Promotes Pancreatic Tumor Growth

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Published OnlineFirst October 20, 2016; DOI: 10.1158/0008-5472.CAN-16-1666 Cancer Tumor and Stem Cell Biology Research Glucose Metabolism Reprogrammed by Overexpression of IKK« Promotes Pancreatic Tumor Growth Haseeb Zubair1, Shafquat Azim1, Sanjeev Kumar Srivastava1, Aamir Ahmad1, Arun Bhardwaj1, Mohammad Aslam Khan1, Girijesh Kumar Patel1, Sumit Arora1, James Elliot Carter2, Seema Singh1,3, and Ajay Pratap Singh1,3 Abstract Aberrant expression of the kinase IKKe in pancreatic ductal tion rate. IKKe silencing also attenuated c-Myc in a manner adenocarcinoma (PDAC) has been associated with poor prog- associated with diminished signaling through an AKT/GSK3b/ nosis. In this study, we define a pathobiologic function for c-MYC phosphorylation cascade that promoted MYC nuclear IKKe in reprogramming glucose metabolism and driving pro- accumulation. In an orthotopic mouse model, IKKe-silenced gression in PDAC. Silencing IKKe in PDAC cells, which over- PDAC exhibited a relative reduction in glucose uptake, tumor- expressed it endogenously, was sufficient to reduce malignant igenicity, and metastasis. Overall, our findings offer a preclin- cell growth, clonogenic potential, glucose consumption, lac- ical mechanistic rationale to target IKKe to improve the ther- tate secretion, and expression of genes involved in glucose apeutic management of PDAC in patients. Cancer Res; 76(24); metabolism, without impacting the basal oxygen consump- 7254–64. Ó2016 AACR. Introduction regulatory factor (IRF)-dependent gene transcription of proin- flammatory cytokines and interferons (4). It is expressed at basal Pancreatic ductal adenocarcinoma (PDAC) is one of the most levels in a subset of tissues involved in immune function, and can lethal malignancies with a 5-year survival rate of about 8% after be readily induced in a variety of cell- and tissue types upon initial diagnosis (1). It is expected to overtake breast malignancy external stimuli (5). Interestingly, IKKe has also been shown to this year as the third leading cause of cancer-related deaths in regulate energy balance in high-fat diet–induced obesity (6) and the United States with an estimated 53,070 new diagnoses and recognized to possess oncogenic properties in breast cancer (7) 41,780 deaths, and may actually become the second by 2020 if with some later reports in other cancers as well (8, 9). In many similar trends continue (1, 2). Over the years, significant progress cancer cases, including PDAC, an upregulation of IKKe, even in the has been made in our understanding of the genetics of PDAC (3); absence of gene amplification, has been reported and associated however, these seminal advancements have not helped much in with poor clinical outcome (7, 9, 10). However, we lack direct the development of an effective treatment strategy for this lethal evidence for its oncogenic activity in PDAC along with complete malignancy. As a consequence, search for novel, functionally lack of an in-depth understanding of involved molecular relevant molecular targets continues, so that effective, mecha- pathways. nism-based approaches for its therapy and management can be Cancer cells remain under constant demand for energy and formulated. building blocks to ensure their continued, rapidly proliferative Inhibitor of kappa kinase subunit-epsilon (IKKe) is an impor- development. As a result, they adapt to glycolytic metabolism, tant member of the IKK family along with four other, distinct yet even when oxygen is not a limiting factor, to meet their demands closely related, members (IKKa, IKKb, IKKg, and NAK). IKKe plays for quick energy (ATPs) and metabolic intermediates that serve as a central role in innate immunity by inducing NF-kB- and IFN building blocks for rapidly dividing cancer cells (11). This shift provides added advantage to the tumor cells, that is, the ability to 1Department of Oncologic Sciences, Mitchell Cancer Institute, University of thrive independently of oxygen diffusion that would otherwise be South Alabama, Mobile, Alabama. 2Department of Pathology, College of Med- a limiting factor for rapidly growing tumors (12). Indeed, mount- 3 icine, University of South Alabama, Mobile, Alabama. Department of Biochem- ing evidence continues to associate enhanced aerobic glycolysis to istry and Molecular Biology, College of Medicine, University of South Alabama, the etiology and malignant progression of several cancers, includ- Mobile, Alabama. ing pancreatic malignancy (13). This metabolic shift, in general, is Note: Supplementary data for this article are available at Cancer Research mediated through aberrant activation of oncogenic transcription Online (http://cancerres.aacrjournals.org/). factors, leading to altered expression of genes involved in glucose Corresponding Author: Ajay Pratap Singh, University of South Alabama, 1660 import and metabolism (14). c-MYC serves as a "master regula- Springhill Avenue, Mobile, AL 36604-1405. Phone: 251-445-9843; Fax: 251-460- tor" of growth and cellular metabolism pathways, and its aberrant 6994; E-mail: [email protected] activation is facilitated at multiple levels (15–17). Emerging doi: 10.1158/0008-5472.CAN-16-1666 clinical and experimental data also support its role in PDAC Ó2016 American Association for Cancer Research. pathobiology (10). 