DOCSLIB.ORG

An Introduction to DKFZ

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
An Introduction to DKFZ An Introduction to DKFZ Otmar D. Wiestler Deutsches Krebsforschungszentrum, Heidelberg Page 1 DKFZ Locations on Campus Cancer Research @ DKFZ • Established in 1964 • National research center • Helmholtz association • Location on Heidelberg biomedical campus • Team of 3000 members • Funding from BMBF & BW • Coordination of national & international activities Helmholtz International Graduate School for Cancer Research • High quality, comprehensive, structured and interdisciplinary graduate training in cancer research • Vivid interaction with international partners (Karolinska, MDACC, WIS) • Cooperation with Universites and Helmholtz centers 450 graduate students National Reference Center for Cancer Information New and expanding research fields Cancer genome Epigenetics, Small regulatory RNAs Systems biology of cancer & modelling Angiogenesis Cancer stem cells Metabolic dysfunction & cancer Cancer immunotherapies Neurooncology High field MRI, molecular imaging Particle therapy, radiation biology Epidemiology, early detection & prevention Stem cells & Cancer • Cancers originate from somatic stem or progenitor cells • Cancer cells with stem cell properties control tumor growth and biology • Cancer stem cells serve as a reservoir for tumor progression and recurrence DKFZ Cancer Stem Cell Program Joint activity with the Dietmar-Hopp-Foundation Three HI-STEM Junior Research Groups Marieke Essers Michael Milsom Christoph Rösli Cancer Genome Consortium • High number of genomic alterations in cancer cells • Striking inter-individual variability • Mutation analysis as basis for individualized treatment • International Cancer Genome Consortium Isocitrate dehydrogenases IDH1 IDH2 cytosolic mitochondrial NADP+ specific NADP+ specific IDH3A / IDH3B / IDH3G Mitochondrial NAD+ specific Andreas von Deimling Isocitrate dehydrogenase 1 0.500 0.450 untr. 0.400 wt H 0.350 E Q 0.300 S C V 0.250 L G 0.200 GFP 0.150 0.100 0.050 0.000 0 5 10 15 20 25 30 35 40 45 wt mut % mut IDH1 Pilocytic astrocytoma WHO grade I (PA I) 41 40 1 2% Subependymal giant cell astrocytoma WHO grade I (SEGA I) 12 12 0 0% Pleomorphic xanthoastrocytoma WHO grade II (PXA II) 7 7 0 0% 685 Astrocytoma WHO grade II (A II) 46 13 34 74% Anaplastic astrocytoma WHO grade III (A III) 47 18 29 62% CNS tumors Primary Glioblastoma WHO grade IV (prGBM) 99 92 7 7% Secondary glioblastoma WHO grade IV (secGBM) 8 1 7 88% Giant cell glioblastoma WHO grade IV (gcGBM) 8 6 2 25% Pediatric Glioblastoma WHO grade IV (pedGBM) 14 13 1 7% Gliosarcoma WHO grade IV (GS) 5 5 0 - Oligodendroglioma WHO grade II (O II) 51 15 36 71% Anaplastic oligodendroglioma WHO grade III (O III) 54 18 36 67% Oligoastrocytoma WHO grade II (OA II) 46 10 36 78% Anaplastic oligoastrocytoma WHO grade III (OA III) 37 8 29 78% Myxopapillary ependymoma WHO grade I (E myx I) 6 5 0 - Ependymoma WHO grade II (E II) 15 15 0 0% Anaplastic ependymoma WHO grade III (E III) 10 10 0 0% Medulloblastoma WHO grade IV (MB IV) 58 58 0 0% Primitive neuroectodermal tumor WHO grade IV (PNET) 9 6 3 33 % Schwannoma WHO grade I (S I) 17 17 0 0% Meningioma WHO grade I (M I) 38 38 0 0% Atypical meningioma WHO grade II (M II) 17 17 0 0% Anaplastic meningioma WHO grade III (M III) 17 17 0 0% Pituitary adenoma WHO grade I (PIAD) 23 23 0 0% Cancer Genome Research PED-NET Additional projects : Early onset prostate cancer Malignant lymphoma Cancer Genome Research International Cancer Genome Consortium DKFZ ultradeep sequencing facility Data storage facility BioQuant & DKFZ 6 petabyte capacity Cancer genome sequencing in a diagnostic setting Peter