege,Mano eNYdaineEmiyUnivenity d ofMe Center, Chicago, IL Atlanta G The cAMP cascade is thought to participate in neurochemical processes G. C prsented at 28 years ofaewith new-onset tonicclonic seizures. He had leading to learning and memory. Although FMR-1 has been identified as the bssinCe S years ofage h progressd to complete deafness by 18 years. gene containing the fragile X mutation and is inactivated in fra X patients, little 23 dhewas found to have catats, mi, and rehmtisxgentosa is known of the function of the FMR-1 protein, its role in mediating cognition, or whcn dtoblindes over s rl y e also had mmel to be dp SManid eotstkand1-- Head been the effect of the mutation on surrounding genes. We have previously disoited formnandwastretedwith=si dayspor tothe ometofseires He never regained normal demonstrated that cAMP production is deficient in platelets from fra X patients. mental status. G. C. was 5 feet tall. During his hospital admission he had renal In an effort to define potential relationships between cAMP production and the symptoms ich~ngprnreswemirenalfl~e, hypekalemia proteiinuia, and edxoenic FMR-1 amplification mutation, we have analyzed cAMP production, fragile site dneys on renal itraso A CT scan of the brain showed marked bilateral percentages, and mutation size in a series of LCLs from 20 controls and 20 fra cala~icatious ofbasal gangia, dentate nuclei and centum semiovale with cerebral X patients with full mutations. Prostaglandin El (PGEI) was used to assess atrophy. Lacic wdosw not presen Hewasfounddead oneafernon(DNR order stimulation of cAMP production and forskolin (FSK) to on chart) with complications of renal disease being the presumed cause of death. receptor-mediated A muscle biopsy showed mitochondri sal of mitochondral directly activate adenylate cyclase. cAMP production in fra X LCLs was cellertmt v. Evaluaion ofmt alDNAreda diminished in PGE1 (74%, p<0.02) and FSK (64%, p<0.1), relative to controls. point mutation at position 3271 that has been previousl reported in 3 MEL.AS Basal cAMP production did not differ. In 17 fra X lines thus far analyzed, basal *ens MAS is a mi encephalomyopathy chareid (r=.0.53, p<0.03) and FSK-stimulated (r=-0.57, p<0.02) cAMP production was balpathy, cAddosis, andStroke-Ileisods Clinial features of E significantly negatively correlated with the maximum and median length of the include short stature, hearing loss, recurrent he s and vomiting, dementia, FMR-1 amplification mutation (values given for maximum length correlations) hemiparesis or h n , and basalgangiacalcifications This patient lacked the and PGEI-stimulated cAMP production showed similar trends. No measure of lactic acidosis and strole-like episodand nd had features mon (cataracts, site All fra X LCLs gaucoma, renal disease) or not repored (hypogonadism, marked bilateral brain cAMP production correlated with Xq27.3 fragile percentages. MELAS. This is a new of m ia were negative for FMR-1 mRNA by RT-PCR. These data suggest that calcifications) in presentation qa -q dassociated with the 3271 mutation The markedcalfico are diminished cAMP production in fra X tissues may be linked to the FMR-1 remnis fenFahrr m , anonspecific disorder characterized byintracerebral amplification mutation, either through its effects on FMR-1 or because of calcifationsandCN symptoms. testingofsuchpa now a alteration of transcription of genes near FMR-1. Diminished cAMP production to be indicated. We suggest the acronym CHERP for5alciflcationsBearnglos, may contribute to cognitive dysfunction in fragile X patients. BIypogonadism, Encepalopathy,Betnitisfigmentosa.

1128 1129 Skewed X-inactivation in BWS patients: (Bird, L M.. Naumova, A.K.. Daub. D., Normal phenotype with patensal uniparental isodisomy for Cavenee, W.K., Carlin, M. E., Newshan, 1. and C. Sapienza) Ludwig Inst. Cancer chromosome 21. ((J.-L Blouin1, D. Avramopoulosl, C. Pangalos2, Research, San Diego, CA S.E. Antnarads.13.)) 1Center for Medical Genetics, The Johns Hopkins The Beckwith-Wiedemann syndrome (BWS) consists of macroglossia, University School of Medicine, Baltimore, MD 21287, USA; 2D1lagnstic omphalocele, mr visceromegaly and earlobe crea Affected individuals are Genetic Center, 115 28 Athens, Greee; 3lnstitute of Medical Genetics, also at increased rik for several embryonal tumor The trait has been reported to University of Geneva Medical School, Geneva, Switzerland. cosegregate with markers linked to chmome IpSI in at least two families. Additionally, isodisomy, duplication and tloctions involving the distal portion of Uniparental disomy (UPD) is characterized by the presence of 2 chromosoe lp have been observed in many sporadic cases. Because many sporadic homologous dcomosomes from a single parental origin; in uniparental cases exhibit bin in the parental origin ofthe chromome Ilp imbalance and some several families show a preponderance of maternal trainission, genome imprinting has been isodisomy both homologous chromosomes are identical. UPD for invoked as a possible factorcontributing to the BWS phenotype. By analogy with chromooes has been found to be involved in a growing number of human genetic modifier-controlled phenotypes in other systems, the BWS phenotype should paologies. In order to assess whether UPD for chromosome 21 might be appear in at least two genetic categories, one locus that consists of the modified gene ana associated with pathological ph pe, we analysed DNA polymorphisms of another locus that consists of the modifier gene. Simpson-Golabi-Behmel syndrome chromosome 21 in a family in which the proband shows a de iovo (SGBS) and BWS have many overlapping characteristics including macrosomia, 45,XY,t(21q21q) karyotype. We typed 17 highly polymorphic short sequence hypoglycemia, macroglossia and viceomegaly. Recently, SGBS has been mapped to tht the peri area and the entire the long ann ofthe X-chromosome. Because it is possible that SGBS and BWS repeat DNA markers map in erc reprent a modifier genedmodified gene pairroting in similar phenotype, we have length of long arm of dcomosome 21. Nine infomative markrs show no examined Xnactivation pattems in female patients diagnosed with BWS. Offive man allele coribution to the genotype of te proband; in addition, there informativefamiliesanlyzed, thre families contained one sporadic case each and two was aways reduction to hmozyosit to the paternal alleles. These results families contained two or more affected individuals In two of the three sporadic cases indicate ta thae was paternal uniparental isodisomy for c some 21 the patients exhibited very highly skewed patterns of X-inactivtionL The unaffected (pUPiD21). The proband is a 40 years old healthy male; he has an mothers of these patients also exhibited skewing of X-inactivation, but were not so unrmarkable medical history qnd no phenotypic abnormalities ware noticed strongly skewed as theiraffected daughters. In one of the two pedigreesjudged to be in the physical m . He came to medical attention through his trisomy 21 I 'familial BWS', none of the three affected daughters northeir unaffected mother offspring. showed a skewed X-inactivation pattern. In the otherfamily (in which the two affected individuals were discordant for a markerat I lpl5) one of the affected daughters had a Our study, and a previously reported caso of maternal UPD21 with normal strongly skewed X-instivatio pattern, but the otherdid not Additional data are phenotype (Creau-Goldberg et al. (1987) Hum Genet 76:396-398), suggest reqired to detennine whether BWSISGBS reprent a modifier genemodified gene that genes on chomosome 21 may be not imprinted. pair.

1130 1131 Methylation status at the DXS255 locus shows incomplete correlation with carrier Dtection of PLPgene mutation in padents wth state in the Wiskott-Aldrich syndrome. ((R. Bodok-Nutzatil, S. Cremint, W. Greer2, by single strand ftional analysis. ((S. Boya4lev. A. Sahota, V. M. Prat Mount Sinai I R Nachtman3, J.W. Belmont3 and KA Siminovitcht.)) Hospital, S.R. Dlouhy, and M. E d.)) dbana Univ. Sch. Med., ndlanapoi. Ontario1, Victoria Gen. Hospital, Nova Scotia2 and BaylorColl of Medicine, Texas3. About 30% Of Pelizaeus-Mezbcor disee (PMD) patet have muton The observation that the hypervariable DXS255 locus is differentially methylated Whilethe ompl reliable for intheX-lnked protepid proten (PLP) gene. only on the active and inactive X-chromosomes has led to the use of this marker way o mutaftmio inthe gene Is sq nc , this Is both expensive, evaluation of carrier state in selected X-linked disorders. However, recent data e We have sand that DXS255-based analysis tIne cansuming, and adapted single from tumor conality analyses suggest methylation may conormIpolymr i (SSCP) analysfiso r screenin for PEPmutatlns. not provide a reliable assay for carrier detection. To address this issue, DXS255 resonance determined in T cells of 29 females from families We have nestd 30 pain, 26 wth clinca and manetic methiylaton patterns were and carriers. The seven segregating for the X-linked immnoiciency, Wiskot-Aldrch syndrome (WAS) iaging data dlegnostic:dPMD kwurupected rfemale and theadiad were compared with those obtained by RFLP-linkage analsis and by exors dfEP were anplified ndMdusly using PCR and OP a-dCTP, and a PCR-based assay of methylation at the human androgen receptor gene locus analyze by SSCP on n gis (5% acuylemldel 5% glyco at (HAR). While 10 obligate carriers showed nonrandom patterns of X-inactivation room temper . Mobility shft wre d b in b p , on pante with both the DXS255 and HAR assays, in 2 obligate carers, the HAR assay gave each for exons 2,3 and 5, and tee patents for wosn 4. D s of nonrandom but the DXS255 assay gave random pattrs of X-inactivation. Among PCR ampfied DNA confirmed the mutati in ewons Z 3, and 5. Two o the 5 females predicted to be WAS carriers by linkage analysis, 4 showed nonrandom changes in exon 4 were dueto a kwnMall ply m, and the thid was X-inactivation in both the DXS255 and HAR assays, while in 1 female, the HAR due to a mutaton. A sevenft paent with a odb mobity shit in mon assay gave a nodom and the DXS255 assay gave a random X-inactivation 3 had awid type sequence of this exon (afise positive resut). The mutations pattern. Among 12 females diagnosed as noncarriers by linkage analysis, 8 showed random X-inactivation profiles with both the HAR and DXS255 assays, 2 showed in etons 2,3 end 5 have not ben prevuly decribd. The ampfd mtrial nonrandom X-inactivation using DXS255 and 2 had a skewed pattern of X- from sm of the patient wa alo subjected to h plex (ND) anasi. inactivation (>80 20) using HAR. DXS255 and HAR methylation patterns were HD did not dect the mutafti In exons 2 or 3 or the 1 polymop In also examined in 15 additional females who were relatives of sporadic WAS cases exon 4. or ketify any new muati. HD analys of the m i exons and who each shared an X chromosome RFLP haplotype with the related affected 4 and 5 is In progre. These reut confirm ta only a *action of patiens boy. In 13 samples the assays gave identical results, while in 2, DXS255 gave with PMD have mutatns in PLP and te de SSCP Is much random and HAR nonrandom X-inactivation patterns. The finding of 7/44 (16%) more tan for detectn ths females in whom the results of DXS2554ased methylation analysis conflict with oeffcnt HD nmutatons. those obtained by the HAR and linkage analyses indicates that an s of DXS255 methylation state does not provide a reliable indicator of carrier state in WAS. Molecular Applications in Clinical Genetics (continued) 1132 1133 IdelFlcatlea of flail tata fage X arrers by mulplex PC of the repeat Genetic mutations at the C-terminal end of the procollagen II ene in Stickler _equems ih te nM-I ad ad race gem. ((C.A. Brown, I.E. syndrome (Hereditary arthro-ophthalmopathy) and identication and Teshima, D. Chitayat and P.N. Ray.)) The Hospital for Sick Children, Toronto, phenotypic desiption of a new mutation. ((D.M. Brown, K Vandenburgh, Ontlaio, Canada. B.E. Nichols, A.R. Erhart, A.E. Kimura, TA. Weingeist, VC Sheffield, E.M. Fragile X syndrome is the most common form of inherited mental retdation. Th Stone.)) University of Iowa College ofMedicine, Iowa City, IA 52242. mutation consists of an fic of a CGG trinuoI repeat in the 5' untranslatedregion of the FMR-1 gene located at Xq27.3. Analysis of length variation The termnal 20 exons of the procollagen Wgne wee exandned by PCR in this regio hows that normal alldes have 6-60 repeats, permutation alleles have 60- amplification of each individual exon in fifteen well chracte-i-ed families 200 repeats and ful mutation aleles found in affected individuals contain >200 (108 afected patients) with Stickler syndrome. Single strand Conformation repeats. We have deveoed a rapid, non-radioactive PCR protocol to determine CGG polymorphism analysis detected two mutations (one previously described in repeat number in the FMR-I gene of query fragile X individuals and to identify male exon 40) and a novel mutation in exon 48 in an additional Sticklerfamily. No and female premutation carirs. Th CGG repeat region is amplified from a genomic mutation was detected in the additional 13 Stickler pedigrees. The eon 48 DNA template using fluorescenty labelled oligon primers flanldng the repeat mutation was present in all eight affected members and consisd of a one region. The fluorescent PCR products ae analyzed by computer-assisted las base pair deletion causing a premature termination of tnsatini an 49. denssometry (CALD) on an Applied Biosysems Inc. Fluorescent Fragment Analyzer. Eight eyes in four patients had retinal detchments and all patients examined While this PCR protocol amplifies and sizes precisely both normal and pemnutation had syneretic vitreous. Four patients had deft palate and six of eight patients alleles, full mutation alleles do not amplify sufficiently well for accurate analysis. had prominent joint pains and/or radiograpic evidence of epiphyseal Females in whom only one size amlifiaion product is seen are elther homozygous dysplasia for two normal alleles or hemio for a normal allele with a full mutation allele which did not amplify by PCR. In order to discriminate these two possbilite without the use of Southern blotting, we ae utilizing a protocol in which both the CAG repeat region in exon 1 of the andrg receptor (AR) gene mapped to Xqll.2-q12 and the CGG repeat sequence in the FMR-1 gene are coamplified using different fluorescent labels. Compas of peak areas of the fluorescent FMR-I and AR amplification products in known normals, premutation carriers and full mutation carriers were initially detmined and ranges etablished for normal and carrier feales. This rapid PCR analysis can discri h ou from henizygous females reducing the number of samples rquiring additional Southern blot analysis.

1134 1135 Complete Mitochondrial DNA Sequence Analysis of Aizheimer's and Analyis of 15q2S5* or markers in patien with ring 15 and Rusell-Sie Parkinson's Disease Patients. ((M.D. Brown, Y.L. Kim, A. Jun, M. Cabell, B. syndromes. ((G. Butlerl, DJ. Dricoll, P.R Papaen, V.P. Johnson, Graham, and D.C. Wallace)). Department of Genetics and Molecular PKC. Rogan'.)) 'Vanderbilt Univ, sof Florida, Medicine, Emory University School of Medicine, Atlanta, GA 30322 Gainmesville'ohe Laboratories, Research Triange Park, North Carolna; Because several lines of biochemical, pharmacological, and genetic UnIv. of South Dakota, Vermilion; 'PA State Univ. College of Medicine, evidence have linked mitochondrial abnormalities with Alzheimers (AD) Hershey. and Parkinson's (PD) diasm, the mitochondrial DNAs (mtDNAs) of three Alhelmer's disem plus Parkinson's disease (AD + PD) patients and one Ring 15 syndrome (r15) is a rae e c disorder d by PD patient were sequenced in an attempt to detect mtDNA sequence -rawh retardation, mIcp , tangur f variants aociated with these disorders. Each mtDNA contained a number brac tly, variable mental spech lmarker of sequence differences relative to the published sequence but, for each (IGF1R,D15S95, D1SS111, FES, DLSS100, IP1SM9, DSS107,DlSS87)from mtDNA, only a few of these had characteristics consistent with a possible theerregionwon anzed wi~th iv SouthrUn hyb disease association. One AD + PD patient harbored a rare T to C transition (e. Ig ItF)an slicrt tandem rpaPCR alpiiin{m*mapiiainfrm four at nucleotide pair (np) 4336 in the tRNAGLN gene and a very rare T to C patientswith r1S and fourwith R Slv ndrome (kS), a condition with ovelappg features, and an ividul with a 15q26.1-qter deletion. Tree transition at np 721 of the 12S rRNA gene. The tRNAGLN polymorphism of the four riSpatientsand the individual with the lSq deletion showed km altered a moderately conserved nuclsotide, was 7.4 times more prealent ofone copy ofthe IGFIRgne with quantitativeSouthern dtio , g in patients than in ethnic-matched controls, and defined a branch of the 3-21 as a control probe from lSqllql3 rio, hile all RSpaiso ed mtDNA phylogenetic tree enriched for AD, PD, and AD + PD patients. A two copes of this gee. In two the three rl5 paten, S107, S87 and second AD + PD patient harbored a rare A to G transition at np 3397 in the IGFIR were deletd. In on to t marker, S100 was also deleted in ND1 gene. This mutation changed a highly conserved methionine to a the 15q dekltionpatent T parental source of the deletion in two paes valine and has not been found in 248 ethnic-matched controls. The third (15qdeletion one rlS)w detrmined and fnmd tobepaternalI origin. AD + PD patient harbored a G to A transition at np 13708 In the ND5 gene. ARKS patients and one rl5 patient were intact for the above nmatrr Afer This variant altered a moderately conserved alanine to a threonine and is the anab of thee fatient the orderoflowi determined to be ee-S95- found at an increased frequency in another neurodegenerative disease, S 1-FES,IPOM9-S ~l FS10-7,iG-The patient with the Leber's Hereditary Optic Neuropathy, but is also present in 6% of ethnic- 15q26.1-qter deltion had more p don, ch is matched controls. The mtDNA of the PD patient harbored four rare rRNA probably due to km of other genes besdes IGF1R that are prommal to mutations of unknown significance. These data suggest that further D1S100but distal to D15SllL IOFIR (and/ars u genes) appear investigation of the association between mtDNA defects and late onset to playa dgnificant roleiin the re th retadati m mostriS pate neurodegenerative diseases is warranted. The cause of the growth retardationin R patientsis appen dotreltd tol of geneti rialo the distal lo arm of m e15.

1136 1137 Non-rdloactive PCR of the CGG repet of the FragileX gene. Genetic approach to functon of the neurp galanin. ((P. Charlton', L Guia, 10.Castellv(-Bel1, H.Kruyer2, l.Banchs2, M.Mil&1 & X.Estivlll4Hospital Clinic N. Copeland, N. Jenkins', D. Munroe4, F. Greenberge, F.T. Fiedorek', R.D. Nicholls.)) I Provincial, 2 IRO, Hospital Duran Reynals, Barcelona, Spain. Univ. of Nrt Cuolna, Chpe Hilll, Univ of Florida,Gainesville & Cs Western Reser Univ., Cev d,OH2, National CmacerInsL.,Frederick M', M chuse The fragile X syndrome (SFX) is the commonest form of inherited mental Ins of Technology, Cambrdge4, BaylorColl. of Medicine, Houston, TX. retardation. The gene associated with SFX (FMR-i) was identified in 1991, and the 5' untranslated region was found to contain a highly polymorphic Ga n, a recently dembed bra-gut pede, is thought to poentiae th CGG repeat and individuals can be divided into three groups according to releae of growth hormone, inhbfit insulin secretion, play a role in --naotp the number of repeats: normal individuals range from 6 to 50 repeats, modultionand hasbeen implicated in the control of satiety. Ab g l premutated individuals range from 52 to 200 repeats, while affected exprsionin the pituitary and ypoamus, ad its marked induction by erogen individuals have above 200 repeats. Thus, it is important to be able to exposue,further suggest an importan endocrine function We are using a genedc determine the number of repeats for offering genetic counselling, especially approach to detemine the biological functions of galanin. as the risk of expansion to the full mutation is proportional to the size of the We have localized the human galain gene to the proximal short am of premutation involved. PCR amplification of this repeat is a rapid and accurate chromosome 1by PCR using primers derived from the 3'end of the published human technique for obtaining the exact number of repeats and to date this has cDNA sequence and anayss of deletion hybrds We are currently yes been performed using ax-3000 32P-dCTP, requiring special facilities and artificial chromosome(YAC)and cosmid contigs spanning the human galatin gene in handling, limiting its use and sometimes making it not feasible, depending proximal lp, from cba -specific iraries, and confirming the cytological on the laboratory. We have developed a non-isotopic PCR assay which gives localizainby fluorescent in situ hybidizatIon(FISO).Analysis of BXD andBXH an accurate sizing of alleles permitting the rapid screening of at risk recombinant inbred (RI) strains and an i fic aross [(CS7BU6J x Mus The PCR sprrrsr)F, x C57BU6JJ localized the mouse ganin gene close to the centromee of individuals. system involves of the samples which are then run on cbromosome gels. These are Southem blotted for 90 min and for 19. These sul extend the regon of synteny for human llql2-ql3/ acrylamide hybridized mouse 19 across the to human two hours, using one of the primers 3'labeled with Fl-dUTP, as a probe. After centrmere lp: ingly, laninis the most washing and detection the results can be visualized on radiographic film in proximal marcer mapped to dameon mouse cm e 19. A fmilial syndrome just 1-3 hours. This retains the of with ociaed with acytge defined in region llpll.12-pl2 technique sensitivity working isotopes exhibits a consetwith but can easHiy be incorporated into routine laboratories, where there are no phenotype planin ffiency(shorta e,hyposonadis , Installations. obesity, development delay), as well as other features, and is curety under our isotopic investigaton. Molecular Applications in Clinical Genetics (continued) 1138 1139

Direct sequsnciag of the complete CiTR gone: the charac- Ezon skipping in the wild type transcripts of APR and its en by a terisation of over 99% of CY mutations in Wales. _mutation. ((J. Chen S. Bye, A. Saota and A. scflekl)) Indiana ((^JP Cheadle,LN Al-Jader, MC Goodchild,^AL Meredith.)) Institute of Medical Genetics, -Department of Child Univ. Sch. Med., Inapolis Health, UWCK, Cardiff, UK, CF4 4XN. Intro, by: PS Harper. It is wel d that splice site mutatios can ad to exon skipig since the identification of the CFTR gene and the major during mRNA ing Rectly, nonsense mutations in the ibilhn sad mutation in over (delta F508) 1989, 150 additional muta- deltaaminotransferase genes have also beet shown to lead to -m tions have been characterised (Tsui LC, Hum.Mut. 1992). We skipping& Adenine phosphrbosra erae (APR!) is an enzyme of have performed an extensive mutation analysis on 183 CF puine families in Wales, to establish the frequency of delta metabolism and its defcencan lead to 2,Sdlhdroxyadenine lithiasis. By FS08, and many of the rarer mutations in the Welsh popula- analysis of PCR-amplified genomic DNA, we hav identIfied 18 tion. Mutations on 328/367 CF chromosomes were identified mutaton in patients with APRT deficien. Nine of these mutationsm inciding after screening for delta F508 and sixteen other muta- two nonsense mutations, ae located in exon 3. Several of the point mations, tions. To the mutations on the 39 un- identify remaining the TG -> TGA nonsense mutation in patient ASA1 have now been characterised chromosomes, we have carried out direct at the RNA level. TheMm coding control sequencing over the complete coding region, intron splice analyzed region (540 bp) from sites, and part of the promoter region of the CFTR gene. subjects and from patients was amplified byRT-PCP, and the cDNAwamnon During this study we have designed a set of specific in- an agarose gel and stained with ethidium bromide. In addition to the expected ternal sequencing primers which allow clear sequencing 540 bp band in all samples, a 0.4 kb bend (at about 10% of the intensity of the through the aforementioned regions. normal band) was present in the sample from .ASAL Transfer of the cDNA to In we have identified 29 mutations of which 5 total, a nylon membrane and hyb ai with in o probes rmed t are novel (MlV, 977insA, W846X1, R1283M, 4016insT), and 8 the 0.4 kb contained Ibis wa also at polymorphisms. We have characterised 365/367 chromosomes fragment fragent present low (over 99%); the two remaining CF chromosomes belong to levels in all the other samples. The 0.4 kb fgment fom ASAI was then unrelated pancreatic sufficient patients with unusual subcloned and Exon 3 (134 bp) was misn from this phenotypes. In order to ascertain accurate frequency data fragment, leading to a change in the reading fr These results indicate tha for the Welsh population, CP families with atleast 3 skipping of exon 3 occurs at low levels in wild type and mutant 'Welsh' were as 'Welsh'. Of grandparents strictly regarded and that sklpping is enhanced when a nonsense mutation is present these families, delta F508 accounts for approximately 72%, in this ezon. They also suggest that, even when consensus site seqences 621+lG>T 7% and 1898+lG>A 5%. The implications for CF splice population screening in Wales will be discussed. are present, the efficiency of splicing may be affected by internal sequences in ezon 3. Supported by NMI grant DK38185.

1140 1141 Poster Symposium-Session 40 identification of a Mutation in the Norris Disease Gene (NDP) in affected members Pushing the PCR envelope: Amplifications of more than 20 kb. [[S. Cheng, of a family with X-linked Familial Exudative Vitreoretinopathy. C. Fockler, and R. Higuchi.JJ Roche Molecular Systems, Alameda, CA (Intro. ((Z-Y. Chenl, E.M. Battinelli1, A. Fielder2, S. Bundey3, K. Sims1, X.O. by: H. Erlich). Breakefield1 and l.W. Craig4)) 1 Molecular Neurogenetics Laboratory, Massachusetts General Hospital-East, Charlestown, MA 02129, USA. The polymerase chain reaction (PCR) and thermstble DNA polymerases 2Department of Ophthalmology, Birmingham and Midland Eye Hospital, Church have revohjtionized molecular biology, human genetics, and forensics. One Street, Birmingham B3 2NS, UK. 3Department of Clinical Genetics, Birmingham limitation, however, has been the inability to reliably amplify sequences of Maternity Hospital, Birmingham 015 2TG, UK. 4Department of Genetics. greater than 5 kb. The work described here demonstrates optimization of Department of Biochemistry, University of Oxford, Oxford OXI 30U, UK PCR conditions to enable amplification of much longer sequences from a model system of lambda DNA. Extension times of greater than 5 minutes are Familial exudative vitreoretinopathy (FEVR) is a neurological disorder necessary for sequences of more than 10 kb, and the presence of a characterized by an abnormality of the peripheral retina which simulates denaturing such as is critical. Additional retrolental Both autosomal dominant and agent glycerol variables influencing fibroplasia. (adFEVR) X-linked the efficiency of PCR include (XLFEVR) forms have been described. The biochemical defect the longer enzyme levels,buffering agent (both for underlying enzyme and of the DNA symptoms is not known. Norrie disease is an X-linked recessive activity protection template and product), K+ and and added neurodevelopmental disorder. Its manifestations include bilateral retinal Mg2+ levels, gelatin. Using such modifications to 'standard' PCR dysplasia foliowed by retinal detachment which leads to congenital blindness. The conditions, sequences as long as 23 kb have been amplified from nanogram gene for Norrie disease has been mapped to Xpl 1.4 and was recently cloned and amounts of lambda DNA. Against a background of higher sequence characterized. Linkage analysis of a four generation X-linked FEVR family maps complexity provided by human genomic DNA, fragments of up to 12 kb have the locus near the markers DXS228 and MAO (Xpl 1.23-11.4). We have been amplified from picogram amounts of lambda. These developments undertaken molecular analysis of the Norrie gene locus (NDP) in this family. An further expand the ever-growing list of applications for PCR, particularly the aberrant SSCP change in exon 3 was detected in all of the affected males, but not in power to complement the current techniques for the physical mapping and the unaffected family members nor in 3 normal controls. Sequence analysis of two sequencing of genomes,and In the characterization and diagnosis of human affected brothers revealed a missense mutation resulting in a change from genetic diseases. Leucine to Phenylalanine at position 84. This represents a conservative change substituting one neutral, polar amino acid for another. This mutation occurs in a region of the protein that has been shown to be highly conserved between mice and humans. We therefore, postulate that the mutation is responsible for the p manifestation of XLFEVR in this family. Given the results obtained here, the possibility of investigating the NDP locus in other X-linked retinal disorders, such as recessive primary retinal dysplasla, will be discussed.