7254 Cancer Res; 76(24) December 15, 2016 Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 2016 American Association for Cancer Research. Published OnlineFirst October 20, 2016; DOI: 10.1158/0008-5472.CAN-16-1666 IKKe Reprograms Glucose Metabolism in Pancreatic Cancer This study provides first evidence for a link between IKKe and Growth kinetics assay c-MYC oncoprotein. We demonstrate that IKKe regulates nuclear Growth rate and population-doubling time (PDT) were deter- retention and stabilization of c-MYC through a cascade of signal- mined by counting number of viable cells using the Trypan blue ing events. We further identify a novel role of IKKe in regulating dye exclusion on the Countess Automated Cell Counter (Life glucose metabolism in PDAC, at least in part, through its c-MYC– Technologies) every day for 8 days, as described previously (18). mediated regulation of metabolic gene expression. IKKe over- expression is also shown to promote growth and metastasis of Clonogenicity assays PDAC cells, thus establishing it as an important molecular target Anchorage-dependent and anchorage-independent clonogeni- for clinical management. city assays were carried out as described previously (20). Materials and Methods qPCR and Ingenuity Pathway Analysis RNA isolation, cDNA synthesis, and qPCR were performed as Cell lines and tissue samples described previously (20) using primers listed in Supplementary The human pancreatic cell lines were obtained and maintained Table S2. The altered genes (fold-change 1.5; P 0.05) were as previously described (18). All the cell lines were tested inter- subjected to Ingenuity Pathway Analysis (IPA) to identify putative mittently and determined to be free from mycoplasma, and upstream regulator. authenticated by either in-house or commercial (Genetica DNA Laboratories) short-tandem repeats genotyping. Normal and Luciferase assay tumor pancreatic tissue specimens were obtained through the Control or IKKe-silenced PDAC cells were transfected with Southern Division of Cooperative Human Tissue Network under either a negative control or c-MYC–responsive luciferase-promot- – an Institutional Review Board approved protocol. er-reporter plasmid (Cignal MYC Reporter Assay Kit, SABios- ciences), and assayed as per the manufacturer's protocol. Antibodies Antibodies used were: anti-IKKe, -c-MYC (rabbit monoclonal), S62 T58 Nuclear and cytoplasmic fractionation -phospho-c-MYC , -phospho-c-MYC (rabbit polyclonal), Cytoplasmic and nuclear extracts were prepared using Nucle- -ubiquitin (mouse monoclonal; Abcam); -phospho-AktT308 (rab- Ser473 ar-Extract Kit (Active Motif) following the manufacturer's bit monoclonal), -phospho-Akt (rabbit polyclonal; Cell instructions. Signaling Technologies); -GSK3b, -phospho-GSK3bSer9, -Akt (rab- bit monoclonal; Epitomics); -LaminA, (mouse monoclonal), Coimmunoprecipitation analysis -a-tubulin (rabbit polyclonal; Santa Cruz Biotechnology). Anti- Coimmunoprecipitation was performed using c-MYC–specific – – b-actin HRP conjugated (mouse monoclonal) antibody was antibody as described previously (21). from Sigma-Aldrich. All secondary antibodies were from Santa Cruz Biotechnology. Glucose uptake and lactate production assays Glucose and lactate concentration in the culture media was Transfections and treatments determined using the Glucose and Lactate Assay Kit (Biovision) as Generation of stable IKKe-knockdown and control cell lines was per manufacturer's instructions. To measure glucose uptake, cells done in IKKe-overexpressing MiaPaCa and Colo357 cells by were first incubated in glucose-free, FBS-free media for 6 hours transfection of IKBKE-shRNA-pGFP-B-RS or the control-plasmid, followed by incubation with a glucose-free DMEM supplemented Scr-shRNA-pGFP-B-RS (Origene), respectively, using X-treme- with 100 mmol/L of fluorescent D-glucose derivative, 2-NBDG GENE HP DNA Transfection Reagent (Roche) as per the manu- (Invitrogen) for 3 hours, and analyzed by fluorescence imaging or facturer's instructions. Transfectants were selected using blastici- flow cytometry using FACS AriaII (BD Biosciences). din (2 mg/mL MiaPaCa and 20 mg/mL Colo357) and assessed for IKKe expression using immunoblotting. For transient knock- Measurement of extracellular
Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
  • Targeting the Hippo Pathway in Prostate Cancer: What's New?