Lichter, Roland Eils Cancer genome sequencing • RNA / exome sequencing • Genome sequencing Brain tumors Prostate cancer High capacity ultradeep Pancreatic cancer sequencing facility at DKFZ • Applied bioinformatics • Vector insertion analysis NCT Outpatient Cancer Genome Treatment Unit Research Group PAGE 18 Strategies for Cancer Immunotherapy T Cell Therapy IMMUNOTHERAPY Breaking Leukemia Hepato- Vaccination Apoptosis and cellular Melanoma Strategies Resistance Lymphoma Carcinoma IMMUNOMONITORING Antibody Therapy APG101 : First in man • DKFZ spin off Extracellular domain of the human CD95 receptor • First CD95 ligand blocker in clinical development • Specific inhibitor of CD95L mediated activation Fc-domain of human IgG • Well tolerated in phase I CD95 • Phase II trial in GBM ongoing Ligand CD95 • Cell FAD PI3 Additional clinical targets D K (pancreas, MDS, GvHD) Caspases AKT/NFkB 8/3 Apoptosis Survival Migration PREPARATION OF A PHASE I/II CLINICAL TRIAL FOR ONCO- LYTIC VIROTHERAPY OF GLIOBLASTOMA MULTIFORME Jean ROMMELAIRE & Karsten GELETNEKY, DKFZ & University of Heidelberg Why glioblastoma? Preclinical proof of concept H-1 PV days p.i. (rat autologous intracranial glioma) • most common primary • complete recovery from symptomatic brain tumour disease, without signs of toxic or (2-3 % of all human inflamatory side effects 0 malignancies) • long term survival without tumour • dismal relapse prognosis 1 Survival 3 (< 5% long term rate: H-1 survivors) 0.5 control 7 0 10 20 30 from: Kleihues, P., days after implantation Kiessling, M., Wiestler, O.D. (2004) Trial •Target: non-resectable, progressing, malignant non-multifocal glioma (grade IV) •Design: single center, non-randomized, i.t. dose escalation study •Objective: assessment of safety and biodistribution of H-1 PV, evidence for antitumoral activity 7T MRI : a new dimension in medical imaging Glioblastoma multiforme 7 T: TSE T2 7 T: MR Angiography 7 T MRI : A new dimension in MR imaging Image guided radiation therapy • Artiste : CT-LINAC for IGRT • MR-LINAC for IGRT • Continuous real time adaptation of the radiation beam Heidelberg Ion-Beam Therapy Center A new era in radiooncology Enrolling patients since Nov. 2009 • Image-guided radiotherapy • Clinical targets for particle therapy • Ions vs. protons and photons • Radiooncology and biologicals • Applied radiobiology (modulators of RT) Prevention is better than cure ! Vaccination against oncogenic human papilloma viruses : A milestone in preventive oncology Nobel prize for Harald zur Hausen 2008 Model projects in preventive oncology • Early detection of colorectal cancer • Colorectal cancer in 1st degree relatives • Metabolic syndrome & cancer • Physical activity and cancer • Familial cancers (BRCA, HNPCC) • National cohort study National Cohort • 200,000 adults (20-70 years) North west: Kiel • Multiple regions in Germany n=30,000 Lübeck Neubrandenburg Hamburg • Close cooperation between Bremen Helmholtz centers and Berlin (MDC) Hannover Braunschweig Brandenburg Universities (HZI) Münster • 8 National recruitment Essen Bochum Halle centers Düsseldorf Leipzig Bonn • Defined subcohorts (DZNE) • Close collaboration with universities Saarland Mannheim Heidelberg Regensburg • Training pograms (DKFZ) Augsburg (HMGU) Freiburg Projected age distribution Joint activities & structures Clinical Cooperation Immunology Units (SFB 938, Alliance) Junior Research Stem Cell Research Groups (SFB 873, HI-STEM) Funding for Neurooncology Tandem Projects (NGFN, ICGC) Funding for MD Imaging Students & Rotations Heidelberg Ion Radiooncology Training Activities Therapy (HIT) (HIRO) Translational research requires national efforts • Translational cancer research