1142 1143

Molecular characterization of inverted duplicated chromosome 15s and Cherecteriztlon of mutatiens In the type VII coln gen In their significance. ((S.-D. Cheng,' N. B. Spinner,2 E. H. Zackai,2and J. H. patints wIth the dytrphikforms ef spidermolysel bullosa. M. Knoll."3)) 'Children's Hospital and 3Beth Israel Hospital, Harvard [[A.M. Christiano.'A. Hbovnan, 2E.A. Bauer and J. Uittof. Departments Medical School, Boston, MA; 2Children's Hospital, Philadelphia, PA. of Dermatology, Jefferson Medical College,Philadelphia, PA; 'INSERM, Creteil,France, and 2Stanford UniverSiy, Stanford,CA. Inverted duplicated chromosomes 15 (inv dup) from eleven individuals Dystrophic buliosa is a were examined by fluorescence in situ hybridization (FISH) and epidermolysis (EB) mechanobulious disorder of the skin in which the anchoring brils of the basement membrane quantitative DNA analyses. The patients Include 7 with severe mental zone, composed of type VII oln,we absetor severely abnormal. retardation and seizures, 2 with a normal 1 with Angeiman phenotype, We have previously domonstratod genetic linkage between syndrome (AS) and 1 with Prader-Willi syndrome (PWS). By combining type VI colagen gene (COL7A1) at th chromosomal locus 3p21 and the FISH and quantitative analyses, three different sizes of inv dup both thedominant and reoessiv forms of dysbophic EB. We have also were identified. 1 the and is Type represents smaelest Inv dup positive recentiy completed cloning and char onof the entire gene and only for DI5Z1. Type 2 is positive for DI5Z1 and D15S18. Type 3 Inv full-ength cDNA for type Vllco1laen. To facilitate the detection of the dup has two copies of each locus (proximal to distal): DIRZ1, DI 5S18, underlying mutations in patients with dystrophic EB in the gene, we D15S9, DI SS1 1, D15S63, DI 5Sl0, GABRB3, GABRA5 and D15S12. designed overlapping PCR amplimers which span the entire genomic Types 1 and 2 were observed in two normal individuals. Type 1 was also sequence. The first homozygous missense mutation in axon 113 of observed in the AS patient and the PWS patient but the inv dup 15 was COL7A1 was identified in two sibilngs with a mild form of recessive EB SSCP not feit to contribute to the phenotypes. The AS patient had a maternal dystrophic using analysis (Christiano et aW., Nature Genet deletion on one chromosome 15. The PWS patient had no detectable 4:6246). Recentiy,we identified two mutations in another patient with severe deletion on the normal 15s but most likely has maternal disomy. Type 3 mutilating (Hailopeau-Slemens) recessive dystrophic EB using MDE This is a was observed in all of the patients with mental retardation and seizures. analysis. patient compound heterozygote, with a maternally inherited insertion of 1 bp in exon 19 on one allele, and a We found no evidence of asymmetry within 1 5ql1q1 3 in the inv and dup paternally inherited deletion of 1bp In exon 31 on the other allele. Both the for the are to interestingly breakpoints inv dup 15s localized the same mutations lead to frameshft which resuit in premature codonson that are stop regions disrupted in AS and PWS patients with interstitial both alleles. Delineation of the underlying mutations in the dysrophic deletions, ie. around Dl 5S18 and distal to Dl 5S12. Molecular definition forms of EB will facilitate the deign of gene theapy modalities to of the Inv dup 15s has important clinical significance. Additional copies of reverse the effects of thi devtatingdisem of the skin. I5q 1 q13 result in a phenotype(s) different from that of AS and PWS. Molecular Applications in Clinical Genetics (continued) 1144 1145 Adenoviral vector mediated gene transfer of 8-galactosidase into human myoblasts and Heteroduplex detection and RNA analysis of NF1 mutations. ((S. Colmanl, myotie in culture. ((P.R. Clemens', KE Korbi, MA. Morsy', T.T. Ngo', F. Graham3 and C. Abernathyl, V. Hol, R. Kamathl, B. Kousseff2, C. Williams', D.J.Driscoll', C.T. Caskeyl.2)) 'Institute for Molecular Genetics and 2Howard Hughes Medical Institute, R. Zorl, F. Collins3, M.R. Wallacel.)) 'University of Florida, Baylor College of Medicine, Houston, Tea and 3McWaster University, Hamilton, Ontario, Gainesville, Canada 2University of South Florida, Tampa, 3University of Michigan, Ann Arbor. Human genetic muscle disases are logical candidates for systemic, somatic gene Neurofibromatosis type 1 (NF1) is a common autosomal dominant disorder therapy approaches because muscle comprises 70% of the cells of the body. Viral vector- characterized by neurofibromas, caf6-au-lait spots, Lisch nodules, axillary mediated methods have shown the highest efficiency of gene transbr, to date. Of these, freckling, and other less-common features such as hypertension, scoliosis, adenoviral vectors are the best sued for gene tansbr into differentiated muscle because and learning disabilities. NF1 is caused by disrupting mutations of the NF1 adenoviral inftion can be achieved in non-dividing cells. Using an adenoviral vector gene (17q11.2), and has a high mutation rate (half of cases are the result of xpressn bacterial ,we hav infeted both human myoblasts and myolubes new mutation). Despite the disease prevalence, only 20 or so specific in culture. In myoblasts, transfction efficiency increased to 70% at 200 plaque forming mutations have yet been identified, with only one recurring in more than one units (pfu) per cell, to almost 90% at 400 pfu per cell andto almost 100% at800 pu per cell. individual. Direct mutation detection is particularly difficult in this disorder Increasing cytopathic effect was observed abo 200 pfu per cell. To test adenoviral gen due to the large gene size (53 exons), high mutation rate, and variety of transfer in myotubes, human myoblasts were grown to confluence, counted and then mutations (large deletions to point mutations). switched to fusion media. Adenoviral gn transer, performed three days later achieved We have chosen heteroduplex analysis as the initial method of examining 60% tsentgene sionattnpfupercell(bsedonthenumberofcellscountedjust individual exons at the PCR level, since it is rapid, easy, and sensitive prior to fusion). At 50, 100 and 200 pfu percell, ene xression wasobserved in enough to detect at least some mutations. approximately 85%, 95% and 99% of myotubes, respectively. However, increasing point We are currently screening cytopathic effwt was observed at thm higher multiplicities of infection. These data 75 patients, and have thus far detected 10 abnormalities out of a set of 14 demonstrate a useful exerimental system for testing adenoviral vector-mediated gene exons. Three of these are clearly mutations, (e.g. frameshifts), two are transfer into dividing human myoblasts and differentiated human myotubes in culture. This polymorphisms, and the others not yet characterized. We are continuing system will be useful for the initial testing of adenoviral vectors encoding muscle disease analysis of all exons to obtain an overall success rate for this method in NF1. gene consruct. In addition, we are testing for the relative quantity of each mutant transcript by ASO analysis (in lymphocyte RNA) to furthercharacterize the effect of these mutations at the cellular level. Results from three mutations (two 1-bp deletions, one 6-bp deletion) indicate that the mutant transcripts are present, but at moderately reduced levels.

1146 1147 Kerain mutations In Epidermolytic Hyperkeratosis (EH) provide a model for Testing forls of heterozygosity in patIents with trchorhinhnr keratin intermediate filament instability. ((J.G. Compton, J.-M. Yang, C.C. syndrome I and Langer-Gledon syndrome. ((A. Cook, D.E. Well and Chipev, 1J.J. DiGlovanna, S.J. Bale, P.M. Steinert.)) Laboratory of Skin M.J. Wagner) Deparbtent of Biology, University of Houston, Houston, Biology, NIAMS and 1Dermatokogy Branch, NCI, NIH, Bethesda, MD. Texas. EH il an autosomal dominant disorder affecting the structurai integrity of the Langer-Giedlon syndrome (LGS) and Trlchorhino ag syndrome keratin intermediate filaments (KIF) of the suprabasal layers of the epidwmis. I (TRPS 1) are frequently accompanied by Intel deltons of the long Several lines of evidence have established that mutations in the keratin 1 arm of chromosome . In moat cas, these deletions have been (K1) and keratin 10 (KIO) genes result in amino acid changes and cause EH. detected by Cytogenetics. In some families however, deletions can not The relationship between the variable presentation of the disease, the type of be detected by cytological analysis. We have appieda method for mutation and its structural implications for KIF is not yet clear. To address this testing for smallerdeletions In patients with LGS or TRpS . Using question, we have identified 10 new EH mutations: 5 at the start of the rod primers for highly polymorphic, short tandem repeat (STR) markers that domain segment 1A of the K10 chain: N8 to H; Ri0 to C, Ri0 to H (2 cases); have been physically mapped to the LGS region (8q24.1i1 q24.13), we and Y14 to D. One other Ki0 mutation occurs in the 2B rod domain segment, performed PCR on LGS or TRPS I patients and their parents. Deletions L103 to Q. Three mutations have been identified in the K1 chain: VII to G of otherwise undetectable can be identified by loss of parental allels In the the H1 end domain segment; N8 to S and S13 to P of the 1A rod domain patients. We describe one nuclear family in which both parents are segment. Synthetic peptides bearing the HI or 1A substitutions are less heterozygotes witha different set of alleles at the DS1i99 locus. Their effective in disassembling preformed KIF in vftro than the wildtype peptide, offspring Inclued onechild with TRPS I. At this loaus we found that the Indicating the Important role of these residues in KIF structure. Strikingly, TRPS I child exhibited only one allele from the mother, and no allel from over 50% of the 19 known keratin mutations in epidermal diseases (EH and the father. We believe this approach wi be useful in identifying new epldermolysls bulbsa simplex) are clustered in the beginning 1 A rod domain deletions in patients with these syndromes. segment, with the others scattered along the protein chains. We have explored this further using wildtype, mutant and control peptides In the disasembly assay and demonstrate that non-conservative substitutions In residues 6-S15 Invariably Interfere with Interactions with KIF. Our data provide additions to the catalog of mutations for use in genetic counseling and prenatal diagnosis and provide a basis for understanding the three- dimenonal structure of KIF.

1148 1149 Mutation size and age at onset in Huntington's disease. ((D Craufurd and A Dodge.)) Department of Medical Mutatlon analysis In African-American cystic fibrosis patients. Genetics, University of Manchester, UK. ((G. R. Cuttingl, M. Macek Jr.1,A. Hamosh1, E. Nash1, S. M. Curristin1, C. L Davis1, S. S. Klesewetter1, R. F. Selden, Jr.2, B. C. Hilman3, B. J. The genetic mutation responsible for Huntington's Rosenstein1.)) 1Dept. of Peds, Johns Hopkins Univ Sch. of Med. Bait., MD; disease has recently been reported. It involves a 2Dept. of Peds, Univ. of Virginia Health Sciences Ctr, Charlottesville, VA, polymorphic trinucleotide (CAG) repeat which is expanded 3CF and Pulmonary Ctr, Louisiana State U. Sch. of and unstable on RD chromosomes, located within the Med., Shreveport,LA. coding sequence of a new gene (IT15) in the RD candidate Cystic fibrosis (CF) is less prevalent in African-Americans (1:17,000 live region on chromosome 4p. We are examining the than in Caucasians relationship between size of the expanded region and age births) (1:2500). To determine the nature of CF at onset in 450 affected individuals from 279 families mutations in this group, we screened 40 African-American CF patlents for 14 known to the North Western Regional ND Register. Data common CF mutations In Caucasian populations: AF508, G542X, G551D, are available to date on 56 affected individuals and 42 R553X, W1282X, N1303K, R117H, 621+iG->T, R334W, R347P, A455E, normal controls. The number of repeats varied from 3 - 1717-1G->A, R560T and 3849+10kbC->T. In patientswith unidentified CF 27 in the controls and 32 - 99 in those affected. alleles, CFTR exons 1-4, 7, 9.13, 17b, 19-23 were analyzed by DNA Additionally, we have confirmed the diagnosis in nine sequencing and/or denaturing gradient gel electrophoresis. The F508 individuals where HD was suspected in the absence of a mutation accounted for 37.5% (30/80) of CF chromosomes in this group. family history; a tenth individual with atypical Seven mutations observed in Caucasians comprise an additional I1% of CF clinical features had 29 repeats, intermediate between chromosomes in this group: R553X (3/80, 3.8%), R352Q, V520F, G542X, normal and abnormal ranges. There was a clear and relationship between the size of the expanded region and S549N, 1812-iG->A, S1255X (each 1/80, 1.3%). Eight mutations age at onset; the youngest (onset nine years) had 99 identified in this study have been observed only in Afnican-Americans: A559T repeats, while onsets between 11 and 25 were associated (2/80, 2.5%) G330X, S364P, 1342-1G->C, Y563D, 3662delA, 3791delC,and with 52 - 67 repeats. Onsets between 25 and 40 ranged W1316X (each 1/80, 1.3%). One patient carried a mutation previously from 40 - 52 repeats, and after 40 years from 32 - 44. reported in an African-American CF patient, 444delA. Altogether, these Further studies will examine the relationship between mutations account for 63.8% (51/80) of CF mutations on African-Americans. mutation size and other clinical variables. Similar to Caucasians, the spectrum of CF mutations in African-Americans is heterogeneous. Screening for CF mutations common in Caucasians will detect only 42.5% of CF alleles. To increase the CF mutation detection rate in African-Americans, mutant alleles that are infrequent but not rare in this group (e.g. A559T, 444delA) should be included. Molecular Applications in Clinical Genetics (continued) 1150 1151 Characterization of a glycine 769 to serine substitution in collagen type III in Parent-of-origin specific DNA methylation and imprinting mutations in the a three generation family with atypical EDS IV. Prader-Willi syndrome. ((B. Dittnch, K. Buiting, G. Gillessen-Kaesbach and [A. De Paepe, L Nuytinck and J. Leroy]. Dpt. Medical Genetics, University B. Horsthemke)). Institut fOr Humangenetik, Universit~tskfnikum Essen, Hospital Gent, Belgium. Germany. (Intro. by: E. Passarge) Mutations in the COL3AI gene cause Ehlers-Danlos syndrome type IV The Prader-Willi syndrome (PWS) and the Angelman syndrome (AS) are (EDS IV) and related clinical conditions. Point mutations duster at the caused by the loss of function of genes which are located in 15q11-13 and carboytermninal end of the al(III) chain and are usually associated with subject to genomic imprinting. In adult tissues, a Hpall site and a Cfol site at "acrogeric" EDS IV. This report concerns a three generation family with an the D15S63 (PW71) locus, which maps 100 kb centromeric to SNRPN unusual EDS IV phenotype. The proband was ascertained after she suffered within the critical PWS region, are methylated on the maternal chromosome, an intracranial hemorrhage at the age of 26 years. She had a history of but unmethylated on the paternal chromosome. The HpaIl site is part of a recurring shoulder dislocations but no bruising or dystrophic scarring. Her with to the terminal slcin was hypere sible, she had sequence high homology 5-long repeat of human mildly arachnodactyly, scoliosis, genua endogenous retroviruses. Another site at the D15S63 is recurvata and a peculiar face. Sitn fibroblasts from the proband produced HpaII locus both normal and mutant procollagen III molecules. SSCP analysis and direct methylated on both chromosomes. In placenta DNA, both Hpaii sites are sequencing resulted in the identification of a G to T transversion in the unmethylated. Sperm DNA carries the paternal-specific adult methylation In a COL3A1 gene converting glycine 769 to serine. Relatives in three genera- imprint. pair of PWS sibs with normal chromosomes of biparental origin dons were found to harbor the mutation. In none of them the diagnosis of we have found a maternal methylation imprint on both chromosomes. The EDS IV had been established previously. Their phenotype was characterized findings in this family and in other families suggest the existence of by recurring shoulder dislocations, bone fragility and peripheral vascular imprinting mutations, which may act in cis or trans on the PWS and AS thromboses. In contrast to patients with typical EDS IV, easy bruising and genes and represent a novel class of human mutations. (Supported by the bleeding and poor wound healing were not a major problem. Deutsche Forschungsgemeinschaft.) This report illustrates the variable phenotypic spectrum of COL3A1 mutations and contributes to improving the correlation between phenotype and genoypee A collagen type III defect should be considered in every instnce of familial or precocious vascular problems, even if typical pheno- typic features of EDS IV are lacking.

1152 1153 Trinuceotiode repeat lhngth: Instability and a&e of onset in Hunt son' dise. Screening for CFTR mutations in aents withl cneftl bilateral ((M.P. DuyaoiC.M. Ambrose1, RIL Myers,A. Noveileto3, F. Passcetd3, G. apasoftheves deAerens. ((D. M.S2,A. Ee', S. Nlcg, J. Barnes',J. Srihl, P~Bird4, J.P. Vonaa4, HD Clical Group*, M.R Horat'.)) Inst Institute of Repro M aAld, and J.. GOusellak.)) IMolecular eurogeneti-a Laboratory, Medicie ofthe Unier Mnstr, Germany. ?4bu~a Genal Hospitl Boston, MA 2Depsment ofNeurology, Boston Congen bilaterel apiasla dthe vas deferes (CBAVD) has r Y University Medical School, Boston, MA 3e mt of Biology, University of been reco ed a partof the doos spectrum caused by mutations Rome, Rome, Itly,4 Dptment ofNeuropathology, Harvard Medical SchooL in the cystic fibrosis anemembrane regulator (CFTR) ene. The Boon, MA. microsug asratn of sp mao from te eidyi (MES) with L 0hoN&fib emM as a p a e TIe Hin s disease gene, IT1S, contains a (CAG)n trinuceotde repeat that apeut opt for frtle cupeswh ma partner is Ed isexpanded on disease chomosomes Orinitia study suggesed tat this repeat by CVABD. In our treatmetprotocol forsuch coplswe hove inced is abeand thatits ength maycorrel with the a ofonsetofthedises. To a ndoy pre p sSeren proedue to test for CFTR address these quesdons, we have now extended our analysis of the triplet repeat on mutations in both partners. Heterodupiex analysis and direct 425 HD chmosomes from 150 independe families compared with 545 normal seueing ar P ,Rn e used to earch for fte R347P, chromosomms. We observed two non;overlping distributions of repeat length. DeltaF508, G542X, OSSID, W1282X end N1303K mutions. Among the Noral romosom displayed 24 alleles ccorsponding to arange of 11 to 34 8 patient with CVABDeamind sofor, we found3 to be he n repeat lengs, andH s yielded S4sles c ing to repeat for DeftaPSOB and one coml for DeaF5OB/ lengts of 37 to 86 units. nMotion was detected i any f t s spouses tesed. Mt Analysis of CAG repeat legthsin thre HDkindredswith dft hbaplotypes coupes are urrently under ies on, and we have now ad led extesive variation within each family indicating condAb instability. R117H to the mutations being for. In addition, evaluation ofHD repeat lengths on the coresponding parental HD After co on o molecuar sdes all couples are offered chromosome demonsodtratthatrepeat nth was eed in both m nl nd coun g by a ncal ic So far, Fe risk etmate for a child paena transmissions. However, therne ofincreasein repeat length was greater affectedby cysticf s been below 0.5% in al cae (Su d U on pa l nissi with the variation being reflected in male germ cells. in part by g Me 10S/1-1 and Ni 138/11). ination of the epeatlghs of 234 individuals whose age of onset data was availale showed thatage of onseti invesely correlated with the size ofthe repeat. Athoughthe overall correlation is striing, a broad rane of onset ages is asiad with any given repeat length. Th spread in ages of onsetis especially ii lare in thelowerend of the HD repeat di (37-52) indicating that other factors maybe involved in deninng onset. To be listed on poste q at 0 1154 1155 i Four novel FBN1 mutations implicta mutant transcript level and EGF4lke domain _li zbacher diee caused by a splice mutatico of the calcium binding in the pa of Marfan syndrome. ((ZA. Eldadah, I. Proteoli protein Beme ad a A et ladig to duplicatioe. I McIntosh, R.E. Pyeritz, CA Frcno, H.C. Dietz)). The Johns Hopkins ((0. Ellis, S. Strautnieks, S. Malcolm.)) Molecular Genetics University School of Medicine, Baltimore, Maryland. Unit, Institute of Child Health, University of London, U.K. Inherited defects In fiidlin (FBNI), a cmp ot xrr miroi Pelizaeus-Merzbacher is a neurodegenerative dysmyelinating bri, cause the Marafn syndrome (MFS). To date, including the four pred here, disorder. Proteolijidprotein is a sjor component of myelin in a total of 13 FBN1 mutations have bean reportei At tis early stage of crrelation the central nervous system. The gene maps to the x chromos of genotype with clinical and cellular phenotype, certain pattems are emerging. AM and mutations, resulting in amino acid substitutions have been mutatins cause moderate or severe substitute found in cases of I-linked Pelizaeux-Merzbacher and in animal misbense disease and residus models. In addition one with putative sinifnce for Ca+2 binding to EGF-1e domains. Native FBNI con- complete deletion of the gene has been sists of of reported. However, the majority of cases of Pelizaeus-Merzbacher arrays these tandemly repeated domains, which in oter proteins have disease, even with been shown to bind an apparently I-linked pedigrees, have failed Ca+2, event that may sablize secndary structure, to show mutations in the coding regions or splice site junctions. promote protein-protein interactions, and confer resistance to prteoysis. Whereas This poses a considerable dilin in genetic counselling. We the majority of missense mutations substi cystaine residue and dist report a further mutation of PLP: a G to T change was identified intramolecular disuffide bonds, tWo of the novel mutations (N-3511 and D-176A) at position -1 of the 3' acceptor splice site of eson 4 in an substitute EGF4lke domain residues which have excus significa for Ca+ affected boy with classical Pelizaeus-Merzbacher disease and his binding. This supports the hypothesis that Ca+2 binding to EGF-Ii domain is obligate carrier mother and grandmother. We have also looked integral to the funtion of native fibrUin and that its perturbation can result in MFS. for rearrangements around the gene in other affected individuals The other two mutations (2444insTTCA and del -253 to -2448;0+1 to A) create a using pulsed field gel electrophoresis. We have detected one frameshift,premature stopcodon, and reduced mutant transcript level. The patient rearrangement using MluI which dosage analysis shows results in with 2444insTTCA has 6% mutant transcript and mild disease, most consistent with a duplication of the gene. This is particularly interesting in MASS phenotype, while the patent with del -2530 to -2448 has 16% mutant trans- view of the fact that a duplication of 1.7Mb of DNA on chromosome and severe MFS. These data a dominant 17 containing the peripheral myelin specific protein PMP-22 is cript support negative model of MFS the usual cause and that deficit of monomer is not the of theperipheral neuropathy hereditary motor pathogenesis suggest wild-type sole deter- and sensory neuropathy type I (Charcot-Marie-Tooth type la). minant of phenotype severity, rather, that a threshold level of mutant gene product This is to of apparently the second example of the dosage of a myelin is necessary produce MFS.Verification thsparadigm would offer mutant al- gene causing instability of myelin with severe pathological leleknockout as a strategy for gene therapy. In addition, the phenotype associated consequences. with del -2530 to -2448 suggests that expression of extreme 5'FBN1sequence may be sufficient, in Isolation, to produce an animal model of MFS. Molecular Applications in Clinical Genetics (continued) 1156 1157 LoCUShergewnityfor Waudenburg snrm is noepreictive ofClinical subtypes. Paternal ts s of congenital myotonlo dysrph. ((K.H. sbeck1, (A iner', JH Asher', Cr Baldwin',TB Htedmsn',J Oreenber, KM crundfast, J. Begoffenhi, J. Kantl, J. Sadky2 D. McDonal-MnR, E.H. Zeoba2.)) AK LAWai4, AMiluna, R Morl, VNewton', R Ranesa?, VS Roo'. TB San 1Unlverslty of Pennsylvania School of Medicne and 2The Childrens Agustin' ER Wilcox', I Wship4, AP Rel.)) 'Bosto Univ., Boon MA; Hospitalof Ph Padelphiah, PA. Sota Univ., B Lansing[ 'Univ. of Cape Town, South Africa; aMichn 4NICD, Myotonic dystropl (DM), is a multisystem disorder with variable Bhsda, MD, sUniv. ofMncher, UK expression. Clinicafeatures of the congenital form of DM nlue reduIced fetal movements, hydramnios in ltor pregnancy, neonatal rroy Waafdnbugt syndrome(WS)isuadMmt inhitedandclinicallyvariable distrws, feeding Problems, facial wealness, hypolonla, disoader of def , pgmentary d b nes d minor abmo lites of facial delayed motordeopmnt, and mental retardation. The reports snructre. Clinically, WS type I (WS1) is diffenad fromWS type II(WS2) on that transmission of congenital DMis almost exclusively if not e the b1s of dystopscanthmunL 1In some families, th disea haa been attributed maternal. We present a cas ofcongenital DM which w initd from a to mutations in the PAX3 gen on chronsomne 2q. We, die NICD WS mldly symptomati father. mhave typed micosaellite markers within and flanking PAX3 in 42 WS The patientis a male product of a34 wk gestation born to a39 yea old kindreds in order to estimate d proportion of families with prbab mutations in father and a 34 yea old mother whose pregnancy wa complicated by PAX3 andto studytheI lio between pe d hetergleneity. polyhydramnbos. He has a history of respiratory and feeding problems in Assuming t a lcd sore of -2 at PAX3 locu rules out linkage and a lod score the neonatal period, delayed motor and language development, and of 2l at PAX3 is sufficient evidence favoring linke mllocus linkage analysis modete mental retardation. Exam at age 14 shows a narrow, elongated indicated that 15 families (all WSl) are linked 17 families WSI and 9 WS2) are face with ptolsi, percussion and grip myotonia, and d d muade (8 tone with genalized symmetrical His father has no s unlinke, and 10 famlies (9 WSI and I WS2) could n be classified with certainty. of musde weakness at age 53, but he has a history of caracts nd frontl These findings sgest that WS in less than 50% of families is linked to PAX3. hair loss, and mid facial weakness on exam. The fates sitr has typical Screenig of the PAX3 gene has revealed mutations in 5 ofthe linked families, I clinical manifestations of DM. Analysis of the CTG repeat in the myotonin- WS1 with equiocal linkage results, and 3 WSIfame which wer not protein kinase gene showed the proband to have one aliele with 12 suitable for linkae anaysi PAX3 mutations have also been discoveed in anodier repeats and the other with about 1500. Hs father has aliss with 14 and family dot is probsby WS2 and in 2 WS3 families (WS3 is an extremely rare 100 repeats, and his mother hasailes with 5 and 12 repeats combination of WSI plus upper limb ao lt). Although piin studies This family illustrates that the congenital form of DM can occur without do not suggest any association between the clinical outcome d the moleculr Intrauterine or other maternal factore related to the dsea. The possibility pathology in the 12 families with kern muons, nealy all families lnked to of paternal trsws of the Congenital form of DMshould be cond PAX3 have dysopa in counseling myotonic dystrophy patients and their families

1158 1159 Mitochondrial ribosomal RNA analysis in patients with sporadic Conformation sensitive gel electrophoresla of polymerase chain aminogycosie ototoxkcty. ((N. FischeW-Ghodsian, T.R. Prezant, X. reaction products of the type II procollagen gene reveals a Bu, C. Bacino, and S. Oztas.)) Cedars-Sinai Medical Center and heterozygous Gly988' Val mutation In a baby with UCLA, Los Angeles, California. hypochondrogenesle. ((A. Ganguly1, M. Rock1, E. Considlne1, S. McCarron1, V.V. Mlcheis2, D.J. Prockopl, and C.J. Williams1.)) tDept. of Aminoglycoslde-Induced deafness has been described In a Biochemistry & Molecular Biology, Jefferson Medical College, Thomas number of Chinm pedigrees, and In nearly ali of these families, Jefferson University, Phiia., PA 19107; 2DepartMent of Medical Genetics affected individuals were related through the maternal side. Mayo Clinic, Rochesr, MN 55905 Recently we analyzed three such families with multiple cass of A new mutation detection technique based on resolution of double- ototoxic deafness, and Identified a pathogenic homoplasmic stranded DNA conformers has been developed. The method detects mutation in the mitochondrial 12S ribosomal RNA gene at differences as small as a single-base mlsmatch in DNA heterodup b of nuclootide position 1555 (Prezant at al., Nature Genetics, in PCR products. The altered migration of heteroduplexes versus press). The mutation occurs at a highly conserved region of the homoduplexes Is resolved In a poiyacrylaml-baeud gel electrophoresis rRNA gene, in which aminoglycosides are known to bind, and in system. The technique was used here to detect a conformatdonal change which aminoglycoside-resistance mutations have been found in In one aliele of exon 48 of the type 11 procolagen gene (COL2A1) In a baby other species. The mutation was not found in 278 controls. with lethal perinatal hypochondrogenesis. Direct sequencing of the PCR The purpose of the current study is to analyze the 12S product revealed a G - T transversion that converted GlySS (-GGT-) to Val mitochondrial rRNA gene of individuals with no famiy history of (-GTT-). The mutation was confirmed by restriction site analysis Fifty deafness, who had severe hearing loss after aminoglycoside normal individuals and ten patients with varous chondrodyspasas did not exposure. Blood was obtained from 36 Chinese individuals with have the base change in the triple-helical domain of type 11 procilajen. 'sporadic' minoglycoside ototoidcity. In one of these 36 sporadic This is the third example of a heteoygous point mutation In exon 48. Two cases we identified the homoplasmic 1555 mutation in the other base substitutions at positions 976 and 997 caused clinical mitochondrial genome. Further molecular analysis of the 1555 phenotypes of severe hip arthropathy asted with epiphyseal dysplasia negative patients will be presented, and the biological and clinical and spondyloepiphyseal dysplasla congenita, respectively significance of these findings wili be discussed. (Supported by Supported in part by grants from N.I.H. (39740), the Lucille P. Markey NIDCD grant RO1DC014OZ and March of Dimes grant 6-FY93- Charitable Trust and the March of Dines/Birth Deects Foundation. 068).

