Bull Mar Sci. 90(1):493–512. 2014 research paper http://dx.doi.org/10.5343/bms.2013.1032
Phylogeography of the manybar goatfish, Parupeneus multifasciatus, reveals isolation of the Hawaiian Archipelago and a cryptic species in the Marquesas Islands
1 Hawai‘i Institute of Marine Zoltán Szabó 1 * Biology, University of Hawai‘i, 2 Kaneohe, Hawaii 96744. Brent Snelgrove Matthew T Craig 3 2 Department of Biology, 4 University of Hawai‘i, Honolulu, Luiz A Rocha Hawaii 96822. Brian W Bowen 1 3 Department of Marine Science and Environmental Studies, University of San Diego, San Diego, California 92110. Abstract.—To assess genetic connectivity in a common and abundant goatfish (family Mullidae), we surveyed 4 Section of Ichthyology, California Academy of Sciences, 637 specimens of Parupeneus multifasciatus (Quoy and 55 Music Concourse Dr, San Gaimard, 1825) from 15 locations in the Hawaiian Islands Francisco, California 94118. plus Johnston Atoll, two locations in the Line Islands, two locations in French Polynesia, and two locations in the * Corresponding author email:
With more than 60 species in six genera, goatfishes (family Mullidae) represent a major component of reef ecosystem assemblages (Uiblein 2007). Their benthic forag- ing behavior is facilitated by chemosensory barbels that invoke their common name. This excavation of soft sediments can shape benthic community structure and at- tract other fishes to the feeding foray, and thus goatfishes are regarded as commu- nity builders and keystone species in benthic feeding assemblages (Johnson and Gill 1998, Uiblein 2007). In addition to the chemosensory barbels, goatfishes have other unusual adaptations, including the ability to change coloration rapidly, mimic the coloration of other species in mixed-species schools (Randall and Guézé 1980), and survive in a pelagic environment long after transforming from larval to juvenile stage (Lo-Yat et al. 2006). Goatfishes are also economically important species, caught in artisanal fisheries throughout the tropical and subtropical oceans. The manybar goatfish, Parupeneus multifasciatus (Quoy and Gaimard, 1825), is probably the most common Indo-Pacific member of the family Mullidae (Friedlander Bulletin of Marine Science 493 © 2014 Rosenstiel School of Marine & Atmospheric Science of OA the University of Miami Open access content 494 Bulletin of Marine Science. Vol 90, No 1. 2014 et al. 2007, ZS pers obs). It occurs inshore around coral reefs and adjacent habitats of the Pacific and can be found to at least 161 m depth R( andall 2007). While specific life history data on the manybar goatfish indicate a pelagic larval duration of 24–28 d in captivity and a short generation time (Pavlov et al. 2011, 2012, 2013), other mem- bers of this family have a relatively long larval stage of about 50 d (Robertson et al. 2004) followed by a pelagic juvenile stage that eventually settles on reefs at lengths of 5–10 cm (Lo-Yat et al. 2006). These pelagic juveniles have been recovered over 1000 km from the nearest shallow water habitat (Clarke 1995), and this trait is likely to translate into high connectivity in population genetic assays (Craig et al. 2007, Horne et al. 2008, Reece et al. 2011), an expectation we hold for P. multifasciatus. Manybar goatfish are distributed throughout the Pacific Ocean, from the Northwestern Hawaiian Islands to the Marquesas in the central Pacific, east of Pitcairn Islands through the islands of Oceania to northwestern Australia and Christmas and Cocos-Keeling Islands in the Indian Ocean, north to Southern Japan, and south to New South Wales, Lord Howe, Norfolk, and Rapa Islands (Randall 2005, and http://www.iucnredlist.org). A similar distribution is common among many demersal fish species (Woodland 1983, Briggs 1999) and encompasses three rec- ognized biogeographic provinces. Based on high levels of endemism, the Hawaiian Archipelago in the North Pacific (25% endemism, Randall 2007) and the Marquesas Archipelago in the South Pacific (12% endemism, Randall and Earle 2000) repre- sent independent provinces. The remainder of the range encompasses the vast Indo- Polynesian province (Briggs and Bowen 2012) from the eastern Indian Ocean to the central Pacific. This area spans about half the planet, and biogeographic cohesiveness is likely maintained by the relatively small distances among island and coastal habi- tats. As noted by Schultz et al. (2008), dispersive propagules never have to travel >800 km to reach adjacent habitat across this region. To the east of this region, the range of the manybar goatfish is presumably constrained by the East Pacific Barrier (EPB), the 5000 km gap in shallow habitat between the central Pacific and the Americas. In recent phylogeographic appraisals of Pacific reef fishes, genetic partitions tend to be concordant with the biogeographic provinces noted above (Gaither et al. 2010, 2011, Leray et al. 2010, DiBattista et al. 2011, Eble et al. 2011a). Hence our initial expectations are genetic breaks distinguishing the Marquesas and Hawaii from the rest of the Pacific range. The present study is also part of a multi-species initiative to explore genetic con- nectivity of reef organisms within the Hawaiian Archipelago (reviewed in Toonen et al. 2011). In particular, the 1600 km expanse of the uninhabited Northwestern Hawaiian Islands (NWHI) was designated as the Papahānaumokuākea Marine National Monument (PMNM, Fig. 1) in 2006, and intensive research efforts were initiated to examine its efficacy in preserving biodiversity and replenishing exploited fish stocks in the densely populated Main Hawaiian Islands (MHI). While very lim- ited artesian bottom fishing existed before the PMNM, public access and fishing was further reduced at the formation of the PMNM. In contrast, the MHI have a current population of approximately 1.4 million people and are heavily fished by local anglers and spearfishers, impacted by sports and tour operators, beach use, land erosion, and development. Here, we focus on the manybar goatfish to address the following questions: (1) Is there genetic partitioning within the range of the species? (2) Is there population genetic structuring within the Hawaiian Archipelago (e.g., NWHI vs MHI)? (3) If so, Szabó et al.: Phylogeography of the manybar goatfish 495
Figure 1. Map of manybar goatfish, Parupeneus multifasciatus, collection sites with number of samples at each site. Species distribution range is indicated in blue shading. On the large-scale map, the Hawaiian Archipelago is represented only by its northernmost and southernmost is- lands, Kure and Hawaii, respectively. Inset details collections within the Hawaiian Archipelago. Photo credit: J Williams. what is the present rate and direction of gene flow among populations? and (4) What are the management implications?
Materials and Methods
Sample Collections Between 2005 and 2010, 637 specimens of P. multifasciatus were collected with pole spears while scuba diving or snorkeling at 22 locations across the Pacific Ocean: 15 sites in the Hawaiian Archipelago (MHI: The islands of Hawaii, Oahu, Kauai and Niihau; Kaula Rock; NWHI: Nihoa Island, Necker Island, French Frigate Shoals, Gardner Pinnacles, Maro Reef, Laysan Island, Lisianski Island, Pearl and Hermes Atoll, Midway Atoll, Kure Atoll), Johnston Atoll, Palmyra and Kiritimati in the Line Islands, Palau and Okinawa in the northwest Pacific, and Moorea and Nuku Hiva (Marquesas Islands) in French Polynesia (Fig. 1, first column of Table 1). The unin- habited Ka‘ula Rock was grouped with the NWHI for the purpose of our study. Tissue samples were stored in a saturated salt-DMSO buffer (Amos and Hoelzel 1991) or in 70% ethanol at room temperature until DNA extraction. Specimens collected from the NWHI were obtained on the NOAA Ship Hi’ialakai as part of an initiative to document and monitor resources in the PMNM. 496 Bulletin of Marine Science. Vol 90, No 1. 2014
Table 1. Collection sites, sample sizes (n), number of haplotypes (HN) and unique haplotypes (HU) observed in a single individual, molecular diversity indices, and estimated age of the analyzed Parupeneus multifasciatus populations. Time since most recent population collapse was calculated from mismatch distributions assuming 1% nucleotide sequence divergence / MY within lineages. Significant P( < 0.02) Fu’s FS values are in bold.