facing grand challenges • Excellent research in German laboratories • Individual sites not sufficiently competitive • Lack of coordinated efforts and critical mass • Translational research requires novel alliances between the best partners Translational research programs Translational research platforms Consortium School of Oncology Provide Education in Clinical Oncology, combining training on interdisciplinary cancer diagnosis, HSO patient care and translational cancer research Facilitate and improve multidisciplinary,scientific and clinical interactions between laboratory-based HSO scientists and clinician scientists Establish training programs in translational research for physicians, physician scientists and HSO life science experts Offer continued medical education for center physicians, GPs and private practitioners HSO in oncology International relationships 30 yrs. DKFZ & MOST / Israel joint funding program INSERM unit and DKFZ - Canceropolé consortium Helmholtz units at French INSERM sites DKFZ & MD Anderson Cancer Center SI agreement DKFZ & NCI exchange program DKFZ & Karolinska DKFZ & NCC Tokyo DKFZ & Clinica d‘Alemana (Santiago de Chile) DKFZ & Weizmann Institute joint graduate school Programs with partners from China, Poland, Tanzania German-Israeli Helmholtz Research School in Cancer Biology DKFZ & NCI, Washington February 2010 DKFZ & Siemens Health Care A strong R&D alliance • Integrated Diagnosis & Therapy (IDTZ) • High field MRI (7T) for oncology • Molecular imaging • IT platform Public Private Partnerships • Strategic alliance DKFZ & Siemens • Strategic alliance DKFZ & Bayer Schering Pharma • Hi-STEM & BioRN • Spin outs Apogenix Progen mtm Affimed Oncology of the Future • Molecular diagnosis & stratification • Targeted treatments • Innovative radiooncology • Intelligent combinations • Individualized treatment • Cancer as chronic disease • Cancer prevention Welcome to the German Cancer Research Center ! Welcome at the DKFZ ! .
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Oncogenic KRAS and BRAF Drive Metabolic Reprogramming in Colorectal Cancer
    Oncogenic KRAS and BRAF Drive Metabolic Reprogramming in Colorectal Cancer By Josiah Ewing Hutton, III. Dissertation Submitted to the Faculty of the Graduate School of Vanderbilt University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY in Biochemistry December 2016 Nashville, Tennessee Approved: Daniel C. Liebler, Ph.D. Robert J. Coffey, M.D. Bruce D. Carter, Ph.D. Nicholas J. Reiter, Ph.D. Jamey D. Young, Ph.D. Charles R. Sanders, Ph.D. Acknowledgements I would like to acknowledge my mentor, Dr. Daniel Liebler, for his constant guidance throughout my graduate career. Dan allowed me the freedom to develop as a scientist, and tactfully provided the tutelage and discussion I needed at exactly the right time and not a moment earlier. I will be grateful for his mentorship, insight, and his wit for the rest of my career. I would also like to acknowledge all current and former laboratory members for not only providing insight and guidance with my dissertation, but also for making every single day in lab enjoyable. I wish to acknowledge my committee members, Dr. Bruce Carter, Dr. Robert Coffey, Dr. Nicholas Reiter, Dr. Charles Sanders, and Dr. Jamey Young. Our meetings throughout the years have helped to guide my research to the work that it is today. I am grateful to my friends, who have always been there for me and would quietly, and sometimes not so quietly, listen to me rehearse my dissertation while we were climbing, so long as I would then push them to climb harder. Lastly, I am grateful to my family, who have always supported me and driven me to work harder.