1160 1161 Mutons i periphrin/ROS Ina wihriI pgWmeit a 12 base-pair DNA-badtyping of the HLA-C ocusof psoriasis patlents reveal$ a novel deltdin ine on 2. ((A. G onJA Rotdige1, P. r, D.G irc, HLA-C allele present at high frequency. ((A.T. Garber and R.W. Hey.)) JR. H l aNd &.P. D W)).Th iUniv. of Teox HSC at Houston; Alberta Children's Hospital and the University of Calgary, Alberta, Canada. VONlty odee, Dun eland; oftitSouthwest, D sTX; and Juls S Eye s., Univ. of Cfnia, Los Angeles. Psoriasis, an inherited skin disease of significant morbidity, affects 1 3% of the Caucasian population. Psoriatic lesions are characterized by As part of our lun tde of Woosml bm of retinitis p4igeON dramatic hyperproifration of epidermal keratinocytes and marked (RP), we screened a pane of DNAs frm75 uinrelatedWpaiets for mtiosin infmmi . The satiology of psoriasis is unknown. Psorlasis shares with pherin/RDS. Thespade7tswerehownmbyprous to he sever oe rdiseases of unknown cause such as disbates and ankylosing rhtodopsin mutatons M patie-ts tested had RP, though several had additional spondylitis, the phe of a significantly Increased relative risk retna fidns Apoowtimel hel of the patlerts were from fmle, hwn associated with certain HLA loci. Of particular note, psoriasis Is unique In do,*miat inhwieritace; Vierreminder wer eithe Isolated -ae or were from human diseases in having its most ignificant HLA association with the HLA- famies too ernsl to mesmbiuh mod of inheritance. The DNAs were tetdby C locus, specificaly HLA-Cw6. In recent years, It has become evident that SSCP uig4 prkime pairs to spa the 3 periphein/RDS scone, foowed by serologicaly-defined HLA icc are often not typed accurately. This is elmetrophoresis under twodiffeet conditions. Amplifiedpi-k were chosen especially true at the HLA-C locus as - 50% of Individuais cannot be typed to Include intron-xon unction (except for the 3'-untrensiatsd end. and are classified as HLA-C *bank'. We have refined a PCR-mediatcd Thiteen of the tested ONAs had varmint SSCP pattemei distinct from the strategy to specifically characterize the HLA-C locus from either total RNA known polymophic a miod sbstilltions (Jordan at *.. Hum. Mut 1:240- (J. Invest. Dem. 98:625A) or genomic DNA samples. A survey of 247, 1692. One of the SSCP variants was the result ofa 12 base, per, in-rame randomly selected psoriasis patlents has revealed known HLA-C allels and deletioni in exon 2whc remnoves codlons 206 through 209 (A906-909). The a novel HLA-C allele present In nealy every psoriasis pant teated. The deltinCR fda with t putav roaieca dop oft epoins. The mutation predicted protein sequence of the extracellular oland o2domains of the wa fund In an affecle fathe and eon, both with severe RP and maculhr novel HLA-C molecule defines a unique peptide binding domain. We have abnormalities .Seueci of te rening SSCP variants Is underway. recently developed a PCR-RFLP atrategy that datects the presence of this Peiphein/RDS is exprese In both rods and covn; i product is a novel HLA-C allele in both genomic DNA and cDNA derived from total RNA. mmbans Ong phootn ta localizes to photo ceptor discs. Thus The presence of a previously unknown HLA-C libele In psoriasis patlents, aioS can affect ehr rode (P), cones (mculer inomN) or both and the known association of psorlasis with the HLA-C locus sugg that Supported bygr frmtheNatoa P F d the George Gund this novel allel plays a significant role In the Initiation and/or perpatuation Foundaion and rom NEI-NIH. of this commonskin disease. Molecular Applications in Clinical Genetics (continued) 1162 1163 Evidence for a recessive point mutation in Charcot-Marie-Tooth disease Rapid screening for point mutations in Duchenne muscular dystrophy (DMD) type 1A. (IC.A. Garcia', 8.8. Roa2, L. Pentao, J.M. Killion2, B.J. Trask', using a translation-ased method. ((R.J. Gardner', F.LM. Norwood, P.AM. U. Suter4, G.J. Snipe, E. Shooter4, P.l. Pel2, J.R. LupskiV.)) 'Louisiana Roest, J.T. dan Dunnen', M. Bobrow', R.G. Roberts')). Paedlatric Research State University School of Medicine, Now Orleans, 2Bayior College of Unit, Guy's Tower, Guy's Hospita London UK.' Department of Human Medicine, Houston, TX, 'Universlty of Washington, Seattle, 4Stanford Genetics, Leiden University, The N land. University School of Medicine, Stanford, CA. 35% of cases of DMD are assumed to be due to small deMons and point mutations in the human dystrophin gene. By ext in from goes deletion Charcot-Marle-Tooth diseasetype 1 A (CMT1 A) Is an autosomal dominant mutations, it is expected at the vast majority of twese mutations wilm 1ikeise peripheral neuropathy usually caused by DNA duplication of a 1.5-Mb disrupt translation and this is supported bythe c.17 point mutations which have region in 1 7pl 1 .2-pl 2 which contains the PMP22 gone, or alternatively by been reported to date, all of which disrupt the translational reading frame. point mutation of PMP22 which encodes a peripheral nerve myolin protein. Due to the large size of the dystrophin gene (79 exons, 2.4Mb) the mRNA We Intified a severely affected CMT1 patient carrying an apparent is studied. Primers have been designed so that all 11 kb of the coding recessive PMP22 point mutation on one chromosome, and a deletion of sequence can be amplified in 10 sections from ectopic lmhyt as 1 .5-Mb on 1 7pl 1 .2-p12 on the homologous chromosome. This individual using reverse transcripti and two rounds of PCR. At thi stage, spie site mutations manifest as length anomalies. The sections are then screened for who was a compound heterozygote for the PMP22 locus displayed severe other translation-terminating mutations using the Protein Truncation Test (PTT) clinical and electrophysiological symptoms of CMT1 A. Analysis of family developed by Roast et a.. The 5' nested primer contains a T7 promoter and members identified one son who is heterozygous for the PMP22 point a eukaryotic talation itiation signal, allowin the scary RT-PCR mutation and displayed no symptoms of peripheral nouropathy. Other product to be tsbed and translated va Met i icorporat and family members who carry only the 1 .5-Mb deletion mutation exhibited the the labelled products separated using SDS-PAGE and autoradoaphud milder clinical phtype of hereditary neuropathy with liablity to pressure Translation-terminating mutations are lcalised by sizing the tu d palsies (HNPP). This finding provides further genetic confirmation that polypeptide and then characterised in detail by direct sequenchi. mutations involving PMP22 lad to CMT1A, and indicates that different Wehavetestedthe PTTsystem using our previouslychacterd mutations point mutations In PMP22 can result in both autosomal dominant and and have now usedit successfully to screen a lrge number of patients for unknown mutations. The technique is easy to perform, noes any neutral recessive alliees contributing to CMT1 A. Furthermore, the possibility is changes and detects point mutations throughout the dystrophin gene. It is raised that mutations in PMP22 may be similarly involved in related therefore a highly efficient method for dignostc use and will quicidy provide peripheral neuropathkis. much awaked data on the distribution of point mutations and small deletions within the dystrophin gene.

1164 1165 Poster Symposium - Session 41 Partial attenuation of fibrlin immunofiuorescence abnornalties in Marfan HUNTMIGTON DISEASE IDENTFICATION OF A PREMUTATION syndrome fibroblasis folowing in treatment with antisense ((Y. P. Gldberg1, IKrearl,B. S. E. Andrew1, J. Thellmnn1, R. phosphorothioate oigonuletides1 ((M. Godfrey and P. L Iversen.)) K Grahaml, F. Squler1, H. TeWnlul, 8 Adaml, AfSaool, El. University of N Mdal Center, Omaha, NE. Starrl, A.Helbeirgz, G. WOAf, and IL R. Hayden1)). 1Dept of Medical Genetics, UBC, Vancouver, B.C. 2Frambu Helsesenter, Gene therapy is now a clinical reality for certain disorders. Ws use in the Siggerud, Norway. 31nstitut fOr Humangenetik und Anthropologle, cardiovascular system, both in ylxtm and in yho. Is also being explored. Universt Freiburg, Germany Although easy to envisage either local or systemic effects of genetically t panted soluble mediators, replacement of structural proteins are more Huntington disease (HD) is a d with expansion of a CAG diffiult to visuaize. Antisense p oonucleotides have been repeat In a novel gene. We have olected DNA and where possible used to inhibitgne exreeslon in severalsystemsIncludingthe metallothionein clinical details from 1050 affected persons with HD (650 families) of gene and HIV. Immunofluorescence abnormalties were the first to suggest whom a total of 936 (89%) represented patients in whom there was a possible role of Ibrillin In the etiology of the Marfan syndrome (MFS). In fact, an established family history of HD. Those patients without an more than 90% of people with cinically diagnosed MFS exhibit an apparent estabished family history of HD (113, 11%) were subjected to further diminution In Immunoreactive bris In hyperonfluent fibroblast cultures. We investigation. An additIonal 95 were excluded by having either a have reoentiy identifieda mutation which results In the deletion of one EGF4-ke family history that raised the possibility of HD or, where HD In exon in one alle at the mRNA level. (Genomic studies to characterize the parents couid not convincingly be excluded. A total of 18 individuals cause of this deletion are ongoing.) We have synthesized antisense remained who fulfilled the criteria of clearly having the signs and olgonuclotides to a region of this deleted exon and to a region spanning the symptoms of HD and having parents who had lived beyond the previously flanking exons. Antisense olgonucdes, to both fibrillin, normal expected age of onset (>60). We show the existence of a and mutant, and unrelated controls, were incubated In fibroblast cultures. premutation in a parental allele of 30-38 CAG repeats in the Results showed almost complete absence of Immunoreactive fibrils H the Huntingtin gene which Is greater than that seen in the general antisense oligonucleotides used were to normal fibrllin. This was true In both population (c30) but below the range seen In patients with HD (>38). normal or mutant cehk On the other hand, incubation of the antisnse These premutations are melotically unstable and in the sporadic olgonuclotide spanning the mutant ibllen had no affect on normal cells, and cases, expand to the full mutation associated with the clinical wasable to partiallymprovetheabnormal immunofhiorescence pattern usually phenotype of HD. These findings indicate a previously unrecognized sen In those colls. Thes studies may provide the w for bsuent risk of Inheriting HDto chiidren of siblings of sporadic cases of HD. work to block translation of delective fibdln allele.

1166 1167 Evidence for the 3271 mutation In the mitochondrial transfer RNA gene Mutations in the carboxy terminus of FBN1 suggest a potential reating to milochondrial cephalomyophe ((V. Gotol, I. Nonakal, S. genotype-phenotype correlation in the Marfan syndrome. ((J. Grossfield, S, H-o2, J.-l. Hayas and S.K.N. Merle.4)) 1Netlora Centor of Neurology and Cao, D.M. Milewlcz)). University of Texas Medical School, Houston, Texas. Psychiatry, Kodair, Tokyo, n; 2National Istitute of Genetics, Mishima, Japan; 3Tuk Universty, Taukub. Japn; and 4unvriqt of Sao Paulo, Characterization of mutations invoiving the carboxy terminus of the FBN1 Sao Paulo, . protein In three unrelated Marfan patients suggests a potential correlation between mutations In this region and the resulting clinical phenotype of the The 3271 mutation In the milhonril tRNA-Leu(UUR) gen lsth second Marfan syndrome MS). The first two patients 17 and 11 years old) are co In paintwlth MELAS (mlochorxal myopathy, nphal sporadic cases with lens dislocation, skeletal features of the MS, and only lac acidosis, and stroke-like episodss).The mutation has been reported so mitral vaiv prolapse on echocardiogram. Dermal fibroblasts explanted from far only In Japanese patients. Each line of evidence from gonotic and these individuals were used to fibrillin Both cells biochmical stuie disclosed that the mutation Is dis . First, the study processing. patients' mutation was detected In patients with miochondrial myopathy of Brazilian, made a faster migrating form of fibriliin, approximately 2OkD smaller, In rnonapaneo, descat The symplnotic patients, however, dtiblted clica addition to a normally migrating form. RT-PCR of the 3' end of the fibrillin features atypical to MELAS. This may be anhrexampie of phenotiic cDNA using RNA harvested from the dermal fibroblasts revealed the same diversity as s the case of the 3243 mutation. Second, tranformants d d 175bp deletion between nucleotldes 5359 and 5534 (Maslen at al., Nature, from rho-zero cells and the patient mitochondria containing the mutants 1991) present in both patients, corresponding to exon 64 of the fibrillin showed decreased activity of respiatoy chain enzymes when the ratio of the cDNA. This deletion results in a premature stop and produces a protein 1 6kD mutants exceed approximately 90% of total mitochodrial gonomes. The smaller. The protein is missing the unique carboxy terminal domain and results supported the claim that the 3271 mutation plays a certain role In disrupting the let epidermal growth factor (EGF)-like repeat of fibrillin. The pahogeneele as the 3243 does. Whether both mutations have the same third patient is a 15 year old boy with lens disiocation. skeletal features of the pathologl affects Including tRNA dyunction and Impairment o tripin MS, and normal echocardiogram. RNA harvested from the patient's dermal termination remains to be en. In conclusion, this study Indicated the fibroblasts was used for RT-PCR and single stranded conformational Importance of the 3271 mutation In pathogenesis of mitochondrial polymorphism analysis of the fibrillin cDNA. This analysis revealed a C to T enepaomyoptis_ transition at nucleotide 5344, substituting a cystelne for an arginine at codon 1782. As a result, a new cysteine is Inserted into the est EGF-Ilke domain of fibrillin. These results Imply that heterozygons mutations Involving the carboxy terminal region of fibrillin result In ocular and skeletal features of the MS out of proportion to the severity of cardiovascular manifestations. Molecular Applications in Clinical Genetics (continued) 1168 1169 A novel point mutation (G-1 toT) in a splice donor site of intron 13 of the Mutation analysis in cystic fibrosis patients with pancreatic sufficiency. for Becker pancreatitis, borderline sweat chloride concentrations or isolated congenital dystrophin gene results In exon skipping and is responsible bilateral absence of the vas deferens. ((A. Hamosh, M. Macsk Jr., E. Nash, muscular dystrophy. S. M. Curristin, B. J. Rosenstein. G. R. Cutting.)) Center for Medical Genetics, of Johns Hopkins Univ. Sch. of Med. , Baltimore, MD. Y. Haglwara, H. Nishio, Y. Kitoh, Y. Takeshima, N. Narita, M. Yokoyna ,1 Dept. Pediatrics, H. Nakamura and Matsuo.2 The 286 cystic fibrosis (CF) patients attending the Johns Hopkins CF Departments of Pediatrics and First Department of Internal Medicine1, and center were clinically characterized to select phenotypically unusual patients International Center for Medical Research2, Kobe University ,Kobe, Japan. for in-depth mutation analysis. Patients were defined as pancreatic sufficient (PS) if they had a normal 72 hour fecal fat study (<5% excretion) and sweat The mutations in one third of Duchenne and Becker muscular dystrophy Cl concentration of >70mM. The second group was patients with a history of (DMD and BMD) patients remain unknown as they do not involve gross 50 and 70 mM We now a defect in the splicing pancreatitis. Patients with a sweat Cr concentration between rearrangements of the dystrophin gene. report and pulmonary or pancreatic disease suggestive of CF were classified as of precursor messenger RNA (pre-mRNA) resulting from a maternally Atypical. Adult males referred because of infertility caused by isolated inherited mutation of the dystrophin gene In a patient with BMD. This defect but without a G to T transversion at the terminal nucleotide of exon 13, within congenital bilateral absence of the vas deferens (CBAVD) results from evidence of pulmonary or pancreatic disease comprised the fourth group. the 5' splice site of intron 13, and causes complete skipping of exon 13 during processing of dystrophin pre-mRNA. Genotypes identified thus far in the 22 PS patients include: AF508/JF508 The predicted polypeptide encoded by the aberrant mRNA isa truncated (n=6), AF508/unknown (unk) (4), AF508/R1 17H (2), 0F508/R352Q (2), dystrophin lacking 40 amino acids from the amino-proximal end of the rod AF5081G551D (1), A455E/W1282X (1), AF508/S1159P (1). R347P/unk (1), domain. This result suggests that this region of the rod domain is important to R553X/unk (1). and A559T/unk (1). The 5 pancreatitis patients had normal dystrophin function. genotypes: AF508/unk (2); &F508/R1 17H (1), R560T/R334W (1), and an intra-exon mutation which completely 444delA/unk (1). The 10 Atypical patients were: RI 17H/unk (2); This is the first report of point identified in the 2 CBAVD inactivates a ' splice donor site in dystrophin pre-mRNA. Analysis of the AF508/P67L (1); and AF508/unk (1). Genotypes patients were AF508/R347H and G542X/unk. A surprising number of the PS genomic context of the G1 to T mutation at the Ssplice site supports the patients (7/22) carry 2 pancreatic insufficient (PI) alleles. Whether these exon definition model of pre-mRNA splicing, and contributes to the patients will be late converters to the PI phenotype or carry additional understanding of splice site selection. mutations which ameliorate the phenotype remains to be studied. The R3520 and S1159P mutations should be added to the list of PS alleles; while the P67L and R347H mutations are new atypical and CBAVD alleles, respectively.

1170 1171 Construction of chromosome band-specific DNA probe pools by An In-frame Deletion in th Proteolipid Protein Gone in a Family with Disease. ((D.O. Isndor, V.M. Pratt, JA Trofatter, irdi n and it's application. (( X-X. Hel2, H.-X.Dengl'2, J- Polizaeus-Merzbacher S.R. Dicuhy, and M.E. Hodes.)) Indiana Univrsity Schoo of Medicine, H.Xial, L-Y.Li1, Y-H Zhul, H-PDsiI,W-Y.Hung2, N.Niikawa3, and Indianapolis, IN. T.Siddique2.)) IMe National KeyLbcaory of Medicl Genetics, Huan of Medical University , Chanqshs, Hunan, China. 2Neparinent P011zaeus-Merzbace disem (PMD) is an Xlinked, earlyoet Neurology, Northwestern University Medical School, Chicago, IL. dyaYSlinatIng diode the coral nervous system. The clinial picture 3Deprtment of Human Genecs, Nagasai University Medical School, icludes ny , titubstion, ps otor delay, and death in the second Naaski, Japan. decade of life. We [Trohftwr at a., PNAS 19891 have previously shown that Chromosome band-specific DNA probe pool is a very useful tool for PMD is tightly linkd to a milsee mutation in waon 2 of the proteolipid cy c and molcular studies. Itcan be used not only for the detction protein gene PLP (led scoar 6.2, e=o). Unftunately, about 70% of PMD- of chosome abnomlitis at band level, but also for the isolaion of affected families have no defects in the sOn exons of the PLP ne. chromosome band-specific DNA probes and markers. We have used Nevertheless, by using single base exon polymorphima i we chromosome microdissection and microcloning techniques to construct have discovered, our combined lod score for PMD versus PLP is 9.9 (00). chromosome-specific and chr fic probe pools fromX, We report now a 1.6kb deletion within the PLP genetaVW an part of exon Y 2, 7, 12, 21, lp36, lp32, lq32, lq42, 2q33, 3q12, Sql3, 6p2l, 8q24, Ilq23, 12ql2, 13q12, 15ql2, 17pl3, 21q21,and Xpl2. To verify the 3, intron 3, and part of xown 4 in a 3-geratio PMD family. in eected fidelity of thes probe pools, we used chromosome painting technique. males, PLP eons tree and four would not amplify by PCR. The delation The signals were only located at corresponding chromosomes or was disoveed by PCR amplificion across the deletion nd wa confirmed chromosome bands. In additon, the DNA probe pool generated from by sequencing. PCR was also used to d t cai status in the icodissction has ben ued toideny cOosome? partial risomyin a probands mother and maternel granodm . The deletion eliminats 48 patient. Several ch nmosome-band pecific DNA markers have lo been amino acids but the sequence remains in-fame. The deletion also isolatd from ourprob pools. intrupts one of four hpo d a m domains in the model of PLP put forward by Popot at al. [J Mamb Biol 19911. This deletion is the only lrge defined deletion within PLP that we ae aware of, nd will probably be usful in furthering understandin of the structure and function of the PIP protei

1172 Poster Symposium-Session 40 1173 Fully automated PCR-based disease gene mapping. ((E. P. Hoffman1, R. C. Unusual Insertion of an Li element along with Its unique Hoopl, J. P. Kentoni, M. B. Burke2, and M. W. Perlin2.)) IUniversity of 3' flanking sequence Into an exon of the dystrophin gene. Meflon University, Pittsburgh, Pennsylvania. ((S. E. Holmes, B. A. Dombroski, C. D. Boehm, C. M. Krebs and H. H. Pittsburgh and 2Carnegie Kazazean, Jr.)) Department of Pediatrics, Center for Medical Genetics, Fast and accurate PCR-bassd genotyping using highly polymorphic tandem Johns Hopkins Hospital, Baltimore, MD. repeat markers is essential for effectively assessing risk in families, and mapping disem genes on chromosomes. Currentiy, there are two key Analysis of a patient with muscular dystrophy of phenotype bottlenecks in such genotyping: the acquisition of data by gel electrophoresis, intermediate between that of Becker and Duchenne showed that exon 48 and the analysis of this data. We have eliminated both of these bottlenecks was inceased by 2 kb in size. It was found to contain an insertion of a using oomputsrzed data acquisition and analysis. This advance enables, for rearranged Li element, but with adjacent 3' unique sequence. The Li example, the fully automated overnight experimentation and analysis needed to sequence is 5' truncated, and 1.4 kb in size. It has 8 nucleotide changes determine affected and carrier status in families with Duchenne's muscular from L1.2B, a previously identified active element, belongs to the Ta drophy (DMD) without a deletion mutation. subset characteristic of active elements, and has an open ORF2. Prior to Our experiments are automated by multiplexed data acquisition on an a 37bp poly A tail, Li sequence ends with an ATTAAA instead of the automated DNA sequencer. The multiplexing is done for nonoverlapping size usual AATAAA. The unique sequence following the polyA tail is 0.6 kb windows and with fluorescently labelled PCR primers, enabling the simultaneous it 3' of of marker experiments per sequencer ane. Each and contains a polyA tail of 41 As at end. PCR analysis normal analysis many independent individuals demonstrated that this flanking sequence is also next to the marker experiment is mathematically processed to eliminate PCR stepping event artach of the CA-repeat, and to unambiguously determine the allele(s) of the Li element in its original genomic location, so the transposition marker. For rapid and accurate DMD molecular diagnosis, four markers involved a transfer of unique sequence which can serve as a 'tag' to to spanning the 10 cM DMD gene are sampled for each pertinent individual in the definitively identify the active element. The flanking sequence maps family. A consistency algorithm is then used to set phase, and determine chromosome 1 using somatic cell hybrid panels, and oligomers from this hypes. The affected and carrier status is then computed, and the results region hybridized to dried gels show one copy in humans and primates. are visually presented on an interactive Macintosh computer screen. The insertion is inherited over 3 generations in this family with 10 family Importantly, once the data acquisition has begun, ali aspects of the multiplexed members affected. Since exon 48 is an in-frame exon of 186bp, the genotyping and analysis are fuly autoated, requiring no human intervention. intermediate phenotype could be caused by exon skipping. This insertion indicates that tne poly A tail of an Li element is not always added post-transcriptionally, and that read-through transcription can carry along flanking single copy sequence in a retrotransposition event. Molecular Applications in Clinical Genetics (continued) 1174 1175

A nvl cau of m skipping: a + 4 A-+G basition in the IVS33 splice MOLECULAR HETEROGENEITY OF HEREDITARY ELLIPTOCYTOSIS IN donorshle of the netnufilbreainshtypel (NFI) gene. ITALY E. Miraglia del Giudice, S. Perrotta, E. Sannino, M. Franciosi, L. Pinto and ((P. HI-ter, S.E. Antonarakis, C.D. Delzer-Blanchet, and MA. Momis)). Alolascon - De t od Pediatrics, Second University ofNaples Division of Medical Genetics, University Medical Centre and Cantonal Hospital, Hereditary Elliptocytosis (HE) is arathercommonethocytic disorder which Gene%%Swtdle~ is hetogeneous in terms of inheritance, clinical severity, red cell morphology and underlying molecular defect. Hereditary Pyropoikilocytosis (HPP) is a more rare and severe, tightly related, hemolitic anemia. HE is frequently associated with To characterize mutations in we have screened samples from 35 patients a defect in NFI, Spectrin (Sp) dimer self-association and aboonnal proteolytic cleavage of the Sp a I for mutations by RT-PCR and other standard methods. In one 59 year-old Swim domain; moreover partial deficiency of the 4.1 protein has been often detected in HE patient with sporadic NFI, RT-PCR frmn leukocyte RNA gave rise to an subjects in Southern France and North Africa. In the following table we summarize abnrma-smal api cin product, in addition to the expeted product. The results of biochemical (SDS-PAGE and spectrin digestion) and molecular studies (direct DN euni~cnenn 1IainHE or HPPpaimt (2kndreds intenly of the two bands after agarose dectrophoesis suggested that Patients Clinical Membrane Molecular Defects approximately equinolar amounts of the two produces were present. Sequence (familes)i Presentation PrtisAnomlte analysis revealed that the abnormal cDNA lacked exon 33 and had a perfect 14 (8) HE Mild(20%mto30%) jeetapostionofexons 32 and 34. protein 4.1 deficit 12 Sequencing of genomic DNA from eon 32 to IVS34 revealed only a single (5) HE 65-Kd. peptide 154 TTGduplication in exon 4 of a Sp nucleotide substitution, an A-4G transition at nucleotide +4 of the IV533 splice I (1) HPP 74-Kd. peptide 28CGT->TGTin donor site (GTrdta toG1U~tpt). exon 2 ofa Sp The aberant spicing of this exvn results in a change of the reading frame and a 3 (1) HE or HPP 74-Kd. peptide 2018GCC->GCC in predicted less of 777 of the 2811 amino acids of the mature protein. As the +4 exonX of 8 Sp 2 (1) HE 74-Kd. peptide 34 CGG->TGG in A-+G tansition was not present in 170 non-NFl chromosomes from unrelated exon 2 ofa Sp Swiss individuals, and as no other mutation wasdetected by genomic sequencing, it 2 (1) HE 74-Kd. peptide associated with appears that this mutation is responsible forthe defective mRNA. This is the second S-Sp oflower molecular weigth i dent case of NFI with skiping of this exon. These results provide the first 7 (5) HE No alterations found evidence that mutations at nucleotide +4 of the spice donor site can to lead Concluding we found 14 HE patients (34%) withjunctional complex alteration and 20 abnormal spicing and human disease. patients (49%) showing defective spectrin self-association whereas in 7 HE subjects (17%) no abnormalities were detected.