    Targeting the Hippo Pathway in Prostate Cancer: What's New?

    cancers Review Targeting the Hippo Pathway in Prostate Cancer: What’s New? Kelly Coffey Solid Tumour Target Discovery Laboratory, Translational and Clinical Research Institute, Newcastle University Centre for Cancer, Faculty of Medical Sciences, Newcastle University, Newcastle upon Tyne NE2 4HH, UK; [email protected] Simple Summary: Prostate cancer is the most commonly diagnosed cancer in men in the UK, accounting for the deaths of over 11,000 men per year. A major problem in this disease are tumours which no longer respond to available treatments. Understanding how this occurs will reveal new ways to treat these patients. In this review, the latest findings regarding a particular group of cellular factors which make up a signalling network called the Hippo pathway will be described. Accumulating evidence suggests that this network contributes to prostate cancer progression and resistance to current treatments. Identifying how this pathway can be targeted with drugs is a promising area of research to improve the treatment of prostate cancer. Abstract: Identifying novel therapeutic targets for the treatment of prostate cancer (PC) remains a key area of research. With the emergence of resistance to androgen receptor (AR)-targeting therapies, other signalling pathways which crosstalk with AR signalling are important. Over recent years, evidence has accumulated for targeting the Hippo signalling pathway. Discovered in Drosophila melanogasta, the Hippo pathway plays a role in the regulation of organ size, proliferation, migration and invasion. In response to a variety of stimuli, including cell–cell contact, nutrients and stress, a kinase cascade is activated, which includes STK4/3 and LATS1/2 to inhibit the effector proteins YAP and its paralogue TAZ.
  • MRT67307 Kinase Inhibitor; TBK1 and Ikkε Inhibitor Catalog Code: Inh-Mrt for Research Use Only Version 19E07-NJ

    MRT67307 Kinase Inhibitor; TBK1 and Ikkε Inhibitor Catalog Code: Inh-Mrt for Research Use Only Version 19E07-NJ

