DOCSLIB.ORG

Inhibition of ERK 1/2 Kinases Prevents Tendon Matrix Breakdown Ulrich Blache1,2,3, Stefania L

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

www.nature.com/scientificreports OPEN Inhibition of ERK 1/2 kinases prevents tendon matrix breakdown Ulrich Blache1,2,3, Stefania L. Wunderli1,2,3, Amro A. Hussien1,2, Tino Stauber1,2, Gabriel Flückiger1,2, Maja Bollhalder1,2, Barbara Niederöst1,2, Sandro F. Fucentese1 & Jess G. Snedeker1,2* Tendon extracellular matrix (ECM) mechanical unloading results in tissue degradation and breakdown, with niche-dependent cellular stress directing proteolytic degradation of tendon. Here, we show that the extracellular-signal regulated kinase (ERK) pathway is central in tendon degradation of load-deprived tissue explants. We show that ERK 1/2 are highly phosphorylated in mechanically unloaded tendon fascicles in a vascular niche-dependent manner. Pharmacological inhibition of ERK 1/2 abolishes the induction of ECM catabolic gene expression (MMPs) and fully prevents loss of mechanical properties. Moreover, ERK 1/2 inhibition in unloaded tendon fascicles suppresses features of pathological tissue remodeling such as collagen type 3 matrix switch and the induction of the pro-fbrotic cytokine interleukin 11. This work demonstrates ERK signaling as a central checkpoint to trigger tendon matrix degradation and remodeling using load-deprived tissue explants. Tendon is a musculoskeletal tissue that transmits muscle force to bone. To accomplish its biomechanical function, tendon tissues adopt a specialized extracellular matrix (ECM) structure1. Te load-bearing tendon compart- ment consists of highly aligned collagen-rich fascicles that are interspersed with tendon stromal cells. Tendon is a mechanosensitive tissue whereby physiological mechanical loading is vital for maintaining tendon archi- tecture and homeostasis2. Mechanical unloading of the tissue, for instance following tendon rupture or more localized micro trauma, leads to proteolytic breakdown of the tissue with severe deterioration of both structural and mechanical properties3–5. Tese mechanisms are implicated in failed healing response and longer-term tendinopathies, with associated individual pain and socioeconomic burden that aficts our increasingly aging society6,7. At present, the underlying molecular mechanisms of tendinopathies are unknown and present a major roadblock to achieving targeted and efective therapies8–10. In the search for mechanisms that are involved in tendon degradation, tendon explants ofer a well-suited tissue model11,12. Tendon explants retain features of native tissue including the ECM architecture/structure, allow for highly controlled experimental conditions, and enable direct functional (mechanical) testing. In this sense, tendon explants overcome important limitations of traditional 2D cell culture systems, engineered 3D tissues and in vivo animal models13. Ex vivo, tendon explants lose their mechanical properties under load-deprived conditions due to proteolytic matrix degradation involving diferent proteases, such as matrix metalloproteases (MMP)12,14–18. We have previously used murine tendon fascicles to show that vascular like niches drive a cellular stress response and proteolytic tendon degradation12. However, the molecular pathways that govern ECM deg- radation and the subsequent loss of tendon biomechanical function remain unknown. In this work, we identify and probe the extracellular-signal regulated kinases ERK 1/2 as a