1176 1177 Mitochondrial Myopathy due to point mutation of proline Th IbenIfka oftanexcoapelpbeln mtaon in afanily with tRNA. J( V. V. Ionasescul, M. Hartl, C. T. Moraes2, S. beteenmMufto a buterfly pawtenculardystphy. IKE. piMauro .)) lUniverity of Iowa, Iowa City, Iowa, USA, E.B. I AColumbia New York, NY, Jackonl, Mitchellt, E.M. Stone2, R.E Ferrelll, M.B. Gorinl.3*l Dept. of University, USA. Human Genetics, Univ. ofPittsburgh; 2 Dept ofOphthalmoL Univ. of Iows, Iowa We studied a 9-year-old girl with progressive proximal City; 3lbe Eye& Ear Int ofPgh, DepL ofOphthlmoL, Univ. ofPittsburgh, PA. weakness of her extremities for two years and negative family history. Her neurological evaluation showed We clinically charceIzed a three-generation family with an antosomal dominant weakness of iliopsoas, gluteals, sternocleidomastoids, dystrophy of the retina and pigment epithelium. Because of the clinical similarities of deltoids, back muscles and no external ophthalsoplegia. Her seval of the cted members with the reported butterfly macular dystrophy serum creatine kinase, electrocardiogram, electromyogram associated with peripherin mutations, we tested for linkage using a polymorphic CA and motor nerve conduction velocities were normal. Her repeat near the peripheuin gene. A LOD score of2.42 at theta -0.1 suggested that the serum lactic acid was elevated (7.3 MEQ/L). Muscle biopsy peripherin gene or a closely linked gene was rpib for the disorder. A novel of left vastus lateralis revealed type I fiber predominance variantin exon 2 ofthe peripherin gene was identified by dening gradient gel and numerous fibers with mitochondrial aggregates, lectphoremis in the proband and an affected cousin. This peripherin mutation was endomysial fibrosis, necrotic and regenerating fibers. confirmed by SSCP analysis of the entire family. eqecing ofthe exon-2 PCR Electron microscopy showed numerous paracrystalline products revealed a C to G change in the second nucloddeofcodon 210, resulting in inclusions in sitochondria with cristae arranged in the substitution of arginine for proline. Nine individuals were clinically affected with parallel rows and whorls. Muscle cytochrome C oxidase was a variety of manifestaton ofretinal and pigment epithelial disease that had significantly decreased (0.49 micromoles/minute/gm versus previously been described a atrophic macular degeneaon, Str 's disease 2.80 micromoles normal value). The molecular genetic study pattern dystrophy, retinitis pigmentosa and butterfly m r dystphy. All ofthese revealed an unusual mitochondrial (mt)tRNA mutation. There individuals were found to carry the same mutaton. A 16-yer old family member was a G to A transition at mtDNA position 15,990 which demonstrated mild symptoms and subte pigmentepithelial changes on fu in changed the anticodon normally found in proline tRNAs (UGG) angiopraphy that suggested an affected status, and she was found to have the to the one found in sarine tRNAs (UGA). This is the first mution Fortysix members of the family were genotyped by SSCP. Six persons pathogenic anticodon alteration described in a higher (ages 20 to 2 yes) showed minimalor no evidence ofclinical disease but were eukaryote- The mutant mtDNA was heteroplasmic (85% mutant) found toc the mutation. The eariest visual symptoms were lightseitity and in muscle but was undetectable in white blood cells from difficulty with light adaptation he subjects' symptoms and devel t of the patient and her mother. Analysis of single muscle degenerative changes were similar to those seen in age-related maculardegn fibers Indicated that mutant mtDNAs severely Impaired The members ofthis family demstrated awiderange ofe ty ad mitochondrial protein synthesis and respiratory chain phenotypes fora single peripherin m *Suord in part by the PA activity, but only when present at greater that 90%. Lions Research Fdn and the Smith-Kettlewell Eye Researc Fdn (M.B.G.)

1178 Poster Symposium-Session 40 1179 Improved herpes simplex-based vectors. ((P. A. Johnson and T. Molecular studies of Prader-Willi and Angelnan syndrome Friedmann)). School of Medicine, University of California San Diego, La patients using nicrosatellites fron chromosone 15. Jolla, CA. M. Kalaitaidaki, Navrou A.,. Salavoura and C. Metaxotou. Genetic Unit, 1st Depastuent of Pediatrics Athens Universi- Replication-defective vectors derived from human herpes simplex virus-1 ty, Aghia Sophia Childrens Hospital, Athens Greece. are attractive candidates for the transfer of genetic Information, especially into post-mitotic cells such as neurons and hepatocytes. Herpes-based Molecular studies of Prader Willi Syndrome (PNH) and Angel- vectors have a broad host range can nan Syndrome (AS) patients have traditionally being and be prepared tovery high titer for carried out with DnA probes and RFLP analynin. We have efficient in vivo gene transfer. On the other hand, they suffer from several used short sequence repeat polymorphisms Tmicrosatellites) disadvantages, including shutdown of transgene expression and from chromosome 15 to study 10 patients suspected forPWS cytotoxicity resulting from expression of Immediate early (IE) genes of the and 4 patients referred for AS diagnosis. Nicrosatellites virus. To overcome these problems we have constructed a herpes simplex- can be typed rapidly by PCR and are much more polymorphic based vector containing a deletion in IE3 and an inactivating insertion than RFLPs.Three micronatellites were used from the mutation in the gene encoding the virlon component VP16 which viral IE commonly deleted region 15qll-ql3 at loci D15S11, D15810, gene expression. Similarly, we have combined the IE3 deletion with a GABRB3 and two outside this region at loci TEBSi (15q15) mutation in the virion host shutoff (vhs) component. In quantitative in vitro and D15S87 (near the telosere). Absence of parental cytotoxiclty assays, the double IE3-VPI6 mutant Is approximately 5-10 fold alleles (from one parent) within the 15q11-13 region could less cytotoxic than the single IE3 deletion mutant in human primary indicate either deletion or uniparental disomy (UPD) fibroblasts. The cytotoxicity of the IE3-vhs double mutant Is similarto that of while the pattern of inheritance of alleles at loci outside the IE3 mutant alone. this region could distinguish deletion from disony. We Paternity was tested with microsatellites from chromosomes have used these mutants to prepare vectors expressing firefly I, 5, and 10. So far we have detected absence of paternal luciferase or the E. coli lacZ reporter genes under the control of several alleles in 3 PVS patients (1 disomy, 1 deletion, 1 unde- promoters including forms of the promoter driving the latency-associated termined) In 4 other cases UPD was excluded. In theAS transcripts (LAT) as well as heterologous viral promoters. We have found patients we detected absence of maternal alleles in one that the double IE3-VP16 mutant expresses the lac reporter gene stably patient and we have excluded UPD in the remaining 3 for greater than 7 days In the neuron-Ike neurosecretory cell line GT-1 and patients. Investigation of our patients is continued with diterentated rat pheochromocytoma PC12 cells. We are further additional micrbaatellites from chromosome 15. characterizing the extent and duration of gene expression from these vectors both in vitro and in vivo. Molecular Applications in Clinical Genetics (continued) 1180 1181 Informative, flanking CA-repeat polymorphisms for linkage analysis of AAV-CFTR vectors integrate at multiple chromosomal sites In a CF families with autosomal spinal muscuar atrophy ((JA Kantl, M. l3ueno2, F.J. bronchial epitheilal cell line. ((W. G. Kearns, S. Aflone, G. Cutting, B. Ramos.)) 1Universlty of Pennsylvania Medical Center, Philadelphia, PA. Carter, P. L Pearson, T. Flotte.)) The Johns Hopkins University 2HoSpial Cllnico Un , Zagoza, Spain, 3The Children's Hospital of School of Medicine, Baltimore, MD. Philadeiphia, PA. Adeno-a ted virus type 2 (MV) is a non-pathogenic human The autosoma recess childhood spinal muscular atrophies (SMA) are isolate that integrates Into eukaryot genomes at high efficiency, often characterized by degeneration of spinal cord anterior horn cells, leading to within a defined region of chromosome 19q13.3-qter (the MVS1 progresve symmetrical paralysis of the limbs and trunk with muscular sequence). MV-CFTR transducing vectors have been deveioped for arophy. Clinical heterogeneity of the different types (1, 11 and 111) has iong CF but it is not known whether been recognized. In 1990, the SMA gene was mapped to chromosome Sq gene therapy, site-specificity of and since then, an Increasing number of flanking markers have been used to integration win be preserved in recombinant MV vectors which lack atudy affected families. Her we report linkage analysis in 12 SMA families the MV ma gene, which encodes proteins that specifically bind to the (10 SMA-1 and 2 SMA-Il) using several flanking dinude repea markers. MV-ITR sequence. We examined MV-CFTR vector integration In a The microsatellites used were: a) proximal: p599/abdas99 (D5S76), EFS- CF bronchisi epithelial cell lne using fluorescent 1naW hybridization 15 (D5S125), JK348 (D5S435); b) distal: JK53 (D5S112), YN (D5S127) and (FISH) with MV-CFTR probes and a restrictIon deavage-re- 6741CAJGT (D5S39). Recombination distances from the SMA icus range circularization-PCR technique for cloning flanking sequences from <1% (JK348) to 5% (p599/ambda59). Informative flanking markers Examination of FISH preparations of interphasmnuei revealed a were present in both parents In all families studied. In the SMA-I families heterogenous pattem in which 60.1% of 259 nuclei scored had 3 or 4 analyzed, no evidence of recombination was found, consistent with linkage integration sites, while 30.1% had 1 or 2 sites, and 9.7% had 5 or to a mutant locus on chromosome 5q. This aliowed 298% confidence for more. M aph preparations showed these signals on a variety of carer/prenatal counseling, assuming no genetic heterogeneity. In both different chromosomes. Ukewise, one short stetch of sequence SMA-i1 families there was a recombination in each proband (maternal flanking the 5 end of integrated MV-CFTR did not correspond to the chromosome) between JK348 and JK53, the two ciosest flanking markers to MVS1 site. These that in the the putative SMA Iocus, resulting in inconclusive risk estimations. findings indicate absence of Rep, MV- Recombination events in each SMA-i fahmily raise the possibility of genetic CFTR vector integration may not be site-specific. hetereogenelty; Insicient family members were availabie to address this Isue adequately. We find dinuclotide repeat markers are the current method of choice for linkage analysis of SMA-1 families until intragenic markers are availabie.

1182 1183 Moiscular analysis of deleted and non-deleted hereditary neuropathy with The rates and patterns of deletions in the factor IX gone: a gone in which liability to pressure palsy (HNPP) families. ((M.L Kennerson D.A. Ross deletions ae uncommon. ((R. P. Ketterling, E. L Vislhaber, T. J. Und, E. C. and G.A. Nicholson.)) Molecular Genetics Laboratory, University of Thorland, and S. S. Sommer.)) Mayo Clinic/Foundation, Rochester, MN. Sydney, Concord Hopital, NSW, Australia. Deletions are commonly observed in some genes with either segments of Hereditary neuropathy with liability to pressure palsy (HNPP) also known highly homologous sequences or excessive gene length. However, in the 34 as tomaculous neuropathy is characterised by dominantly inherited kb factor IX gene and in most genes, deletions (> 20 bp) are uncommon. liability to pressure palsy and sausage-like (tomaculi) swellings of We have sequenced 290 families with hemophilia B (204 independent Schwann celis in peripheral nerve. HNPP has been reported to be deleted mutations), and find 12 deletions larger than 20 bp. Eleven of them are in the Charoot-Marie-Tooth type 1A (CMTIA) duplication region (1). We larger than 2 kb (range 3-1631 kb), and one is 1. 1 kb The junctions of the report a family that is deleted for VAW409R3 (D17S122) and EW401 four deletions which are completely contained within the factor IX gone have (D17S61). Both of these ci lie within the binary repeat that bounds the been determined. A novel type of mutation occurred in patient HB1 28: the CMT1A duplication (2). Pulse field gel electrophoresis analysis of this data suggest that a 26.8 kb deletion occurred between two segments of family shows a novel 180kb Mlu I fragment In affected individuais when alternating purines and pyrimidines and a 2.3 kb sense strand sement hybridised with a probe 73B9-D (3) which is iocated outslde the proximal derived from the deleted region was inserted. For our sample of 204 end of the HNPP deletion. An additional HNPP family proven on biopsy independent mutations, we estimate the abmline rates of dohtional does not show a deletion for VAW409R3 (D17S122). The extent of the mutations per basepair per generation as a function of the size of the non-deleted region in this family will need to be determined by testing deletion. The rate for large deletions (2 kb) is exceedingly low. Theoodds other markers that lie within and flank the dei-tion region. The findings in of a given base being at the junction of large deletions are 58-fold and 985- these families suggest that there is heterogeneity in the molecular basis of fold lower, respectively, than the odds of a microdeletion (<20 bp) or a base defect(s) causing HNPP. substitution. Analysis of the nine reported deletion junctions in the factor IX gene literature reveals that: (i) five ae associated with inversions, orphan References 1. Chance et al (1993) Cell 72:143-151 2. Pentao et al sequences, or sense strand insertions; (ii) the four simple deletions display (1992) Nature Genet 2:292-300 3. Ros et al Abstract submitted for ASHG an excess of short direct repeats at their junctions; (iii) there is no dramatic conference 1993. clustering of deletion junctions within the gene; and (iv) with the exception of alternating purines and pyrimidines, deletion junctions are not preferentiafly associated with repetitive DNA.

1184 1185 Development of a gene therapy for Marf an syndrome: Use of qutative PCR hi DMD/BMD carrir dg Svia ribozyme mediated down-regulation of the FBN1 gene KSchling. Ber ocza nd JO Ho ntt for product. ((MW Kilpatrick', RG Del Mastro', G Carmichael' Humengne der Universi , Germ and P Tsipourasu.)) Departments of Pediatrics' and llicrobiology UConn Health Center, Farmington CT. sevral technical e sice te comI do DT"the licallon of the gene produc Marfan sdre (Mr8) is a systemic heritable disorder I , carrierdton b Sim a MhiroutIn DNA- of the connective tissue. The identification of mutations dianss D~rct carrier digoi h iSI~ mb Fp in the fibrillin gene located on chromosome 15 (FBI1) in deletons or duplicato ha bnt nbye individuals with UPS makes it possible to unravel the an~l(q~ie Sohen anlss and or ldnilcto of detailed molecular pathology of this disorder and to hvnft by p d utilise this knowledge in the development of a rational the kft-uNOhbm many Case, re-m to be therapy. As the first step in the development of an d~~~~~~Geals swi it of cnrd risks In antisense based therapy we constructed an antisense RNA hdnsdepend on Wage studes usi RFLPs and molecule for the 5'-end of the F7N1 mRNA. The molecule, 'Wa stdies mai basd an Fill-RZ1, has been designed as a potential F7N3 specific microstelte_.Beasanalysis, ae moN rsd, een h w known ribozyme and comprises 25 bases of 7331 sequence gen FVllCreeraontlarer stas often is inetgated byti containing a centrally located GUC cleavage site, along rhsd U Wpnormal high with the sequence necessary for the formation of an recobinlon requNce fthoughnou tiW dywohiee; thus hamerhead structure. The FB31 mR3& has been treated with carIer detectionb directehd is mesb the F1N1-Rhl ribozyme in vitro, and cultured dermal To avoid most f t blem we deelped a _ntitwi PCR- fibroblasts and smooth mecle cells have been transfected systeml for thos 18dstrpl gene weons involved IN* with a plasmid construct (pRSV-FB11-RZl) containing the 98%of ON cDNA dtcal delietion. Senitiv and accurate Y331-RZ 1 sequence downstream of the Rous Sarcoma Virus qutflatis of u PCR roducs d at low promoter and upstream of a cis-acting ribozyme sequence. copy numbers ae by use of an automai non- These experiments have shown thatt 1) B331-RhI can radioactive fluoresc system (A.LF.). This syem efficiently cleave its target in vitro and 2) fibroblasts prd to offer a nd eficient stratey fr dict carrier and smooth muscle cells transfected with pRSV-73I-RZ1 di s whn MBMD all by drh produce the 73I3-311 ribozyme. Our data suggest that this reero The h is estl usel h approach might be effective in the somatic gene therapy where urveoohnuncesbslm of disorders due to a gene product exerting a dominant- are not bb. negative effect. Molecular Applications in Clinical Genetics (continued) 1186 1187 Evaluation of normal and mutant allele transcript levels of the myotonic Molecular study of 6 patients with Crigler-Najgar type I disease.(( Ph dystrophy protein khase gen in affected tissues of myotonic dystrophy Labrune, A Myara-, M Hadchouel-, F Ronchi...., 0 Bemard-, F patients. ((R. Krahel, T. Ashlzawa2. J. Dubel, J. Gilbert3, H. Taylors A. Trivin", A Munnich--, and M Odibvre-)) 1H-pital Antoine BMclIre, Roses3, and M.J. Sicilianol.)) 'Univ. Texs M.D. Anderson Cancer Center; Clamnart, *Hpital Saint Joseph, -H6pital de Blctre and --HpIta des 213aylor College of Med., Houston, TX; 3Duke Univ. Med. Ctr, Durham, NC. Enfants Malades, Paris, France, and O-spedaie C0ib, Catolka, Ity. Crigler-Najjar type I diase (CN) is a rare, autosomal recessive inborn Myotonic dystrophy (DM) l an autosomal dominant, progressive neuro- error of bilirubin metabolism due to a severe deficiency of hepatic bilirubin UDP-glucuronosyltransferase (B-UGT) activity. The cDNA and the gene muscular disorder. The severity of the clinical pheope acted1 with a have been recently cloned, and only 4 different mutations have been newly described type of mutation -an unstable trinucleotde repeat - recently reported so far. We report on 6 unrelated patients In whom 3 new mutations Identified in at least three other human inheried diseases. In DM the repeat were identified. SM patients were born to first-cousins parents. Two girls Is located in the 3 unand region of the myotonic dystrophy protein were of portuguese origin, two other girls came from Tunisia and the two knase (DMPI) gene. The molecular basls of the disease Is unknown. boys came from Italy and from Turkey. All of them presented with severe Increased stability of the transcribed message has been suggested (Sabourin and persistent neonatal unconjugated hyperbilirubinemia, and all had B- et al., Am J Hum Genet 51:A329). It has also been reported that repeat UGT hepatic deficiency (method of Black and Billing). Genomic DNA was expansion results in a doera in messenger RNA and protein DMPK levels extracted fom peripheral leukocytes, and axons 1 to 5 of the B-UGT gene (Fu et al., Science 260:235). In the latter study, immortalized lymphoblastoid were PCR amplified and directly sequenced, using an automatic DNA cell lines, rather than tissues normally affected by the disease, were evaluat- sequencer. The two Portuguese girls were homozygous for a G--->A ed for allele specific message levels by reverse transcription - PCR (RT-PCR). transition in exon 2 (changing glycine into ghttamic acid). The two Tunisian Furthermore, the RT-PCR was conducted across the expanded p(CTG)n girls were homozygous for a A--->G transition in exon 3 (changing repeat which, due to the high GC-content, is refractory to both the RT and PCR glutamine into arginine). Finally, the two boys were homozygous for a T- >G transition in exon 4(changing seine into arginine). The parents of each steps. Here we present an RT-PCR approach that Is based on the presence patient were found to be heterozygous for the corresponding mutation. of informative intronic polymorphisms in the DMPKsequence, which allows Three new mutations have been found, illustrating the genetic for quantitation of steady-state levels of primary transcripts from alleles on heterogeneity of CNI. However, it is worth noting that the same mutation both normal and DM chromosomes. This procedure was tested on total RNA was found in patients originating from the same areas of the Mediterranean from a variety of tissues and shown to detect such products. Expression of the region. locus in muscle of congenital and adult-onset patients was detected. Results on allele specific expression in tissues from a series of normal, congenital and adult-onset DM patients will be reported. (Supported in part by MDA)

1188 1189 Carrier female. for X-linked dyskeratosis congenita show nonrandom X Sex determitn of single human amniocytes by tr inactivation. ((5.LangloLs', A Junkerc, S.L. Yong', I. YTam, J. polymorph~sm of polmese can t amplld Livingston', R. SLminovitch. ))'Dept. of Medical Genetics, 0pt of (PCR) ZFrX/ZFY lod. Pediatrics, Univ. of British Columbia, Vancouver, Canada, pt of ((S.E. lanndorf, 0. Heldn , C. DeScieclolo, R.N. Salnickt SA Gfn Medicine, UnLv. of Toronto, Ontario, Canada. G.D. Hodgen, W.E. Gbbons.)) The Jones Institute for Reprod v Medine, dof Dyskeratosi congenlta (DC)is a condition characterized by cutaneous Derm OB/GYN, Eastern Virgini Medical Schoo, Norfdk,Virgi pigmentation, nail dystrophy, oral leucoplakLa and pancytopenia. DC is genetically heterogeneous with both X-linked, autosomal recessive and For sex deternation, two pdrm sets ae typica dene to ampll autosomal dominant fo r ported. in neither form has a reliable carrier test been described. We have studied an extensive four repetitie sequenc on the X and Ydchrom osome An alteative metod of generation family with two affected males (firat cousins once removed) diagnoss is the use of a restction fragment length polymopmof genes compatible with an X linked mode of inheritance. Both males presented on both the with nail dystrophy, oral leucoplakia and bone marrow failure with death lcatsd X aid Y dcrosom. U*s the ZFX-ZFYlobd - at S years and 9 years of age. All three obligate carrier females were Gadick A et al, Cel 57:1247, 199), we describe here terdeterminatio of se studied for nonrandom X inactivation using a PCR based assay which in single hum tes. The PCR mplWd sequence was furr detects patterns of ethylation S' of the polymorphic CMO repeat in the humn androgen receptor gene. All three females showed nonrandom X subjected torestictonendonuci digstion wih Af I1 which ecognizesthe inactivation with the maternally inherited X being preferentially s Cue CTTAA, present only on empWd ZFY. Analysis was peromed on inactive. X inactivation studies of four at risk female relatives singeam ctsisoblaed frm cuiures end the resu were revealed nonrandom X inactivation in two. compwWd to A second family with two affected brothers was studied. The mother karyotypefindings. The protocol nvwved hper I PCR fbr 40 cydes wihean was uninformative for the PCR assay but was shown by hybrid analysis to iWa de ratona 94 tfr3 min followed by denaurat at94Cfor I mh, have nonrandom X inactivation. The sister who presented at birth with I sr 5 cell deficiency and thrombocytopenia which reeolved by 2 months of age Iho at 55Cfor min i at 72C for I min percycle. This developed eymptomatic agmmaglobulinemia by 1 year of age and was shown PCR resulted In a 434 banpair (bp) amprllfld product For deterination d by the PCI assay to have nonrandom X inactivation. x, 10 mniters of amplilfsd product wee cbaefd wih 10 unsat AN 11 fbr We conclude that t 1. nonrandom X inactivation studies can be used as a carrier toot for X-linked DC presenting with pancytopenlaj 2. the 2 hr at 37.In te presence of the enrzm, the ampled Y-sequence wee cut nonrandom X inactivation pattern seen in lymphocytes is indicative of it twofragments of 203 md156 bpeach. Theanped X4squsnce maied an in vivo selection againet the cells having the mutant gene on their uncut werecdolted from 25 culr wlh actve X chromosomel 3. the clinical expressLon of this disease in a Single amioyte mpcton of female found to be a carrier suggests that some autosomal recessive the target occurring in 91.4% (32/35) of fte clls. Diagnosis d se by families reported could in fact represent X-linked DCt 4. X- this meth was corre in al instances (100%). This study demri ats tha inactivation studies could be useful to differentiate between X-lnked and autoeomal recessive inheritance. Linkage analysis is being carried analysis o se can be reliably performed in single call using M 11 out in family 1 to refine the previously reported linkage to Xq28 polymorphim odPCR ampllfed ZFX/ZFVY . This p c provides a rapid markers. methd for sex determinaton in iot fluids and fbr use in erbryo biopsy.

1190 1191 A new axon 9 mutation In Gaucher dles dettd by denaturing gradlent Rapid Genotyping by Heterodupiex Detection Following Agerose gel e rhorei ((K H. Laubeher', Ft H. Gw3, FL E Le', and FL T. Electrophoresis for a Common Mutation (Codon 41/42 -TTCT) Oldnk'.)) 'Los Alamos National Labortory, LOS Alao, NM, Unverslty of Causing BetaThaisasasmbiin Singapore. ((HY Law, JBK Ong, ISL Ng NM, Albuqu NM, Unverty o FPiburgh, Pittsburgh, PA. (Intro. by: S. and CLTan.))DepartmentofPadlatrics, Singapore General Hospital, A. Amuno ) Singapore. Gaucher dee isan autosomal rossive diorder usay causd by point mutations In the lysosomal Pg e L e gne. The four base pair deletion in codon 41/42 (-TTCT) in beta globin g orebrosides lresponsible r the brakdown o gto gene Is the most common mutation found In Chinese. It accounts for glucose aN crmlds. Although several common and a variety of re about 50% of thasa alleles In the Chinese which make up mutations have been detected In the gene of Gaucher 70% of the popultionin Singapore. A simple and quick method has patients, many of thin patients st habor unknown gen atratong. been established to detect this mutation. This method involves Denaturing graent gel electophoresi (DGGE) w used to analyze axons 5 amplification of a 170bp fragment that p the mutation, through 10 In a severely affected patient whoe mutant genotype had not using an upstream primer specific to beta globin been fuy d DGGE analysis confirmed the presence of a common (5'CTCTCTCTGCCTATTGGTCT3') anda downstream primer with a 1448 axon 10 mutatIon In one alli and alo rev d a ra ad new betaglobin specific 3' end (5'GCCATCACTAAAGGCACCG3'). The muton in xon 9. Sangrddeoxy-equencng Indcated that the mutation in PCR product is then denatured in the presence of a homozygous axon 9 weS a G to A dcn at cDNA aepalir pc n 1237. This alteration normal or homozygu mutant PCR product to allow heteroduplex caused an unino add coding chan from to S . The results formation. Electrophoresis of the above in 2% MetaPhor agerose indird tha the 1237/1448 genotp, unlike the 1226/1448 genotype, can gives distinct separation of the 170bp normal and 166bp mutant result In the seve neurologic farm of Gaucher diseas. The DGGE fragments. The whole procedure, starting from preparation of the analysis of Intron 5 aleo inrdicate a homozygous 3297 (genomkcDNA DNA fromclinical samples, can be carried out well within a working basepisr position) minus pol s. The data dmnstate the utility of day. The results obtained using this method was confirmed by the DGGE tehnology In detcting new mutations In Gauhrpatients. The standard allele-specific ollgonuclsotide hybridisation. This cost Inticiation of rare alteraions such as the 1237 mutation In type 2 Gaucher effective method is thus potentially useful for quick screening and patients may evntually provide important dues twads undeandin the antenatal diegnosls, especially when a couple are both carriers of the neurologica basis of this disease. This research we funded by Los Alamos above mutation. National Labo LDRD funds. Molecular Applications in Clinical Genetics (continued) 1192 1193 Use of five mlcrosatellite markers ip nourofibromatosls type 1; Detection of deletion within 17p1 1.2 region in 13 french families affected by deetions and inrect c aniys(C. Lizaro, A. Gaona, A. Ravella, Hereditary Neuropathy with liability to Pressure Paisies (HNPP).((E. LEGUERN*, V. Volpini & X. Estivili3.R.O. Molecuiar Genetics Dept., Hospital Duran i F. STURTZ**, M. GUGENHEIM*, R. GOUIDER*, C. BONNEBOUCHE", N. Reynals, Barcelona, Spain. RAVISE*, P-M. GONNAUD**, S. TARDIEU*, P. BOUCHE*, G. CHAZOT", Y. AGID*, A. VANDENBERGHE**, and A. BRICE*)) * H6pitW de la Siptrlre, Neurofibromatotyp I (NF1) or von Recklinghausen disease is one of the Paris, France and" H6pltal de l'Antiquallie, Lyon, France. most common autosomal dominant disorders in man, characterised by peripheral neurofibromas, cafe-au-lait spots and Usch nodules of the iris. Thirteen families with hereditary peripheral neuropathywith liabWtto preasure Due to the high mutation rate at the NFl locus, most patients are expected palsies (HNPP) have been analyzed with 17p1 1.2 markers, correspond tothe to have different mutations, limiting molecular analysis and genetic duplicated region in Charcot-Marie-Tooth la (CMT1a) patents. The 28 patients counselling to the identification of the mutation in each patient or family. To present a unique allele for the polymorphic markers RMI 1GT and VAW408R3a. date very few of these mutations have been identified and in most cases In seven families, allele segregation for either RM1 1GT and VAW4O9R3S reveals genetic analysis has to rely on the use of linked polymorphic markers. We the absence of contribution from the affected parent to the affected child, have analysed 5 microsatellite markers within the NF1 gene: IVS27AAAT2.1 suggesting that the disease is associated with a deietion within the 17p1 1.2 (G. Xu), IVS27AC33.1 (R. Weiss) and IVS27TG24.8, IVS27AC28.4 and region. In order to estimate the extend of the deletion, gene dosage experi. IVS38GT53.0 (this study). Heterozygosities of these markers range from ments have been performed with VAW409R3a (D17S122) and EW401 (D17S61) 0.46 to 0.82, the most informative being IVS38GT53.0. We have analysed markers which are loated dose to both extremities of the duplicated region In 70 NF1 families with these intragenic microsatellites and have found 4 cases CMT1a. Hemizygocity was found for these markers in al patients sggs of hemizygositles detecting 2 deietions of more than 50 kb, one of 12 kb and that the HNPP deletion corresponds to the 1.5 Mb CMT1a monomer unit and another not completely characterised. Microsatellites are useful tools for that both genetic abnormalities could arise from a same unequal recombinatlon. indirect genetic analysis of NF1, with 80% of families being informative. The We have also shown by gene dosage experiment that PMP22, which is high informativity of these microsatellites has also allowed us to detect responsible for CMT1a phenotype by gene dosage effect or point mutation, is hemizygosity in four NF1 families highlighting interstitial deletions, which also deleted in HNPP patients. It is, therefore, reasonable to speculate ta represent about 5% of the NF1 chromosomes tested here. The region PMP22 is responsible for HNPP by an opposite gene dosage ef. This would studied accounts for only 50 kb of the NF1 gene, the development of similar be the first example of two dominantly inherited diseases caused by a Oln miror polymorphic intragenic markers in other regions of the gene will help in the deletion / duplication mechanism where a gene dosage effect would be Identification of other NF1 deletions and will facilitate indirect diagnosis in sufficient to produce two different phenotypes characerized by an abnormal families negative for mutation analysis. myelination of the peripheral nerves. This study underlines the infmatvty of the RM1 1GT microsatellite as a tool for molecular diagnosis of HNPP.