    MRT67307 Kinase inhibitor; TBK1 and IKKε inhibitor Catalog Code: inh-mrt https://www.invivogen.com/mrt67307 For research use only Version 19E07-NJ PRODUCT INFORMATION CHEMICAL PROPERTIES Contents CAS Number: 1190378-57-4 (free base) • 10 mg MRT67307 (hydrochloride) Formula: C26H36N6O2 . x HCl Molecular weight: 464.60 g/mol (free base) Storage and stability Solubility: 15 mg/ml H2O - MRT67307 is provided as a dried powder and shipped at room temperature. Upon receipt, store product at -20 °C. METHODS - Upon resuspension of MRT67307 prepare aliquots and store Preparation of stock solution (10 mg/ml) at -20 °C. Resuspended product is stable for at least 3 months when 1. Add 1ml of endotoxin-free H O properly stored. 2 2. Use immediately or store aliquots at -20 °C - Avoid repeated freeze-thaw cycles. 3. Prepare dilutions using sterile endotoxin-free water Quality control Working concentration range: 1 - 20 µM (for cell culture assays) - Purity: ≥95% (UHPLC) - Inhibition of TBK1/IKKε by MRT67307 has been confirmed using Inhibition of TBK1/IKKε by MRT67307 in a cellular assay cellular assays. Below is a protocol using InvivoGen’s THP1-Dual™ cells for studying - Absence of bacterial contamination (e.g. lipoproteins and endotoxins) specific inhibition of the IRF pathway by MRT67307. These cells has been confirmed using HEK-Blue™ hTLR2 and HEK-Blue™ hTLR4 cells. express both an inducible Lucia luciferase reporter and an inducible secreted embryonic alkaline phosphatase (SEAP) reporter to measure PRODUCT DESCRIPTION the activation of the IRF or NF-κB pathways, respectively. Changes in MRT67307 is a potent, reversible kinase inhibitor, and a derivative the Lucia expression levels upon inhibition can be readily assessed by of BX7951.
  • Mechanisms of IKBKE Activation in Cancer Sridevi Challa University of South Florida, Challasridevi@Gmail.Com

    Mechanisms of IKBKE Activation in Cancer Sridevi Challa University of South Florida, [email protected]

    University of South Florida Scholar Commons Graduate Theses and Dissertations Graduate School 1-29-2017 Mechanisms of IKBKE Activation in Cancer Sridevi Challa University of South Florida, [email protected] Follow this and additional works at: http://scholarcommons.usf.edu/etd Part of the Biochemistry Commons, Biology Commons, and the Cell Biology Commons Scholar Commons Citation Challa, Sridevi, "Mechanisms of IKBKE Activation in Cancer" (2017). Graduate Theses and Dissertations. http://scholarcommons.usf.edu/etd/6617 This Dissertation is brought to you for free and open access by the Graduate School at Scholar Commons. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Scholar Commons. For more information, please contact [email protected]. Mechanisms of IKBKE Activation in Cancer by Sridevi Challa A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Cell Biology, Microbiology, and Molecular Biology College of Arts and Sciences University of South Florida Major Professor: Mokenge P. Malafa, M.D. Gary Reuther, Ph.D. Eric Lau, Ph.D. Domenico Coppola, M.D. Date of Approval: January 12, 2017 Keywords: EGFR, Olaparib, resistance Copyright © 2017, Sridevi Challa DEDICATION This dissertation is dedicated to my kind and courageous mother. ACKNOWLEDGMENTS I would like to acknowledge Dr. Cheng for trusting me with completion of the projects. I would like to thank him for giving me the freedom to explore any aspect of research and always willing to provide the necessary resources and guidance for my projects. I want to also acknowledge Ted and the Cheng lab personnel for their support.
  • Cep-2020-00633.Pdf