    [Show full text]
  • 19 Research Centers – One Association Shaping the Future Together
    19 RESEARCH CENTERS – ONE ASSOCIATION SHAPING THE FUTURE TOGETHER The Helmholtz Association comprises 19 scientific-technical Cooperation and biological-medical Research Centers with more than Helmholtz cooperates with the best national and international 40,000 employees and an annual budget of more than 4.7 billion partners from science, industry and politics in order to achieve euros. outstanding research results quickly and efficiently. Our research transcends the boundaries of disciplines and countries. In this Research for Mankind and the Environment way, Helmholtz is internationally competitive and able to deliver a All research at Helmholtz – whether it concerns climate change, a decisive contribution to solving the major challenges facing society. sustainable energy supply, the mobility of tomorrow, the preserva- tion of an intact ecosystem or the treatment for diseases – is Research Infrastructures and large-scale Facilities ultimately aiming at securing the foundation of human life in the Accelerator systems, research vessels, observatories or super- long term and creating the technological basis for a competitive computers – Helmholtz offers scientists unique research infra- economy. structures and large-scale facilities. Every year, more than 10,000 visiting scientists from more than 30 countries benefit from the Excellent Science from basic Research to Application unique research opportnities offered by our Helmholtz Centers. Around 16,000 scientific publications, more than 400 patent applications per year and currently around 3,000 industry International Project Management collaborations – Helmholtz has an excellent track record in both Helmholtz is frequently the hub of large-scale international research basic research and the development of applications. We have the tenacity to drive large-scale projects forward.
    [Show full text]
  • Helmholtz Association Perspectives for Junior Researchers
    Helmholtz Association Perspectives for junior researchers Dr. Caroline Krüger Forschen in Europa, September 2012 HELMHOLTZ MISSION . Seeking solutions for major societal challenges with cutting-edge research . Think big, act big: Developing and operating complex infrastructure and large-scale facilities for the national and international scientific community . Creating wealth for society and industry through transfer of knowledge and innovation PAGE 2 FACTS AND FIGURES . 33,634 Staff . 11,369 scientists & engineers . 6,234 PhD students . 1,623 vocational trainees . Budget 2012: €3.4 billion . €2.1 bn: Institutional funding (90% federal, 10% local) . €1.1 bn: Third-party funding . €0.1 bn: Other (Helmholtz Institutes, National Centres for Health Research) Germany's largest scientific research organisation. PAGE 3 HELMHOLTZ CENTRES . Alfred Wegener Institute for Polar and Marine Research (AWI) . Deutsches Elektronen-Synchrotron DESY . German Cancer Research Center (DKFZ) . German Centre for Neurodegenerative Diseases (DZNE) . German Aerospace Center (DLR) . Forschungszentrum Jülich (FZJ) . Karlsruhe Institute of Technology (KIT) . GSI Helmholtz Centre for Heavy Ion Research . Helmholtz-Zentrum Berlin für Materialien und Energie (HZB) . Helmholtz-Zentrum Dresden-Rossendorf (HZDR) . Helmholtz Centre for Environmental Research - UFZ . Helmholtz Centre for Infection Research (HZI) . Helmholtz-Zentrum Geesthacht - Centre for Materials and Coastal Research (HZG) . Helmholtz Zentrum München - German Research Center for Environmental Health (HMGU)
    [Show full text]
  • Laboratory Genetic Testing in Clinical Practice