1194 Poster Symposium-Session 40 1195 IN Nits ybrztion with different color control probe determines Submicroscopic deletions at 22qI 1.2. Variability of the clinical picture and geun anepedy reliably. L-Y Li,1 Y SuO X SuI L Martelli,1 0. Hurko,2 delimiwion of the commonly deleted region. ((EA. Lndsayl.2, F. Greenbergl, S. LShIiro1J Chel, RV. Lebo.l (1) Univerity ofCalifornia, San Fancsico Pagel, L G. Shafferl, PJ. Scambler3, A. Baldinil.2.)) 1-Institute for Molecular and (4 Johns Hopns Medical Ceter, Baltimoe, MD. Genets, 2-Human GCnome CenterBaylor College ofMedicine, Hoon, 1X,USA. Univeuiy 3-Insdtutc of Child Health, London, UIL Several known gen anuploiiresult in huma n disease. X-inked ichthyosis results from steroid Submicrosoic deletions at 22ql are associated with DiGeorge syndrome sulfatae deficiency (STS); 90% of affected (DGS), Veoc facial syndrome (VCFS) and, to recent reports, with p ts have a complete deletion of the entire 146kb SIS gne on the distal X some according chromoome shot m (Xp22.3). Autosomadominant CMTA on chromosome isolated and filial heart defects. The gene(s) responsible forthese conditions 17pll.2 results in most caes fom three copies of the CMT1A gene region. In have not yet been identified the milies p diasi and carrier ng can be completed quickly by Using fluorescence in situ hybridization (FISH) on maphase and interphase hybi 2 d cosmid probes labeled with ucen or Texas red and chromosomes, we have ordered cosmd and YAC clone win the DGS critical conterstaning int ae region (lindsayet al., Genomics, in press). Usg these Probes we have strted FISH nucear DNA with DANL An STS gene probe labeled screning supected and confirmed DOS and VCFS patients recruited locally at the with Texas red hybrii edfically to the steroid sulfatase gene on the X Baylor College of Medicne clinics. To date, we have identified 9 patients canying a chromosome. second flanking probe beled with fluorescein hybridizes to deleion that includes the critical Although the clinical features of the both the normal Ychronosomeand noal and SS deleted X chromosomes hi region. patients this fashion the interphase nuclei of affected males is disi d from ar variable, the deletions detected are undistinguishable using our probe set. We geneclly normal indids Direct analysis ofinterphase nucl from f estimated that the size ofthe commonly deleted region is at least2 Mbp and includes, and at-risk CMTIA patients by multicolor in situ hybridization to a commonly butisLargrthan, the critical re The molecula definition ofthe extremities ofthe duplicated CMT1A probe is informative more often than polymorphic PCR deleted region is currently insufficient o reveal small differences in the extent of the analysis, faster than pulsed field eVectpgel (PFGE), and faster, more deletions or whether deletion brakponUts occur preferentially in specific regos. ilformaivc, and more reliable than r ion enzyme analysis. This procedure Work todefine the endsofthe region iscurently in poess in ourlabo y. ca e used with lymphocyte, direct and cultued chorionic villus cells, direct An apparently balanced trocao (Augusseau et al., Hum.Ge 74:206, and culturedam Tes gv a 1986) in a patient with DOS phenotype with mildpathyrid and thymic disfunction anocd fibroblas methods phigherwpent of has been described suggesting that at ast partof the DOS phentpe wooled Vnckixflectcopythgtnumberthansinglecolorinsini hybrdii is caused by a Simirmethods will ic sinle gene. Therefoe atpresent, it cannot beruledout that the vale expsion of buseful forrapid dia assessment ofother loid a single gene might be resp sible for the various clinical features of 22q11.2 gn disorders. he 5%m0y.

1196 1197 Poster Symposium-Session 40 Use of a mismatch binding protein, MutS, for mutation detection Improvements in dideoxy fingerprinting and its implication for the sensitivity within the cystic fibrosis gene b a band-shift assay. (( A. I. of SSCP. ((Q. Uu', A. Bailey2, R. Molinari2, and S. S. Sommer'.)) 'Mayo Lishanskaya, and J. D. Rine )). Human Genome Center, Clinic/Foundation, Rochester, MN; 2AT Biochem, Malvern, PA. Lawrence Berkeley Laboratory, Berkeley, CA. (Intro.by: Edward Rubin) Dideoxy fingerprinting (ddF) is a hybrid between SSCP and dideoxy sequencing. In ddF, one lane of a dideoxy Sanger sequencing reaction is An experimental strategy for detecting heterozygosity in electrophoresed on a nondenaturing gel. If, for example, dideoxy T is used genomic DNA has been developed. It is based on a preferential in the Sanger reaction, a mutant sequence that generates T will produce an binding of MutS, an E.coHi mismatch binding protein, to extra band while a mutant sequence that changes a T to another base will heteroduplex as compared to homoduplex DNA molecules. The lose one band. Thus about 50% of mutations will result in the gain or loss binding isdetected by a gel mobility-shift assay. This approach of a band at the site of the mutation. Subsequent to the site of the has been tested using the most commonly occuring mutations mutation, the mutant sequence can be identified by SSCP. If a mutant within the cystic fibrosis gene (CFTR) as a model. Genomic DNA occurs in a segment that migrates near the bottom of the gel, 50 nested samples were amplifiel using the 5-end labeled primers that SSCP segments can contain the mutation. If only one of these segments bracket the site of the AF508 3 bp deletion In exon 10of CFTR has an altered mobility, the mutation will be detected. Previously 84 of 84 g~enetogenerate PCR products 100,200, 340 and 491 bp long single-base mutations were detected with ddF using a 5.8 polyacrylamide gel bsequenty denaturedand reannealed. MutS protein with 10% glycerol. We have now examined the effect of temperature, gel binds more strongly to heteroduplexes that correspond to matrix, and glycerol on mutation detection. In routine screening for heterozygous carriers of 4F508 and contain a CTT or a GAA mutations, MDE, or the related matrix, Gene Amp, offer a good balance of loopIn one of the strands than to homoduplexes corresponding convenience, reproducibility, and virtually 100% sensitivity for the detection to homozygotes. This ability of MutS to differentiate between of mutations. We have used ddF gels to quantitate the fraction of SSCP heteroduplex and homoduplex DNA molecules depends on their bands with altered mobility. Four randomly selected primers were chosen. size, being greater for shorter PCR products, and also on the Well over 2000 SSCP bands were examined. The percentage of positive fidelity of a thermostable DNA polymerase used for PCR. The SSCP segments with a 25% MDE gel, 40C without glycerol was 77%, method was also able to detect carriers of the G542X mutation compared with 37% for polyacrylamide gels at room temperature. in exon 11 of CFTR gene by a preferential binding of MutS to Statistically, a 25% MDE gel at low temperature provided the greatest G/A + T/C single-basemismatcheson a 141 bp PCRproduct sensitivity for detection of mutations by SSCP. Molecular Applications in Clinical Genetics (continued) 1198 1199 A very frequent fameshift mutation of the cystic fibmois gene in the Identification of an identical non-lethal al(I) mutation in two unrelated families with wide variability of osteogenesis Swis population. ((N. J. Maik', M.A. Mor2, F. Thonney3, and E.M. imperfecta phenotype.(( J.C. Marini, Q Wang, and M.B. Bohier')). Divisions of Medical Genetics, Basel Children's Hospital', Geneva Levis.)) Human Genetics Branch, NICHD, NIH, Bethesda, Nd. USA Universy Medical Centre and Cantonal Hospital, Lausanne University and We have identified the sane heterozygous non-lethal G - A change, causing a type I collagen al(I) gly 352 - serine Cantonal HospitaSwIterland. substitution, in four individuals with wide variability of 01 phenotype. This is the first report of occurrence of the sae We have analysed the CFTR gene of 201 Swiss cystic fibrosis non-lethal OI mutation in unrelated patients. patients by Three of the affected individuals are in one family. The direct sequencing. Twenty-five of these patients were heterozygous for a novel affected father has classic OI III phenotype. He is 47 yrs old mutation, 3905iNsT, which is chateried by the insertion ofasnae thymidine with a height of 112 cm (50% for 5 yrs). He has blue sclerae, a large cranium, barrel chest, severe scoliosis, mild (T) residue in exon 20. This frameshift mutation generates a premature conductive hearing loss and basilar compression. Upper and translation termination signal 6 codons 3' of the mutation. 3905#NsT is present lower long bones have been rodded. He can transfer with on 6.2% of Swiss CF chromosomes, and so represents the most important crutches and utilizes an electric wheelchair for mobility. Both the sons of this man are affected with OI. The phenotype mutation after 8F508. Patients with the genotype 3905iNsT/8FS08 have of the sons is type IV OI. One son is age 12 yrs, with the moderately-severe disease, with pancreati insufficiency. Haplotypes were height of a 6.5 yr old. He had 4 post natal femur fractures determined for 23 of the 25 chromosomes with 39051NsT, for the loci D7S23 and attained ambulation at 3 yrs of age. The younger son is 9 yrs old, with the height of a 6 yr old. He attained (XV2c and KM19), D7S399 (Mp6d.9), and D7S8 03.11). Twenty-one ambulation at 18 months of age and has had 10 post-natal femur chromosomes shared the haplotype 2-1-1-1, and the remaining two had the fractures. The unaffected mother is of normal stature. 2-1-1-2. To date we have detected in The fourth patient with the gly 352 - ser substitution has haplotype 3905i1sT exclusively individuals a de noVO mutation in an unrelated family (JBC 26: 2667). Her of Swiss ethnic origin. The association with a distinct haplotype suggests either a OI severity is intermediate between the father and sons in the recent evolutionary origin for the mutation, or a founder effect. In the latter first family. She is 8.5 yrs old, with the height of a 2.5 yr old. She attained limited ambulation at age 3 yrs. She had 5 case, it would be expected that the mutation wil be detected in other ethnic post-natal femur fractures and 2 femur rodding procedures. gru- We are currently comparing the expression of the mutation in the four affected individuals, as well as the type I collagen sequences in all alleles in both families.

1200 1201 Four different mutations in the paired box region of human PAX6 gene. ((Aruna Mutation of Typo X Collagen (COLIOAI) Resulting in Schmid Martha*, Robert E. Ferrell', Helen Mintz-Hittner+, and Grady F. Saunders.*)) Metaphyseal Chondrodysplasia. (( I. McIntosh, T. W. Hefferon, M.L. whe University of Texas M.D. Anderson Cancer Center, Hoston, Texas, Warman. B.R. Olsen & C.A. Franoomano)). Johns Hopkins University 'University of Pittsburgh, Pennsylvania and +Baylor College of Medicine, Houston, School of Medicine, Baltimore MD & Harvard Medical School, Boston Texas. MA. Aniridia, an autoomal, semidomit developmental disorder of the eye, results Schmid metaphyseal chondrodysplasia (MIM 156500) Is an autosomal from mutations in the PAX6 (AN) gene located on chromosome llp13. PAX6 dominant disorder of the osseous skeleton resulting in short stature, encodes a protein containing both paired box and homeobox motifs. The PAX6 gene coxa vara and a waddling gait. Type X collagen is an extra cellular matrix is 22kb long and contains 13 exons and 12 introns. To examine the distribution of protein expressed exclusively by the hypertrophic chondrocytes. This mutations in the PAX6 gene in aniidia patients, nine exons viz., 3, 4, 5, 6, 7, 8, restricted pattern of expression in conjunction with experiments in 9, 10, 11 were amplified with exonic ptimers and the nature of the mutations transgenic mice suggest a role in endochondral ossification. Recent work examined. Thirty-three unrelated individuals were analyzed for polymorphic identified a 13bp deletion in COLlOA1 which segregates with the disease variation in the GT dinucleotide repeats contained in intron 8 a region flanked by in a large Mormon pedigree (Z = 18.9. e = 0; MLW et at, in press). We exons encoding the homeobox domain of PAX6 gene. Our results indicate that the have applied SSCP analysis to lymphocyte DNA from a further five human aniridia gene is polymorphic for the number of GT repeats with 11 frequent families with Schmid metaphyseal chondrodysplasia. Amplification of the alleles and 54.5% heterozygosity. A GT repeat allele, of 36 repeats showed carboxy-terminal non-triple-helical domain demonstrated a conformation complete cos ion with the aniridia phenotype in a large four generation family change in the proband and her mother from a Mexican-Lebanes family. with 28 affected family members. Analyses of DNA mutations responsible for the DNA sequencing identified a T -> C base change at position 1771 aniridia phenotype in this family detected a mutation of 7 base pairs (TGCGGAC) resulting in the substitution of Arg for Cys at codon 591 (C591 R). This insertion in the paired domain contained in exon S of the PAX6 gene. Additional base change was not detected in other analyses of individuals for PAX6 family members or on 100 normal mutations in eight small families revealed four chromosomes. Since the carboxy-terminal region is highly conserved 0 different mutations in the paired box region and one in the homeobox region. The across species and important in trimer formation we believe that this four mutations found in the paired box region, are composed oftwo familial and two mutation is disease causing in the proband. This observation represents sporadic mutations. The one mutation found in the homeobox region is in a small the second known COLlOA1 mutation in a family with Schmid family and segregates with the aniridia phenotype in three generations. These metaphyseal chondrodysplasia. findings indicate that the human aniridia gene (PAX6) is polymorphic and mutations in both paired box and bomeobox domains can lead to familial and sporadic anindia.

1202 1203 Norrie disease: mutation analysis, proten stucture and expression Congenital bilateral absence of the vas deferens : exhaustive screening ((T. Meltinge, A. Mend, P. Boi, C. Sander# and Jan Murken'.)) for mutations in the 27 exons of the CFTR gone. ((lB. Meroier, 2W. Abt. P~diatrische Genetik, Knderpolldinik der Universitlt MOnchen, Germany Ussens, 1M.P. Audrczet, 2M. Bonduelie, 11. Quer6, 1C. Verlingue, 10. IEMBL Hedelbeg. Germany Ragu6nhs, 21. Uebaers, 1C. F6rec )2 1Centre de Blog6n4ftque, C.D.T.S., BP 454, 29275 Brest France, Department of Medical GenetIcs, Norris disease, an X-lnked disorder ch id by congenital blindness and University Hospital VUB, Laarbeeklaan 101, 1090 Brussels, Belgium. quey ac by de and me dis , is due to mutations in the Norrie gene. It encodes a protein of 133 amino acids (NDP) and its Absent or nrdimentary vasa deferentie is a general observation In males expression was shown to be limited to felal as well as adult brain and eye tissues. with cystic fibrosis as In males with congenital bilateral absence of the vas By focussing sequence comparIsons on the number and the spacing of cystine deferens (CBAVD). It has been recently reported that males with CBAVD present an increased frequency of the most common cystic fibrosis residues, hoNo ogies wre detected between the product of the Norrie gene and a mutation (AF508) suggesting that those patients may carry a mild carbox-terminal domain which Is common to a group of extracellular proteins mutation on another allele as for example the IR1I7H. To explore including mucins, vWF and a family of growth regulators. Secondary structure exhaustively the entire coding sequence of the CFTR gene, we have predictions and 3D model building now provides preliminary evidence that the undertaken a systematic screening in 20 patients with CBAVD. The three dknenslonal structure of NDP is sImilar to TFG-B1. This would add a new results of the analysis of the 27 exons of the CFTR gene will be mer to the exarig ftmily of growth factors containing a cystine lnot modt. presented. Up to date, we have analysed 80% of the coding sequence. Mutation analysis was performed In 12 families with Norrie syndrome. No We have identified 6 mutations accounting for 33% of the alleles tested. correlation could be observed between genotype and the timing and extent of deafness and menal retration in the familIes studied. RNA ues dicaed addia expression of the Noris gene in feta kidney and feotall" as wel as 1eggtimate tanEWrNtoon f the Norrie gene In peripheral blood cels which was used for mution analysis. A p exprsd and purld Norris proten was used for the generation of polyconal antbodes In rabbil, which are currentiy tested on Western blot nt Ongproadne hom d1rent tsue. Molecular Applications in Clinical Genetics (continued) 1204 1205 befinesm eshf)ca eaeuM m = ina " WA mlud" Molecular genetic analysis of Duchenne and Becker muscular (DIBMD) In the efdimvudA nSeUWM MiW,RD. NWuA Coi',TA A. dysrophy Spanish populadon.4M.Miranda, H.Kruyer, O, V.Volpini & Hospital Duran i Reynals, Barceona, Spain. MilJ. )_AAnwOJVDieUiv*uL e(MeisiseUiVarsilyHsqii )lEstivill)IRO, sed M've sHe DeBhuMA Over the est 2 years we have studied 48 spanish D/BMD famliles using PCR and Southern analysis. 41 of these families were DMD, 7 were BMD and 4 Webmen dwisshs0binewiAeq Wdbiid dseessufbVW had no living affected member. In 20 out of 44 we were able to detect the Adirse (c AVD) seseW sd i.Weryuthebm i remsd deletion responsible for the disease, representing 0.46 ±0.14 (aO.06). After ornum*IdICF =Wil i UAVDn Wbj~e comparing familial cases of DMD (ie. with at least 2 affected individuals) with isolated cases (not de we that Meaw&UAVD bykv auIureadyseuisreo necessarily nowc), found familial cases had a as"N"h much lower incidence of detectable deletions (27%) than isolated cases ie.HOWmrby.qbehftIefibd.sadadsl .suMrliL (54%) which concurs with previously published data. For BMD the situation Webuud14idkE&UAVDx esfr2 @eemsrfarsilM CFmdim Six is the reverse, although the sample size is very limited. 15 out of 20 deletions (43%)w mreh sfrehrW AFSOS R117HarI75Qre A (75%) occur in the distal region of the dystrophin gene, between exons 44 bi0 and I kid lfifl dIn e.(bssUAVD C hhrI IN 52, varying from to 6 exons inlength. The other 5 cases (25%) have proximal deletions involving exons 5 to 21 and from 2 to 19 exons in bmnwetire& -mwACBAVD. AU w ranging e(&essemibr ~a"s~key length. 4 highly polymorphic STRPs that saturate the distal deletion hot spot have proven to be an essential tool for molecular analysis, with a combined WePrspfess1 bhersgI Wms( FixshDuUAVD ad heterozygosity of 100%, where the majority of familles are informative for 3 STRPs. In 14 out of 15 1's #U A VDminswi& ebl' sdI egies10 wilI eei dswibmidc7 (93%) of the distal deletion families the STRPs - provided direct information on carrier status the of gxpes. Mmmrwesmd A 6id wAUAVD_ eadbfr by loss he osity, a vast improvement on the highly subjective technique of dosage analysis i at ptefb bsi~ebAn d_P sin hsmnd using cDNA probes. By combining PCR of the exons with the 5', 3' and intragenic STRPs molecular analysis of D/BMD is more rapid, which is especially relevant for prenatal diagnosis and now, in a number of cases, direct evidence of carrier status is provided.

1206 1207

Fragile syndroae: Discordant exprssion of FN3-1 with identical Ntaml, r t Isiy In A Hydr1as fttalis a-Id 00O inserts in two brothers. ((0.T. Mueller, J.K. Hartfield, Fab. L.A. Gallardo and B.G. Kousseff)). Genetics Division, Department of Pediatrics, University of South Florida, Tampa, Florida. L.Y. NM.3.In . Di~wn.D.Li andO.W. Jf~. IDarrt of Medicine, Medical Gentics Division, uhivrrsity of A fourteen old white was Son and year male born by SVD following a 36 week Clifrzrda, Dieo Odlkm's Hoqpiita and Health 0*sr, Sin Birth gestation. weight was 2.9 kg, length 49.5 cm, OPC 32.7 cm, and cheat circumference 30.5 cm. He first sailed at 2 months, rolled over at 6 stood Wb ces weeks, alone at 18 months, walked alone as 6.7 years, and e rqio have a of hydrcp fetalis secodary to ks cr- said his first r words atlS1 months. He practically nonverbal. KEG thlmmia-3L hbt ltir o p n u and e audiometry are normal, lie shrieks and slap himself In the face. -d0of hydq fetalisiu ta f Both ears are eac of proinn. He has marked dental overjet, drooling and e-glbin gnm. Typicaly parent an affected fetu, is an bruxism. testis volume 25 far of tw Right cc, and left, 15 cc, by Pradar Wit CszriaW ddletian e-gldin ne on the - orchidometer. He walks with d e __16 and is short steps, placing the feet flat on the thns kstaoqgne fowo-thmlmmia-1. floor while turning then out. There marked psychomotor retardation. His mother is a this ce, a 20 mu high school graduate and he has a 12 year old brother In wdc gostation fets wtalzmd to haw who is bV slightly delayed in school, but otherwise asymptomatic. hydrns t ut d blen kinglobln el resis Bart's and no Cyogenetic fragile X teats were negative for the proband and his realed htiogldiin fetal hingdbin. mother in 100 metaphases examined. Measurement of the K analysis with 5S-zeta pr m-d double digestion by and C00 insert Amp size by Southern blot (pllOO/PstI detection) and by PCR amplification 7158 resFiction _aym d that the feus wa followed by blotting and detection indicated en Isygcas for tammia-l. CH% from the tus did insert of 45 x nt COG, which is within with for th the 'gray area' of 40.60 x that designates the hytWidlz c3 proi a-gliin gom. affected/normal range overlap. The methylation status at the Kagl site MIA detected with St512.3 Indicated an active The Paretal aalysis revealed the father is hetogman for a- gene. proband's mother thammia-1 the to and asymptomatic brother have identical inserts and methylation hat poved ba IsygmSr l. state. The _~sij~tly, 3 aralymis t proximal flanking RFLPs D1598 and as well as wtha51-Rro revealed DX5369 distal a mastanal markers DXS15 and DICS52 indicated that both allele hbt mingle aid identical allele in th rfthe ad brothers had inherited the with lp ftas same chromosome with respect to the 1111.1 locus. These discrepant arisdmat di-y. phenotypes are associated with discordant levels of expression, as demonstrated by RT-PCR of leukocyte ON&. The underlying cause for the different in phenotypes these brothers could be the effect of a second undetected 1131 mutation altering aRNA stability.

1208 1209

Mosalism in fragil X atfeoted males. ((S.L Noun, G.E. Houck, Jr., S.-Y. Frequ of Delta-F508 in a mexican sample of cystic patients at U, X.H. Dig, W.T. Brown, C.S. N.Y.S. Basc fibrosis diagnosed autopsy. ((L. Orosoo, M. Dobkin.)) Institute for Moreno, M. Chvez, C. Researc, Staten blind, New Ridaura, B. Lbpez-Corella, JL York. Lezana, A. Carnevale)) Instituto Nacional de Pediatria, Asociaciun Nexicana de Fibrosis QuIstica, Mexico City, Moscism In hoge X miles has been reported to be 19% Mexico. at al., NEJM 325:1673, 1991). Mosaic mlsare kide the by In our presence of a methyistid band charcteristic of laboratory, Delta-F508 mutation was detected in 45 the mutation and an out of 148 CF additlonal unmtlad band in chromosoe (30.4%) from 74 living CP the premutetion range attr dgestion with patients. Thu frequncy is lower than that EaoR I and Eq and Sothern the reported in blot saWysi with probe StS 12.3. We U.S.A., Canad& and Northern Rurope, and it is also lower afected both n *agXmal by Sou bbltt and PCR and that that found in Argentina and Spain. The high rats of fund to CF 31 (40%) be mosalc This is a su-pbstantiall lrger poporton hn cases who die without diagnosis, the ethnic origin of noted The reon for diffrence may be tW 8 indviduals in mexican population and the limited number of cases our studs exhibited a ow studied could account for the low frequency found in only very intensity unmetykatd band. population studied. the To detrmine whether mosaicsm might hae a familial basis as To test the hypothesis that in our country severe by a st* of mnzygoic twins. (Devys at al. AJMG 43:203, mutations, such as delta-P5s8, May be more frequent the 77 indivIduals in our in sudy were divided angxV 38 sate of 2 or undiagnosed cases who die in Pediatric Hospitals, we 3 brothers. No f asoctn was observed, with 2 mosaic males looked for delta-F508 in a sample of 32 autopsies where ig in 8 of 38 Se the was only (22%) d brohers. One unusual mosaic was CF diagnosis made after death on the basis of ienified, however, withia band which to histopathological findings. The mutation was detected single appeared be in the normal PCR-mediated by range by Southern analysis Amphflcstl ofthe site directed mutagensis in 35 CF regin by PCR revealed 47 chromosoMes out of 64 (54.7%). When compared with CGG repeast (normal I50) aition tothe expected >200 the repeats frequency found in living patients, the difference was for an affected mal. A mosaic of this type has not ben previously highly statistically different (p<0.0001). We want to rmported call the attention on the possible bias of CF gen These date suggest nmsalcism in affected males may be mutations fr quency, when estimated in living more diagnosed in patients presentlyr Wecondudethetm Cmoe not ountries where lack of awareness and have afanil basis more environmental diseases that mimic CP may favour the b ut, results from the ture of the of early large COG repa". death undiagnosed CF patients with severe mutations. Molecular Applications in Clinical Genetics (continued) 1210 1211 First clues to the genotypephenotype correlation in Marfan syndrome Mlocondria D-Ioo fi pti With LoW Str y Single Specfi Prm ((L Peltonen, R KaIinen, L. Kunen, L. Ldnnqvist, and T. Ratamiki)) PC (LSSP-PC): a novel apprach to ident Ing. ((S.DJ.LPOWt2, G.Bare2, National Public Health Insitule, 00290 Helsinki, Finland. C.LGinher3 end AJ.G.Simpaon4.)) Ndcleo de Getica Miic de Mines Gerisi (GENE)1, Bo H BioDil.;z Univalade Federal de Minas Gerais2, Mlo Marfan syndrome (MFS) is caused by mutations of the fibrillin 1 (FBNl) gene. Horizonte, Mail; Univeat of Californa, Bereley, Cafni; Centro de Th related clinical phenotype, dominantly inherited ectopia lentis (EL) has also been NP _lsas Ren Rudhou4, Ml Hodmt, BraiL genically linked to FBNI. We have used SSCP and direct sqnng to screen for We have developed a simple and rapid PCR-bad technique (lSSP-PCI) for mutations in the fibrillin cDNA of MFS and EL patients Here we report ten novel denectio of DNA aequnce variation that c idnify sine or multip mutations in mutations of fibrillin cDNA, nine of them in MFS patients and one in a EL patient. gene sied DNA fiagments. It consists of submitting a DNA fragment to PCR Eight of the identified mutations occur in the EGF-like motifs, the repeating structural amplfication using a sinle digo tide prima specific for one of the ectremites conponents of fibrillin polypeptide chain. Thes mutations include cysteine of the fragment u conditions of very low stringency. Th primer hybridizs muttions, mutations of residues keown to be important for calsium-binding of the ytos its c nary exrmity and nonspecifically to multiple sites EGF-like motif and one splice-site mutation causing the slipping of one EGF-like within the fragment, in a a _-encdaendent mn. The PCI reaction yields a motif. Two of the identified mutations occur in the 8-cysteine motif repeated several lage number of products th, folowinig el c a n, give ise to a times in the fibrillin polypeptide chain. Interestingly, the mutations of three patients *DNA fagment fingerprint- that reflects te underlying aeu We apied LSSP- which represent severe neonatal MFS cases are situated quite close to each other, PCI to the detectio of sequence variation in the D-boop region of human messing the functional importance of this particular area in the fibrillin polypepde mntochondrial DNA, which is known to differ from between one and fifteen base chain and perhaps giving the first clues to the correlation of genotype to plype. between unrelated individuals. We prepared human DNA samples from blood and Since every family most probably has a unique mutation, a generally applicable amplified a l,O24-bp portion of the mtDNA control region using primers L15996 and DNA diagnostic method detecting mutations seems impossible. We have tested the H408. The PCR product was gelpurified and ten mplif under LSSP-PC value of four amplifiable polymorphisms inside and close to FBN1 gene. In our conadition using L15996 or H408 to produce complex paterns which always differed family mateial of 15 families, every family was informatve with at least one of the between unreated individuals. In contrast, all mothr-child pairs teased wer used markers (two intragenic markers of FBN1 and G113 and CYP19 which are identical, as expected frm te matrilineal in ce of mtDNA.C i on located within 4 cM from FBN1 gene). Therefore we conclude that in families with DNA n ing more than 30 individuals swed that LSSP-PCR is capable of several affected fiamily members, the diagnosis of MFS can be made or excluded with detectig even a in the fingeints dver a high degree of certainty using these markers. single bas change the D-boop and that The finacial suppet of die Naional Marfsi Foundin Mm Academy of Fnisd ad die Eopean progressively as the number of base differe inc . Thus, the ue of LSSP- Concered Actn on Heritable Connective Tum Dismls is gratefuilly acknowledged. P forD-oop fn in constitutes a new simple for identity .