Haplotype Allelic Percent nucleotide
Location n HN HU diversity, h (SD) richness [r(9)] diversity, π (SD) Fu’s FS Age (yrs) Kure Atoll 29 8 3 0.808 (0.046) 3.806 0.22 (0.16) −2.87 116,343 Midway 45 16 5 0.868 (0.032) 4.856 0.28 (0.18) −10.75 146,197 Pearl and Hermes 37 8 1 0.764 (0.047) 3.352 0.21 (0.15) −2.54 117,880 Lisianski 28 12 3 0.884 (0.036) 4.996 0.28 (0.19) −6.93 147,249 Laysan 52 14 4 0.812 (0.035) 4.062 0.23 (0.16) −8.48 118,851 Maro Reef 30 13 2 0.899 (0.031) 5.281 0.30 (0.20) −7.68 161,974 Gardner Pinnacles 12 6 1 0.682 (0.148) 3.750 0.21 (0.16) −2.67 88,188 French Frigate Shoals 31 13 5 0.785 (0.071) 4.327 0.26 (0.18) −8.51 160,356 Necker 25 10 1 0.837 (0.056) 4.467 0.25 (0.17) −5.18 129,126 Nihoa 29 11 5 0.823 (0.050) 4.220 0.28 (0.18) −5.45 139,887 Kaula Rock 19 9 3 0.813 (0.081) 4.455 0.25 (0.18) −4.70 138,269 Niihau 30 8 0 0.777 (0.063) 3.773 0.23 (0.16) −2.67 113,269 Kauai 30 9 2 0.770 (0.063) 3.706 0.26 (0.17) −3.26 136,570 Oahu 28 12 3 0.823 (0.062) 4.545 0.29 (0.19) −6.63 95,793 Island of Hawaii 28 10 2 0.788 (0.067) 4.060 0.25 (0.17) −4.87 123,058 Johnston Atoll 20 6 1 0.816 (0.051) 3.702 0.21 (0.15) −1.59 113,107 Palau 9 3 0 0.556 (0.165) 2.000 0.10 (0.10) −0.53 63,673 Palmyra 28 9 4 0.587 (0.107) 2.954 0.15 (0.12) −6.15 80,421 Kiritimati 58 17 9 0.712 (0.061) 3.649 0.17 (0.13) −16.40 91,990 Moorea 38 13 5 0.753 (0.066) 3.874 0.20 (0.14) −9.70 100,485 Okinawa 13 8 2 0.885 (0.070) 5.138 0.25 (0.18) −4.74 131,149 Nuku Hiva (Marquesas) 18 2 2 0.366 (0.112) 0.959 0.06 (0.07) 0.80 40,615 Total 637 99 59 0.842 (0.009) 0.53 (0.30) −24.53 133,819
DNA Extraction, PCR, and Sequencing Total genomic DNA was extracted from 2 to 6 mm2 of pectoral fin clips in 50 μl volume using the HotSHOT protocol (Meeker et al. 2007) with the modification of using a pH 7.5 TRIS-HCl buffer (1M) for the neutralization step. A segment of the mitochondrial cytochrome b gene (mt-cyb) was amplified with primersCyb9 / L14725 (5΄–GTGACTTGAAAAACCACCGTTG–3΄) and Cyb7/H15573 (5΄– AATAGGAAGTATCATTCGGGTTTGATG–3΄) (Meyer 1993). Polymerase chain reaction (PCR) mixes were prepared following the manufacturer’s instructions using MangoMix (Bioline USA, Inc., Taunton, MA), containing 0.2 μM of each primer, 1 µl of 1:50 dilution of template DNA in 15 μl total volume. In a few cases, lower dilution (1:10 or undiluted) DNA stocks were used to achieve successful amplification. PCRs were performed in an ABI 2720 thermocycler (Applied Biosystems, Inc., Foster City CA, USA) as follows: initial denaturation at 95 °C for 3 min followed by 35 cycles of denaturing at 95 °C for 30 s, annealing at 50 °C for 45 s, and extension at 72 °C for 45 s, followed by a final extension at 72˚C for 5 min. PCR products were visualized on 1% agarose gels stained with GelStar (Lonza AG, Basel, Switzerland ) under UV light. PCR products were cleaned of excess oligonucleotides and unincorporated primers by incubating with exonuclease I and FastAP alkaline phosphatase (Fermentas, Glen Burnie, MD, USA) at 37˚C for 60 min, followed by deactivation at 85˚C for 15 min. Szabó et al.: Phylogeography of the manybar goatfish 497
All DNA fragments were sequenced in the forward direction (and reverse direction for rare or questionable haplotypes, those with ambiguous base reads) with fluores- cently labeled dye terminators following manufacturer’s protocols (BigDye, Applied Biosystems, Inc., Foster City, CA) and analyzed on an ABI 3130XL Genetic Analyzer (Applied Biosystems) at the Hawai‘i Institute of Marine Biology EPSCoR Sequencing Facility. The sequences were aligned, edited, and trimmed to a common length of 618 bp using Sequencher 4.9 DNA analysis software (GeneCodes Corporation, Ann Arbor, MI). Variable sites were visually checked to ensure accuracy, and unique mt- cyb haplotypes were deposited in GenBank (Pmu 1–Pmu 99, accession numbers JN006869–JN006963 and KF425538–KF425539). The full data set is also available from GenBank as a popset file (KF439062–KF439698). Data Analysis mtDNA Haplotype Network.—Evolutionary connections were estimated with an unrooted parsimony-based network of mtDNA haplotypes using Network 4.6 (http://www.fluxus-engineering.com). The data were first processed through the MJ (median-joining) algorithm (Bandelt et al. 1999) followed by the maximum parsimony (MP) option (Polzin and Daneschmand 2003). The default calculation weights for variable nucleotide positions were changed to 15, which allowed for lowering the weights for two highly variable nucleotide positions of #46 and #247 (5΄ à 3΄, refer to submitted GeneBank haplotype for numbering of nucleotide positions) to 10 and 5, respectively, to further reduce “superfluous” links, as suggested by the user manual. The initial network was drawn with Network Publisher 1.3.0.0 (http://www. fluxus-engineering.com/), and was further simplified by hand to eliminate multiple connections. Connections were deemed superfluous only if they were between low frequency haplotypes and there was an alternate connection to another haplotype of 10-fold higher frequency. Also, loops via internal nodes (where haplotypes were not present) were eliminated if there was an alternative direct connection. Molecular Diversity.—Arlequin 3.5 (Excoffier et al. 2005) was used to calculate summary statistics including haplotype diversity (h, equation 8.5 in Nei 1987) and nucleotide diversity (π, equation 10.19 in Nei 1987) for each collection site, as well as to test for genetic structure on several geographic scales: (1) within the Hawaiian archipelago, (2) between Hawaii and all other Pacific islands without Marquesas, and (3) between Marquesas and all other collections sites. Haplotype diversities were rarefied to nine individuals using the program Contrib 1.2 (Petit et al. 1998) to ac- count for increasing haplotype diversity with larger sample sizes. To assess whether haplotype diversities differed significantly between groups, we ran Mann-Whitney (Hawaiian archipelago vs all other Pacific locations) and Kruskal-Wallis (MHI vs NWHI vs all other locations) tests on the rarefactioned allele richness values from Table 1 using VassarStats (available from http://www.vassarstats.net/index.html, ac- cessed 14 July, 2013). Population Structure.—We tested for population structure and phylogeographic patterns with three independent analyses in a hierarchical manner. First, popula- tion pairwise ΦST statistics were generated in Arlequin to identify genetic partition- ing with the mutational model of Tamura and Nei (1993), the closest match to the TrN+I+G model that was chosen by jModelTest 0.1.1 (Guindon and Gascuel 2003, Posada 2008) using the Akaike information criteria. jModelTest also indicated that 498 Bulletin of Marine Science. Vol 90, No 1. 2014 the best-fit model of DNA sequence evolution had a γ = 0.324 that was used through- out all analyses in Arlequin. Significance was tested by permutation and P values adjusted (corrected α = 0.008) according to the modified false discovery rate method (Benjamini and Yekutieli 2001, Narum 2006). Second, an analysis of molecular variance (AMOVA, Excoffier et al. 1992) was per- formed to assess population structure between regions, among populations within regions, and between all populations in several scenarios or groupings. These group- ings were primarily guided by the significant STΦ values (Table 2), but also included scenarios where geographical distance was a consideration. Nonparametric permu- tation procedures (n = 20,000 iterations) were used to construct null distributions and test the significance of variance components for each hierarchical comparison. Third, a spatial analysis of molecular variance S( AMOVA 1.0, Dupanloup et al.