central checkpoint that regulates proteolytic tendon matrix breakdown. Results Standard ex vivo tissue culture of tendon explants is widely documented to provoke tissue deterioration. In con- trast to the nutrient hyper-availability that characterizes standard tissue culture conditions, we employed more physiological ex vivo culture conditions comprising standard culture medium but at 3% oxygen and 29 °C—con- ditions we have identifed to maintain tendon fascicle viability while preserving native biomechanical properties12 (Fig. 1A). Here, we extend these fndings by exploring the potential molecular mechanisms that underpin the niche-dependent tendon degeneration in this model system. We started by re-examining our published transcriptome dataset of tendon fascicles (E-MTAB-7832), in which we have identifed ~ 3000 genes to be diferentially expressed between standard and reduced niche condi- tions. First, we applied the Expression2Kinase (E2K) pipeline to computationally infer key regulatory kinases 1Department of Orthopedics, Balgrist University Hospital, University of Zurich, Zurich, Switzerland. 2Institute for Biomechanics, ETH Zurich, Zurich, Switzerland. 3These authors contributed equally: Ulrich Blache and Stefania L. Wunderli. *email: [email protected] Scientifc Reports | (2021) 11:6838 | https://doi.org/10.1038/s41598-021-85331-1 1 Vol.:(0123456789) www.nature.com/scientificreports/ A B FGFR2FGFR3 TRKC EphB2 FGFR1 TRKB FGFR4 TRKA KDR FLT1 FMS EphB1 ROR2 EphA5 MUSK ROR1 KIT RET EphB3 DDR2 MER EphA3 AXL FLT4 EphA4 DDR1 TYRO3 PDGFRa Standard culture Reduced culture FLT3 IRR PDGFRb EphA6 IGF1R ErbB2 YES INSR MET EGFR EphB4 RON MLK3 SRC ROS MLK1 ALK TIE2 LYN EphA7 TIE1 LTK ErbB4 HCK FYN RYK MLK4 EphA8 CCK4 MLK2 TNK1 TYK2 LCK FGR ACK JAK1JAK2 Temperature ErbB3 37°C 29°C EphA2 JAK3 BLK TKL ZAP70 ANKRD3SgK288 DLK PYK2SYK LZK TK EphA1 LMR1 FAK LMR2 ALK4 RAF1 ITK FRK ZAK TGFbR1 TEC EphB6 KSR1 BRAF SRM RIPK2 KSR2 TXK IRAK1 BTK BRK LMR3 IRAK3 ALK7 LIMK1 ARAF BMX EphA10 LIMK2 BMPR1B TESK1 ILK BMPR1A Oxygen CTK RIPK3 TESK2 TAK1 ALK1 21% 3% CSK HH498 ALK2 ABL2 ACTR2 ABL1 FES IRAK2 ACTR2B FER RIPK1 TGFbR2 JAK3_b MAP3K2 JAK2_b LRRK1 MISR2 MAP3K3 LRRK2 BMPR2 MAP3K5 TYK2_b SuRTK106 IRAK4 MAP3K19 STE ANPa JAK1_b MAP3K7 DMEM DMEM ANPb MOS KHS1 MST1 YSK1 MST2 HSER HPK1 KHS2 MST3 SgK496 Wnk1 Medium GCK + 10% FBS + 10% FBS MAP3K6 MST4 DYRK2 PBK Wnk3 DYRK3 CYGD MAP3K4 NRBP2 Wnk2 HGK DYRK1A DYRK4 NRBP1 + 200µM AA + 200µM AA DYRK1B CYGF MAP3K1 OSR1 MINK STLK3 TNIK MLKL Wnk4 NRK STLK5 PEK STLK6 MYO3A SgK307 SLK PKR MYO3B HIPK1 HIPK3 GCN2 SgK424 LOK SCYL3 TAO1 HIPK2 SCYL1 COT TAO2 Mechanical SCYL2 NIK TAO3 PRP4 PAK1 yes no CLK4 HIPK4 HRI PAK3 PAK4 CLK1 CLIK1 PAK2 CLK2 IRE1 MAP2K5 PAK5 degradation IRE2 CLIK1L CLK3 TBCK PAK6 MAP2K7 RNAseL MAP2K1 GCN2_b MAP2K2 MSSK1 TTK SgK071 SRPK2 KIS MAP2K3 MYT1 MAP2K4 MAP2K6 CMGC SRPK1 CK2a1 Wee1 SgK196 CK1d MAK CK2a2 CDC7 Wee1B TTBK1 GSK3B ICK PRPK CK1e Haspin GSK3A MOK TTBK2 CK1a CDKL3 CK1a2 PINK1 CDKL2 SgK269 SgK493 VRK3 CK1g2 CDKL1 CDKL5 Erk7 SgK396 SgK223 CK1g1 CDKL4 Erk4 Slob SgK110 NLK Erk3 CK1g3 SgK069 PIK3R4 BUB1 Erk5 SBK CK1 IKKa BUBR1 VRK1 Erk1 IKKb CDK7 IKKe PLK4 VRK2 Erk2 p38g TBK1 MPSK1 JNK1 PITSLRE TLK2 p38d JNK3JNK2 CDK10 GAK PLK3 AAK1 ULK3 TLK1 p38b CDK8 CaMKK1 CDK11 PLK1 PLK2 p38a CDK4 CCRK BARK1 BIKE CaMKK2 RHOK CDK6 ULK1 BARK2 Fused GPRK5 GPRK7 PFTAIRE2 ULK2 ULK4 SgK494 PFTAIRE1 CDK9 NEK6 GPRK6 GPRK4 NEK7 RSKL1 PCTAIRE2 NEK8 NEK10 SgK495 PASK PDK1 MSK1 RSKL2 RSK1 NEK9 LKB1 MSK2 PCTAIRE1PCTAIRE3 CDK5CRK7CHED RSK4 RSK2 DYRK2 