1212 1213 Chromosome 22q11.2 deletion in patients with a new facial-cardiac Cystic Fibrosis gene mutations found in Chronic Obstructive Pulmonary syndrome ((JW Plerpont, LH Seaver, SB Cassidy, RL Donnerstein, RP Disease patients.((P.F.Pignatti1, C.Bombieri1, C.Marigo1, M.LuislttI2.)) 1 Erickson.)) The Steebl Memorial Children's Research Center and Department of Pediatrics, The University of Arizona, Tucson, Arizona Inst. Biological Sciences, Univ. Verona; 2 Inst. Respir. Dis., Univ. Pavia, italy. A blinded ca-contrl Study was conducted to test the hypothesis that A genetic predisposition to Chronic Obstructive Pulmonary Disea some children with pulmonary atresia with ventriculoseptal defect (PA/VSD) (COPD) has been suggd. Pathogical changes, particularly have a recognizable pattern of physical and developmental anomalies. A bronhiec, and fnctional impairment, may be similar in COPD and In standardized dysmorphology physical examination was performed on 7 Cystic Fibrosis (CF) patients. We have therefore looked for CF children with PAJVSD and 7 controis with other cyanotic congenital heart Transmembrane Regulator (CFTR) gene mutations In 29 unrelated COPD defects. 6/14 (43%) were considered to definitely have a similar facial patients, 14 males and 15 females, and in 36 matched controls affected by appance, and 2 were possibly similar. All 6 in the former and 1 in the other pulmonary diseases. We have used PCR-resction analysis, reverse later group had PANVSD. Common clinical findings include mild postnatal dot blot, allele specific amplification, denaturing gradient gel growth deficiency and motor delay and a subtle but recognizable facial electrphofresis, automated DNA sequencing. Mutations were found in five phenotype clearly distinct from that of classic VCFS. No child had overt or female patients: deletion F508, the most common CF mutation worldwide, submucus cleft palate, speech difficulties, hypocalcemia, seizures or immune deficiency, none was considered learning disabled. and three rare missense mutations substituting arginines in transmembrane Recent reports on 22q1 1.2 deletions in patients with cardiac defects have domains: R117H and R1066C In one patient each, and R347P/l/L in two included some patients without typical VCFS. For this reason we conducted patients. In the controis, deletion F508 was observed once. These data w a preliminary molecular study on 4 of the PA/VSD families. The dinuclotide an increase of 4.9 times over the exected care frequency. Disease repeat D22S264 located on chromosome 22q1 1.2 was used to test genomic severity correlates with the amount of apial current reduction obtained In DNA. 3'of the 4 PA/VSD patients have a maternal deletion at this locus. It is delta F508, RI 17H, and R347P gene transfection experiments (Sheppard et - possible that the microsatellite D22S264 may be in a separate, but contig- al., Nature 362: 160, 1993). The CFTR gene is therefore likely to modify the uous region, with the DNA probes that identify deletions in VCFS (i.e. risk of COPD. This is the first report of CFTR mutations otherthan delta F508 D22S75 and D22S259). Alternatively, parent-specific deletion inheritance, in COPD. i.e. imprinting, may be involed in the phenotypes observed. The poor prog- Acknowedgements: Supported by italian National Research Council nosis of VCFS in regard to leaning, speech and possible psychiatric illness target projcts YGenetic Engineering' and 'Biotechnology and makes it important not to include the patients with PA/VSD and a different Bioinstrumentatlon'. dysmorphic phenotype in the spectrum of VCFS. Further investigation of the possible noncontigulty of the deletions in the 2 syndromes is needed.

1214 1215 lamiiea f stoohndral Dl& s-aranna innatents with mtNAh Molecular and togenetictudies of an X;autosome t octon in a patent with premature ovarian falr and review of oher cas: is thre a POF2 gene? ((C.M. Pwl, R.T. Tgr, T.C. Dr1hle, D. Wangas, C. abn3, LM. Nelson', B.J. Wh'.)) 1.N Institutes of Hath, Bethesda, Maryland, t, atig A, 2umnich A, torten K, 3 ff LA, Mr M. Deparme~nt of Pdatria, iaity of xford, John Sadcliffe 2.Chlrn's National Medicel C r, W , D.C., 3.Wayn State Univ., Sospital, Naadinctcn, oxford,* U.'l -12, NopitualGs anta - Detri, Michiga. s, Paris. pt clinal a e a, Newcastle upon Tyne. IoeBartsnt of Siochasistry, Univeraity of Oxford We have ldentified a patient with sporadc prature ovarian failure (POF) Two p otype are clocely associated with deletiona mitoohondrial ofealy-onset nd an X;autosornsIocaftin: 46,XQt(X;6)(q13.3 orq21;p12), Ma Pearson', and Kearn-s-ayre syndrome. wa have re-investigated was eight patienta with Pearn' synd for the presence of using hg-esolution analysis and FISH. Her phenotype normlg except mitochondrial Ma (stUAM duplications. In each of two patienta with for a mid cubitus valgus. BrdU analysis revealed tht her normal X was te- Pearsonassyndrome, duplications were easily detectable as well as and X is deletions. Because there wa never sore then one abnormal junction banslocated ealrreplrcatirIg which typical of X;auoeome fragment on any restriction digest, thes two types of intent stoM rerrngments. Using PCR priners, genoric probes, and a YAC to study are probably derived from a single illegitimate recoobination event, DNA from the patient, her chrosomaily-r parent, and somatic cell followed by resolution with wild type. Both of them patients had a phenotype which evolved into lKarns-Sayre syndrome. However, in hybridscontaining eachtr c, wehavecharaceizedthe 3/3 patients ian there no neurological signs, deletions wae the breakpoint on Xq and d the pent origin of the transiocation. Our only recobinant atns detected. Families of re-arranged molecules pat's is panay-deried, and is localized to my he involved ia the change ia distribution of mutants which rerraement Xql3.3- accompanies the p ot change. Xq2.1, between PGK1 and DXS447 loi, a distance of 0.1 cM. A 'critical region' for normal ovarian futIo has been for Xq13- We also present data no 16 older petients with siatch-ndrial syopathy aonc ofp t end major re-arrngmta of eta. The presence of high levels of Xq26, egcu withX;autosome -ansocaoons duplLcstLons wee "socLated wLth the Kearns-sayre phenotype, and andgonrdaldysfuion. Few cass h had molecr e of deletlons alone wLth cbhonic progressive external ohthaleoplegia. the bkpoits to fur rdefine the region. While triocaon the rein Thus, duplicatlons of MA may he central to the petbaognes of Kearns-a syndrome. We argue that other data suggest that may ladto ovarian d n by d normal meosis or by a position dupl td ionral MM may he prsnt in the ger9line, henoe eff two recet repr o pits with POF andXq deletions sugges th generatLon of duplicated etU preceeds deleted mitochondralDon" thr and in these fdilis. We sake the novel suggestLon that duplicatLons is agene (POFI) blzed to Xq21.3->Xq27 possby to Xq2.1-> of etl my he intermediates ln the formstion of deletions. This Xq27 rsponil for POF. d on our studis and review of ohr cas, has important iWlLcations both for genetic oounselling and for our we propose ta tee may be a second lou for esriy-st POF (POP2) understandn of tc rlil bLogeness. locaed at Xq13.3-Xq2.1. Molecular Applications in Clinical Genetics (continued) 1216 1217 Molecular screening of exons Al, A2, A3, and E of the choroideremia gene. Identification of ((MAN. Preising and LH. PawlowitzkL)) Institute for Human Genetics, new mutations in the dystrophin gene. ((T. W Prior, A. C. Weatfalian Wilhelms Univ., Mfnster, Germany. Papp, P. J. Snyder, A. H. M. Burghes, C. Bartolo, M. S. Sedra, L M. Western and J. R. Mendell.)) Ohio State University, Columbus, Ohio. Choroideremia (CHM) is an X-linked chorioretinal degeneration that is charactrized by congenital night blindness and later loss of vision due to Approximately one third of DMD patients have no detectable deletions or atrophy of the outer retinal layers and the choroid. The gene underlying CHM duplications. These cases are most likely the result of point mutations, or has been cloned (Crmer et aL Nature 345:674, 1990) and we characterized S small deletions and duplications point mutations in 30 unrelated affected males in the 4 CHMeons(B3,B4, C, that cannot be identified by routine and D) analsed so far (v.d.Hurk et aL AmJ.HumGenet S(:1195-120Z 1992) strategies. Utizing a heteroduplex approach, we screened 110 DMD In the present study we anabsd 4 further exons (Al, A2, A3 and E) in 44 patients for small mutations in the dystrophin gene. Upon the identification affected males andfor carriers from pedigr segregatng for CHM collected of an aberrant heteroduplex band, direct DNA sequencing was used to by us. In addition 20 unrelated cases clinically classified as having eye diseases confirm the presence of the causative mutation. other than CHM were screened. The 4 primer pairs used were designed by F. We have completed the screening of 50 dystrophin exons in our DMD Cremers (unpublished) and idndl provided for this study. Using PCR-SSCP- population. Thirteen new mutations have been identified: one missense technique 11 of 44 males with CHM showed amplified DNA-fragments with mutation, eight altered electrophoretic mobility suggesting ence ch es. In addition 1 nonsense mutations, two single bp insertions, one single female with eye- and sidnsymptomes cly classified as incontinentia bp deletion and an eleven bp deletion. The missense mutation results in pigmenti showed an altered fragment mobility of exon E in the SCP-ans the substitution of evolutionarly conserved leucine to arginine In the actin- confirmed in her daughther and one of her two granddaughters. Direct binding domain and defines the first single residue that is crucial for sequencing of exon Al showed S patients with point mutations that introduce dystrophin function. All the mutations have been unique to single chain terminations in codons 5, 33 (Arg), and 20 (Tyr) respectvely. None of the patients. However a small clustering of mutations have been found in patients sharing the same stop codons are known to have a common ancestry. exon 19 and the 3' This findings suggest that a considerable proportion of sequence changes is end of the gene. Upon the identification of the detectable i the exons Al, A2, A3, and E and that stop codons maye more causative mutation in the affected, accurate direct carrier testing has now frequent in exon Al as compared to published fndings in other CHM exons. been extended to several of the families. The analysis of our DMD Molecular analysis of CHM exons in patients diagnosed as having eye diseases population has also resulted in the identification of several rare and two other than CHM may improve differential diagnosis and genetic counseling in common polymorphisms in intron 2 and exon 53. Our results suggests that some cases. supported i part by the German Ministeiy of Science and a majority of DMD small mutations lie either within introns or another Technology (BMFI) and bythe Commision of the EC. region of the gene.

1218 1219 A new Phenylketonuria (PKU) mutation detected by illegitimate Alport syndrome in Italy: a muiticenter screening for COL4A5 gene mutations. transcription results in RNA mis-splicing: Founder effect and PKU ((A. Renieril, L. Gallil. M. Sen1, M. De MarchI. B. Peissel3, A. Turco3, P.F. in Australia.((S. J. Ramus and R. G. H. Cotton.)) Pignatti3, T. Neri4, P. Zaneli4, M. Savi4, E.R. H&mpliinen5. T. Pllajaniemis, The Murdoch Institute, Victoria . AUSTRALIA. Clinical centers: A. Antonelli -Luoca, G. Banfi - Milano, B. Basoio - Torino. M. Giordano - BSari, R. Coppo - Tonno, G. Chiarulli - Acquaviva, C. Danesino - Illegitimate transcripts of phenylalanine hydroxylase (PAH) have Pavia, N. Di Paolo - Siena, F. Fasciolo -Brescia, R. Gusmanno - Genova, M. been used to detect known PKU mutations 11I. Using this method a Giani - Milano, E. Gotti - Bergamo, E. Imbasciati - Lodi, G. Lama - Napoli, D. new mutation causing PKU was identified, a single base pair Lamperi - Genova, A. Lupo - Verona, G. Lavoratti - Firenze, S. U Volti- deletion In exon 11 (del A 400). As well as the frameshlft resulting Catania, N. Miglietti - Brescia, G. Mignani - Rimini, M. Mileti - Crema, C. from the this mutation a Manno - Bari, R. Palla - Pisa, C. Pecoraro *Napoli. M.V. Pellanda. Bassano, deletion, is change In the coding region L Peratoner - Trieste, P. Regler *Bolzano. G. Rizzoni - Roma, M. Sadeli - which results in mis-splicing of the RNA. This change must be in a Arezzo,A. Sessa - Vemercate. S. Schiavano - Casarano. F. Scoari - Broscia, region important to normal RNA splicing as It results in both exon R. Tenconi - Padova.)) Genetica Medica, Dept. Biol. Mol., Siena. Italyi. skipping and use of a cryptic splice site. Mis-splicing of PAH RNA in Sci.Clin.Biol. Univ. Torino Italy2. Blologia e Genetica Univ. Verona, italyN normals and patients has also been found due to poor natural Genetica medica, Univ. Parma, itWy4. Dept Medical Biochemistry. Univ. Oulu. splice sites rather than mutations In the DNA. Finland5. This new mutation was found In two apparently unrelated families and a genealogical search was performed to look for a common Among 111 collected Alport syndrome families, up to now 85 underwent ancestor who could have been a carrier of this mutation. The mutation screening in the COL4A5 gene by Southern blotting with cDNA mutation was traced back to Ireland in the early 1800 s. probes of the entire gene. and by non isotopic single-strand conformation polymorphism (SSCP) for 15151 exons. In 17 probands a molecular defect Almost 90% of the mutant ales in our group of Australian was identified: eight gross untreated PKU patients have been Identified. The frequencies of rearrangements (seven large deletions and one these 2.7 kb Insertion), six frameshift mutations (one de eve Insertion of 4bp and alleles rect the high Immigration from Ireland to Australia five deletions of 7. 4, 1, 1. 1 bp, Renild et al. Hum. Genot in press). onei in the 1800's. As well as being of historical significance these frame duplication of 36 bp, two missense mutations which changed glw25 results have Important Implications In screening for causatve (GGA) to glu (GM) (a de novo mutation, see Hum. Mol. Genot 1:127-129, mutations in the Australian PKU popuiation with 3 mutations 1992) and gy143 (GGC)to ser. Clinical evaluation confirmed in one patient accounting for 54% of alleles. the association of 5 deletions with lelomyomatoais, and suggested that frameshMift mutations might be associated with early progression to ESRD, Ramus et Human Mutation 1: possibly by ous of the NC domain, as suggested by Smeets at al. (Kny Int 11] al. (1992) 154-158 42: 83-88. 1992).

1220 1221 A rapid, sensitive PCR method for clinical Identification of Huntington's dDipod 0made B r by PCR hjoxk Disease allels. ((H. Rennert and J. A. Kant)) University of Pennsylvania S Medical Center, Philadelphia, PA. M(ScKe,,Houton7XH-Mcy.{IP.Wa1IoaHuo~duP.Watn,Aft"k C.T.Cog)>Bra* dh Huntington's disas (HD) Is an autosomal dominant neurodegenerative Gmre h %datmuriuion d hDuchsnnandBec ermriy y disorder charateriAed by adult onset of progressive involuntary chorelform patldelstons In th ust gsnsdc dprs. Acueaste de of such movements and psychiatric manieions. This disease affects 1 In 1000 m~lim cmb bbnmd bmbegtnet dystrophbe gwnscDNA Individuals In some populations. The D gene was assigned to chromom hm -# Vbopbn gnemoo i~n to#l; m a 4 In 1983. The Huntingon's D Collaborative Research Group rcntly isolated a chromosome 4p cDNA which demonstrates limited expansion of ftenedorsmwrns Thecurs19pkrsPCRassdsets9s%ofdclobiams id an unstabl (CAG)n trinudleotde repeat in HD patients. byscuihern. hwealiem to rpleo sournsw a poweulPCR asa, we hv The published method for assayIng the HD PCR l f has several di CAG-repetregion using 22etion b2arhg tedmn b gmgm Inrea : a) amplification efficiency is low, presumably bidn b~ond2gz _dD Dbadwmm to &poWdfofto rl amio because amplified alleles are very GC rich; thus, PCR products can not be were accrtl datmbe in 192 d the by our now PCR sawy wd visuslized on ethidium brmIdeaIned ges, b) each reaction empioys large cordbysotrm In ft kdWnr~ of ,V 63%dto mu~ wo on* ID amounts (5 ug) of prim, and c) lbled DNA products must be resolved on desitins deon53alone.Thladadcm d se forbOhh 53 and4 now allw a denturing polyacrylamide geis. By employing a 3'flanidng primer cdser to comped corage of th delbton %ct sp of exo ns43 -53. thish sdy we foued t the CAG repe region, we have developed a rapid method for assaying 72.4% all deOn dscted h Thisc favorty w te f normal and expanded alhes In this region more standard PCR bbsfrcomthemubcw ,bein whh w7d hh.4%) dsietoinswwo delecld conditions. using inthe rion.End poi dabobacaydulbdby Amplification Is performed for 35 cycies using annealing of CRaibne77T8%odftebgl temperatures of 650C., 300 ng genomic DNA, O.SuM of each primer, 10 mM ofthat regin(mul-cr daa) ve 762% deltons delteded be oursudy. This alba Trdcne buffer 1.5 mM 0.01% Ccatse beitnofsiesmsbedchin reedleth NA paba eusedIst am (pH 8.3), MgCl2, Triton X-100, 0.1% gean, 200 nd pot a entialtodteme whetr delions are heIr or oul-o-rues for uM dNTPs and 10% dimethylsulfoxide (DMSO). High concentrations of ~~~~~The2 morons wbd two PCR are essential for p_ ahui psbw _f"= DMSO efficient amplification and detection of expanded ~~~~onhrsfoondolrr13 zoxmL Boh van s up oW=mf ft moh (HD) aslels. Alieles of expected size (:40 CAG repeats In HD patents), wplilicaton protocols and products were anau on a 1.4 % aga p or we 8% (

1224 1225 Rhodopsin mutations in patits with ret pigmentosa. ((J.A. Rodriguez1, Uniparental disomy in Angelman Syndrome: A consequence of paternal CA D.G. Birch' J.R. and S.P. 'The Univ. of ieiotic non-disjunction. ((PK Rogan+, TR Lichty+, RL Ladda, MJ, Herrera', Heckenlpve Dalger1)). Mascari+ MW Steele0, SL Wenger@, S Malcolm*, DJ Driscoll and RD Texa HSC at Houston; 2Reia Foaon the Southwest, Dallas, TX; and Nicholls}°.)) +PA State Univ Col of Ned, Hershey, @Children's Hoop Jules Stein Eye Inst, Univ. of California, Los Angeles. of Pittsburgh, Pittsburgh, PA, *Institute of Child Health, London, CB, Univ of Florida Col of Ned, Gainesville, 0Case Western Reserve Univ, As part of our continuing stdes d atoso f1ms of retinifis piosa Cleveland, OH. (RP), we screened a panel d DNAs fro 134 u d patients for mtntions in rhodopsin. App a half ft patients were from families showing The majority of AS patients with Angeluan Syndrome (AS) lack dominant Inh e the remainder were eiter cases or from families maternal chromosomal sequences from the 15qll-ql3 interval. Although ; Isolated maternal deletions in this region are the predominant genotype, about too emal to establish mode d Wineia. Paftent DNAs were first tested using 51 of patients inherit two intact paternal chromosomes (paternal ASO procedures to det the common mutation at codon 23 (Pro23His); disomy). We present a survey of polymorphic genetic markers for 6 AS hereaer, DNAs without ts muton were screened by SSCP. SSCP was patients with a paternal disomy genotype, 2 of which have been reported accomplished using 7 prim pairs to span the 5 rhodopsin exons followed by in part (Malcolm et aI., Lancet 337:694, 1991; Nicholls et aI., Ann esis under two different conditions. Amplified prmers were choen Neurol 32,512, 1992). In contrast to the high frequency of aiosis I to inciude intron-o untions.. non-disjunction in various maternally-derived trisomies, paternal Ten of the tested DNAs had the Pro23His mutaton. is consistent with an disomy in AS has been suggested to arise by either asiosis II segrega- This tion errors or by duplication of paternal chromosome 15 in a monosomic expected ftruencyof 10% among American in pits zygote. Five of the six patients studied inherit tvo distinct paternal with autosomal dominant RP. Among fe remaining 124 samples, n SSCP alleles at one or more loci (heterodisomy), suggesting that the paterns - dis from each otr and from the known, polym nuIeotide majority of these cases are due to paternal miotic non-disjunction substitutions - were detected in 6 DNAs. Seq of se variants revealed rather than post-zygotic endoreduplication. Proximal isodisomy the foilowing mutatns: Lou48Arg, Aspl9OAsn, His21Arg, Leu32BPro, a332- (consistent with maiosis II non-disjunction) is likely in three of and Pro347Thr. The clinical for tes from mild these patients, while miosis I non-disjunction is suggested 336 spectrum patients ranged by heterodisomy close to the centromere in the other two individuals. (type 2) to severe (type 1). Two additional SSCP variants are the result of Four of these AS patients carry recombinant disomic chromosomes substitutins within the splice sie, both at the 3' end of eown 1. consisting of both isodisomic and heterodisomic chromosomal domains. Additional testi of thmse mutants is underway. Finally, a furhr 10 SSCP Both single and double recombinants are observed, consistent with variants are being sequened. previous studies of chromosome 15 chiasmata distribution during Supported by grants from the National RP Foundation, the George Gund spermatogenesis. F dation and from NEI-NIH.

1226 1227 Monitoring Bone Marrow Transplant Engraftment Using Fluorescently Tagged PCR Molecular analysis of a partial trisomy 21 patient. ((J. A. Scott1, S. L. Primers for Human Identity Markers. ((S. J. Scharf, A. Smith1, C. MacFarland , and Wenger2, M. W. Steele2, and A. Chakravartil.)) 'Department of Human H. A. Erlich.)) Roche Molecular Systems, Alameda, CA, and I Fred Hutchinson Genetics, University of Pittsburgh, Pittsburgh, Pennsylvania, and Cancer Research Center, Seattle. WA 2Department of Genetics, Children's Hospital, Pittsburgh, Pennsylvania. The forensic community has been quick to adopt use of highly polymorphic A nine year old mildy mentally retarded female presented with faatures genetic markers, eg. VNTRs and STRs, coupled with PCR amplification as a rapid consistent with Down syndrome. The phenotype included bilateral and simple determination of human Identity, both for the determination of epicanthus, flat facies, small ears and mouth, and a short full neck. An paternity and for enmination of biological physical evidence in criminal cases. We echocardiogram was normal. Chromosome analysis on peripheral present here another use for these markers in determining human identity- lymphocytes and skin fibroblasts revealed a normal 46,XX karyotype. meauring the extent of marrow transplants. With the advent Chromosome analysis on both parents was normal. of the Unrelated Bone Marrow Donor Registry and precise DNA-based HiA Several cases of partial trlsomy 21 resulting in Down syndrome have been typing, the number of bone marrow transplants performed annually will be cited in the literature, and have been instrumental in trying to identify the increasing significantly. The ability to monitor the level of engraftment of the minimal critical region on chromosome 21 responsible for the major Down recipient post-transplant provides the physician with the means for early syndrome phenotypes. Molecular analysis has determined that the region treant We have developed a method for monitoring the extent of engraftment around D21 S55 (subband 21q22.2) is critical for the expression of the Down of allogeneic bone marrow Using minisatellite (VNTR) or microsatellite syndrome phenotype. (STR) genomic markers, one can select loci that discriminate HLA-matched We used 15 highly polymorphic (CA)n repeat markers to reveal a partial unrelated or HLA identical sib bone marrow donors from transplant recipients duplication in this patient that was of matemal origin. Markers D21S212, Fluorescently taged PCR primers are used to amplify the locus or loci that D21S156, D21S231, D21S259, D21S167, and D21S270 showed three distinquish donor alleles from recipient alleles. Pre-transplant recipient and donor distinct alleles; markers proximal to, and including, D21S21 1 were not DNA is mixed and amplified for these loci to produce a standard curve duplicated. The finding of three distinct alleles suggests that both maternal reconstruction of a chimeric transplant Analysing the fluorescendy tagged PCR homologues were involved In the origin of this de novo duplication. Two products on agarose gels with the ABI GeneScanner or acrylamide gels with the mechanisms could result in this finding: a small unbalanced translocation ABI Sequencer, one can correlate allele peak areas to the percentage of donor or below the current cytogenetic resolution, or a de novo duplication involving recipient DNA present Amplifying and analyzing the post-transplant sample both homologues by unequal crossing over. We are currently using YACs DNA(s) and interpolating the pk area percent of the informative allele(s) from isolated from markers In the duplicated region and FISH analysis to the standard curve allows determination of the extent of eaftment. Additionally, determine the mechanism by which the duplication arose. a system for determining donor or recipient DNA concentration will be discussed. Molecular Applications in Clinical Genetics (continued) 1228 1229 DETECTION OF GEM LIE MITATIONS IN THE EUOFIBROATOSIS TYPE 1 (WF) Ala4 Mutation in SODI is the Most ENE USING HIET OL ANALYSIS Frequent Mutation in MH Shen, M Upadhyaya. Institute of Medical Genetics, Heath Park, Chromosome 21-Unked Faniial ALS (FALS) Cardiff, CF4 4XN, UK. Intro. by P.S. Harper. T. Slddique1 H-X Dengl, A. Hental1, W-Y. Hung1, A. Cayabyab1, NF1 is one of the most cmon genetic disorders, with an incidence P. G. J. R.P. of approximately 1 in 4,000. The specific mutation analysis in the B. Herzfeldt1, Hu1, Deng1. Rimmler2, Roos3, A.D. NF1 gene has been problematical. The search for these mutations has RoseOs2 and M.A Percak-Vance2 been further complicated because of the large size of the gene, the 1) Department of Neurology, Northwestern University Medical high mutation rate, the presence of pseudogenes and the presence of School, Chicago, IL the nomal NF1 alelle. Since the cloning of the gene, more than 3 of Duke Medical years ago, only a few specific mutations have so far been described 2) Department Neurology, University Center, in NF1 patients. Durham, NC Previous reports have focussed on screening exons 28-36 of the NF1 3) Department of Neurology, University of Chicago, Chicago, IL gene, which represents 23S of the overall coding sequence. We have used a panel of primers for amplifying 8 fragments scattered We have previously Identified a locus for FALS on chromosome 21 throughout the whole gene, spanning part of S' end noncoding region and demonstrated genetic-locus heterogeneity. Mutations in the and exon 1, exons 13-15, 17, 38, 41, 43, 44 and 46 and their flanking chromosome 21 encoded to be intron sequences. The PCR products of 1SO unrelated NF1 patients q gene SODI, appear responsible were examined using heteroduplex analysis on Hydrolink gels. Three for a subset of FALS cases. Two hundred FALS families were novel mutations were detected, of which two include identical 3 bp screened for mutations in all five exons of SODI and mutations deletions (AAT) in exon 17 and the third one is a 10 bp deletion were identified in exon 1, 2. 4 and 5. A point mutatlon in exon I (TTCTCTTGGA) in exon 44. The mutation in exon 17 demonstrates a third that changes Aia4 to Val is responsible for over 50% of the SODI example of a recurrent mutation found at the NF1 locus. The 10 bp mutations in FALS. deletion alters the reading frame, introducing an inappropriate stop codon. We have also identified two polymorphisms, which may be useful intragenic markers for diagnostic tests. A relationship between the Three large FALS families previously reported by us to be not type of mutation and the clinical features of the disease will be linked to chromosome 21, do not have mutations in the SODI discussed. gene. These families are being tested in a genome-wide search to identify the second FALS locus.