2002) was conducted to evaluate patterns emerging from pairwise ΦST values and AMOVA. SAMOVA utilizes a simulated annealing procedure (n = 100 permutations) within an AMOVA framework and removes a priori group identity bias by randomly partitioning mtDNA sequences into “K” groups. We tested K = 2 to K = 14, and the configuration with the largest among group differentiation (ΦCT) was retained. Specimens from Marquesas were excluded from the SAMOVA analyses because the haplotype network indicated an ancient divergence of the Marquesan population from the rest of the range. Mantel tests were carried out with 10,000 iterations in Arlequin to assess whether significant correlations existed between population differentiation (calculatedST Φ values) and geographical distance (isolation by distance, IBD). Negative ΦST values were converted to zeros after it was confirmed in pilot runs that doing so did not change outcomes. Test of Neutrality and Selection.—Deviations from neutrality and possible signa- tures of population expansion were assessed with Fu’s FS (Fu 1997) and by comparing observed and expected pairwise mismatch distributions using Arlequin; significance was tested using 99,999 permutations. As neutrality tests are sensitive to deviations from panmixia, we estimated these statistics both on the full data set, and inde- pendently within each region identified as genetically distinct by SAMOVA (i.e., all Hawaiian Islands including Johnston Atoll vs all other Pacific islands). Specimens collected from Johnston Atoll were geographically grouped with the Hawaiian sam- ples given the proximity (1400 km) and assignment to the same biogeographic prov- ince (Hourigan and Reese 1987, Briggs and Bowen 2012). FS values were regarded as significant at P < 0.02 per Arlequin user manual. Significant negative FS values indicate an abundance of rare haplotypes in non-recombining sequences such as mtDNA, a signature of either population expansion or selection. Population Coalescent Time Estimates.—Mismatch distributions were fitted with the population parameter τ to estimate coalescent time (time to most recent popu- lation expansion). We estimated population age using the equation τ = 2ut (Rogers and Harpending 1992, Harpending 1994), where t is age in generations and u is the mutation rate per generation for the 618 bp fragment. We used a chronological muta- tion rate of u = 1% per My within lineages (as calibrated for other reef fishes;B owen et al. 2001, Reece et al. 2010) to estimate coalescent times. A first order estimate of generation time, 2.2 yrs, is based on life history data (Pavlov et al. 2013) and the von Bertalanffy growth function (vonB ertalanffy 1938) using the life-history tool Szabó et al.: Phylogeography of the manybar goatfish 499 at http://www.fishbase.us/summary/Parupeneus-multifasciatus.html (accessed 29 October, 2012. Linf = 22.1 and K = 0.47, kindly provided by D Pavlov, Moscow State University). Migration.—Bayesian coalescent-based calculations of time-averaged migration rates (Nem: where Ne is effective population size and m is migration rate) and direction among groups were assessed with Migrate 3.3.2 (Beerli 2009) on a multilevel scale: (A) between the MHI and the NWHI in the Hawaiian Archipelago (Online Supplement S1-A), (B) between the populations of [Hawaii + Palau] vs [PKM + Okinawa] that were identified by a SAMOVA (Online Supplement S1-B), and (C) a purely geographi- cal model, where the western Pacific locations of Okinawa and Palau were separate- ly tested (or the two grouped into a WEST population) vs MHI vs NWHI vs PKM (Online Supplement S1-C). Specimens from Marquesas were excluded from the Migrate analyses, because of the ancient divergence of the Marquesan population. Settings were as follows: population subsampling option was set to match the sample number of the smallest sample in any comparison. After several exploratory runs, we chose Metropolis sampling for the proposal distributions of Θ and M and the exponential window setting for the prior distributions. Slice sampling of priors was used for the migration analysis of the two populations identified by SAMOVA (see B above). Values for Θ prior were: Minimum = 0.00, Mean = 0.01, Maximum = 0.10, Delta = 0.01, and Bins = 1500. Values for M prior were: Minimum = 0, Mean = 1000, Maximum = 10000, Delta = 1000, Bins = 1500. We ran a total of 1,000,000 genealo- gies sampled at every 100 generations with a 20% burn-in; Metropolis-Hastings sam- pling of both Θ and M priors was used in A and C (above), slice sampling was used in B. Static heating was turned on and four Markov chains were run with temperatures 1.0, 1.5, 3.0, and 1,000,000. Program defaults were used for all other settings. The transition-to-transversion ratio was calculated using jModelTest 0.1.1 and was set to 1.43:1. Each successful run was repeated a second time to ensure that posterior distributions remained the same and were independent from the starting point of the prior distributions. Peak values (i.e., mode) of the Θ and M posterior distributions were used to calculate the number of migrants per generation (Nem = Θj × Mji, where direction of migration is j à i). For Bayes factor calculations and model comparisons (i.e., likelihood of reduced number of parameters), the log-probability of the data given the model numbers [Prob(D|Model)], were used as instructed by the Migrate tutorial (https://molevol.mbl.edu/wiki/index.php/Migrate_tutorial, and Beerli and Palczewski 2010). Using NWHI and MHI as an example, the migration models were: (1) two populations sizes and two migration rates, (2) two population sizes and one migration rate to population 1 (MHI), (3) two population sizes and one migration rate to population 2 (NWHI), and (4) the two population (NWHI and MHI) are pan- mictic. The log-probability number used for this calculation was obtained by using a Bezier-curve and thermodynamic integration (Beerli and Palczewski 2010, provided in the Migrate outfile).