NEK2 CHK1 p70S6K RSK3 AKT2 NEK11 AurA p70S6Kb AKT1 DYRK3 CDC2 AKT3 CDK3 NEK4 SGK1 DYRK1A CDK2 AurB DYRK4 Trb3 PIM1 PIM2 AurC PKN1 SGK2SGK3 NEK3 LATS1 PKG2 PKN2 DYRK1B Trb2 PIM3 LATS2 PKG1 NEK5 NDR1 PKN3 Trb1 Obscn_b NDR2 PRKY YANK1 PRKX NEK1 SPEG_b MAST3 PKCh Obscn MASTL PKCz PKCe STK33 YANK2 PKCi PKCd PEK SPEG YANK3 PKCt PKACg PKACa PKCg TTN MAST2 PKACb PKR Trio smMLCK HIPK3 Trad ROCK1 PKCa HIPK1 GCN2 TSSK4 CHK2 HUNK ROCK2 PKCb skMLCK SNRK DMPK1 HIPK2 SSTK MAST4 MAST1 SCY DRAK2 NIM1 CRIK TSSK3 PKD2 PRP4 DRAK1 DCAMKL3 AGC CLK4 HIPK4 HRI SgK085 TSSK1 DCAMKL1 DMPK2 TSSK2 PKD1 DCAMKL2 CLK1 CLIK1 caMLCK MELK PKD3 CASK IRE1 DAPK3 DAPK2 VACAMKL MRCKb CLK2 CLIK1L PHKg1 DAPK1 MAPKAPK5 PSKH1 MRCKa IRE2 MNK1 PHKg2 TBCK AMPKa2 PSKH2 CLK3 MNK2 MAPKAPK2 AMPKa1 CaMK2g CaMK2a CaMK2b RNAseL BRSK2 MAPKAPK3CaMK2d CaMK4 BRSK1 RSK4_b TTK NuaK2 MSSK1 SgK071 NuaK1 RSK1_b MSK1_b KIS MSK2_b CaMK1b SRPK2 QSK RSK2_b RSK3_b CMGC SRPK1 CaMK1g CK2a1 SIK MAK QIK CK2a2 CDC7 CAMK CaMK1a ICK CaMK1d GSK3B MARK4 GSK3A MOK MARK1 MARK3 CDKL3 MARK2 CDKL2 S CDKL1 CDKL5 Erk7 CDKL4 Erk4 NLK Erk3 Erk5 Erk1 CDK7 Erk2 p38g JNK1 PITSLRE p38d JNK3JNK2 CDK10 p38b CDK8 CDK11 p38a CDK4 CCRK CDK6 PFTAIRE2 -log10(p-value) PFTAIRE1 CDK9 PCTAIRE2 PCTAIRE1PCTAIRE3 CDK5CRK7CHED CDC2 CDK3 CDK2 Min Max CD 2.5 2.0 K 1.5 Tubulin 1.0 p-ERK 1/2 p-ERK / t-ER 0.5 t-ERK 1/2 0.0 e Fresh tissue Fresh tissue StandardReduced cultur culture StandardReduced culture culture Figure 1. Niche-dependent ERK 1/2 activity and phosphorylation in load-deprived tendon explant cultures. (A) Overview of experimental conditions and starting phenotypes. DMEM = Dulbecco’s modifed Eagle’s medium, FBS = fetal bovine serum, AA = ascorbic acid. (B) Upstream kinase enrichment prediction based on the transcriptome data set E-MTAB-7832 (ArrayExpress), which analyses diferentially expressed genes in tendon tissues cultured ex vivo in standard and reduced niches. Kinome tree dendrogram mapping of all the predicted protein kinases generated by Coral42. Te circle color and size refect the enrichment signifcance with red color encoding higher signifcance. (C) Bar plots show the 20 most signifcantly enriched kinases. Red bars represent the ERK 1 and 2 kinases. GraphPad Prism (version 8.4.3) was used to generate the fgure. (D) Western blot validation of ERK 1/2 phosphorylation (ERK 1: Tr202/Tyr204; ERK 2: Tr185/Tyr187) in freshly isolated or cultured tendon fascicles (12 days). Full Western blot images are provided in the supplementary material (Supplementary Fig. 3). Quantifcation of band pixel intensities of phosphorylated ERK (p-ERK 1/2) compared to the total ERK (t-ERK). GraphPad Prism (version 8.4.3) was used to perform statistical analyses and generate the fgure. Bars show mean values + SD, with individual replicate values as data points, N = 8. Repeated measure ANOVA with Tukey’s multiple comparisons test: **p < 0.01, ***p < 0.001. Scientifc Reports | (2021) 11:6838 | https://doi.org/10.1038/s41598-021-85331-1 2 Vol:.(1234567890) www.nature.com/scientificreports/ upstream of the diferentially expressed genes (DEG). E2K algorithm predicted ~ 100 upstream protein kinases that are likely responsible for regulating DEG. Mapping the identifed kinases into Kinome phylogenetic tree showed that the majority of these kinase hits clustered around the CMGC kinases, which is a large kinase group including the mitogen-activated protein kinase (MAPK) family (Fig.
Recommended publications
  • Characterization of Protein Kinase C Alpha Deficiency in a Mouse Model