    BioMed Research International Laboratory Genetic Testing in Clinical Practice Guest Editors: Ozgur Cogulu, Yasemin Alanay, and Gokce A. Toruner Laboratory Genetic Testing in Clinical Practice BioMed Research International Laboratory Genetic Testing in Clinical Practice Guest Editors: Ozgur Cogulu, Yasemin Alanay, and Gokce A. Toruner Copyright © 2013 Hindawi Publishing Corporation. All rights reserved. This is a special issue published in “BioMed Research International.” All articles are open access articles distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Contents Laboratory Genetic Testing in Clinical Practice,OzgurCogulu,YaseminAlanay,andGokceA.Toruner Volume 2013, Article ID 532897, 1 page Identification and Characterization of DM1 Patients by a NewDiagnostic Certified Assay: Neuromuscular and Cardiac Assessments, Rea Valaperta, Valeria Sansone, Fortunata Lombardi, Chiara Verdelli, Alessio Colombo, Massimiliano Valisi, Elisa Brigonzi, Elena Costa, and Giovanni Meola Volume 2013, Article ID 958510, 6 pages Ultradeep Pyrosequencing of Hepatitis C Virus Hypervariable Region 1 in Quasispecies Analysis, Kamila Caraballo Cortes,´ Osvaldo Zagordi, Tomasz Laskus, Rafal Ploski, Iwona Bukowska-O´sko, Agnieszka Pawelczyk, Hanna Berak, and Marek Radkowski Volume 2013, Article ID 626083, 10 pages Feasibility of a Microarray-Based Point-of-Care CYP2C19 Genotyping Test for Predicting Clopidogrel On-Treatment Platelet
    [Show full text]
  • Anti-IDH3A Antibody (ARG42205)
    Product datasheet [email protected] ARG42205 Package: 100 μl anti-IDH3A antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes IDH3A Tested Reactivity Hu, Ms, Rat Tested Application ICC/IF, IHC-P, WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name IDH3A Antigen Species Human Immunogen Recombinant fusion protein corresponding to aa. 28-366 of Human IDH3A (NP_005521.1). Conjugation Un-conjugated Alternate Names Isocitrate dehydrogenase [NAD] subunit alpha, mitochondrial; EC 1.1.1.41; NAD; Isocitric dehydrogenase subunit alpha; + Application Instructions Application table Application Dilution ICC/IF 1:50 - 1:200 IHC-P 1:50 - 1:200 WB 1:500 - 1:2000 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Positive Control Raji Calculated Mw 40 kDa Observed Size ~ 40 kDa Properties Form Liquid Purification Affinity purified. Buffer PBS (pH 7.3), 0.02% Sodium azide and 50% Glycerol. Preservative 0.02% Sodium azide Stabilizer 50% Glycerol Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw www.arigobio.com 1/3 cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. Note For laboratory research only, not for drug, diagnostic or other use. Bioinformation Gene Symbol IDH3A Gene Full Name isocitrate dehydrogenase 3 (NAD+) alpha Background Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate.
    [Show full text]
  • The Stuff of the Future Hydrogen Is a Beacon of Hope for the Energy Transition
    2-20 FORSCHUNGSZENTRUM JÜLICH’S MAGAZINE The stuff of the future Hydrogen is a beacon of hope for the energy transition FROM THE AIR IN THE DEEP ACROSS BORDERS Drones help to optimise How soils can better Jülich builds bridge of manioc cultivation in Africa provide for plants knowledge to Palestine 2 AS WE SEE IT IV S10 S12 PEM-Elektrolyse-Zelle Anode Kathode 2 Unusual flying object Floating and gathering: for several weeks in May and June 2020, the Zeppelin NT could be marvelled at over the Rhineland. S13 The airship flew in the service of atmospheric research and collected measurement data on nitrogen oxides, trace gases and fine dust in the air. This is how Jülich troposphere researchers wanted to find out how the pandemic affects air quality lockdown in the corona. Climate researcher Astrid Kiendler-Scharr says more on the topic in the video (in German): fz-juelich.de/covid-luftqualitaet S14 S15 TOPICS 3 NEWS “Crisis as an 5 opportunity” How the corona pandemic is affecting the relationship between science and society. COVERIV STORY S10 S12 25 The driving force The soil Builder of bridges as a pantry How soils can sustainably supply plants with nutrients. PEM-Elektrolyse-Zelle 18 Anode Kathode RESEARCH Research cooperation: The loss of taste Ghaleb Natour brings Germany and Palestine together. Hydrogen is to help implement 26 2 the energy transition. Technology from Jülich can make an important contribution to this. 8 SECTIONS Editorial 4 SCIENCE YEAR OF THE BIOECONOMY Publication details Survey confirms the influence of COVID-19 on the sense 4 Sowing knowledge, of taste and smell.