Results
We resolved 618 bp of the mtDNA (mt-cyb) of 637 individuals sampled at 22 lo- cations across the Pacific Ocean (Fig. 1, Table 1). Ninety-nine haplotypes were resolved, among which 65 were detected in single individuals, and there were no 500 Bulletin of Marine Science. Vol 90, No 1. 2014
Figure 2. Maximum parsimony network of 637 mt-cyb haplotypes from Parupeneus multifas- ciatus. Pie charts represent individual haplotypes and colors designate geographical locations. The size of the pie charts is proportional to haplotype frequencies. Sticks indicate mutational distance. Mutational differences larger than one nucleotide are indicated by cross bars on branch- es. Numbers within haplotypes indicate the number of individuals (with the given haplotype). Empty circles with a cross represent predicted haplotypes that were not observed. The lack of magenta colors in the first and fourth most common haplotypes labeled 172 and 37 is a strong indication of haplotype frequency shifts between the Hawaiian Islands and Palmyra, Kiritimati, and Moorea. shared haplotypes between Marquesas and the remaining Pacific island populations indicating complete genetic partitioning. We observed two haplotypes in 18 speci- mens at Marquesas, representing significantly lower allelic richness and nucleotide diversity (one sample Wilcoxon signed-rank test: reff = 0.959, π = 0.006, P < 0.0001) at this site. Allelic richness in Hawaii was significantly higher than other locations in the Pacific (one-tailed Mann-Whitney: Ua = 21, Ub = 69, n1 = 15, n2 = 6, P < 0.05).
Haplotype Network The most striking feature of the mt-cyb haplotype network (Fig. 2) is that Marquesas specimens are 25 mutations away from their nearest relative. This translates to d = 4.12% corrected pairwise genetic difference T( amura and Nei 1993) from the rest of the population, well within the domain of species-level divergences in other fishes (Johns and Avise 1998, DiBattista et al. 2011). The remaining 619 specimens could be sorted into 97 closely related haplotypes. The star shape phylogeny of the rest of the Szabó et al.: Phylogeography of the manybar goatfish 501 network indicates a shallow maternal genetic history, a common feature of marine fishes (Grant and Bowen 1998). The abundance of low frequency haplotypes differing by only one nucleotide from the four most frequent haplotypes (numbered 37, 98, 154, and 172) is consistent with recent population expansion. The central haplotype (154) is ubiquitously present at all sampled locations (except the Marquesas). Population Structure
Pairwise ΦST.—Significant and large pairwise STΦ values (Table 2) indicated three distinct populations: Marquesas stood out from all other locations with ΦST > 0.96 (group 1); the Hawaiian Islands grouped together (group 2) and were separated from the Line Islands and Society Islands (Palmyra, Kiritimati, and Moorea = PKM), al- though P values were non-significant in six out of 17 comparisons with group 2. Okinawa also seemed to group with PKM (group 3). Palau (n = 9) was only signifi- cantly different from Marquesas, but had the smallest sample size. Analysis of Molecular Variance.—Seven AMOVAs were run (Table 3) to test pop- ulation groupings indicated by the pairwise ΦST table and geographical distance: Hawaii, PKM (central-south Pacific), Okinawa, and Palau. The Marquesan popula- tion was dropped from the AMOVA comparisons, because the 4.1% divergence is more appropriate for a phylogenetic analysis. The highest among groups (AG) varia- tions were in the range of ΦCT = 0.132–0.136, and the strongest partitioning were identical to that detected with the pairwise ΦST table: [Hawaii + Palau] vs [PKM +
Okinawa] or Hawaii vs [PKM + Okinawa + Palau] (ΦCT = 0.136, P < 0.001). Since the Palau population did not differ significantly from any other population in this analy- sis, grouping with either Hawaii or [PKM + Okinawa] did not change the ΦCT values. Breaking up the Hawaiian population into a NWHI and a MHI group resulted in a
37.5% drop of the among groups variation (ΦCT = 0.085 vs 0.136), thus such partition- ing is not supported by genetic data. This geographic partitioning was also consistent with theS AMOVA (Online Supplement S2). Excluding Marquesas, K = 2 indicated the highest genetic partition- ing, with the two maximally differentiated groups consisted of [PKM + Okinawa] and [Hawaii + Palau] (ΦCT = 0.138, P < 0.0001). The second highestS AMOVA score
(ΦCT = 0.136), K = 3, consisted of PKM, Okinawa, and [Hawaii + Palau]. Comparisons of Marquesas vs all other islands yielded ΦCT = 0.948 (P < 0.04). Tests for IBD (cor- relation between genetic and geographical distance) were run parallel with AMOVA and were non-significant among populations (P = 0.09). Historical Demography The overwhelming majority of the haplotypes were present at low frequencies and only one to two mutational steps away from the four major haplotypes in the hap- lotype network (Fig. 2), indicating recent population expansions. As expected, the mismatch analysis of pairwise nucleotide differences for the total data set indicated a unimodal distribution plus a small spike to indicate the two Marquesan haplo- types (Online Supplement S3; Harpending’s raggedness index: r = 0.078, P < 0.001). Mismatch distributions were unimodal for all sample groups, and a non-significant raggedness index (r) was detected only in the MHI (Table 4: MHI: r = 0.050, P = 0.453; NWHI: r = 0.072, P = 0.003; Hawaii + Palau: r = 0.067, P = 0.002; PKM + Okinawa: r = 0.086, P = 0.027; Marquesas: r = 0.206, P = 0.417; all other: r = 0.087, P < 0.001). When mismatch distribution was analyzed at the level of individual sample 502 Bulletin of Marine Science. Vol 90, No 1. 2014 − 22 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* − 21 0.0* 0.0* 0.0* 0.001 0.007 0.005 0.004 0.021 0.001 0.011 0.044 0.974 0.003 0.037 0.007 0.254 0.013 0.008 0.236 0.248 0.009 − 20 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* 0.986 0.0* 0.0* 0.076 0.0* 0.143 0.0* 0.0* 0.283 0.470 0.0* − 19 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* 0.971 0.0* 0.0* 0.009 0.030 0.0* 0.0* 0.0* 0.091 0.860 0.0* − 18 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* 0.0* 0.001 0.972 0.0* 0.0* 0.010 0.002 0.0* 0.037 0.0* 0.0* 0.093 0.0* sampled at sites across the Pacific ( n = − 17 0.065 0.152 0.141 0.088 0.181 0.208 0.110 0.054 0.030 0.320 0.978 0.505 0.266 0.010 0.206 0.250 0.205 0.039 0.334 −0.002 −0.010 − 16 0.292 0.794 0.757 0.550 0.411 0.694 0.748 0.415 0.100 0.113 0.724 0.118 0.974 0.902 0.935 0.793 0.127 0.778 0.947 0.127 0.003 − 15 0.006 0.471 0.620 0.387 0.700 0.279 0.730 0.720 0.436 0.034 0.968 0.039 0.183 0.319 0.219 0.330 0.233 0.149 0.435 0.229 0.083 Parupeneus multifasciatus − 14 0.997 0.511 0.844 0.873 0.463 0.563 0.180 0.445 0.962 0.351 0.112 0.919 0.145 0.867 0.160 0.862 0.873 0.151 0.038 −0.022 −0.006 − 13 0.425 0.943 0.789 0.759 0.722 0.238 0.288 0.966 0.329 0.132 0.895 0.157 0.877 0.171 0.712 0.936 0.166 0.045 −0.021 −0.012 −0.027 − 12 0.714 0.147 0.411 0.933 0.376 0.070 0.969 0.147 0.210 0.328 0.219 0.212 0.234 0.147 0.406 0.230 0.073 −0.011 −0.001 −0.007 −0.005 − 11 0.577 0.928 0.843 0.485 0.244 0.970 0.413 0.150 0.771 0.168 0.696 0.191 0.640 0.829 0.187 0.040 −0.022 −0.018 −0.023 −0.028 −0.018 − 10 0.006 0.020 0.347 0.187 0.082 0.596 0.964 0.341 0.081 0.955 0.117 0.897 0.124 0.962 0.818 0.118 0.026 −0.020 −0.019 −0.017 −0.013 − 9 0.001 0.746 0.568 0.059 0.968 0.173 0.174 0.431 0.187 0.493 0.206 0.249 0.520 0.203 0.053 −0.004 −0.015 −0.006 −0.016 −0.002 −0.027 − 8 0.013 0.681 0.046 0.965 0.074 0.201 0.335 0.221 0.239 0.238 0.139 0.449 0.230 0.079 −0.002 −0.014 −0.009 −0.014 −0.022 −0.022 −0.015 − 7 0.059 0.025 0.017 0.057 0.020 0.978 0.039 0.297 0.123 0.310 0.082 0.342 0.073 0.112 0.357 0.192 −0.007 −0.002 −0.010 −0.015 −0.022 − 6 P is <0.001. 