    Characterization of Protein Kinase C Alpha Deficiency in a Mouse Model

    Aus der Medizinischen Klinik mit Schwerpunkt Infektiologie und Pneumologie der Charité – Universitätsmedizin Berlin Eingereicht über das Institut für Veterinär-Physiologie des Fachbereichs Veterinärmedizin der Freien Universität Berlin Characterization of Protein Kinase C Alpha Deficiency in a Mouse Model Inaugural-Dissertation zur Erlangung des Doctor of Philosophy (Ph.D.) an der Freien Universität Berlin vorgelegt von Elena Ariane Noe Tierärztin aus Düsseldorf Berlin 2016 Journal-Nr.: 3878 Gedruckt mit Genehmigung des Fachbereichs Veterinärmedizin der Freien Universität Berlin Dekan: Univ.-Prof. Dr. Jürgen Zentek Erster Gutachter: Prof. Dr. Dr. Petra Reinhold Zweiter Gutachter: Univ.-Prof. Dr. Martin Witzenrath Dritter Gutachter: Univ.-Prof. Dr. Christa Thöne-Reineke Deskriptoren (nach CAB-Thesaurus): Mice; animal models; protein kinase C (MeSH); pulmonary artery; hypertension; blood pressure, vasoconstriction; esophageal sphincter, lower (MeSH); respiratory system; smooth muscle; esophageal achalasia (MeSH) Tag der Promotion: 14.07.2016 Contents Contents ................................................................................................................................... V List of Abbreviations ............................................................................................................... VII 1 Introduction ................................................................................................................. 1 1.1 Protein Kinase C (PKC) and its Role in Smooth Muscle Contraction ........................
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB

    Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB

    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
  • Outlier Kinase Expression by RNA Sequencing As Targets for Precision Therapy

    Outlier Kinase Expression by RNA Sequencing As Targets for Precision Therapy

    Published OnlineFirst February 5, 2013; DOI: 10.1158/2159-8290.CD-12-0336 RESEARCH ARTICLE Outlier Kinase Expression by RNA Sequencing as Targets for Precision Therapy Vishal Kothari 1 , Iris Wei 2 , Sunita Shankar 1 , 3 , Shanker Kalyana-Sundaram 1 , 3 , 8 , Lidong Wang 2 , Linda W. Ma 1 , Pankaj Vats 1 , Catherine S. Grasso 1 , Dan R. Robinson 1 , 3 , Yi-Mi Wu 1 , 3 , Xuhong Cao 7 , Diane M. Simeone 2 , 4 , 5 , Arul M. Chinnaiyan 1 , 3 , 4 , 6 , 7 , and Chandan Kumar-Sinha 1 , 3 ABSTRACT Protein kinases represent the most effective class of therapeutic targets in cancer; therefore, determination of kinase aberrations is a major focus of cancer genomic studies. Here, we analyzed transcriptome sequencing data from a compendium of 482 cancer and benign samples from 25 different tissue types, and defi ned distinct “outlier kinases” in individual breast and pancreatic cancer samples, based on highest levels of absolute and differential expression. Frequent outlier kinases in breast cancer included therapeutic targets like ERBB2 and FGFR4 , distinct from MET , AKT2 , and PLK2 in pancreatic cancer. Outlier kinases imparted sample-specifi c depend- encies in various cell lines, as tested by siRNA knockdown and/or pharmacologic inhibition. Outlier expression of polo-like kinases was observed in a subset of KRAS -dependent pancreatic cancer cell lines, and conferred increased sensitivity to the pan-PLK inhibitor BI-6727. Our results suggest that outlier kinases represent effective precision therapeutic targets that are readily identifi able through RNA sequencing of tumors. SIGNIFICANCE: Various breast and pancreatic cancer cell lines display sensitivity to knockdown or pharmacologic inhibition of sample-specifi c outlier kinases identifi ed by high-throughput transcrip- tome sequencing.
  • Reframing Psychiatry for Precision Medicine

    Reframing Psychiatry for Precision Medicine

    Reframing Psychiatry for Precision Medicine Elizabeth B Torres 1,2,3* 1 Rutgers University Department of Psychology; [email protected] 2 Rutgers University Center for Cognitive Science (RUCCS) 3 Rutgers University Computer Science, Center for Biomedicine Imaging and Modelling (CBIM) * Correspondence: [email protected]; Tel.: (011) +858-445-8909 (E.B.T) Supplementary Material Sample Psychological criteria that sidelines sensory motor issues in autism: The ADOS-2 manual [1, 2], under the “Guidelines for Selecting a Module” section states (emphasis added): “Note that the ADOS-2 was developed for and standardized using populations of children and adults without significant sensory and motor impairments. Standardized use of any ADOS-2 module presumes that the individual can walk independently and is free of visual or hearing impairments that could potentially interfere with use of the materials or participation in specific tasks.” Sample Psychiatric criteria from the DSM-5 [3] that does not include sensory-motor issues: A. Persistent deficits in social communication and social interaction across multiple contexts, as manifested by the following, currently or by history (examples are illustrative, not exhaustive, see text): 1. Deficits in social-emotional reciprocity, ranging, for example, from abnormal social approach and failure of normal back-and-forth conversation; to reduced sharing of interests, emotions, or affect; to failure to initiate or respond to social interactions. 2. Deficits in nonverbal communicative behaviors used for social interaction, ranging, for example, from poorly integrated verbal and nonverbal communication; to abnormalities in eye contact and body language or deficits in understanding and use of gestures; to a total lack of facial expressions and nonverbal communication.
  • Selective Targeting of Cyclin E1-Amplified High-Grade Serous Ovarian Cancer by Cyclin-Dependent Kinase 2 and AKT Inhibition