    [Show full text]
  • Helmholtz Research for Grand Challenges
    RESEARCH FOR HELMHOLTZGRAND CHALLENGES Helmholtz Association ■ Anna-Louisa-Karsch-Straße 2- 10178 Berlin ■ Germany Coordinator of the ExtremeEarth CSA project proposal European Centre for Medium -Range Weather Forecasts -ECMWF Dr. Peter Bauer Shinfield Park Reading, Berkshire, RG2 9AX UNITED KINGDOM 07.02.2018/AT Endorsement of the Flagship candidate project ExtremeEarth (CSA proposal) Dear Dr. Bauer, On behalf of the Helmholtz Association of German Research Centres I The President am expressing my strongest support for the CSA proposal to develop a Prof. Dr. med. Dr. h.c. mult. Otmar D. Wiestler FET Flagship Project ExtremeEarth. Hermann von Helmholtz Association of German Research Centres This activity of the climate and earth system science communities to SpreePalais am Dorn develop a joint FET Flagship candidate project is a most timely and Anna-Louisa-Karsch-Straße 2 appropriate measure for the future of Europe. It will drastically enhance 10178 Berlin ■ Germany Europe's capability to predict and monitor environmental extremes and Tel. +49 30 206329-52 their impacts on society enabled by the imaginative integration of edge Fax +49 30 206329-59 and exascale computing and beyond, and the real-time exploitation of pervasive environmental data. [email protected] www.helmholtz.de The Helmholtz Association of German Research Centres is strongly involved in Earth and environmental research activities which are Head Office: pursued at eight Helmholtz Centres. Ahrstraße 45 53175 Bonn ■ Germany Understanding and advancing our ability to predict the frequency of District Court Bonn VR 7942 occurrence and intensity of extremes reliably is of paramount importance for efforts to make society more resilient to the environmental impacts of Bank details: Sparkasse KölnBonn the present and changing climate, and it will allow European IBAN: DE59 3705 0198 0029 0005 10 governments and businesses to plan more effectively than they are able BIC: COLSDE33 for current and changing climate risks.
    [Show full text]
  • The Helmholtz Association (MDC), Berlin Contact E-Mail: [email protected]
    GERMANY‘S RESEARCH LANDSCAPE AND FUNDING OPPORTUNITIES FOR COOPERATION Dr Oksana Seumenicht Managing Director, German-Ukrainian Academic Society www.ukrainet.eu International Relations Manager Max Delbrück Center for Molecular Medicine in the Helmholtz Association (MDC), Berlin www.mdc-berlin.de Contact e-mail: [email protected] KYIV German-Ukrainian Forum of Young Researchers 9 December 2017 Germany’s Research Funding Environment More than 1000 public & publicly-funded research institutions, incl.: 400 higher education institutions > 250 institutes/ centres within 4 non- university research organizations 40 federal research (e.g. Robert Koch Institute) 130 state (Länder) research institutes/ centres 605,000 staff in R&D, incl. 361,000 researchers Page 2 Funding Organizations Federal Ministry for Education and Research (BMBF): core funding of institutes, targeted strategic initiatives, support of international collaboration German Research Foundation (DFG): national research funding agency (grants for projects and programmes) German Academic Exchange Service (DAAD): individual scholarships and programme grants to support internationalisation of German universities Alexander von Humboldt Foundation: individual scholarships & prizes (for PhD-level scientists), strong support of the alumni network Foundations: Volkswagen Stiftung, Robert Bosch Stiftung, Landesstiftung Baden-Württemberg, Bertelsmann-Stiftung, Fritz Thyssen Stiftung, BI Fonds, etc. http://www.stiftungen.org/en/association-of-german-foundations.html Higher
    [Show full text]
  • Helmholtz Young Investigator Groups Our Offer Apply If You Have
    Photo: The chestnut creative HELMHOLTZ YOUNG INVESTIGATOR GROUPS OUR OFFER APPLY IF YOU HAVE • Early scientific independence for • Between 2 and 6 years of research excellent postdoctoral researchers experience after your doctorate • Funding of at least € 300,000 p.a. for • International research experience six years to lead a research group • An exceptional scientific record • A permanent position in case of a positive midterm evaluation • An innovative research project in one of the research fields of the • Professional skills training by the Helmholtz Association Helmholtz Management Academy • Strong motivation to set up and • Close collaboration with a university, lead your own research group often as joint appointments “The Helmholtz Young Investigator Group program was a great way to start an independent group in a multidisciplinary research center and to establish myself within the field. It is a fantastic opportunity for going from a postdoc to becoming an established group leader.” Photo: DKFZ/Tobias Schwerdt aurelio teleman Head of Division/Professor German Cancer Research Center/University of Heidelberg Helmholtz Young Investigator Group Leader 2007 “Winning a prestigious Helmholtz Young Investigator Group has been a game changer for my academic career. Besides its high reputation, it offered me the opportunity to build up an interdisciplinary research group under exciting working environments – being involved in big satellite missions and academia at the same time.” Xiaoxiang ZHU Group Leader/Professor German Aerospace Center/Technical University of Munich Helmholtz Young Investigator Group Leader 2013 APPLICATION PROCEDURE THE HELMHOLTZ ASSOCIATION The Helmholtz Association is Germany’s largest 1. Please contact the Helmholtz Center that best fits research organization.