0.050 0.006 0.035 0.010 0.038 0.041 0.099 0.961 0.398 0.054 0.533 0.078 0.355 0.087 0.652 0.361 0.078 0.008 −0.017 −0.004 −0.010 P values (above diagonal) based on 618 bp of cyt B sequence data from − 5 0.037 0.001 0.002 0.015 0.002 0.013 0.025 0.070 0.964 0.108 0.509 0.102 0.459 0.108 0.373 0.459 0.100 −0.021 −0.002 −0.001 −0.012 4 − 0.003 0.003 0.002 0.040 0.964 0.097 0.120 0.942 0.131 0.964 0.989 0.121 0.013 −0.028 −0.020 −0.020 −0.020 −0.022 −0.004 −0.007 −0.005 3 − 0.001 0.012 0.008 0.056 0.001 0.970 0.120 0.134 0.140 0.921 0.937 0.139 0.028 −0.022 −0.019 −0.019 −0.018 −0.019 −0.007 −0.003 −0.021 2 − 0.016 0.016 0.007 0.016 0.053 0.960 0.000 0.086 0.105 0.117 0.837 0.106 0.017 −0.017 −0.016 −0.012 −0.013 −0.018 −0.009 −0.019 −0.015 (below diagonal) and associated 1 − 0.044 0.001 0.970 0.125 0.140 ST 0.149 0.147 0.028 −0.033 −0.005 −0.021 −0.023 −0.002 −0.024 −0.020 −0.009 −0.004 −0.003 −0.028 −0.022 − 0.015 P < 0.0083) values are in gray background. For 0.0*, n 16. Johnston Atoll 16. Johnston 15. Island of Hawaii 14. Oahu 13. Kauai 12. Niihau 11. Kaʻula Rock 11. 10. Nihoa 9. Necker 8. French Frigate Shoals 7. Gardner Pinnacles 6. Maro Reef 22. Nuku Hiva (Marquesas) 5. Laysan 21. Okinawa 4. Lisianski 20. Moorea 3. Pearl and Hermes 2. Midway 19. Kiritimati 1. Kure Atoll 1. Kure 18. Palmyra Locatio 17. Palau 637). Significant ( Table 2. Matrix Table of pairwise Φ Szabó et al.: Phylogeography of the manybar goatfish 503
Table 3. Analysis of molecular variance (AMOVA) for different population groupings. NWHI = Northwestern Hawaiian Islands; MHI = Main Hawaiian Islands; PKM = Palmyra, Kiritimati,
Moorea. Significant F statistics are in bold (P < 0.05 unless otherwise noted, * P < 0.001). AG = among groups, AP(G) = among populations within groups, WP = within populations.
Population groupings Source of variation Variation (%) Φ statistics
NWHI, MHI, [Palau+PKM+Okinawa] AG 8.48 ΦCT = 0.085*
AP(G) −0.07 ΦSC = −0.001 WP 91.64
Hawaii, [Palau+PKM+Okinawa] AG 13.55 ΦCT = 0.136*
AP(G) −0.05 ΦSC = −0.001 WP 86.50
[Hawaii+Palau], [PKM+Okinawa] AG 13.55 ΦCT = 0.136*
AP(G) −0.05 ΦSC = −0.001 WP 86.50
[Hawaii+Palau+Okinawa], PKM. AG 12.67 ΦCT = 0.127*
AP(G) 0.61 ΦSC = 0.007 WP 86.72
[Hawaii+Palau], Okinawa, PKM AG 13.31 ΦCT = 0.133*
AP(G) −0.07 ΦSC = −0.001 WP 86.76
Hawaii, Palau, [PKM+Okinawa] AG 13.42 ΦCT = 0.134*
AP(G) −0.08 ΦSC = −0.001 WP 86.66
Hawaii, Palau, PKM, Okinawa AG 13.18 ΦCT = 0.132*
AP(G) −0.09 ΦSC = −0.001 WP 86.91
locations, raggedness values were all non-significant (data not shown). Fu’s FS indicat- ed an abundance of rare haplotypes (Tables 1, 4), which could be evidence for recent demographic expansion of all populations identified by SAMOVA. Fu’s FS was signifi- cantly negative for 11 out of 16 locations in Hawaii (Fu’s FS = −10.17 to −1.59) and 4 out of 6 in the remaining Pacific samples T( able 1). For all the combined intraspecific sample groups (NWHI, MHI, Hawaii, PKM + Okinawa, All combined; Table 4), Fu’s
FS was negative and ranged from −24.07 (n = 135) to −181.70 (n = 619). Coalescence time estimates for individual sampling sites were in the range 80–162 ky (Table 1). Older populations were indicated in the NWHI and MHI vs PKM, which was con- firmed when samples were analyzed as metapopulations defined by SAMOVA (Table 4). Estimated ages are NWHI: 140,500, MHI: 137,000 and PKM + Okinawa: 95,800 yrs. The age difference between the NWHI and PKM + Okinawa was particularly no- table, since sample sizes were almost identical: 135 and 137, respectively. The single nucleotide difference between the two haplotypes recovered at Nuku Hiva does not allow for a reliable estimation of a historical bottleneck in the Marquesan population (0 < τ < 1.2; 0–100 ky). Using a divergence rate of 0.02/My between lineages and an average corrected sequence divergence of d = 4.12%, we estimate the divergence of the Marquesan population at about 2 My. Contemporary Gene Flow Although occasionally we were able to get converging values for a full geographical migration model in which MHI, NWHI, WEST, and PKM were treated as separate 504 Bulletin of Marine Science. Vol 90, No 1. 2014 + P <
+ S
0.80 F − 24.07* − 74.09* − 44.84* − 181.70* − 109.16* P < 0.001,
P 0.153 0.000 0.003 0.002 0.004 0.102 0.382
Model (SSD) SSD 0.007 0.008 0.008 0.007 0.006 0.005 0.005
P 0.453 0.000 0.003 0.000 0.002 0.027 0.417 r
0.050 0.087 0.072 0.078 0.067 0.086 0.206 Harpending raggedness ∞ ∞ ∞ ∞ ∞ ∞ 20.611 Theta1 are population size parameter estimates at time of coalescence of time at estimates parameter size population are Theta1 (9.25 – 99999) (2.81 – 99999) (4.25 – 99999) (21.15 – 99999) (12.91 – 99999) (21.89 – 99999) (16.80 – 99999) and Theta0 0 0 0 0 0 0 0.002 Theta0 (0.000 – 0.686) (0.000 – 0.782) (0.000 – 0.067) (0.000 – 0.095) (0.000 – 0.067) (0.000 – 0.077) (0.000 – 0.142) tests for population expansion or selective neutrality, SSD tests for deviations from the sudden the from deviations for tests SSD neutrality, selective or expansion population for tests S F
70,227 66,060 68,487 66,909 66,909 47,896 20,307 Age (2%)