    Selective Targeting of Cyclin E1-Amplified High-Grade Serous Ovarian Cancer by Cyclin-Dependent Kinase 2 and AKT Inhibition

    Published OnlineFirst September 23, 2016; DOI: 10.1158/1078-0432.CCR-16-0620 Biology of Human Tumors Clinical Cancer Research Selective Targeting of Cyclin E1-Amplified High-Grade Serous Ovarian Cancer by Cyclin- Dependent Kinase 2 and AKT Inhibition George Au-Yeung1,2, Franziska Lang1, Walid J. Azar1, Chris Mitchell1, Kate E. Jarman3, Kurt Lackovic3,4, Diar Aziz5, Carleen Cullinane1,6, Richard B. Pearson1,2,7, Linda Mileshkin2,8, Danny Rischin2,8, Alison M. Karst9, Ronny Drapkin10, Dariush Etemadmoghadam1,2,5, and David D.L. Bowtell1,2,7,11 Abstract Purpose: Cyclin E1 (CCNE1) amplification is associated with Results: We validate CDK2 as a therapeutic target by demon- primary treatment resistance and poor outcome in high-grade strating selective sensitivity to gene suppression. However, we found serous ovarian cancer (HGSC). Here, we explore approaches to that dinaciclib did not trigger amplicon-dependent sensitivity in a target CCNE1-amplified cancers and potential strategies to over- panel of HGSC cell lines. A high-throughput compound screen come resistance to targeted agents. identified synergistic combinations in CCNE1-amplified HGSC, Experimental Design: To examine dependency on CDK2 in including dinaciclib and AKT inhibitors. Analysis of genomic data CCNE1-amplified HGSC, we utilized siRNA and conditional from TCGA demonstrated coamplification of CCNE1 and AKT2. shRNA gene suppression, and chemical inhibition using dina- Overexpression of Cyclin E1 and AKT isoforms, in addition to ciclib, a small-molecule CDK2 inhibitor. High-throughput mutant TP53, imparted malignant characteristics in untransformed compound screening was used to identify selective synergistic fallopian tube secretory cells, the dominant site of origin of HGSC.
  • Hidden Targets in RAF Signalling Pathways to Block Oncogenic RAS Signalling

    Hidden Targets in RAF Signalling Pathways to Block Oncogenic RAS Signalling

    G C A T T A C G G C A T genes Review Hidden Targets in RAF Signalling Pathways to Block Oncogenic RAS Signalling Aoife A. Nolan 1, Nourhan K. Aboud 1, Walter Kolch 1,2,* and David Matallanas 1,* 1 Systems Biology Ireland, School of Medicine, University College Dublin, Belfield, Dublin 4, Ireland; [email protected] (A.A.N.); [email protected] (N.K.A.) 2 Conway Institute of Biomolecular & Biomedical Research, University College Dublin, Belfield, Dublin 4, Ireland * Correspondence: [email protected] (W.K.); [email protected] (D.M.) Abstract: Oncogenic RAS (Rat sarcoma) mutations drive more than half of human cancers, and RAS inhibition is the holy grail of oncology. Thirty years of relentless efforts and harsh disappointments have taught us about the intricacies of oncogenic RAS signalling that allow us to now get a pharma- cological grip on this elusive protein. The inhibition of effector pathways, such as the RAF-MEK-ERK pathway, has largely proven disappointing. Thus far, most of these efforts were aimed at blocking the activation of ERK. Here, we discuss RAF-dependent pathways that are regulated through RAF functions independent of catalytic activity and their potential role as targets to block oncogenic RAS signalling. We focus on the now well documented roles of RAF kinase-independent functions in apoptosis, cell cycle progression and cell migration. Keywords: RAF kinase-independent; RAS; MST2; ASK; PLK; RHO-α; apoptosis; cell cycle; cancer therapy Citation: Nolan, A.A.; Aboud, N.K.; Kolch, W.; Matallanas, D. Hidden Targets in RAF Signalling Pathways to Block Oncogenic RAS Signalling.
  • Mtor Coordinates Transcriptional Programs and Mitochondrial Metabolism of Activated Treg Subsets to Protect Tissue Homeostasis