    [Show full text]
  • Mouse Idh3a Mutations Cause Retinal Degeneration and Reduced Mitochondrial Function Amy S
    © 2018. Published by The Company of Biologists Ltd | Disease Models & Mechanisms (2018) 11, dmm036426. doi:10.1242/dmm.036426 RESEARCH ARTICLE Mouse Idh3a mutations cause retinal degeneration and reduced mitochondrial function Amy S. Findlay1, Roderick N. Carter2, Becky Starbuck3, Lisa McKie1, Klára Nováková1, Peter S. Budd1, Margaret A. Keighren1, Joseph A. Marsh1, Sally H. Cross1, Michelle M. Simon3, Paul K. Potter3, Nicholas M. Morton2 and Ian J. Jackson1,4,* ABSTRACT these diseases have a wide range of pathologies (Koopman et al., Isocitrate dehydrogenase (IDH) is an enzyme required for the 2012). Common to many of the diseases, however, are neurological production of α-ketoglutarate from isocitrate. IDH3 generates the or neuromuscular manifestations, including retinal disease. We have NADH used in the mitochondria for ATP production, and is a tetramer identified a missense mutation in the gene encoding a subunit of the made up of two α, one β and one γ subunit. Loss-of-function and tricarboxylic acid (TCA) cycle enzyme isocitrate dehydrogenase 3 missense mutations in both IDH3A and IDH3B have previously been (IDH3) as causing a retinal degeneration phenotype in mice. There implicated in families exhibiting retinal degeneration. Using mouse are three isocitrate dehydrogenase isozymes in mammals. IDH1 and models, we investigated the role of IDH3 in retinal disease and IDH2 are both homodimers that catalyse the decarboxylation of α mitochondrial function. We identified mice with late-onset retinal isocitrate to -ketoglutarate with the concomitant reduction of NADP degeneration in a screen of ageing mice carrying an ENU-induced to NADPH. IDH1 is cytoplasmic, whereas IDH2 is localised to the mutation, E229K, in Idh3a.
    [Show full text]
  • A Research Giant Stays the Course
    Germany index MICHAEL GUTSCHE/ALFRED WEGENER INSTITUTE WEGENER MICHAEL GUTSCHE/ALFRED Polarstern’s Arctic mission carried hundreds of scientists to perform climate research. cutting-edge research as well as teaching. Germany’s chancellor since 2005, Angela A research giant Merkel, a physicist before she was a politician, has continued a tradition of strong science funding. Under a pact between the federal stays the course government and the Länder (states), Germa- ny’s four major organizations (Helmholtz National bodies thrive under funding certainty, but Association, Max Planck Society, Fraunhofer Society and Leibniz Association) and its central some universities suffer cuts. By Hristio Boytchev research funding organization, the German Research Foundation (DFG), jointly funded by the two levels of government, enjoyed a guar- n October 2020 the colossal German such as the Polarstern expedition. Known as anteed annual research funding increase of 5% research icebreaker, Polarstern, docked in MOSAiC (Multidisciplinary drifting Obser- for the 10 years to 2015. The annual increase the city of Bremerhaven on the North Sea vatory for the Study of Arctic Climate), the from 2015 until 2030 is set at 3%. coast. The 118-metre vessel had spent most €140-million (US$165-million) international In June, the government introduced a €60-bil- of the largest-ever Arctic expedition locked collaboration involved researchers from lion stimulus package to shore up education, Iin a giant slab of moving sea ice. On board, hun- more than 80 institutions and 20 countries. research and innovation against the impact of dreds of researchers were carried thousands of The Alfred Wegener Institute in Bremerhaven, COVID-19.
    [Show full text]