95,793 40,615 140,453 132,120 136,974 133,819 133,819 Age (1%) τ 1.736 1.633 1.693 1.654 1.654 1.184 0.502 (0.00 – 1.20) (0.69 – 2.70) (1.42 – 2.02) (1.44 – 2.09) (1.44 – 2.05) (1.41 – 2.05) (0.82 – 1.65) n 18 135 619 318 637 482 137 mt-cyb mismatches. CI = confidence interval; PKM = Palmyra, Kiritimati, Moorea; “Hawaii” = MHI + NWHI + Palau. * Population 0.391. ) and Fu’s Fu’s and ( r ) raggedness Harpending’s respectively. present, and Table 4. Estimates (95% CI) of manybar goatfish historical demography for SAMOVA populations. τ: population age parameter, age: coalescent time (population time coalescent age: parameter, age population τ: populations. SAMOVA for demography historical goatfish manybar of CI) (95% Estimates 4. Table years. million per 2% and 1% of rate mutation lineage within for estimate age) Main Hawaiian Is. 95% CI All other expansion model of 95% CI NW Hawaiian Is. NW 95% CI Overall 95% CI “Hawaii” 95% CI 95% CI PKM+Okinawa 95% CI Marquesas Szabó et al.: Phylogeography of the manybar goatfish 505 populations (Online Supplement S1-C), they were not reliably reproducible, thus we were not able to conclusively test hypotheses about dispersal. We had the same outcome for migration models where Okinawa and Palau were treated separately from Hawaii and PKM. A four-parameter migration analysis between the NWHI and MHI indicated a migration predominantly in the MHI direction. Based on five replicate runs, the mean number of migrants per generation was 85 to the MHI and 1.3 to the NWHI. With static heating turned on, we were able to evaluate four pos- sible migration models: (1) two populations sizes and two migration rates, (2) two populations sizes, one migration rate to MHI, (3) two population sizes one migration rate to NWHI, (4) panmixia within Hawaii. Bayes factor calculations indicated a statistically significant (98.9%) probability for the single migration rate model toward the NWHI (Online Supplement S1-A). Between the SAMOVA-defined two popula- tions, Hawaii vs [PKM + Okinawa + Palau], a full four-parameter model indicated migration from the central and South Pacific toward the Hawaiian Islands: 8.1 mi- grants/generation (Nem) into Hawaii vs 0.016 from Hawaii. Bayes factor calculations (Online Supplement S1-B), however, were only slightly in favor of a single migra- tion rate model toward Hawaii with a 60% probability vs single rate migration out of Hawaii at 30% probability vs full migration model of 10% probability. We consider this latter result as not robust enough to exclude a two-directional four-parameter migration model between Hawaii vs [PKM + Okinawa + Palau].
Discussion
In our phylogeographic analysis of P. multifasciatus, we identified a monophyletic lineage in the Marquesas Islands (Fig. 2) and detected a significant genetic partition between the Hawaiian Archipelago and our sample locations in the southern and western Pacific T( ables 2, 3). Our migration analysis, while yielding contradictory re- sults, indicates a rate of about eight migrants per generation into Hawaii, low but pos- sibly sufficient to prevent evolutionary separations. AMOVA resultsT ( able 3) show no significant barriers to gene flow within the Hawaiian Archipelago. Coalescence analysis of expanding populations indicates a genetic bottleneck ca 140 ka in the main Hawaiian Islands and Okinawa and a very recent one in the Marquesas. The timing of the Hawaiian and Okinawan bottleneck coincides approximately with a Pleistocene (Illinoian era) sea level minimum of 120 m below current sea level (http:// www.ncdc.noaa.gov/paleo/ctl/clisci100k.html#sea, Voris 2000). Prior to dissecting these results, we address two caveats. First, we note that this is a single locus study with the inherent limitations that entails, especially in regards to estimating migration with Bayesian coalescent-based calculations (Beerli 2009). Selective sweeps or sex-biased dispersal could alter our conclusions; however, the former is very rare (Karl et al. 2012) and the latter is unknown in fishes with larval dispersal. Nonetheless, discrepancies between mtDNA and nuclear DNA data sets are documented in marine fishes for reasons that have yet to be adequately explained (DiBattista et al. 2012). Second, the finding of a divergent evolutionary lineage in the Marquesas is not an artifact of species misidentification. Our research team collect- ed and identified these specimens, which were readily distinguishable from the five other goatfish species in the Marquesas. Vouchered specimens from the Marquesas clearly fit the key for P. multifasciatus. Finally, our (unpublished) morphological comparisons between P. multifasciatus from the Marquesas and elsewhere in the range indicate very high similarity. 506 Bulletin of Marine Science. Vol 90, No 1. 2014
Endemism in the Marquesas and Routes of Colonization Our survey of P. multifasciatus indicates an ancient separation of the Marquesas population and a cryptic species. The observed cytochrome b divergence of d = 4.12% is comparable to other congeneric species pairs of fish species (Johns and Avise 1998, Rocha et al. 2008, DiBattista et al. 2011), but nuclear DNA data and morphological examinations would be desirable to evaluate this taxonomic issue. We compared ex- ternal morphology in a limited number of specimens in the collection of the Bishop Museum and no obvious differences were detected between the Marquesan indi- viduals and specimens from elsewhere in the range of P. multifasciatus. The Marquesas is one of the most isolated archipelagos in the Indo-Pacific region with 11.6% endemism in fish species R( andall and Earle 2000), the third highest be- hind Hawaii (25%; Randall 2007) and Easter Island (21.7%; Randall and Cea 2012). Recent surveys have revealed that this isolation extends to phylogeographic studies as well (Planes and Fauvelot 2002, Gaither et al. 2010, Leray et al. 2010). This high level of endemism in both species and genetic lineages is attributed to a combination of physical and ecological factors (Randall and Earle 2000), including geographical isolation (distance from larval sources), hydrographical isolation (cold upwelling, prevailing currents), young geological age (few marine habitats), and temperature fluctuations. The Marquesas Archipelago is isolated from the Americas by the Eastern Pacific Barrier spanning 4700 km of open ocean. The nearest atoll is 500 km to the southwest in the Tuamotus. Because of the prevailing east–west direction of the South Equatorial Current (Wyrtki and Kilonsky 1983, Bonjean and Lagerloef 2002); however, the Marquesas normally does not receive larvae from the west. The only exception may be during El Niño conditions, when warm water flows toward the east. This increase of water temperature and the reversal of current flow might be an opportunity for larvae to disperse toward the east. Higher surface water temperature during ENSO events also lowers the thermocline, which allows for a larger body of warmer water to come in near shores of these mostly volcanic islands (Randall and Earl 2000). Once the oscillation reverses, the cold upwelling returns creating intol- erable conditions for tropical Indo-Pacific shore fish species that are not adapted to colder temperatures. Parupeneus multifasciatus is a demersal species that has been reported at 161 m depth (Chave and Mundy 1994) and therefore can tolerate cold water. Until recently, pelagic larval duration (PLD) was believed to have a primary role in the dispersal of marine species. Intuitively, the longer the PLD, the farther larvae can disperse. However, more recent analyses indicate that the relationship between PLD and dispersal is not a simple one, and is likely confounded by