    Cep-2020-00633.Pdf

    Clin Exp Pediatr Vol. 64, No. 5, 208–222, 2021 Review article CEP https://doi.org/10.3345/cep.2020.00633 Understanding the genetics of systemic lupus erythematosus using Bayesian statistics and gene network analysis Seoung Wan Nam, MD, PhD1,*, Kwang Seob Lee, MD2,*, Jae Won Yang, MD, PhD3,*, Younhee Ko, PhD4, Michael Eisenhut, MD, FRCP, FRCPCH, DTM&H5, Keum Hwa Lee, MD, MS6,7,8, Jae Il Shin, MD, PhD6,7,8, Andreas Kronbichler, MD, PhD9 1Department of Rheumatology, Wonju Severance Christian Hospital, Yonsei University Wonju College of Medicine, Wonju, Korea; 2Severance Hospital, Yonsei University College of Medicine, Seoul, Korea; 3Department of Nephrology, Yonsei University Wonju College of Medicine, Wonju, Korea; 4Division of Biomedical Engineering, Hankuk University of Foreign Studies, Yongin, Korea; 5Department of Pediatrics, Luton & Dunstable University Hospital NHS Foundation Trust, Luton, UK; 6Department of Pediatrics, Yonsei University College of Medicine, Seoul, Korea; 7Division of Pediatric Nephrology, Severance Children’s Hospital, Seoul, Korea; 8Institute of Kidney Disease Research, Yonsei University College of Medicine, Seoul, Korea; 9Department of Internal Medicine IV (Nephrology and Hypertension), Medical University Innsbruck, Innsbruck, Austria 1,3) The publication of genetic epidemiology meta-analyses has analyses have redundant duplicate topics and many errors. increased rapidly, but it has been suggested that many of the Although there has been an impressive increase in meta-analyses statistically significant results are false positive. In addition, from China, particularly those on genetic associa tions, most most such meta-analyses have been redundant, duplicate, and claimed candidate gene associations are likely false-positives, erroneous, leading to research waste. In addition, since most suggesting an urgent global need to incorporate genome-wide claimed candidate gene associations were false-positives, cor- data and state-of-the art statistical inferences to avoid a flood of rectly interpreting the published results is important.
  • Iκb Kinase Ε and TANK-Binding Kinase 1 Activate AKT by Direct Phosphorylation

    Iκb Kinase Ε and TANK-Binding Kinase 1 Activate AKT by Direct Phosphorylation

    IκB kinase ε and TANK-binding kinase 1 activate AKT by direct phosphorylation Xiaoduo Xiea, Denghong Zhangb, Bin Zhaoa, Min-Kan Lua, Ming Youc, Gianluigi Condorellib, Cun-Yu Wangd, and Kun-Liang Guana,1 aDepartment of Pharmacology and Moores Cancer Center and bDepartment of Medicine, University of California at San Diego, La Jolla, CA 92093; cCancer Center, Medical College of Wisconsin, Milwaukee, WI 53226; and dLaboratory of Molecular Signaling, Division of Oral Biology and Medicine, University of California Los Angeles School of Dentistry, Los Angeles, CA 90095 Edited* by Jack E. Dixon, The Howard Hughes Medical Institute, Chevy Chase, MD, and approved March 8, 2011 (received for review October 27, 2010) AKT activation requires phosphorylation of the activation loop The noncanonical IκB kinase ε (IKKε) has been demonstrated (T308) by 3-phosphoinositide-dependent protein kinase 1 (PDK1) to play an essential role in Ras-induced cell transformation, which and the hydrophobic motif (S473) by the mammalian target of requires activation of both the Raf-MEK-ERK and PI3K-AKT rapamycin complex 2 (mTORC2). We recently observed that pathways (20). Of particular interest is the observation that IKKε phosphorylation of the AKT hydrophobic motif was dramatically can functionally replace the requirement of AKT to support cell elevated, rather than decreased, in mTOR knockout heart tissues, transformation, which suggests that IKKε may act as an AKT indicating the existence of other kinase(s) contributing to AKT regulator or effector. Consistently, IKKε was found to be ampli- phosphorylation. Here we show that the atypical IκB kinase ε and fied in several types of human cancer, including ovarian cancer TANK-binding kinase 1 (IKKε/TBK1) phosphorylate AKT on both the and breast cancer (20, 21).
  • Molecular Mechanisms Underlying Innate Immune Kinase