1230 1231 Molecular and immunological studies in X-linked and autosomal recessive Alport The analysis of the trinucleotide repeat causing syndrome. ((H.J. Smeets', H.H. Lemminlc, L.P. van den Heuvell, L Kljuijnans', Huntington's Disease n 440 patients from 269 kindreds. C.H. Sdbrder', T. Mochizuki2, J. Zhou, S. Render2, K. Trygvaaon', L Mon- ((RG Snall, JC MacMillan, JP Cheadle, I Fenton, LP nes', H.G. Bnner.)) ' Depts. of Human Genetics and Pediatrics, University Lazarou, P Davies, PS Harper, D.J. Shaw)) Institute of Medical Genetics, University of Wales college of Hospital Nijmegen, Nijmegen, The Neth d; 2oyr Center for Molecular Medicine, Cardiff. Medicine, Yale University School of Medicine, New Haven;' Biocenter and Dept. An unstable (C&G)n repeat in the 5' region of the of Biochemistry, University of Oulu, Oulu, Finland Huntingtin gen is the mutation causing Huntington's disease (RD). Molecular analysis of this repeat sequence In a group of 45 patients with Alport syndrome (AS) a total of 10 mutations were in 440 RD patients fron 269 kindreds, along with 360 identified, 9 in dte X-linked COL4AS gene and 1 in the autosomnl COL4A3 gene. normal controls has shown a range of 30-70 repeats in affected individuals coma wredvith 9-34 repeats in The COU4A5 mutations involved two large deletions, a 5' and upstream deletion normals. Ther was a significant negative correlation leading to AS and leiomyomatosis and a complex 3' deletion to AS with a specific between number of repeats and age at onset, while andtGBM nephritis afr renal tplntion. ELISA studies revealed that the anti- paternally transmitted cases showed an excess of larger GBM antibodies of the latter patient were directed naginst COLAS epitopes. The repeat lengths in comparison with those maternally seven remaining COL4AS mutations were detected by PCR-SSCP analysis of transmitted. Significant anticipation was seen in individual exons, covering about 30% of the coding region. Three of these caused a paternally transmitted cases, with a 9 year earlier onset of a conserved amino led one in offspring of affected fathers compared with 2.75 years substitution acid, thee to a frame shift and destroyed a earlier when the mother was affected. Thes results splice acceptor site. In leucocytes of the patients with the frmeshift mutations, suggest that the expansion of the unstable repeat mRNAs containing the particular mutations were the most abundant species. Someti- sequenc of the disease allele is an important factor in mes additional mRNAs were detectable from which the exon, containing a prematue variation of age at onset in RD and may explain both the stop codon, had been deleted. Shorter mRNAs did also result from the sice se excess of paternal transmissions in early onset cases and mutation and, one of the missens mutations. A COL4A3 frameshift the observed anticipation in the sale line. However a surprisingly, negative correlation was also found between the repeat mutation was identified in afmily, in which X-linlkd inheritance was excluded. In length of the normal allele and age at onset but only this family a severely affected female patient developed anti-GEM nephritis after when that allele was paternally transmitted, suggesting a kidney transplantation. A omtive SA was highly suggestive for the COL4A3 sex specific imprinting effect at this locus. NC-domain belng the anigenic epitope. Therefore, in two patients with a post- transplant anti-GBM nephritis the different targets of the antsera corela with the mutations in their respective genes.

1232 1233 Poster Symposium-Session 41 G to A Mutation In the Type 11 Procollagen Gone that Converts Myotonic dystrophy: Retraction of the (CTG) repeat is associated with a more Glycino-247 to Serine In a Family with Spondyloepiphyseal severe phenotype in one offspring ((R Spiegel', I Einschenk', H Dyspiasla. ((B. P. Sokolovl.2, P. Ritvaniomi3, C.J. Williamsl, E. HungerbOhler2, W Schmid'.)) 1instltute of Medical Genetics, University of Considine1, L Yurgenev1, E.M. Meerson4, L. Aia-Kokko1.3 and D.J. Z~rich, Z~rich, Switzerland; 2Dept. of Neurology, Kantonsspital, Aarau, Prockopi.)) iDept. of Biochemistry and Molecular Bboogy, Jefferson Switzerland. (Intro.by: WP Robinson). Institute of Molecular Medicine, Jefferson Medical College, Thomas Jefferson University, Philadelphia, PA 19107. 21nstitute of Human Myotonic dystrophy (DM) is an autosomal-dominant multisystem disorder Genetics, National Research Center of Medical Genetics, Moscow, Russia. with aduit onset, characterized by myotonia and progressive muscular 3Collagen Research Biocenter and Dept. of Medical weakness. Differing degrees of amplification of a trinucleotide (CTG) repeat Unit, Biochemistry, located at the 37 untranslated end of the DM gene strongly correlate with University of Oulu, Oulu, Finland. 4Dept. of Clinical Genetics, Central disease severity in affected individuals. Expansion of the triplet repeat Research Institute of Traumatology and Ortopedy, Moscow, Russia sequence in successive generations has been proposed to be the molecular A search for mutations in the gene for type 11 procollagen (COL2AI) basis of anticipation. Retractions of the mutation during transmission to a was carried out in a family with severe spondyloepiphyseal dysplasia smaller or even normal size range, associated with milder or absent DM resulting in short stature, restricted mobility and severe pain In joints, phenotype in the offsprings, have recently been decribed. deforming arthritis in hips and claudication. Analysis of the Hindlil and We report hereon a DM family in which the paternal DM chromosome (600- VNTR polymorphisms at the COL2A1 gene in the family showed that the 700 repeats) has been transmitted with a reduction in size of the mutation to with the giving positive LOD score 0.49 at the daughter (150 repeats) and to the son (400 repeats). Despite showing a gene cosgregated disease of reduction, the son had onset of the diseasewith age 10years,while the father zero recombinatlon. Screenig for mutations in the COL2A1 gene using had onset of cknicai signs at age 30 years. The 15 years old daughter shows PCR-denaturing gradient gel electrophoresis suggested a sequence In no clinical or electromyographic signs of DM at the present time. The findings variation one allele of axon 19 from the proband. Direct sequencing of in son the PCR exon the clearly contrast with the observation that phenotype severity within products for 19 revealed a single base mutation that DM families is related to the size of the unstable trinucleotide converted the oodon of -GGT- for glycine 247 to -AGT-. a codon for serine. directly repeat. mutant in Extensive somatic heterogeneity with a larger size of the mutation in muscle of The COL2A1 allele was present all affected family members, but the son absent in non-affected members and a affected cannot be excluded. in group of 50 unrelated healthy However, this case indicates that determination of the individuals as -well as in 20 patients with chondrodyspiasias and 30 length expanded patients with precocious osteoarthrits. trinucleotide sequence in peripheral leucocytes, or prenatally in chorion villi Supported in part by grants from N.I.H. (39740), the Lucille P. Markey samples may have a limited value for predicting the severity of the disease in Charitable Trust, and the March of Dimes/Birth Defects Foundation. an offspring. Molecular Applications in Clinical Genetics (continued) 1234 1235 r ph"' Pfi PCR-SSCP mutation detection analsis of human d a ldWnf tp with livak-arginass of rWu MUMtior M =11 mm. ((Kw SWtv h, LM. 1 W. point mute on in two unrelatad AsItrdnazi Jewish families. ((0. E Tabor, J. G Vocldey. , V.M. chP.E A.E. R y Burk9 d Id'ER.W olo Mdd )1Unl R. M. Kem B. K Goodman P. W. Wmn, W. W. Grody. and S.D. Caderban th CX Seattbe, %WIbIAOi UCLA School of Medcin Los Angsles California. Insttuts, P CA, Siai aof Medi , New York, NY.

Six paties whnuobromatoestype 1 (NFl), mildy dmorpc f The hydrolys of argn to ornithina and urea s catalyzad by arginase in the lea tures, and ments reardaion or nn disabiy were screened for deion ap of the uresa cycle Arnse deficiency in humans results in hype of the NF1 gene. ls of NF1 copy nur ber, NF1 htagenic pol- which is clinicl by tha eevation of plasma a pisodas of piTls, somIo ceil hybrI _rammonem lpaagroth ndpsrdastivtmanndlknpelrrntain d de ton > 700 A a The a e ien is 11.5kb in length, dided into eight ns.in aend iocated on 4 were deleted in patnt, he 350 kb NF1 and the chromosome We examined a of deficient embedded in the NF1 ecoropc viral on 2A and 6q23. group arginase peatnts by PCR- 2Band the myl glycoprot. Two de noo de SSCP analysis to c C the molecular bas of this disorder. We found two in poa allele. In ad 5 no unrelated AshkWnz Jewish pants which have the same mutation in won four Nge detected inthe NF1 alle which appsared to retng in the bsin of gline for asprtic acid at poslon 128 This apac be exp d norma as d ined by RNPCR. A co rr of pheno acid lies in a regi higy consved across species indicating that it may be revealed (1 each deletion had a large number Of fctionally significant to enzym activ.i. The parents of thm two affected fibrm relative totheir age, (2) each deletion avar- inddui ware sequenced to damonatrat the inheritanca of this adsl. Patient ble numT beof features O Noonen insuffi- MK althou is at ths ics a mutant ele from each cint the Noonan Syndroe, no significant homozygous receiving Parent Patient B.R. pdk ur p wiF pd v m W~~~~~~~dleton is heterozygous. inheriting one mutant able from his mother. His other mutation has d tis se nt ot chrsom 17, nd 4) e one pant wIthout a deletion not yet been identified Also identified was a nonsense mutation in two affected w the ony documetd i NF his menS tdation and siblings of Hispanic descent resulting in a translational stop at amino aid position dysmorphic Features were not observed in other affected family ember. 122. This mutation has been previously idefid in a Japanm patiert. A mutation rxthese results, wee thatsoi NFl, dysmor- resulting in the substitution of laucine for histidine at position 141 was identified in shirm, and Intellectual El 1my morke hae deletions of the another Hisparic patier. This histidine is in the same oserved regon as the that an NF mutation on of an eaqcent may predispose to numerous r nd/or certain dysmor- aP acid 128 mutation, suggesting that the coseron f amino acide in this region is critical to the funcion of the protein. Of tan mutant dale reported. ight cause prematur chain teiniand twnoca am cidau .

1236 1237 Genetic sapbilityto the Parkinson's disease. ((Y. Tanakal, N. Molecular predictors of wolvemet in fragile X female. ((A.K. Taylor"3, J.F. Murayamal, K. Tuotol, Y. Mizuno2, A. Sanol and I. Kondol.)) Safanda', M.Z. Fall', C. Ouince', K.A. Lang', C.E. Hul12, I. Carpenter2, L.W. Staley2 and R.J. 1Ehime and 2Juntendo Univ. School of Medicine, lEhime and Thtkyo, Hagerman".)) 'UCHSC DNA Diagnostic Laboratory, University of Colorado HSC, Denver, CO; 1The Children's Hospital, Denver, CO; 3Department of Japan. Pediatrics, University of Colorado HSC, Denver, CO. Parkinson's disease (PD) is a result ofenvironmental factors acting on geneticaly susceptible individuals with normal aging. Endoous and Wide variation is exhibited in the degree of phenotypic invo of fragile X carrier females. We exogenous the ozias A studied the relative influence of FMR-1 CGG repeat number, by (MAOA) percent methylation of the mutant alle. end X inactivation status or B (MAOB) and CYo P450 are neurotozic to dopaanergic on both the neons. Theop r (DAT) is a pump which taikes up cognitive and physical affectedness of 48 fragile X heterozygotes. A Southrn released dopammne back into p tic terminals. We istiated the blot aoprosch was utilized to simultaneously asess FMR-1 mutation size and the methylation status of the normal genetic variations ofthese eymes and DAT in patients with PD to and mutant alIles. Signal intensity was identify the possible relations to PD. quantitated by phosphorimaging. Regressionanalysis revealed asignificant inverse The geotypes ofMAOA consisted of a GTmicrosatellite correlation between 10 and both CGG repeat number and percent methylation of directly the adjacent to an duplicated 23-bp VNTR motif were determined using PCR mutant allele for the carrier group as a whole but not within the promutation products. e ditibution of four genotpes in MAOA was not different or full mutation subgroups. These two molecular parameters articulate the in patients with PD and healthy controls. The distribution of numbers of difference between premutations and ful mutations, but do not contribute towards the ph c variation seen within the full mutation carrier In a 40-bp repeitive element inthe DAT was also the same inboth group. contrast to reports by other researchers, we found no correlation between l0 and the populations. However, the distribution ofgenotpes of e P450 proportion of normal (non-mutant) alles carried on debrsoquine (CYP2D6) in patients with PD was sgificantly different the active X chromosome (normal active X"). We conclude that the proportion of normal from that in normal control. Patients with PD had a tendency to have active X cannot functionallydefective types ofCYP2D6. Thesm data that the be used to predict degree of involvement in carrier females. We did find evidence suggest for age dependent selection of cals carrying CYP2D6 is one of the genetic factors making humans susceptible to PD the normal active X in full mutation acquisition. females. Finally, comparisons of leukocytes and saliva-bome pithedial cells revealed striking differences not only in the heterogeneous pattern of full mutation bends, but also in mutation type. In one individual, premutation/full mutation mosaicism was found in saliva but only a full mutation was present in blood. This finding underacores the importence of bearing tissue differences in mind when correlating molecular and clinical parameters of fragile X syndrome.

1238 1239 Poster Symposium-Session 41 Myotonic Dystrophy in an affected family member inheriting affected parents A closer look into the relationship between the degree of allelc expansion normal chromosome. (H.P. Taylor, C.J. Schwartzbach, J.R. Gilbert, P.H. of the CTG repeat end the severity of myotonic dystrophy. ((MC Thlbault, J Koza-Taylor, MC. Spear, J.M. Stajich, R. Krahe, M.J.Siciliano, and AD. Mathieu, L P1russe, R Komeluk, C Laberge)) Centre Hospitalier de Roses,) Duke UnIversity, North Carolina and University of Texas, Texas. l'Universite Laval, Qu6bec, Hopital de Chicoutimi, Oubec and Children's Hospital of Eastem Ontario, Ottawa, Canada Myotonic dystrophy (DM) is characterized by a specific unstable CTG nucleotide triplet (p(CTG)nJ repeat at the 3' end of the myotonic protein We analysed more closel the relationship between the of kInase gene. The prevailing opinion is that the size of the p(CTG)n degree repeat expansion of the CTG repeat and the clinical severity of DM In a cohort of approximately correlates with clinical symptoms of DM and there are 287 French Indications that the number (n) of p(CTG)n repeats and severity of the Canadian patients from Eastem Quebec, Canada (Saguenay- disease can both increase through subsequent generations. Normal Lac-St-Jean). Non-congenital end non-Infantile cases were graded for their persons will have a p(CTG)n repeat between 5 and 40 and persons suffering muscle disability state (Mathieu et al, Neurology, 1992). The relationshlp from this autosomal dominant diseme will have from 50 to several thousand was also made using congenital, infantile, early adult, adult and mild repeats. In the course of screening DM families we discovered a 29 year old categories (Koch et al, Am J Hum Genet, 1991). Total genomic DNA war female DM patient who comes from a well characterized DM family who has digested with EcoRI and probed with a 2.2 kb BamHl/EcoRI subolone of a normal sized repeat, p(CTG)5, on both alleles. Neurological examination pGB2.6 which maps to the 10 kb EcoRI fragment containing the variable confirmed the phenotypic expression of DM in this patient who has been length polymorphism (Mahadevan et al, Science, 1992). The expansion followed for 22 years. Based on the with 16 markers In the 19q13.3 results was correlated with neuromuscular severity (r 0.61, 72: 139, p < 0.001). region of chromosome 19 we deduced that she had inherited the normal Although patients with highest expansions were mere severely affected, chromosome from her affected father whose affected chromosome had a considerable variation repeat Combined use in phenotypes (ranging from 0 to high muscular p(CTG),.m expansion. of Southem blot analysis of were however for the patients' genomic DNA and of PCR amplified products failed to detect disability) observed subjects with lower ranges of any enlargement of her p(CTG)S repeat in blood and fibroblast DNA. FISH expansion. Koch's categories were also correlated with the degree of analysis indicated that she was diploid for the locus and there is no expansion (r: 0.58, z2: 205, p < 0.001) but early adult and adult cases were evidence that the normal allele has been converted or deleted. This distributed In all expansion categories. The age of onset was inversely observation of a p(CTG)s repeat on each chromosome with the failure of related to the degree of expansion (r: -0.21, p < 0.05). No relationship was concomitant phenotypic loss of DM is an unique example of an exception to observed between CTG expansion and lens changes or speed of the rule that the presence and expansion of the repeat Is connected to progression of the disem. This Indicates that predictions of DM severity disease severity and anticipation. The nature of the DM mutation In this based on CTG expansion status should be made with caution. patient is being Investigated. Molecular Applications in Clinical Genetics (continued) 1240 1241 Poster Symposium - Session 41 Antisense-oniented gene transfection decreases glutathione reductase activity Fragile XfuIl mutation intwo dintically unaffected brothers. ((WTorres, ASahota, in Chinese Hamster Ovary (CHO) cells and increases their sensitivity to oxidant S Boyac4lev, (3 H Vance and D D Weaver.)) Irdilana Univ. Sch. Med., iniury. ((H. Tonold, H. McMiclken, F. D. Ledley, C. V. Smith and T.N. Hansen.)) Idanols Dept. of Pediatrics and Cell Biology, Baylor College of Medicine. Houston, TX. The fragile X syndrome is caused by exansion of the CGG tr3MipeIn the 5' Glutathione reductase (GR) protects cells from oxidant injury by catalyzng the region of the FMR-1 gene and methdyato of the associated CpG Isand. This reduction of glutathione disulfide (GSSG) to glutathione (GSH). Inhibition of GR two stage process can be detected by double digestion of ON4wlth Ecoffiand by BCNUJ has been used to study the antioxidant role of GR but BCNU may Eagl, and hyridlization with probe StB12& The genetic changes appear to injure cells by mechanisms in addition to GR inhibition. The purpose of our creaewiththe phntp, and DNAtesting is nowwidely usedforcolrnn experiments was to create a OR-deficient cell line by transfecting cells with clinical dianois dtrinkig carrierstatus and nmadng prenatal diagnosis. W antisense GR cDNA and to use these cells to study the role of GR in protection report a family in which two of the maternal uncles of the proband had full from oxidant injury. We constructed an expression vector with a full length fraile X mutation (>200 CGG repeats) by direct DN4 analysis but were human GR CDNA downstream and antisense to the human metallothioneln Ila clnically normal. The proband was an affiected male with fuN expansion, promnotor. We co-transfected this vector with a neomycin resistance gene into methyiaton of the FMR-1 gene and upon chrooo alranlysis; had 5% fragile CHO cells to obtain stable cell lines. One clone (GI17) had decreased cellular X poisitive calls. The mother and the maternal gra~ndother both carried the and mitochondrial GR activities (cellular~8.3±0.3 in G17 vs 16.9±1.6 in control; premutation, with approximately 80 and 1300CGG repeats, respectively. The mitochondria: 1.81±0.19 in (317 vs 3.94±0.76 in control - all activities are maternal granidfatheor, aunt, and another uncle had CGG repeats in the normal mU/mg protein; mean±SD). By Southern analysis the antisense cDNA was range. The DNA studies were repeated on second samples and identical integrated in the genomnic DNA. Baseline (3SS0 concentrations were higher in results were obtained. Hybridization bands in the DNAs were more dffuss (317 cells than in controls (0.92±0.19 vs 0.22±0.16 urnolmg protein) while GSH than those from the proband. These unfetdmales have a fuN mutation concentrations were not different from controls. Treatment of 017 and control pattern with expansion of the CGO repeats andmetylalo of the FMR-1 gene. cells with increasing doses (0.5 to 10 mM) of t-butyl hydroperoxide (TOOH) This osrainsuggests that there Is exrsinof the FMR-1 gene in these increased cellular GSSG concentrations and decreased GSH concentrations. ndWduais. It may be possible that there Is selection against abnormal CGG Concentrations of GSH were lower in (317 cells than in controls at all doses of triplet repeats, differences in CGG expansion and or methi tion diferece In TOOH while concentrations of GSSG were higher. A 4 h exposure to 10 mM specific tissues. Characterization of FMR-1 transcripts in lymphoctes by TOOH caused more LDH release in GI17 cells than in controls (50% vs 15 %). RT7PCRIs In progress. We conclude that partial OR deficiency impairs the ability of (317 celia to reduce GSSG resulting in loss of GSH and increased the sensitivity to injury by TOOH.

1242 1243 Albrights Hereditary Osteodystrophy- evidence for imprinting and parental NELAR A LYSIS OF 40 DUA REARRANGENENTS IN SPORADIC AND FANILIAL origin for Gsa gene mutation. ((RC Trembath.' L Wilson.," M Oude- CASE OF FACIOSCAPIR. ULNISCULAR IXSRPW(FSPD) Luttikhuis and J Leonard2)) Depts of Genetics and Medicine, University of C(14 Up~dhyaya , P1 ard net , 2 Majad.3FrhmMSraai,R of 2 UK. Frants', PS Harperl, P Lunt2. Inst Medical Heath Park, Leicester lan Instutute Child Health, London, England, Cardiff, UK. Inst Child Health, Bristol, UK.Geneiics,University of ischaracterised the Dp ua eeis Aibrights Hereditary Osteodystrophy (AHO) by presence LieLonecidenuniversity,nvriy LendenFrigo.UAedn of short stature, subcutaneous and basal calcification and shortening of the 4th and 5th metacarpels. Individuals with additional evidence of resistance Facioscapulohumeral muscular dystrophy (FSHD) is a neuromuscular at G-protein hormone receptor coupled end organs have progressive disorder following an autosomal dominant pattern of pseudohypoparathroidism (PHP-1) and those without hormone resistance inheritance with an estimated prevalence of 4-5/100,000. Approximately Mutations lOS affected individual s represent new mutations. The gene for FSHD havhaetepseudo-pseudohypoparathyroidism (PPHP) phenotype. been mapped to 4q35. The molecular defect underlying this disease theGs ofeeoth Gsageneonhoooe2q13hvcromoome 0q1 hav beeenietfeidetifid inbothPHPIisnbt H-1hasnot known. Analysis of FSHD in sporadic and familial cases with, and PPHP and both disorders have frequently been observed in the same a new DNA marker p13E-11 defined by locus D4S81O revealed that the pedigree. The discordance between genotype and phenotype remains disease was associated with the presence of a smaller EcoRI fragment unexplained with important. implications for genetic counselling. C 28kb in FSHD; 28-50kb in normal). We have analysed 45 FSHD families We have identified 34 AHO patients of which 16 are familial, exclusive and a further 17 sporadic FSHD cases with the probe pl3E-11. We find 29% (23/80) patients had a minimum size fragment larger maternal transmission of PHP-1 was sean in B cases, in accord with a 28kb. OurFSHDresults confirm that probe p13E-11EcoR!detects a de novo recetrecetreiewrvie off revousyprviouly pulisedpblised ase.ases ThseTheeobervaionspromtedDMAbsevatins romtedthan rearrangement in 16 of the 17 new mutation cases and ITs--M speculation on the role of imprinting in AHO. Furthermore, the mouse closest marker to FSHD (0-0.02, Z-36.49). No obvious genotype homolog GNAS is located within an imprinted region on chromosome 2. phenotype relationship was observed in isolated FSHD cases. Of the Molecular analysis using DGGE has identified an exon 5 mutation in a four recombinants detected, two were in clinically affected arose de novo on the allele, individuals. The findings based on multiply informative meioses and patient with apparent PPHP, which paternal mapping indicate that FSHD locus maps distal to D4S810. Ad Addiionllya4Opdaatindeleto wthiexo4 wadtceiaaoihmultipointwit Our data clearly suggest that the presence of an EcoRI restriction aditonlyca40bpAHO nd ypoalcamia al preiouwreithin axponrwsreort beigdetngecthedethe basinas chngemhalges orfragment in the 14-28kb size range is not a definitive indication of a small 4bp deletion. Further analysis of this characterised cohort will FSHD. Prior to the identification of FSHD gene, we would advocate, for provide data to determine the role of genomic imprinting of the Gsa gene diagnosis this probe should be used in association with at least one in man in determining disease. other closely linked marker.

1244 1245 Poster Symposium-Session 41 Mutatiens in the LICAM pine are responsible for X-limked Hydrocephialus A normal trnmtigmale shows a mosaic FMR)-pattern with COG-repeat aad MASA syndroe.m 0. Van Camp, L Vits, P. Coucke, and PJ. Willems. insertions of 450-950 basepairs andi an unmethylatd. CpG islamd. Department of Medical Genetics, University of Antwerp, Belgium. ((A.H. van der Hout', P. van der V~ies', J. Tuertings', E. Sikktens', B.A. Oostra, H. Scheffer', C.H.C.M. Buys'.)) 'Deatetof Medical Genetics, University of X-linked hydrocephalus with stenosis of the aqueduct of Sylvius (HSAS, Groningen. 'Department of Human Genetics, University of Nijmegen, McKusick 307000) is the most common genetic form of hydrocephalus. The 'Department of Cell Biology andI Genetics, Erasmus University of Routndam, HSAS gene was first localized by us in a 2 Mb interval between DXS52 and The Netherlands. (Inro, by: Prof. Dr L.P. ten Kate) F8C in Xq28 by linkage analysis. MASA syndome is a recessive X-linked disorder, also mapping to Xq27-q28 and characterized by mental retardation, In a large fragile X pedigree from the.Netherlands we came upon a man with a adducted thumbs, shuffling gait, aphasia and in some cases hydrocephalus. As somatic mosaicism of FMRI-alleles with (COG), repeat insertions in the range of the clinical spectrum of MASA syndrome overlaps with that of X-linked 450-950 basepairs and a normal itlgec.It is stated in the literatur that males hydrocephalus, and as both diiseases have been mapped to Xq28, it has been with repeat insertions longer than 600 bspisalmost invariably show clinical suggested that MASA syndrome and HSAS are allelic disorders. A mutation expression of the fragile X syndrome. Three brothers of this individual are in the neural cell adhesion molecule LICAM, located in Xq28, was recently mentally retarded and show insertions of >1000 basepairs. The mother shows one described in a family with X-linked hydrocephalus (Nature Genet 2:107-112, normal and one premutation FMRI-allele with an insertion of aroximately 200 1992). However, as the LICAM mutation could only be identified in one basepairs. It appeared that in this individual the CpG island adjacent to FAR] is HSAS family, it remained unclear whether or not LUCAM was the gene unmethylated. This may account for his normal mental status. Moreover, it is responsible for HSAS. In this study we conducted a mutation analysis of clear that, at least in this case, methylation of the CpG island does not proceed LICAM in 25 HSAS families and in 8 MASA families. In none of these extension of the (CGG), repeat. families was the previously reported mutation found. In one HSAS family, however, a 13 kb genomic duplication of the 3'-end of the LICAM gene was identified, cosegregating with HSAS and significantly changing the intracellular domain of the LUCAM protein. In one MASA family, a deletion has been found, segregating completely with the disease and deleting more than 600 bp of the open reading frame of the LICAM gene at the 3'-end, leading to truncated LICAM protein. LICAM, therefore, harbours both mutations leading to MASA syndrome and to HSAS, and might be frequently implicated in X-linked mental retardation with or without hydrocephalus. Molecular Applications in Clinical Genetics (continued) 1246 1247 Poster Symposium - Session 41 CFTR mutations in men with impaired sperm function (ISF) and azoospermia Analysis of the expanding CAG-repeat In the Dutch Huntington's disease without congential absence of the vas deferens (CBAVD). ((K. van der Ven', A. patisnt population. ((K.E. de Rooij', M. Losekoot'2, P.A.M. de Koning Rahman', H. van der Ven', S. Heilman', R.S. Jeyendran2, C. Ober'.)) University of Gans', R.D.M. Belfroid2, M.J.R. van der Wlelen2, M.I. Skraastad , M. Chicago, IL,, ALS Inc. and Northwestern University, IL2. Vegter-van der Vhis2, R.A.C. Roos`, E. Bakker' ', J.T. den Dunnen' and G.J.B. van Ommen'.)) 'Department of Human Genetics, 2Clinical Genetic Cystic fibrosis (CF) in males is associated with infertility due to CBAVD. Recently, Center, and 3Department of Neurology, Leiden University, The Netherlands. mutations in the CFTR gene have been reported in men with CBAVD but without clinical CF, raising the possibility that the CFTR protein may have primary effects After a search period of 10 years the Huntington's disease (HD) gene has We been Identified. The molecular defect was traced down to expansion of a on the development of the epididymis and on the maturation of sperm. basis for hypothesized that mutations in this gene are associated with male infertility due to CAG-trinuclsotide repeat. Further research questions Include the with the variable age of onset and duration of illness, the preferential association causes other than CBAVD. Semen samples were collected from 20 men differential onset of azoospermia and from 25 men with ISF. All subjects had undergone extensive between paternal transmission and juvenile onset, the clinical neuropsychiatric and motoric symptoms, and the specific deterioration of infertility evaluation that excluded CBAVD; none of the subjects had the wide manifestations of CF. DNA was extracted from sperm and/or seminal plasma caudate and putamen, which is in apparent contradiction with in the expression of the gene. To correlate repeat length with clinical history and leukocytes and epithelial cells. DNA was screened for five mutations CFTR in the gene (AF508, G551D, G553X, RI17H, 3849+10kbC-T). Three mutations were parental gender, we have set up the PCR analysis of the CAG-repeat 9 mutations DNA of all available HD patients in the Dutch population. A total of 184 detected in 2 of 20 subjects with azoospermia (7.5% of chromosomes); All have one normal allele were in 8 of 25 subjects with ISF (18% of chromosomes). Two compound patients from 85 families have been tested. detected ranging from 12-30 CAG-repeat units and one expanded allele ranging from heterozygotes were detected (AF508/G551 D in ISF group; Ri 1 7H/G551 D in onset and paternal azoospermic group). Of the 9 mutations in ISF subjects, eight were associated with 39-65 CAG-repeat units. Two patients with a juvenile These transmission of the disease show a more dramatic Increase In repeat asthenozoospermiaand one was associated with isolated teratozoospermia. 79 and 82 CAG-repeat units. Further studies into the disease data suggest that the CFTR gene is involved in normal sperm development. number, i.e. mutations may result in male infertility of different clinical mechanism require amongst others the assessment of repeat expansion in Furthermore, CFTR different areas of the brain. We have a large collection of autopsy material, manifestations and are not limited to males with CBAVD. Mutation studies are fixed brain specimens of currently underway in DNA derived from peripheral lymphocytes in these subjects encompassing 28 frozen and 140 formalin HD are restricted to tissues or present in patients, of most of which extensive clinical and neuropsychiatric data to determine whether the mutations germ-line have been recorded. The PCR assay has been adapted to analyse the brain somatic cells as well. material. Details of the procedure will be presented, together with the first results of expansion determination and evaluation of somatic mosaicism.