navigation, swimming ability, and oceanic conditions (Selkoe et al. 2010, Leis et al. 2011, Selkoe and Toonen 2011). Mora et al. (2012) suggested that larvae can travel long distances on oceanic currents, concluding that PLD is not a determining factor in successful colonization. While stepping-stone atolls greatly facilitate dispersal, rare long-distance dispersal events can also contribute to colonization (Crandall et al. 2012). These long-range dispersal events, however, have much less chance to succeed because the larvae be- come diluted and there is a greater chance for habitat differences between remote locations. For a species to become established in a new geographical location, the larvae must reach their destination in sufficiently high numbers and find suitable habitat. Often the new location has different environmental parameters than the origin, e.g., greater temperature fluctuations or limited food resources. Multiple Szabó et al.: Phylogeography of the manybar goatfish 507 introductions are probably necessary for a successful establishment of a breeding population. Certain life history traits, such as a non-specialized carnivorous diet con- sisting mainly of benthic invertebrates (>72%), fishes, and fish eggsR ( andall 2004), indeterminate fecundity, and year around spawning (Pavlov et al. 2011, Emel‘yanova et al. 2013) make P. multifasciatus an excellent candidate for long-range dispersal. Parupeneus multifasciatus appears to be one of the most successful colonizers among goatfish species. In the Marquesas there are six Parupeneus species, but only one reached Rapa Nui (Easter Island) to the east (Randall and Cea 2012). This Easter Island species was initially identified as Pseudupeneus multifasciatus (Quoy and Gaimard, 1824) by Kendall and Radcliffe (1912), which was the historical name for Parupeneus multifasciatus at the time. Later, morphological differences were noted (e.g., shorter barbel length in the Easter Island), and the Easter Island endemic form was renamed Parupeneus orientalis (Fowler, 1933). It is possible that the Marquesan P. multifasciatus is on an evolutionary trajectory similar to P. orientalis, and it would be informative to conduct a molecular phylogenetic comparison of P. orientalis and P. multifasciatus. Easter Island is farther south of the Equator, and temperature fluc- tuations are even greater than in the Marquesas (Randall and Cea 2012). The ability of P. multifasciatus to tolerate colder temperatures and greater temperature fluctua- tions could have contributed to the colonization of these remote locations. Low Genetic Diversity at the Marquesas The Marquesas are geologically very young (1.3–4.7 My), rises steeply from the ocean and therefore do not have a fringe reef or abundant live coral (Randall and Earl 2000, ZS pers obs). Allelic richness at Nuku Hiva is very low compared to other collection sites in our data set (Table 1), consistent with the assumption that smaller habitat generally translates into smaller effective population sizes. It is not surprising, therefore, that our analysis of historical demography indicates a much smaller popu- lation and a more recent genetic bottleneck in the Marquesas than in the Hawaiian Islands. This kind of pruning of the genetic diversity could have been repeated many times during the 2-My history of the Marquesan lineage. Population Structure Within the Hawaiian Archipelago Our mtDNA analyses of P. multifasciatus did not reveal significant population structure within the Hawaiian Archipelago, a common outcome for marine fishes (Eble et al. 2009, Craig et al. 2010, DiBattista et al. 2011, Gaither et al. 2011, but see Ramon et al. 2008, Eble et al. 2011b, Rivera et al. 2011, Toonen et al. 2011). One of the main goals of our study was to examine whether larval exchange can occur be- tween the NWHI and the populated MHI. We found no evidence of barriers to gene flow and our results indicate that larval dispersal is sufficient to homogenize haplo- type distributions from one end of the archipelago to the other, a distance of about 2600 km. While migration results were contradictory, the predominant direction of larval flow seems to be from the Main Hawaiian Islands toward the Northwestern Hawaiian Islands, consistent with the dominant surface currents and with previous genetic surveys (Gaither et al. 2011, DiBattista et al. 2011, Toonen et al. 2011). The management implications of this finding are that the heavily-fished MHI cannot be quickly replenished by the protected NWHI and draws attention to the importance of effective management of local fish stocks in the Main Hawaiian Islands. 508 Bulletin of Marine Science. Vol 90, No 1. 2014
Population Structure Between Hawaii and the Wider Pacific We observed significant mtDNA haplotype frequency shifts between the Hawaiian Archipelago and the central and South Pacific (Palmyra, Kiritimati, Moorea = PKM). The highest level of differentiation centered on the Gardner Pinnacle/French
Frigate shoals area in the middle of the archipelago (0.200 < ΦST < 0.357, Table 2). Geographically, this area may be shielded from larval showers that arrive through the Kuroshio-North Pacific currents (Eble et al. 2011a). Palau n( = 9) did not show significant difference from either the Hawaiian Archipelago or PKM, indicating that dispersal routes are capable of maintaining genetic connectivity across the Pacific Ocean. On the other hand, Okinawa (n = 13) lies 19° north of Palau in the path of the Kuroshio Current and still maintains genetic differentiation from the Hawaiian Archipelago, but not from PKM. It is likely that this genetic connectivity across thou- sands of kilometers is augmented by the extended pelagic phase known for members of the goatfish family. In conclusion, the range of the manybar goatfish encompasses three biogeographic provinces defined by endemism: Marquesas, Hawaii, and the vast Indo-Polynesian Province (Briggs and Bowen 2012). We discovered significant genetic structure be- tween Hawaii and the South and western Pacific indicating historic population par- titioning, and an isolated population in the Marquesas Islands that is mostly likely a cryptic endemic species based on mtDNA genetic distance. The genetic partitions overall are concordant with the marine biogeographic provinces of the Pacific Ocean. Since the inception of phylogeography as a discipline (Avise et al. 1987), practitioners have asked if the microevolutionary separations observed within species (defined by DNA sequence data) eventually translate into the macroevolutionary separations be- tween species (defined by taxonomy). In this case the barriers apparent in mtDNA sequence analyses agree with the biogeographic boundaries based on species distri- butions. It seems that at least in some cases, phylogeographic breaks are the starting point for speciation (Rocha and Bowen 2008).