    Molecular Mechanisms Underlying Innate Immune Kinase

    MOLECULAR MECHANISMS UNDERLYING INNATE IMMUNE KINASE TBK1-DRIVEN ONCOGENIC TRANSFORMATION APPROVED BY SUPERVISORY COMMITTEE Michael A White, Ph.D. Melanie H. Cobb, Ph.D. Lawrence Lum, Ph.D. John D. Minna, M.D. DEDICATION This work is dedicated to my mother and Arlene for their love and support. ACKNOWLEDGEMENTS I am very grateful to my mentor, Dr. Michael White, for his continuous support and guidance through the entire study. I really appreciate his inspiration, patience, and generosity. I would also like to thank my committee members, Dr. Cobb, Dr. Lum, and Dr. Minna, for their invaluable advice and discussion. I thank all the White lab members and my friends for their help, suggestion, and discussion. Particularly, I would like to thank Rosie, Michael, Brian, Tzuling, and Malia for their long-term support and collaboration. I would also like to thank my friends, Veleka, Pei-Ling, Jen-Chieh, Shu-Yi, Chih-Chiang, Jen-Shuan, Yi-Chun, and Yu-San for their friendship. I am grateful to Drs. Rolf Brekken, Zhijian James Chen, Xuetao Cao, Philip Tsichlis, Charles Yeaman, William Hahn, Keqiang Ye, and Shu-Chan Hsu, Bing Su, Dos Sarbassov, Mark Magnuson, David Sabatini, Thomas Tan, and Bert Vogelstein for many of the reagents used in these studies. Finally, and most importantly, I would like to thank my mother and Arlene for their unending support and encouragement. MOLECULAR MECHANISMS UNDERLYING INNATE IMMUNE KINASE TBK1-DRIVEN ONCOGENIC TRANSFORMATION by YI-HUNG OU DISSERTATION Presented to the Faculty of the Graduate School of Biomedical Sciences The University of Texas Southwestern Medical Center at Dallas In Partial Fulfillment of the Requirements For the Degree of DOCTOR OF PHILOSOPHY The University of Texas Southwestern Medical Center at Dallas Dallas, Texas April, 2013 Copyright by YI-HUNG OU, 2013 All Rights Reserved MOLECULAR MECHANISMS UNDERLYING INNATE IMMUNE KINASE TBK1-DRIVEN ONCOGENIC TRANSFORMATION Publication No.
  • BMK1 Kinase Suppresses Epithelial–Mesenchymal Transition Through the Akt/Gsk3b Signaling Pathway

    BMK1 Kinase Suppresses Epithelial–Mesenchymal Transition Through the Akt/Gsk3b Signaling Pathway

    Published OnlineFirst January 26, 2012; DOI: 10.1158/0008-5472.CAN-11-2055 Cancer Tumor and Stem Cell Biology Research BMK1 Kinase Suppresses Epithelial–Mesenchymal Transition through the Akt/GSK3b Signaling Pathway Runqiang Chen, Qingkai Yang, and Jiing-Dwan Lee Abstract Epithelial–mesenchymal transition (EMT) plays a crucial role in the development of cancer metastasis. The – jun mitogen-activated protein (MAP) kinases extracellular signal regulated kinase, c- -NH2-kinase, and p38 have been implicated in promoting EMT, but a role for the MAP kinase BMK1 has not been studied. Here, we report that BMK1 signaling suppresses EMT. BMK1 elevation augmented E-cadherin–mediated cell–cell adhesion, downregulated mesenchymal markers, and decreased cell motility. Conversely, BMK1 silencing attenuated E-cadherin–mediated cell–cell adhesion, upregulated mesenchymal markers, and stimulated cell motility. BMK1 depletion dramatically increased the accumulation of endogenous Snail in the nuclear compartment. Snail accumulation was mediated by Akt/GSK3b signaling, which was activated by a modulation in the expression of the mTOR inhibitor DEPTOR. In support of these observations, BMK1 depletion promoted metastasis in vivo. Together, our findings reveal a novel mechanism of EMT control via mTOR/Akt inhibition that suppresses cancer metastasis. Cancer Res; 72(6); 1–9. Ó2012 AACR. Introduction that control cancer progression. The majority of mitogenic/ – The process of epithelial–mesenchymal transition (EMT) oncogenic signal activated signaling pathways stimulate is critically involved in the progression of human diseases, EMT(2).Inparticular,3ofthe4mitogen-activatedprotein such as cancer metastasis and fibrosis (1). EMT involves (MAP) kinase pathways described to date (namely, Erk, JNK, profound phenotypic changes that include loss of cell–cell and p38; ref.
  • Novel Regulation of Mtor Complex 1 Signaling by Site-Specific Mtor Phosphorylation

    Novel Regulation of Mtor Complex 1 Signaling by Site-Specific Mtor Phosphorylation

    Novel Regulation of mTOR Complex 1 Signaling by Site-Specific mTOR Phosphorylation by Bilgen Ekim Üstünel A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Cell and Developmental Biology) in The University of Michigan 2012 Doctoral Committee: Assistant Professor Diane C. Fingar, Chair Associate Professor Billy Tsai Associate Professor Anne B. Vojtek Assistant Professor Patrick J. Hu Assistant Professor Ken Inoki “Our true mentor in life is science.” (“Hayatta en hakiki mürşit ilimdir.”) Mustafa Kemal Atatürk, the founder of Turkish Republic © Bilgen Ekim Üstünel 2012 Acknowledgements This thesis would not have been possible without the enormous support and encouragement of my Ph.D. advisor Diane C. Fingar. I am sincerely thankful for her research insight and guidance during my Ph.D. training. I would like to express my great appreciation to Billy Tsai, Anne B. Vojtek, Ken Inoki, and Patrick J. Hu for serving on my thesis committee, whose advice and help have been valuable. I would like to thank all members of the Fingar, Tsai, and Verhey labs for the discussion in our group meetings. I also would like to thank the CDB administrative staff, especillay Kristen Hug, for their help. I thank Ed Feener for performing the liquid chromatography tandem mass spectrometry analysis to identify novel phosphorylation sites on mTOR and Steve Riddle for performing the in vitro kinome screen to identify candidate kinases for mTOR S2159 phosphorylation site. I thank Brian Magnuson, Hugo A. Acosta-Jaquez, and Jennifer A. Keller for contributing to my first-author paper published in Molecular and Cellular Biology Journal in 2011.
  • PRODUCTS and SERVICES Target List

    PRODUCTS and SERVICES Target List

    PRODUCTS AND SERVICES Target list Kinase Products P.1-11 Kinase Products Biochemical Assays P.12 "QuickScout Screening Assist™ Kits" Kinase Protein Assay Kits P.13 "QuickScout Custom Profiling & Panel Profiling Series" Targets P.14 "QuickScout Custom Profiling Series" Preincubation Targets Cell-Based Assays P.15 NanoBRET™ TE Intracellular Kinase Cell-Based Assay Service Targets P.16 Tyrosine Kinase Ba/F3 Cell-Based Assay Service Targets P.17 Kinase HEK293 Cell-Based Assay Service ~ClariCELL™ ~ Targets P.18 Detection of Protein-Protein Interactions ~ProbeX™~ Stable Cell Lines Crystallization Services P.19 FastLane™ Structures ~Premium~ P.20-21 FastLane™ Structures ~Standard~ Kinase Products For details of products, please see "PRODUCTS AND SERVICES" on page 1~3. Tyrosine Kinases Note: Please contact us for availability or further information. Information may be changed without notice. Expression Protein Kinase Tag Carna Product Name Catalog No. Construct Sequence Accession Number Tag Location System HIS ABL(ABL1) 08-001 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) ABL(ABL1) BTN BTN-ABL(ABL1) 08-401-20N Full-length 2-1130 NP_005148.2 N-terminal DYKDDDDK Insect (sf21) ABL(ABL1) [E255K] HIS ABL(ABL1)[E255K] 08-094 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) HIS ABL(ABL1)[T315I] 08-093 Full-length 2-1130 NP_005148.2 N-terminal His Insect (sf21) ABL(ABL1) [T315I] BTN BTN-ABL(ABL1)[T315I] 08-493-20N Full-length 2-1130 NP_005148.2 N-terminal DYKDDDDK Insect (sf21) ACK(TNK2) GST ACK(TNK2) 08-196 Catalytic domain
  • Elucidating the Regulation and Effectors of the Breast Cancer Oncogene, Ikkepsilon