1248 1249 Reexamining an unusual Uuntimgton disease fsally demoastrates Targoeed isuption of Xt mous aenosire deaminae (ADA) gene in embryonic sem cells. that some affected Ladividuals do not inherit the genamic segment ((M. Welarmyal, S. Vashnav2, A. Bradleyi2 and C. T. Casiyl2.)) lrInetit for Molecular contain the 3D-spcific trisuclootide expassios from the Genetics and 2Howd Hughes Medical Institute, Baylor Coll of dicn, Housto, affected pareat. ((T. Vo, K. OutrLdge, S. Withers and L. Texas. Carlock.)) Wayne State Univ., Detroit, MI. deaminm (ADA) deficency, a rue autmmal rcwive dsor, is an ideal Three families have been described in the literature that canidaefogeneAdrnoime replacement therap. Ahoh ivfe experiments uing animal models contain affected offspring which fail to inherit 4pl.3 genetic are esential for g therapy sudie there is no ADA-d nt animal availabl. markers from the affected parental chromosome. An extensive study However, the rapid deveicpment of gene targeting technology in recnt yan offers a has recently been performed on one of these families (Fally 217) method inan (Am. J. Hum. Genet. V50, ppl218-1230, 19921. In this family, one tdehipetoowtmicedefldetmnspecflcginas Wehavbeen uingthis child (SI-3) inherited the HD chromosome from the affected parent attImD tocretADA4dflcient mice. and was affected. Two siblings (11-1 and 11-2) did not inherit Correcy tgeed embryc stem (ES) cf were not obtained from epiments using any 4pl6.3 markers from the HD chromosome but were clinically a tgi vector made from nonogi DNA. Therefore, a 129Sv mouse genomi library affected. The remaining sibling (11-4), which displayed early HD was curned to obtain isogeneic DNA. An 8.6 kb genomicfragmentwas isolated and used symptoms, was a putative double-recombinant with little 4p16. 3 to construct a new r etp t ing vector. The vector contains 8.6 kb of the 3D-speclflc DNA. We have continued to examine family 217 using a mouse ADA gene (xo 2-6), a ncIfnycin resfor gene inexon Sas a posit sectOn series of new genetlc markers extending from D48180 to D4810 and marker, end to HesSimplex Virus fhLookeMe genesas negatve selection have confirmed that the 3 disputed siblings do not contain any madks, After hemologous recOini, th results in an insertional muaon in axon5 of alleles from the parental HD &ernt. We mapped the 4pl6.3 the ADA gene. The vector wee introduced into ES calls, ABI, by sect oi and the prozimal recombination junction in individual 11-4 to a l0kb celis were selected forG418 and FAU rsistance. About 1,100 coliwer picked,lo *egent within the D4W10 locus between the D4510 VETR and pTV20. which onsthird were analyzed bySouther analysis. Ten percent ofthe resistant colonies Surprisingly, examining the genaoLc organization proximal to the poved obetargted coret*. Twelve done have been epanded and used to gerate ITIS trinucleotlde repeat established that II-1, 11-2 and 1I-4 nineteen chimeric mice. The chimerism of thm mice vares from 10% o 90%. The chimeras did not contain the IT15 expansion identified in 11-3, who had are to t line contuton of ES celis. clearly inherited the HD chromosome from the affected parent. We nowbeing bred assess germ are examining the genomic region encompassing the HD mutation to determine whether a second mutation exists in the disputed siblings or whether these individuals represent a clinical bias for identifying 3D-lLke symptoms in this family.

1250 1251 Fibnllin analysis In the Marfan syndrome: idet n of new mutations and Use of antisense oligonucleotides directed at mRNA and genomic DNA to polymorphisms. ((M. Wang, C. E. Price. and M. Godfrey.)) University of selectively suppress production of the mutant a2(l) chain in Osteogenesis Nebraska Medical Center. Omaha, NE. imperfecta type IV fibroblasts.((Q. Wang and J.C. Marini)) Human Genetics Branch, NICHD, Bethesda, Md. The Marfan syndrome (MFS) Is an autosomal dominant connective tissue disorder affecting the cardiovascular, skeletal, and ocular systems. Defects in To examine the effectiveness of antisense suppression as an approach for fibuillin have been shown to be the cause of MFS. We use denaturing gradient therapeutic Intervention In osteogenesis imperfects, we utilized the fibroblasts gel eectrophores (DGGE) and single-strand conformational polymorphism from a case of type IV 01. These cells synthesize both normal o2(l) chain and (SSCP) analyses to det mutations in fibroblast derived cDNAs from MFS a shortened a2(1) chain In which the residues encoded by axon 16 are deleted patients. The molecular harcterizatIon of the fibrilln alieles In some 70 MFS due to a splice site mutation. We utilized antisense, sense and missense thio- patients has thus far Identified abnomaWly migrating bands in eight people. oligos directed at the mutant exon 15/17 junction and antisense, sense and Sequence anayss of these regions have been performed in three patients. missensa thio-oligos directed at the genomic point mutation. Transfection with One of the point mutations we have Identified is a C-Ttranstifon at position lipofectamine was more effective than transfection with lipofectin or no lipid. 165 of the flbrllin cDNA resulting in an arginine to byptophan subston. The amount of mutant protein present in culture was quantitated by Interestingly, hat region of the molecule is not homolgou to eier the EGF densitometry of the fast migrating form of a2(1) CB 4 peptide in ('H)-proline- or TGFB1 binding protin motfs that are found in fbrillin. Unfortunately, the In collagens harvested 8 or 24 hrs after transfection, the parents of this sporadic case are unavailable, so we are currently using labelled collagen. population and molecular modeling techniues to distinguish between a mna following suppression pattern was seen: &s mutation and a neutral polymorphism. In another sporadic case, we have AS S MS GAS GS GMS documented aT-Atrnvrin at positin 6692 This change resuits insa non 8 Hrs 67 107 82 82 98 99 (% of untreated control) conservative substituton of a hdph lucine for a basic hiidine in an 24 Hrs 51 92 76 64 59 100 (% of untreated control) EGF-lke domain and is kely to affect the stability of the disuMde bridg. When the cells were treated with antisensa oligo to mRNA and collagen was Parental genomic DNA is currently being analyzed. A third base position labelled only for the 6 hrs prior to harvest, equal suppression (45-50%) was neutral polymorphism was identified at posmon 3225. This T-+C transition found In the 12-18 and 18-24 hr intervals post transfection. maintains the coding for alanine in an EGF-ike motif. Since this substitution Densitometry of Northern slot blots using 1-8 ug of total RNA from thlo-oligo does not change the restriction pattem, the informativeness of this treated cells probed for mutant and normal a2(l) mRNA showed approximately polymorphism is dependent on DGGE analysis and allele specific equal normal and mutant mRNA at 8 hrs post transfection. At 24 hrs post oligonultde hybzain. transfection, AS and GAS showed equivalent (45-50%) decrease of mutant mRNA but GAS was most specific, with minimal decrease of normal mRNA. Molecular Applications in Clinical Genetics (continued) 1252 1253 A point mutation In one allele of the type II procollagen gone Bloom syndrome and maternal uniparental disomy for chromosome 15. produces a Gly97C -. Ser substitution of the gene In a family ((T. Woodagel, M. Prasad', J.W. Dixon2, R.E. Selby3, D.R. Romain2, L.M. with severe degenerative arthropathy of the hips associated Columbano-Green', D. Graham', P. Rogan4, A. Smith' and R.J. Trent'.)) with probable epiphyseal dyspilasla. ((C.J. Williams1, S. McCarronl, 'Department of Molecular Genetics, Royal Prince Alfred Hospital, E. Considlne1, D. McLan2, W. Murphy3, A. Gangulyl, M. Rock' and D.J. Camperdown, 'Regional Genetics Service, Wellington Hospital, Prockop1.)) IDept. of Biochemistry & Molecular Biology, Thomas Jefferson 3Department of Paediatrics, Wellington Hospital, Wellington, New University, Phila., PA 19107; 2Birmingham Rheumatology, Birmingham, AL Zealand, 4Department of Pediatrics, Division of Genetics, The Milton S. 35209; and 3Mallinckrodt Institute of Radiology, Washington University Hershey Medical Center, Hershey, PA, USA and "Cytogenetics Medical Center, St. Louis, MO 63110. Laboratory, The Children's Hospital, Camperdown, NSW, Australia. Direct sequencing of PCR-amplified genomic DNA from a patient with severe, bilateral osteoarthritis of the hips and probable epiphyseal Bloom syndrome (BS) is a rare autosomal recessive disorder dysplasla revealed a single base change in exon 48 of the type 11 characterized by proportional dwarfism, skin rash, a dysmorphic facies, procoilagen gene (COL2A1) which produces a Gly -+ Ser mutation in one severe immunodeficiency and an increased incidence of various allele of the gene. Antisense sequencing, heteroduplex analysis, and restriction digestion of the patient's DNA confirmed the mutation. The malignancies. A markedly raised frequency of sister chromatid exchange proband is a member of an Alabama kindred presenting with early-onset. (SCE) is pathognomonic of BS. Linkage analysis and monochromosomal severe degenerative changes of the hips. His daughter, who presented hybrid complementation studies have shown that the BS locus is on with hip pain at the age of 19, also has the mutation, as do all other affected chromosome 15q. A three year old male with elevated SCE and clinical family members tested. The mutation was absent in 108 unrelated features of both BS and Prader-Willi syndrome (PWS) was found to have individuals. Radiologlcal evaluation of the proband's hips revealed severe maternal uniparental disomy for chromosome 15. Assessment with bilateral cartilage loss, sclerosis and subarticular bone erosion. The polymorphic DNA markers has shown that the subject is heterozygous mutation which resides in the triple helical region of type 11 procollagen at for maternal alleles at markers on proximal 1 Sq and homozygous at distal amino acid position 976, is very close to a Gly976 .- Ser mutation in exon 1 5q loci. Crossover between the regions of heterozygosity and 48 previously reported in a proband with spondyloepiphyseal dysplasia homozygosity has been mapped to the interval between Dl5S95 and congenita (Chan and Cole, JBC 266:12487, 1991). However, in the family D1 5S87. Unlike PWS, BS is probably not due to genetic imprinting, but in reported here, severe arthropathy of the hips was the major clinical this case has occurred due to homozygosity for a recessive allele manifestation of the disease. inherited from a carrier mother. Studies are in progress to refine the Supported in part by grants from N.i.H. (39740), the Lucille P. Markey region of isodisomy, allowing a more precise localization of the BS locus. Charitable Trust, and the March of Dines/Birth Defects Foundation.

1254 1255 Simultanu deteton of two mutions on the cysc fibrosis gene from Isolation ofcandidate genes for X-linked retinal diseases. ((D. Yan, IH Pawr, singile blatMeres of prelmplanttio embryos un poymra chain S. Staum, T. Yang-Feng', and A. Swaroop.)). Dept. Oplnolog & reaction. ((Y.X. Tan, K.P. Xu, J. Cohen, Z. R was nd JA Gfo.)) Human Geneics. University of Michiga, Am Arbor, MI; Dept. Geneticsl, ObA3yn, Comell Unives Meical College, New York, NY. Yale University, New Haven, CT. Succssful detection c a mutation on the cystic fibrosis (CF) gen WMF50) We ar deveoping two strategies for isolating X-chromosoie encoded hI preimplantatn embryos usng polynmease chsin reactn (PCR) has ben retinal cDNAs that may serve as candidae genea for X-linked retinal diseaes. eported (Hand e at al., 192, N. Engl. J. Med. 327, 905). There is no (0) The subtacton-selection method utilizes a poMrase chain reaction avalabbe method hI mlantat genelc diagnosis for detecting W1282X (PCR) - based procedure to generate probe from inserts ofa utracted retinal in singie coL In addon, due to the high fequency of thm mutions cDNA library for screening a sorted human genomic X-chromosome library could be coules who ae mbixd carriers one with UF508 and th ohr with (e.g., LAOXNLO1). A least 15 indepan X-genc clons that hybridize W1282X. We have deds ed a protoo for skim y to subtracted retinal cDNA probe have been isolated. Of these, thirteen W1282X, and iF50, with a nesd PCR stategy. Arredsedeavagestg contain (CA), micosatellite repeat Four clones, 31A, S3X67, DY2 and e y were obtained from the Comel iVF Centr (Potoco 0890-985). DY3, ae sublclized by f c il si hybri d in (F to Xpll.4- Singl blastomeres with nuclei wer bolded and used as templete for the p21.1, the region of X-ined Retinitis P (XLRP) Wi. S1X31, that tudy. The first anempi-icato incuded both pairs of the primers forAF508 and map at Xp22.1-22.2, encodes a potential candidate gne for Retnoachisis or was spar y for Ocular Albinism 1. The corepning cDNAa ae now being identified for W1282. The second set d PCR carded otd each locus. several of these genomic clones. Mio-osatl (CA),, repeats from three X- PCR cycles nd p e w i l eo both reacons could be novel performed in a g tm ir. Sic the W1282X muation destroys a genonic cones are being characterized. (d) A second approach of restrion s (Lr 1), an enzyme digestion followed. Analyz 15 cDNA selection is based on: a) the hybridizon of single-stranded (a) blatIme ftrom 8 embryos showed ta thy all produced two bands with circular cDNAs to the corrspnd genomic RNAa through a sandwich of a preded dsizes, whereas DNA from a carder ehowed 3 bands and DNA rom biotin-labeled SV40 RNA tail; and b) the retention of approprte cDNAs on a hx got W1282X yIelded onya ingl band. The relta indicatX an avidin matix, and their subsequent recovery with ribouceas A. This a mutipiex-nestad protoco can be applled for clinical trale evaluating both biori-flinity method has been used for the selection of a specific cDNA in a mutatons sI Amultaneouly in single cells from eMbryOeL model xpeiment. The isoltion of cDNAs using a X-chromosom specific genomic library and YACs s the XLRP region is in progres

1256 1257 Poster Symposium- Session 40 Homezygosity for a missense mutation (020R) in a corved area of Screening for Mutations by Enzyme Cleavage of Mismatch using adenoelne deaminase (ADA) m i wh neonatal onset ADA deficient T4 Edonuclease Vll.((+R. Youil, §B.W. Kemper and Sevee Co ed __m dflcny (ADA SCID) E(D.R. Yang, M.L.Huie, R. +R.G.H.Cotton.)) +The Murdoch Institute, Melbourne, Hiohhom.)) NYU Medical Center, New York, New York. AUSTRALIA. ++lnstitute for Genetics of the University of Cologne, Mutatn at the adenoeDne deamlnase loeus can result in varying degrees Kodn, GERMANY. of hnunoe , Including rapidly fulidnant Severe Combined Two examples from each o 4 possible sets (G.A/C.T, C.C/G.G. modeHf y ISCID) as welles a dowly progress Inun flenc A.A/T.T and C.A/G.T) of the 8 possible single ba pair not dagnomeuntl laterin chlldhood. Gentic is fa intie mismatches that can occur after heteroduplex formation between cal e it. We have now Identified, by direct seu nc of PCR normal and mutant DNA was examined for cleavage by use of the "amplflid genomic DNA, a 0 to A transition at Cp din epred iting uciform resl enzyme - T4 Endonuclease V1i. Two deletio a g*ynetoague sustio *atcodon 20(20) tht, in mogosiy mutants were also included In this study. was aoc d with neonatal onset rapidly fatal SCID. C tnt with The various PCR-derlved products used in the Tormaon Of homozygosity, the ehild derived from a a isolated Inbred communy hetroduplexss ranged from 130 bp to 1.377 kbp. At least one Newfoundland.Wedemo that the 020R mutation s dle us mismatch in each set was cleaved alklwing possible mutation since tdu of th mutation hu a normal ADA minige abolished detection In each case. Chemical Cleavage of Mismatch (CCM) enzyme activity, as min by transient eessIon In monkey kIdney was performed on all the samples tested and the cleavage (Cos) cells. The ano sod on occurs In an area of the molecule products compared with those derived by Enzyme Cleavage of cnseed from E cell to ma and ta, s shown by rystallographic Ms t (ECM). zm e cavage occurs 3' and a few analysis, Is Involved in the binding of Zn at the catalytic elt. Although th nuclodes away rom the sie of mismatch. mutation an be classified as a whot spot" mutation, it was not found in 43 We propose tat this method may be a simple and effective additiona ADA ch o rnes. The mutation abolishes a *eni site and - procedue to dewt and position all mutational dcanges when be simply detected by agaroes oress following PCR -mpllfication NA of axon 2 from genomic DNA nd d esn with Bamri. By smlr is screned for mutations. _bmllc io of genomi DNA end enzyme digestion, we ae now able to detec the marriqaty of ADA mdissense mtations. Molecular Applications in Clinical Genetics (continued) 1258 1259 Poster Symposium-Session 41 PRNP codon 129 polorphism and Gersmann-Straussler-Sch r (GSS) The melotic instability of (CAG)n trinuclotide repeats in the human androgen with nutation at codon 102. ((K Young', C.K Jones', A. Lazzarn, Ll. receptor gene studied by sperm typing. ((L Zhang, J. Yu and N. Amhaim.)) GolbeI, T.R. Zimmerman2, D.W. Dickson3, H.V. Vinters, M.E. Hodes', S. Molecular Biology, Univ. of Southem Cal., Los Angeles, CA 90089-1340. Diouly' and B. GhAt'.)) 'Indiana Univ. Sch. of Med., Indanapol, IN, 2Robet Wood Johnson Med. Sch., New B n N.J., Abort Einstein Coblege of Trinucleotide repeat expansion appears responsible for several genetic Med., BrAnx, N.Y. ad 4UCLA Medical Cene, Los Angeles, CA. diseases. One, X-linked spinal and bulbar muscular atrophy (SBMA, Kennedy's disease), is caused by the expansion of a (CAG)n trinucleotide in the first axon of the gene. In prion diseases, o go for a pol at codon 129 in the repeat androgen receptor (AR) The molotic instability of this trinucleotide repeat has been observed in SBMA patients pion protein gene (PRNP) has elated with age of onset In the (40-62 repeats), but not observed in normal Individuals (11-31 repeats) Wiried and with to disem In the sporadic possibly due to the small number of melosis analyzed. We deveioped a PCR Codon 129 ale nc vary in diffvernt ethnic groups (e.g., 0.32 system which enables us to amplify this repeat in single sperm and determine (metione, M) and 0.68 (an, V) in the British popuon; 0.96 (M) and 0.04 the size of the repeat by ethidium bromide-staining on non-denaturing gels. in the Japanese poplin). In four published families, each with a diferent This method facilitates the analysis of this trinucleotide repeat in single cells mutation (codon 105, 117, 198 or 217), the mutation is in and makes SBMA preimpWntation genetic disease diagnosis possible. coupling phm wIth V at codon 129. In the Indiana kindred (mutation at codon Three individuals whose repeat sizes were estimated to be 22, 28 and 31 198), it has bon shown that codon 129 homzygosty is correlated with an were analyzed. For the donor with 22 repeats, 255 X-chromosome containing earier age of onset Curren, we report two new families sperm were detected out of 565 sperm. A 1.57% change was detected, two with GSS disease caused by mutation at codon 102. In one family, the contractions and two expansions. A higher frequency of proband was a codon 129 M/V he and in the other fanmiy, an M/M contraction/expansion was observed for the individuals with 28 and 31 hom In both fmilies, th codon 102 mutation is on the M allel as repeats. Among 237 X-chromosomes from the individual with 28 repeats, nine contractions and no were determined by PCR aMf and disc estiction digestion. SON expansions observed (3.80% change). In the case of the individual 31 five one by M13 not reable. To our these two with repeats, contractions and expansion were observed In 177 X-chromosome containing sperm (3.39% change). faTies represent the first reported cases of GSS with a PRNP mutation in Most of the contraction/expansIon events we observed Involved a change in coupling with an M allele. Ages at death were 34 years (M/M) and 56 years CAG number estimated to be two or Our these patet are tom different this repeat one. observations suggest (M/V). Although families, data is there is a correlation between the frequency of contraction/expansion and the consient with an eelier age of onset in codon 129 homzes. (Supported size of the trinucleotide repeats and that among normal chromosomes, by PHS R01 NS29822) contractions predominate over expansion.

1260 1261 Mutations in the ND gene in families with Norrie disease. ((D. Zhu and l.H. Direct sequencing of PCR products derived from cDNAs for the proul and Maunenee.j) The Johns Hopkins Center for Hereditary Eye Diseases, The proa2 chains of type I procollagen as a screening method to detect Johns Hopkins Medical Institutions, Baltimore, Maryland. mutations in patients with oaseogenesis imporfecta. ((J. Zhuan, G. Tromp, H. Kulvanlemi and D. J. Prockop.)) Department of Biochemistry and Norrie disease is an X-llnked neurodevelopmental disorder characterized by Molecular Biology, Jefferson Institute of Molecular Medicine, Thomas congenital blindness due to retinal dysplasia and detachments followed by Jefferson University, Philadelphia, PA. pseudotumorous proliferation and phthisis. Mental retardation and deafness A series of mutations in the two for I Al are associated features. The Norrie disease contains genes type procolagen (COL commonly gene (ND) and COL1A2) have been found to cause osteogenesis Imparfecta (01), a 3 axons and 2 introns. It is expressed in fetal and adult brain tissue and heritable disorder cacterized by of bone. It is, however, rare to encodes a of 133 amino acids. Molecular DNA studies were protein see identical mutations In unrelated patients. A reliable screening method performed on 19 affected males from 11 pedigrees, including two male should, therefore, be able to detect previously characterized, as well as fetuses. Gene sequence alterations were found In 9 out of 11 pedigrees. previously uncharacterized, mutations with a high degree of confidence. Microdeletion was detected in one family using Southern blot analysis with The method that can detect most mutations Is DNA sequencing. As an probe L1.28. Different size deletions were found in four additional added benefit, DNA sequencing also either excludes any additional pedigrees ranging from complete, partial, and 4bp to single base pair sequence changes or defines them if present. We have concentrated on deletion of the ND cDNA by the candidate gene approach using polymerase developing the direct sequencing technology to be a rapid screening chain reaction, DGGE, SSCP, and DNA sequencing. Single base method. substitutions In exon 3 were found in three pedigrees. The missense Here we report on three single base mutations found with direct mutations of Leu42Pro, CysilOArg, and Arg 11Gly were detected in sequencing technoiogy that changed a codon for glyolne to a codon for pedigrees G, J and K respectively. One pedigree showed an Inversion another amino acid. The first mutation changed the Glyl54 of the a1 chain involving the Norrie disease region. No mutations have been found to date (numbered from the first glycine of the triple-helical domain) to arginne in a in two sporadic patients. Prenatal diagnosis in two consecutive pregnancies patient with type I 01. The second mutation changed Gy70 of the a2 chain of the same mother did not show a deletion on Southern blot analysis In the to serne in a patient with ype 101. The third mutation changed Gly0 of the chain to in a with first affected male; however, using the candidate gene approach deletions a1 serie patient type 1I1 01. At the same time, we found several unreported polymorphisms in the a2 chain. We analyzed 4379 bp of of axons 2 and 3 were recognized In both the first affected male and the heterozygous (8758 bp of alabli) sequences of the proal(I) collagen and second fetus. The ND candidate gene approach using PCR, SSCP and 4200 bp of heterozygous (8400 bp of allefic) sequences of the pror2(l) direct sequencing Is a sensitive way to detect mutations In Norrie disease. collagen from each patient.

6

1262 1263 Characterization of aberrantly spliced tunscripts in cystic fibrosis patients carrying Idenfificatin of both de nov molecular deletions and an apparent excess 621+lG-#T, 711+1G-IT, and 1898+5G-+T mutations. ((J. Zielenakil, D. of male germ-line mutations In X-linked hypohidrotIc ectodermal dyspbs Markiewiczl, D. Bozonl, T. Yang-Feng2, F.-Y. Huang3, S.-P. Lin3, and L.-C. (EDA): Implications for genetic counseling. ((J. Zonanal, M. Jons1, A. for Tonto, Tguil.)). IThe Hospital Sick Children Canada; 2Yale University School Clariusand N.S&T. Thomas2)) 1) Oron Health Sciences Univ., Portland, 2) of New Memorial Medicine, Haven, USA, 3MacKay Hospital, Taipei, Taiwan; Univ. of Wales C of Medicine, Cardiff, U.K 4University of Toronto, Canada. X-linked hypohidrotic cdarmal dysplasia (EDA), an X-llnked trait, is fully To determine the consequence of mutations detected at various splicejunctions of the panerant In but detectble in two-thirds of females. In CFTR gene, we have analyzed the trscripts from patients carrying some of these maes, incally only many families n poal carrier females is p noes mutations. The first patient was compound heteozygous with the 621+IG-+T and generaton In wich the mutation arose is unclear. Therefore, have 71l+lG-T mutations. RT-PCR analysis of the RNA from the nasal epithelial cells and EBV-ninsformed lymphoblsts from this patient yielded three aberrant products studied muiipl unrelatd families wih EDA for DNA using for the region spanning exons 3 and 7. Two of theproducts were missing either exon cosmids that physically map at or near the EDA locus as probes In 4 or exon 5, as anticipated from the substitutions at the two splice donor sites, Southem analyses. In addition, the germ-line origin of the apparent de respectively. The third aberrant product was derived from the 621+10G-T allele novo mutatins (non-deleted) was determined by an analysis of the duough the use ofa cryptic splice donor sequence within exon 4. All three uunscripts segregation of EDA and muitiple polymorphic flanking markers. Two de would result in the deletion of a significant segment of the first ATP-binding domain nova molecular deletion were found, one apparently originating during of CFTR. These molecular defects are consistent with the severe, pancreatic spermatogemanei (mate grandr), and the other during cogenesis. insufficient phenotype of the patient. The study also demonstred the utility of Ten families wer Informative havhg an affected or obligate carrier mother, transcription in mutation The third splice mutation, ectopic analysis. 1898+5G-T, at least one affected son, and clinically normal gr In eight of ten was originally detected in a Chinese patient of consanguineous marriage. Transcript EDA with the grandf s analysis was only possible, however, with the use of mRNA from the lymphobists instances, segregated maternal haplotype, producing a M/F sex ratio of at 4:1 for the origin of mutation, since in of the moerof the deceased patient. While RT-PCR amplified product missing exon 12 was detected in the sample as anticipated, this aberrant product was also found in two instances the matemal grandmothers might be non-manifesting some nonmal individuals without any known CFTR mutaons To confirm that the carriers. The carrier risk for females in ten famiiles was snifanty altered aberrant product was derived from the mutant allele ofthe mother, a sequence variant following the above analyses. The apparant excess male germ-line located in exon 10 (lS40A/G) was exploited. The result showed that 298% of the mutations would also Increm the carri risk for unaffected mothers of aberrant products and !92% of the normal transcripts were derived ftom the mutant sporadic cases. Based on with other X-inked disordes, allele. The latter observation suggests that a level of S4-5% of normal CFTM altered sex ratio may indcat the majority of undefined mutations in transcript is apparently sufficient to confer a mild, pancreatic sufficient phenotype EDA are point mutations raher than yet to be detected molecuar deletionsa observed in the homozygpus 1898+SG-T gatient.