    Mtor Coordinates Transcriptional Programs and Mitochondrial Metabolism of Activated Treg Subsets to Protect Tissue Homeostasis

    ARTICLE DOI: 10.1038/s41467-018-04392-5 OPEN mTOR coordinates transcriptional programs and mitochondrial metabolism of activated Treg subsets to protect tissue homeostasis Nicole M. Chapman1, Hu Zeng 1, Thanh-Long M. Nguyen1, Yanyan Wang1, Peter Vogel 2, Yogesh Dhungana1, Xiaojing Liu3, Geoffrey Neale 4, Jason W. Locasale 3 & Hongbo Chi1 1234567890():,; Regulatory T (Treg) cells derived from the thymus (tTreg) and periphery (pTreg) have central and distinct functions in immunosuppression, but mechanisms for the generation and acti- vation of Treg subsets in vivo are unclear. Here, we show that mechanistic target of rapamycin (mTOR) unexpectedly supports the homeostasis and functional activation of tTreg and pTreg cells. mTOR signaling is crucial for programming activated Treg-cell function to protect immune tolerance and tissue homeostasis. Treg-specific deletion of mTOR drives sponta- neous effector T-cell activation and inflammation in barrier tissues and is associated with reduction in both thymic-derived effector Treg (eTreg) and pTreg cells. Mechanistically, mTOR functions downstream of antigenic signals to drive IRF4 expression and mitochondrial metabolism, and accordingly, deletion of mitochondrial transcription factor A (Tfam) severely impairs Treg-cell suppressive function and eTreg-cell generation. Collectively, our results show that mTOR coordinates transcriptional and metabolic programs in activated Treg subsets to mediate tissue homeostasis. 1 Department of Immunology, St. Jude Children’s Research Hospital, 262 Danny Thomas Place, MS 351, Memphis, TN 38105, USA. 2 Department of Pathology, St. Jude Children’s Research Hospital, 262 Danny Thomas Place, MS 250, Memphis, TN 38105, USA. 3 Department of Pharmacology & Cancer Biology, Duke University School of Medicine, Levine Science Research Center C266, Box 3813, Durham, NC 27710, USA.
  • Product Data Sheet

    Product Data Sheet

    Product Data Sheet ExProfileTM Human AMPK Signaling Related Gene qPCR Array For focused group profiling of human AMPK signaling genes expression Cat. No. QG004-A (4 x 96-well plate, Format A) Cat. No. QG004-B (4 x 96-well plate, Format B) Cat. No. QG004-C (4 x 96-well plate, Format C) Cat. No. QG004-D (4 x 96-well plate, Format D) Cat. No. QG004-E (4 x 96-well plate, Format E) Plates available individually or as a set of 6. Each set contains 336 unique gene primer pairs deposited in one 96-well plate. Introduction The ExProfile human AMPK signaling related gene qPCR array profiles the expression of 336 human genes related to AMPK-mediated signal transduction. These genes are carefully chosen for their close pathway correlation based on a thorough literature search of peer-reviewed publications, mainly including genes that encode AMP-activated protein kinase complex，its regulators and targets involved in many important biological processes, such as glucose uptake, β-oxidation of fatty acids and modulation of insulin secretion. This array allows researchers to study the pathway-related genes to gain understanding of their roles in the different biological processes. QG004 plate 01: 84 unique gene PCR primer pairs QG004 plate 02: 84 unique gene PCR primer pairs QG004 plate 03: 84 unique gene PCR primer pairs QG004 plate 04: 84 unique gene PCR primer pairs Shipping and storage condition Shipped at room temperate Stable for at least 6 months when stored at -20°C Array format GeneCopoeia provides five qPCR array formats (A, B, C, D, and E) suitable for use with the following real- time cyclers.
  • Transcriptomic Analysis of Native Versus Cultured Human and Mouse Dorsal Root Ganglia Focused on Pharmacological Targets Short

    Transcriptomic Analysis of Native Versus Cultured Human and Mouse Dorsal Root Ganglia Focused on Pharmacological Targets Short

    bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Transcriptomic analysis of native versus cultured human and mouse dorsal root ganglia focused on pharmacological targets Short title: Comparative transcriptomics of acutely dissected versus cultured DRGs Andi Wangzhou1, Lisa A. McIlvried2, Candler Paige1, Paulino Barragan-Iglesias1, Carolyn A. Guzman1, Gregory Dussor1, Pradipta R. Ray1,#, Robert W. Gereau IV2, # and Theodore J. Price1, # 1The University of Texas at Dallas, School of Behavioral and Brain Sciences and Center for Advanced Pain Studies, 800 W Campbell Rd. Richardson, TX, 75080, USA 2Washington University Pain Center and Department of Anesthesiology, Washington University School of Medicine # corresponding authors [email protected], [email protected] and [email protected] Funding: NIH grants T32DA007261 (LM); NS065926 and NS102161 (TJP); NS106953 and NS042595 (RWG). The authors declare no conflicts of interest Author Contributions Conceived of the Project: PRR, RWG IV and TJP Performed Experiments: AW, LAM, CP, PB-I Supervised Experiments: GD, RWG IV, TJP Analyzed Data: AW, LAM, CP, CAG, PRR Supervised Bioinformatics Analysis: PRR Drew Figures: AW, PRR Wrote and Edited Manuscript: AW, LAM, CP, GD, PRR, RWG IV, TJP All authors approved the final version of the manuscript. 1 bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
  • Human Kinome Profiling Identifies a Requirement for AMP-Activated

    Human Kinome Profiling Identifies a Requirement for AMP-Activated

    Human kinome profiling identifies a requirement for AMP-activated protein kinase during human cytomegalovirus infection Laura J. Terrya, Livia Vastagb,1, Joshua D. Rabinowitzb, and Thomas Shenka,2 aDepartment of Molecular Biology and bDepartment of Chemistry and the Lewis-Sigler Institute for Integrative Genomics, Princeton University, Princeton, NJ 08544 Contributed by Thomas Shenk, January 11, 2012 (sent for review December 29, 2011) Human cytomegalovirus (HCMV) modulates numerous cellular (7). Thus, the connections between AMPK activity and metabolic signaling pathways. Alterations in signaling are evident from the changes during HCMV infection have remained unclear. broad changes in cellular phosphorylation that occur during HCMV We confirmed the requirement for AMPK during infection, infection and from the altered activity of multiple kinases. Here we and we show that an AMPK antagonist, compound C, blocks report a comprehensive RNAi screen, which predicts that 106 cellular HCMV-induced changes to glycolysis and inhibits viral gene kinases influence growth of the virus, most of which were not expression. These studies argue that AMPK or a related, com- previously linked to HCMV replication. Multiple elements of the pound C-sensitive kinase is an essential contributor to metabolic AMP-activated protein kinase (AMPK) pathway scored in the screen. changes initiated by HCMV and provide unique insight into As a regulator of carbon and nucleotide metabolism, AMPK is poised potential antiviral strategies. to activate many of the metabolic pathways induced by HCMV infection. An AMPK inhibitor, compound C, blocked a substantial Results portion of HCMV-induced metabolic changes, inhibited the accumu- HumanKinomeScreenIdentifies Putative Effectors of HCMV Replication. lation of all HCMV proteins tested, and markedly reduced the We conducted an siRNA screen of the human kinome to perform an production of infectious progeny.
  • Profiling Data

    Profiling Data

    Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8