    Elucidating the Regulation and Effectors of the Breast Cancer Oncogene, Ikkepsilon

    Elucidating the Regulation and Effectors of the Breast Cancer Oncogene, IKKepsilon The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Zhou, Alicia. 2012. Elucidating the Regulation and Effectors of the Breast Cancer Oncogene, IKKepsilon. Doctoral dissertation, Harvard University. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:10086028 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA 2012 – Alicia Yiran Zhou All rights reserved. Dissertation Advisor: Dr. William C. Hahn Alicia Yiran Zhou Elucidating the regulation and effectors of the breast cancer oncogene, IKKepsilon Abstract The IkappaB kinase epsilon (IKKepsilon, IKKi, IKBKE) is both a regulator of innate immunity and a breast cancer oncogene that is amplified and overexpressed in ~30% of breast cancers. IKKepsilon promotes malignant transformation through the activation of NF-kappaB signaling. In addition, breast cancers that harbor amplifications in the IKBKE gene are dependent on IKKepsilon protein expression for survival. IKKepsilon has been characterized as a non-canonical inhibitor of kappaB kinase (IKK) that activates both the interferon response pathway and NF- kappaB signaling in innate immunity. In this dissertation, I explore both the regulation and effectors of the IKKepsilon kinase in the context of malignant transformation. I found that IKKepsilon is modified and regulated by K63-linked polyubiquitination, a proteasome- and degradation-independent form of ubiquitination, at Lysine 30 and Lysine 401.
  • The Breast Cancer Oncogene Ikke Coordinates Mitochondrial Function and Serine Metabolism

    The Breast Cancer Oncogene Ikke Coordinates Mitochondrial Function and Serine Metabolism

    Article The breast cancer oncogene IKKe coordinates mitochondrial function and serine metabolism Ruoyan Xu1,†, William Jones1,†, Ewa Wilcz-Villega1, Ana SH Costa2,3, Vinothini Rajeeve4, Robert B Bentham5,6, Kevin Bryson7, Ai Nagano1, Busra Yaman1, Sheila Olendo Barasa1, Yewei Wang1, Claude Chelala1, Pedro Cutillas3, Gyorgy Szabadkai5,6,8 , Christian Frezza2 & Katiuscia Bianchi1,* Abstract 2017). A key step leading to inflammation in both compartments is activation of the transcription factor nuclear factor jB (NFjB), IjBkinasee (IKKe) is a key molecule at the crossroads of inflamma- mediated via canonical or alternative, non-canonical pathways. Key tion and cancer. Known to regulate cytokine secretion via NFjBand players in both pathways are the members of the IjB kinase (IKK) IRF3, the kinase is also a breast cancer oncogene, overexpressed in a family, which, by phosphorylating IjB, induce its proteasome- variety of tumours. However, to what extent IKKe remodels cellular mediated degradation, a step required for the release of NFjB from metabolism is currently unknown. Here, we used metabolic tracer its IjB-imposed cytosolic localisation, thus leading to its nuclear analysis to show that IKKe orchestrates a complex metabolic repro- translocation (Cle´ment et al, 2008). gramming that affects mitochondrial metabolism and consequently Evidence in support of the crucial role played by the IKK family in serine biosynthesis independently of its canonical signalling role. We inflammation-induced malignant transformation was provided by the found that IKKe upregulates the serine biosynthesis pathway (SBP) reduction of tumour incidence following the deletion of the canonical indirectly, by limiting glucose-derived pyruvate utilisation in the TCA IKK family member IKKb in intestinal epithelial and myeloid cells in cycle, inhibiting oxidative phosphorylation.