Acknowledgments
This research was supported by the National Science Foundation Grants OCE-0929031 to BW Bowen, as well as NOAA National Marine Sanctuaries Program MOA 2005-008/6682 to RJ Toonen. For specimen collections, the authors thank K Szabó, M Kinjyou, T Arakaki, J Reimer, anonymous fishermen in Okinawa, R Kosaki, C Meyer, Y Papastamatiou, J Eble, J DiBattista, T Daly-Engel, M Gaither, S Jones, C Wilcox, G Concepcion, D Pence, P Colin, L Colin, D Smith, K Tenggardjaja, J Zamzow, M Iacchei, D Wagner, J Schultz, R Coleman, J Copus, I Fernandez-Silva, The Nature Conservancy, Coral Reef Research Foundation, the supporting staff of Palmyra Atoll Research Consortium, and the crew of the RV Hi‘ialakai. The authors also thank S Rowley, A Suzomoto, and L O’Hara for assistance with morpho- logical analysis; M Donovan and DA Pavlov for help with life history data analysis, P Beerli, J DiBattista, M Gaither, Y Chan, C Wilcox, and J Eble for consulting on genetic analysis; R Toonen, Hawai’i Department of Land and Natural Resources, and the Papahānaumokuākea Marine National Monument, US Fish and Wildlife Service, and members of the ToBo lab for logistic support; J Williams and J Randall for providing photographs and consultation; A Eggers, L Valentino, and M Mizobe of the HIMB EPSCoR core facility for their assistance with DNA sequencing. We thank editor C Riginos and three anonymous reviewers whose comments improved the manuscript. This is contribution no. 1576 from the Hawai‘i Institute of Marine Biology and no. 9057 from the School of Ocean and Earth Science and Technology. Szabó et al.: Phylogeography of the manybar goatfish 509
Literature Cited
Amos W, Hoelzel AR. 1991. Long-term preservation of whale skin for DNA analysis. Rep Int Whal Comm. 13:99–103. Avise JC, Arnold J, Ball RM, Bermingham E, Lamb T, Neigel JE, Reeb CA, Saunders NC. 1987. Intraspecific phylogeography: the mitochondrial bridge between population genetics and systematics. Ann Rev Ecol Syst. 18:489–522. Bandelt H-J, Forster P, Röhl A. 1999. Median-joining networks for inferring intraspecific phylogenies. Mol Biol Evol. 16:37–48. http://dx.doi.org/10.1093/oxfordjournals.molbev. a026036 Beerli P. 2009. How to use Migrate or why are Markov chain Monte Carlo programs difficult to use? In: Population genetics for animal conservation. Bertorelle G, Bruford MW, Hauffe HC, Rizzoli A, Vernesi C, editors. Vol. 17. Conservation Biology, Cambridge University Press, Cambridge UK. p. 42–79. Beerli P, Palczewski M. 2010. Unified framework to evaluate panmixia and migration di- rection among multiple sampling locations. Genetics. 185:313–326. PMid:20176979. PMCid:PMC2870966. http://dx.doi.org/10.1534/genetics.109.112532 Benjamini Y, Yekutieli D. 2001. The control of the false discovery rate in multiple testing under dependency. Anns Statist. 29(4):1165–1188. Bonjean F, Lagerloef GSE. 2002. Diagnostic model and analysis of the surface cur- rents in the tropical Pacific Ocean. J Phys Oceanogr. 32:2938–2954. http://dx.doi. org/10.1175/1520-0485(2002)032<2938:DMAAOT>2.0.CO;2 Bowen BW, Bass AL, Rocha LA, Grant WS, Robertson DR. 2001. Phylogeography of the trum- petfish (Aulostomus spp.): ring species complex on a global scale. Evolution. 55:1029–1039. http://dx.doi.org/10.1554/0014-3820(2001)055[1029:POTTAR]2.0.CO;2 Briggs JC. 1999. Coincident biogeographic patterns: Indo–West Pacific Ocean. Evolution. 53:326–335. http://dx.doi.org/10.2307/2640770 Briggs JC, Bowen BW. 2012. A realignment of marine biogeographic provinces with particular reference to fish distributions. J Biogeogr. 39:12–30. http://dx.doi. org/10.1111/j.1365-2699.2011.02613.x Chave EH, Mundy BC. 1994. Deep-sea benthic fish of the Hawaiian Archipelago, Cross Seamount, and Johnston Atoll. Pac Sci. 48(4):367–409. Clarke TA. 1995. Larvae of nearshore fishes in oceanic waters of the central equatorial Pacific. Pac Sci. 49:134–142. Craig MT, Eble JA, Bowen BW. 2010. Origins, ages, and populations histories: compara- tive phylogeography of endemic Hawaiian butterflyfishes (genusChaetodon ). J Biogeogr. 37:2125–2136. http://dx.doi.org/10.1111/j.1365-2699.2010.02358.x Craig MT, Eble JA, Robertson DR, Bowen BW. 2007. High genetic connectivity across the Indian and Pacific Oceans in the reef fish Myripristis berndti (Holocentridae). Mar Ecol Prog Ser. 334:245–254. http://dx.doi.org/10.3354/meps334245 Crandall ED, Sbrocco EJ, DeBoer TS, Barber PH, Carpenter KE. 2012. Expansion dating: cali- brating molecular clocks in marine species from expansions onto the Sunda Shelf following the last glacial maximum. Mol Biol Evol. 29(2):707–719. http://dx.doi.org/10.1093/molbev/ msr227 DiBattista, JD, Craig MT, Rocha LA, Feldheim KA, Bowen BW. 2012. Phylogeography of the Indo-Pacific butterflyfishes, Chaetodon meyeri and Chaetodon ornatissimus: sister species reveal divergent evolutionary histories and discordant results from mtDNA and micro- satellites. J Hered. 103:617–629. PMid:22888133. http://dx.doi.org/10.1093/jhered/ess056 DiBattista JD, Wilcox C, Craig MT, Rocha LA, Bowen BW. 2011. Phylogeography of the Pacific blueline surgeonfish Acanthurus nigroris reveals a cryptic species in the Hawaiian Archipelago. J Mar Biol. Article ID 839134. http://dx.doi.org/10.1155/2011/839134 510 Bulletin of Marine Science. Vol 90, No 1. 2014
Dupanloup I, Schneider S, Excoffier L. 2002. A simulated annealing approach to define the genetic structure of populations. Mol Ecol. 11:2571–2581. PMid:12453240. http://dx.doi. org/10.1046/j.1365-294X.2002.01650.x Eble JA, Rocha LA, Craig MT, Bowen BW. 2011a. Not all larvae stay close to home: long-distance dispersal in Indo-Pacific reef fishes, with a focus on the brown surgeonfish (Acanthurus ni- grofuscus). J Mar Biol. Article ID 518516. http://dx.doi.org/10.1155/2011/518516 Eble JA, Toonen RJ, Bowen BW. 2009. Endemism and dispersal: comparative phylogeogra- phy of three surgeonfish species across the Hawaiian Archipelago. Mar Biol. 156:689–698. http://dx.doi.org/10.1007/s00227-008-1119-4 Eble JA, Toonen RJ, Sorenson L, Basch LV, Papastamatiou YP, Bowen BW. 2011b. Escaping paradise: larval export from Hawai’i in an Indo-Pacific reef fish, the yellow tang (Zebrasoma flavescens). Mar Ecol Prog Ser. 428:245–258. http://dx.doi.org/10.3354/meps09083 Emel’yanova NG, Pavlov DA, Thuan TBL , Ha VT. 2013. Some data on the structure of the go- nads of manybar goatfish Parupeneus multifasciatus (Mullidae) from the Nha Trang Bay, South China Sea. J Ichthyol. 53(8):600–609. http://dx.doi.org/10.1134/S0032945213050032 Excoffier L, Laval G, Schneider S. 2005. Arlequin (version 3.0): an integrated software package for population genetics data analysis. Evol Bioinform. 1:47–50. PMCid:PMC2658868. Excoffier L,S mouse PE, Quattro JM. 1992. Analysis of molecular variance inferred from metric distances among DNA haplotypes: application to human mitochondrial DNA restriction data. Genet Soc Am. 131:479–491. Friedlander AM, Hunter C, Kreiger S. 2007. A survey of the marine resources of Lawai Bay, Kauai, to support changes in management proposed by the National Tropical Botanical Gardens. National Tropical Botanical Garden, Lawai, HI. