Mouse Idh3a Mutations Cause Retinal Degeneration and Reduced Mitochondrial Function Amy S

Total Page:16

File Type:pdf, Size:1020Kb

Mouse Idh3a Mutations Cause Retinal Degeneration and Reduced Mitochondrial Function Amy S © 2018. Published by The Company of Biologists Ltd | Disease Models & Mechanisms (2018) 11, dmm036426. doi:10.1242/dmm.036426 RESEARCH ARTICLE Mouse Idh3a mutations cause retinal degeneration and reduced mitochondrial function Amy S. Findlay1, Roderick N. Carter2, Becky Starbuck3, Lisa McKie1, Klára Nováková1, Peter S. Budd1, Margaret A. Keighren1, Joseph A. Marsh1, Sally H. Cross1, Michelle M. Simon3, Paul K. Potter3, Nicholas M. Morton2 and Ian J. Jackson1,4,* ABSTRACT these diseases have a wide range of pathologies (Koopman et al., Isocitrate dehydrogenase (IDH) is an enzyme required for the 2012). Common to many of the diseases, however, are neurological production of α-ketoglutarate from isocitrate. IDH3 generates the or neuromuscular manifestations, including retinal disease. We have NADH used in the mitochondria for ATP production, and is a tetramer identified a missense mutation in the gene encoding a subunit of the made up of two α, one β and one γ subunit. Loss-of-function and tricarboxylic acid (TCA) cycle enzyme isocitrate dehydrogenase 3 missense mutations in both IDH3A and IDH3B have previously been (IDH3) as causing a retinal degeneration phenotype in mice. There implicated in families exhibiting retinal degeneration. Using mouse are three isocitrate dehydrogenase isozymes in mammals. IDH1 and models, we investigated the role of IDH3 in retinal disease and IDH2 are both homodimers that catalyse the decarboxylation of α mitochondrial function. We identified mice with late-onset retinal isocitrate to -ketoglutarate with the concomitant reduction of NADP degeneration in a screen of ageing mice carrying an ENU-induced to NADPH. IDH1 is cytoplasmic, whereas IDH2 is localised to the mutation, E229K, in Idh3a. Mice homozygous for this mutation exhibit mitochondria. No inherited disease has been associated with IDH1 signs of retinal stress, indicated by GFAP staining, as early as mutations, but mutations in IDH2 cause a metabolic disease, D-2- 3 months, but no other tissues appear to be affected. We produced a hydroxyglutaric aciduria, with a range of features including epilepsy, knockout of Idh3a and found that homozygous mice do not survive hypotonia and other neurological manifestations (Kranendijk et al., past early embryogenesis. Idh3a−/E229K compound heterozygous 2010). IDH1 or IDH2 has been found to be mutated in a high mutants exhibit a more severe retinal degeneration compared with proportion of glioblastomas and other tumours of the nervous system. α β Idh3aE229K/E229K homozygous mutants. Analysis of mitochondrial By contrast, IDH3 is a heterotetramer, composed of two ,one and γ function in mutant cell lines highlighted a reduction in mitochondrial one subunit, encoded by three genes. IDH3 is located in the α maximal respiration and reserve capacity levels in both mitochondria, where the conversion of isocitrate to -ketoglutarate is Idh3aE229K/E229K and Idh3a−/E229K cells. Loss-of-function Idh3b necessary for the TCA cycle to progress and generate NADH, which mutants do not exhibit the same retinal degeneration phenotype, feeds into oxidative phosphorylation to generate ATP. No recurrent with no signs of retinal stress or reduction in mitochondrial respiration. mutations in any of the IDH3 genes have been described in tumours. It has previously been reported that the retina operates with a limited A number of patients have been described with a variety of mitochondrial reserve capacity and we suggest that this, in mutations in IDH3A (Fattal-Valevski et al., 2017; Pierrache et al., combination with the reduced reserve capacity in mutants, explains 2017). A patient with the most severe of these, a homozygous missense the degenerative phenotype observed in Idh3a mutant mice. mutation (p.Pro304His), exhibited neurological defects from birth, possibly due to a failure during development, as well as retinal This article has an associated First Person interview with the first degeneration. However, the patient showed no symptoms of muscle author of the paper. weakness, typically associated with mitochondrial deficiencies. The remaining patients, with bi-allelic variants, all exhibited childhood KEY WORDS: Krebs cycle, Mouse model, Retinitis pigmentosa onset of retinal degeneration and some had pseudocoloboma of the macula. Pseudocoloboma is not a developmental defect but is caused INTRODUCTION by degeneration of the retina. Seven different alleles were found in four Mitochondrial diseases are highly diverse: over 220 different genes different families all predicted to be pathogenic, including two that have been identified that can cause diseases of the mitochondria, and could potentially cause nonsense-mediated decay. The other five, all missense mutations, are anticipated to be damaging. Two families 1MRC Human Genetics Unit, Institute of Genetics and Molecular Medicine, with homozygous mutations in IDH3B, and which exhibited University of Edinburgh, Crewe Road, Edinburgh EH4 2XU, UK. 2Molecular non-syndromic retinal degeneration, have also been described Metabolism Group, Centre for Cardiovascular Sciences, Queens Medical Research Institute, University of Edinburgh, Edinburgh EH16 4TJ, UK. 3MRC Mammalian (Hartong et al., 2008). None of these patients showed symptoms of Genetics Unit, MRC Harwell Institute, Harwell Campus, Oxfordshire OX11 0RD, UK. mitochondrial dysfunction other than retinitis pigmentosa (RP). 4Roslin Institute, University of Edinburgh, Edinburgh EH25 9RG, UK. We have identified a missense mutation, E229K, in mouse *Author for correspondence ([email protected]) Idh3a, which is associated with late-onset retinal degeneration. In addition, we generated a complete loss-of-function mutation in A.S.F., 0000-0002-9382-5911; P.S.B., 0000-0001-8951-2413; I.J.J., 0000-0001- this gene and show that it is early embryonic lethal. This mutation, 6526-0688 when combined with the missense mutation Idh3aE229K,results This is an Open Access article distributed under the terms of the Creative Commons Attribution in a more rapid retinal degeneration than that in the missense License (https://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution and reproduction in any medium provided that the original work is properly attributed. homozygotes. Photoreceptors of the retina have a particularly high energy requirement, and the mitochondria of these cells Received 9 July 2018; Accepted 12 November 2018 function at 70-80% of their maximal rate, leaving limited reserve Disease Models & Mechanisms 1 RESEARCH ARTICLE Disease Models & Mechanisms (2018) 11, dmm036426. doi:10.1242/dmm.036426 capacity (Kooragayala et al., 2015). This most likely accounts phenotypes were detected in the mice up to 18 months of age for the sensitivity of the retina to mitochondrial mutations. On the (Table S1). other hand, a loss-of-function mutation in Idh3b is viable and Genotyping of the affected littermates in this cross revealed a has no detectable abnormal phenotype. The retina of these mice single common region of homozygosity on chromosome 9, between are normal up to 6 months of age. We have analysed the 50.1 Mb and 74.8 Mb. Analysis of whole-genome sequence of the mitochondrial function in cells with Idh3 mutations, and find the founder male for this line found two candidate protein coding maximum and reserve capacity of Idh3a mutant cells to be mutations in the interval, heterozygous in the founder: sorting nexin reduced. However, cells lacking IDH3B show no detectable 33 (Snx33) and the α subunit of isocitrate dehydrogenase 3 (Idh3a). mitochondrial defect. The Snx33 mutation was not present in the mutant line, presumably because it is on the unaffected chromosome. We considered the RESULTS missense mutation, E229K, in Idh3a to be the likely causative Following a screen for N-ethyl-N-nitrosourea (ENU)-induced mutation, as human patients with mutations in either IDH3A or recessive mutations with an age-dependent phenotype, we IDH3B exhibit retinal degeneration (Fattal-Valevski et al., 2017; identified a mouse line that exhibited loss of vision and retinal Hartong et al., 2008; Pierrache et al., 2017). To confirm Idh3a as the degeneration associated with increasing age (Potter et al., 2016). causative gene, we used CRISPR/Cas9 to introduce a loss-of- When subjected to a moving visual stimulus within an optokinetic function mutation. We generated an insertion of 5 bp into exon 7 of drum (OKD) at 12 months of age, a subset of the littermates in this the gene, c.702_703InsGTACT, termed Idh3aem1Jkn, abbreviated cross responded with the stereotypical head movement only at ∼0.2 herein as Idh3a−. cycles per degree (c/d), compared with >0.3 c/d for phenotypically We bred compound heterozygous mice for Idh3a− and Idh3aE229K wild-type littermates. These mice maintained a diminished response and examined their eyes and visual function. As documented below, at 18 months (Fig. 1A). The same mice had abnormal retina, these mice have rapid retinal degeneration, demonstrating lack of identified by indirect ophthalmoscopy and documented by fundal complementation between the two alleles, and indicating that the imaging at 7 months (Fig. 1B). The dark patches on the retinal E229K mutation is the cause of retinal degeneration in the mice found images are indicative of retinal degeneration. No other overt in the screen. Fig. 1. Idh3aE229K/E229K mice exhibit signs of retinal degeneration. (A) Idh3aE229K/E229K mice (red) showed a decline in visual acuity, as determined by optokinetic drum (OKD) score, by 12 months {0.2071±0.01872 c/d [mean±s.e.m., n=9, female (F) 4, male (M) 5]} compared with wild-type (blue) [0.3090±0.009441 c/d (mean±s.e.m., n=23, F14, M9)] (P<0.0001) and heterozygous (yellow) [0.3173±0.007472 c/d (mean±s.e.m., n=35, F24, M11)] (P<0.0001) mice. This significant decline continued and, by 18 months, homozygous mice (red) had degenerated further [0.1592±0.02396 c/d (mean ±s.e.m., n=9 F4, M5)] compared with wild-type (blue) [0.3004±0.01223 c/d (mean±s.e.m., n=23, F14, M9)] (P<0.0001) and heterozygous (yellow) [0.2836 ±0.009699 c/d (mean±s.e.m., n=35, F24, M11)] mice (P<0.0001).
Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Download (Pdf)
    Invivoscribe's wholly-owned Laboratories for Personalized Molecular LabPMM LLC Medicine® (LabPMM) is a network of international reference laboratories that provide the medical and pharmaceutical communities with worldwide Located in San Diego, California, USA, it holds access to harmonized and standardized clinical testing services. We view the following accreditations and certifications: internationally reproducible and concordant testing as a requirement for ISO 15189, CAP, and CLIA, and is licensed to provide diagnostic consistent stratification of patients for enrollment in clinical trials, and the laboratory services in the states of California, Florida, foundation for establishing optimized treatment schedules linked to patient’s Maryland, New York, Pennsylvania, and Rhode Island. individual profile. LabPMM provides reliable patient stratification at diagnosis LabPMM GmbH and monitoring, throughout the entire course of treatment in support of Personalized Molecular Medicine® and Personalized Based in Martinsried (Munich), Germany. It is an ISO 15189 Molecular Diagnostics®. accredited international reference laboratory. CLIA/CAP accreditation is planned. Invivoscribe currently operates four clinical laboratories to serve partners in the USA (San Diego, CA), Europe (Munich, Germany), and Asia (Tokyo, Japan and Shanghai, China). These laboratories use the same critical LabPMM 合同会社 reagents and software which are developed consistently with ISO Located in Kawasaki (Tokyo), Japan and a licensed clinical lab. 13485 design control. Our cGMP reagents, rigorous standards for assay development & validation, and testing performed consistently under ISO 15189 requirements help ensure LabPMM generates standardized and concordant test results worldwide. Invivoscribe Diagnostic Technologies (Shanghai) Co., Ltd. LabPMM is an international network of PersonalMed Laboratories® focused on molecular oncology biomarker studies. Located in Shangai, China.
    [Show full text]
  • Oncogenic KRAS and BRAF Drive Metabolic Reprogramming in Colorectal Cancer
    Oncogenic KRAS and BRAF Drive Metabolic Reprogramming in Colorectal Cancer By Josiah Ewing Hutton, III. Dissertation Submitted to the Faculty of the Graduate School of Vanderbilt University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY in Biochemistry December 2016 Nashville, Tennessee Approved: Daniel C. Liebler, Ph.D. Robert J. Coffey, M.D. Bruce D. Carter, Ph.D. Nicholas J. Reiter, Ph.D. Jamey D. Young, Ph.D. Charles R. Sanders, Ph.D. Acknowledgements I would like to acknowledge my mentor, Dr. Daniel Liebler, for his constant guidance throughout my graduate career. Dan allowed me the freedom to develop as a scientist, and tactfully provided the tutelage and discussion I needed at exactly the right time and not a moment earlier. I will be grateful for his mentorship, insight, and his wit for the rest of my career. I would also like to acknowledge all current and former laboratory members for not only providing insight and guidance with my dissertation, but also for making every single day in lab enjoyable. I wish to acknowledge my committee members, Dr. Bruce Carter, Dr. Robert Coffey, Dr. Nicholas Reiter, Dr. Charles Sanders, and Dr. Jamey Young. Our meetings throughout the years have helped to guide my research to the work that it is today. I am grateful to my friends, who have always been there for me and would quietly, and sometimes not so quietly, listen to me rehearse my dissertation while we were climbing, so long as I would then push them to climb harder. Lastly, I am grateful to my family, who have always supported me and driven me to work harder.
    [Show full text]
  • IDH2 Mutations—Co-Opting Cellular Metabolism for Malignant Transformation Eytan M
    Published OnlineFirst November 9, 2015; DOI: 10.1158/1078-0432.CCR-15-0362 Molecular Pathways Clinical Cancer Research Molecular Pathways: IDH2 Mutations—Co-opting Cellular Metabolism for Malignant Transformation Eytan M. Stein Abstract Mutations in mitochondrial IDH2, one of the three isoforms function that catalyzes the conversion of alpha-ketoglutarate to of IDH, were discovered in patients with gliomas in 2009 and beta-hydroxyglutarate (2-HG). Supranormal levels of 2-HG subsequently described in acute myelogenous leukemia (AML), lead to hypermethylation of epigenetic targets and a subse- angioimmunoblastic T-cell lymphoma, chondrosarcoma, and quent block in cellular differentiation. AG-221, a small-mole- intrahepatic chloangiocarcinoma. The effects of mutations in cule inhibitor of mutant IDH2, is being explored in a phase I IDH2 on cellular metabolism, the epigenetic state of mutated clinical trial for the treatment of AML, other myeloid malig- cells, and cellular differentiation have been elucidated in vitro nancies, solid tumors, and gliomas. Clin Cancer Res; 22(1); 16–19. and in vivo.MutationsinIDH2 lead to an enzymatic gain of Ó2015 AACR. Background Interestingly, in a screen of 398 patients with AML, TET2 and IDH2 mutations were mutually exclusive, suggesting that these Isocitrate dehydrogenase (IDH) catalyzes the conversion of two mutations have a similar function. Wild-type TET2 demethy- isocitrate to alpha-ketoglutarate. IDH occurs in three isoforms, lates DNA, and mutations in TET2 lead to increases in 5-methyl- IDH1, located in the cytoplasm, IDH2 located in the mitochon- cytosine similar to those seen in patients with IDH mutations. It dria, and IDH3, which functions as part of the tricarboxylic acid has been suggested that elevated levels of 2-HG caused by mutant cycle.
    [Show full text]
  • Effect of Citric Acid Cycle Genetic Variants and Their Interactions With
    cancers Article Effect of Citric Acid Cycle Genetic Variants and Their Interactions with Obesity, Physical Activity and Energy Intake on the Risk of Colorectal Cancer: Results from a Nested Case-Control Study in the UK Biobank Sooyoung Cho 1 , Nan Song 2,3 , Ji-Yeob Choi 2,4,5 and Aesun Shin 1,2,* 1 Department of Preventive Medicine, Seoul National University College of Medicine, Seoul 03080, Korea; [email protected] 2 Cancer Research Institute, Seoul National University, Seoul 03080, Korea; [email protected] (N.S.); [email protected] (J.-Y.C.) 3 Department of Epidemiology and Cancer Control, St. Jude Children’s Research Hospital, Memphis, TN 38105, USA 4 Department of Biomedical Sciences, Graduate School of Seoul National University, Seoul 03080, Korea 5 Medical Research Center, Institute of Health Policy and Management, Seoul National University, Seoul 03080, Korea * Correspondence: [email protected]; Tel.: +82-2-740-8331; Fax: +82-2-747-4830 Received: 18 August 2020; Accepted: 9 October 2020; Published: 12 October 2020 Simple Summary: The citric acid cycle has a central role in the cellular energy metabolism and biosynthesis of macromolecules in the mitochondrial matrix. We identified the single nucleotide polymorphisms (SNPs) of the citrate acid cycle with colorectal cancer susceptibility in UK population. Furthermore, we found the significant interaction of SNPs in the citric acid cycle with the contributors to energy balance and SNP-SNP interactions. Our findings provide clues to the etiology in cancer development related to energy metabolism and evidence on identification of the population at high risk of colorectal cancer.
    [Show full text]
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
    [Show full text]
  • Mtor Coordinates Transcriptional Programs and Mitochondrial Metabolism of Activated Treg Subsets to Protect Tissue Homeostasis
    ARTICLE DOI: 10.1038/s41467-018-04392-5 OPEN mTOR coordinates transcriptional programs and mitochondrial metabolism of activated Treg subsets to protect tissue homeostasis Nicole M. Chapman1, Hu Zeng 1, Thanh-Long M. Nguyen1, Yanyan Wang1, Peter Vogel 2, Yogesh Dhungana1, Xiaojing Liu3, Geoffrey Neale 4, Jason W. Locasale 3 & Hongbo Chi1 1234567890():,; Regulatory T (Treg) cells derived from the thymus (tTreg) and periphery (pTreg) have central and distinct functions in immunosuppression, but mechanisms for the generation and acti- vation of Treg subsets in vivo are unclear. Here, we show that mechanistic target of rapamycin (mTOR) unexpectedly supports the homeostasis and functional activation of tTreg and pTreg cells. mTOR signaling is crucial for programming activated Treg-cell function to protect immune tolerance and tissue homeostasis. Treg-specific deletion of mTOR drives sponta- neous effector T-cell activation and inflammation in barrier tissues and is associated with reduction in both thymic-derived effector Treg (eTreg) and pTreg cells. Mechanistically, mTOR functions downstream of antigenic signals to drive IRF4 expression and mitochondrial metabolism, and accordingly, deletion of mitochondrial transcription factor A (Tfam) severely impairs Treg-cell suppressive function and eTreg-cell generation. Collectively, our results show that mTOR coordinates transcriptional and metabolic programs in activated Treg subsets to mediate tissue homeostasis. 1 Department of Immunology, St. Jude Children’s Research Hospital, 262 Danny Thomas Place, MS 351, Memphis, TN 38105, USA. 2 Department of Pathology, St. Jude Children’s Research Hospital, 262 Danny Thomas Place, MS 250, Memphis, TN 38105, USA. 3 Department of Pharmacology & Cancer Biology, Duke University School of Medicine, Levine Science Research Center C266, Box 3813, Durham, NC 27710, USA.
    [Show full text]
  • Laboratory Genetic Testing in Clinical Practice
    BioMed Research International Laboratory Genetic Testing in Clinical Practice Guest Editors: Ozgur Cogulu, Yasemin Alanay, and Gokce A. Toruner Laboratory Genetic Testing in Clinical Practice BioMed Research International Laboratory Genetic Testing in Clinical Practice Guest Editors: Ozgur Cogulu, Yasemin Alanay, and Gokce A. Toruner Copyright © 2013 Hindawi Publishing Corporation. All rights reserved. This is a special issue published in “BioMed Research International.” All articles are open access articles distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Contents Laboratory Genetic Testing in Clinical Practice,OzgurCogulu,YaseminAlanay,andGokceA.Toruner Volume 2013, Article ID 532897, 1 page Identification and Characterization of DM1 Patients by a NewDiagnostic Certified Assay: Neuromuscular and Cardiac Assessments, Rea Valaperta, Valeria Sansone, Fortunata Lombardi, Chiara Verdelli, Alessio Colombo, Massimiliano Valisi, Elisa Brigonzi, Elena Costa, and Giovanni Meola Volume 2013, Article ID 958510, 6 pages Ultradeep Pyrosequencing of Hepatitis C Virus Hypervariable Region 1 in Quasispecies Analysis, Kamila Caraballo Cortes,´ Osvaldo Zagordi, Tomasz Laskus, Rafal Ploski, Iwona Bukowska-O´sko, Agnieszka Pawelczyk, Hanna Berak, and Marek Radkowski Volume 2013, Article ID 626083, 10 pages Feasibility of a Microarray-Based Point-of-Care CYP2C19 Genotyping Test for Predicting Clopidogrel On-Treatment Platelet
    [Show full text]
  • Anti-IDH3A Antibody (ARG42205)
    Product datasheet [email protected] ARG42205 Package: 100 μl anti-IDH3A antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes IDH3A Tested Reactivity Hu, Ms, Rat Tested Application ICC/IF, IHC-P, WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name IDH3A Antigen Species Human Immunogen Recombinant fusion protein corresponding to aa. 28-366 of Human IDH3A (NP_005521.1). Conjugation Un-conjugated Alternate Names Isocitrate dehydrogenase [NAD] subunit alpha, mitochondrial; EC 1.1.1.41; NAD; Isocitric dehydrogenase subunit alpha; + Application Instructions Application table Application Dilution ICC/IF 1:50 - 1:200 IHC-P 1:50 - 1:200 WB 1:500 - 1:2000 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Positive Control Raji Calculated Mw 40 kDa Observed Size ~ 40 kDa Properties Form Liquid Purification Affinity purified. Buffer PBS (pH 7.3), 0.02% Sodium azide and 50% Glycerol. Preservative 0.02% Sodium azide Stabilizer 50% Glycerol Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw www.arigobio.com 1/3 cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. Note For laboratory research only, not for drug, diagnostic or other use. Bioinformation Gene Symbol IDH3A Gene Full Name isocitrate dehydrogenase 3 (NAD+) alpha Background Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate.
    [Show full text]
  • Src-Family Kinases Impact Prognosis and Targeted Therapy in Flt3-ITD+ Acute Myeloid Leukemia
    Src-Family Kinases Impact Prognosis and Targeted Therapy in Flt3-ITD+ Acute Myeloid Leukemia Title Page by Ravi K. Patel Bachelor of Science, University of Minnesota, 2013 Submitted to the Graduate Faculty of School of Medicine in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Pittsburgh 2019 Commi ttee Membership Pa UNIVERSITY OF PITTSBURGH SCHOOL OF MEDICINE Commi ttee Membership Page This dissertation was presented by Ravi K. Patel It was defended on May 31, 2019 and approved by Qiming (Jane) Wang, Associate Professor Pharmacology and Chemical Biology Vaughn S. Cooper, Professor of Microbiology and Molecular Genetics Adrian Lee, Professor of Pharmacology and Chemical Biology Laura Stabile, Research Associate Professor of Pharmacology and Chemical Biology Thomas E. Smithgall, Dissertation Director, Professor and Chair of Microbiology and Molecular Genetics ii Copyright © by Ravi K. Patel 2019 iii Abstract Src-Family Kinases Play an Important Role in Flt3-ITD Acute Myeloid Leukemia Prognosis and Drug Efficacy Ravi K. Patel, PhD University of Pittsburgh, 2019 Abstract Acute myelogenous leukemia (AML) is a disease characterized by undifferentiated bone-marrow progenitor cells dominating the bone marrow. Currently the five-year survival rate for AML patients is 27.4 percent. Meanwhile the standard of care for most AML patients has not changed for nearly 50 years. We now know that AML is a genetically heterogeneous disease and therefore it is unlikely that all AML patients will respond to therapy the same way. Upregulation of protein-tyrosine kinase signaling pathways is one common feature of some AML tumors, offering opportunities for targeted therapy.
    [Show full text]
  • Kras, Braf, Erbb2, Tp53
    Supplementary Table 1. SBT-EOC cases used for molecular analyses Fresh Frozen Tissue FFPE Tissue Tumour HRM Case ID PCR-Seq HRM component Oncomap (KRAS, BRAF, CNV GE CNV IHC (NRAS) (TP53 Only) ERBB2, TP53) Paired Cases 15043 SBT & INV √ √ √ √ √ √ 65662 SBT & INV √ √ √ √ √ 65661 SBT & INV √ √ √ √ √ √ 9128 SBT & INV √ √ √ √ √ 2044 SBT & INV √ √ √ √ √ 3960 SBT & INV √ √ √ √ √ 5899 SBT & INV √ √ √ √ √ 65663 SBT & INV √ √ √ Inv √ √ √ 65666 SBT √ Inv √ √ √ √ √ 65664 SBT √ √ √ Inv √ √ √ √ √ 15060 SBT √ √ √ Inv √ √ √ √ √ 65665 SBT √ √ √ Inv √ √ √ √ √ 65668 SBT √ √ √ Inv √ √ √ √ 65667 SBT √ √ √ Inv √ √ √ √ 15018 SBT √ Inv √ √ √ √ 15071 SBT √ Inv √ √ √ √ 65670 SBT √ Inv √ √ √ 8982 SBT √ Unpaired Cases 15046 Inv √ √ √ 15014 Inv √ √ √ 65671 Inv √ √ √ 65672 SBT √ √ √ 65673 Inv √ √ √ 65674 Inv √ √ √ 65675 Inv √ √ √ 65676 Inv √ √ √ 65677 Inv √ √ √ 65678 Inv √ √ √ 65679 Inv √ √ √ Fresh Frozen Tissue FFPE Tissue Tumour HRM Case ID PCR-Seq HRM component Oncomap (KRAS, BRAF, CNV GE CNV IHC (NRAS) (TP53 Only) ERBB2, TP53) 65680 Inv √ √ √ 5349 Inv √ √ √ 7957 Inv √ √ √ 8395 Inv √ √ √ 8390 Inv √ √ 2110 Inv √ √ 6328 Inv √ √ 9125 Inv √ √ 9221 Inv √ √ 10701 Inv √ √ 1072 Inv √ √ 11266 Inv √ √ 11368 Inv √ √ √ 12237 Inv √ √ 2064 Inv √ √ 3539 Inv √ √ 2189 Inv √ √ √ 5711 Inv √ √ 6251 Inv √ √ 6582 Inv √ √ 7200 SBT √ √ √ 8633 Inv √ √ √ 9579 Inv √ √ 10740 Inv √ √ 11766 Inv √ √ 3958 Inv √ √ 4723 Inv √ √ 6244 Inv √ √ √ 7716 Inv √ √ SBT-EOC, serous carcinoma with adjacent borderline regions; SBT, serous borderline component of SBT- EOC; Inv, invasive component of SBT-EOC;
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]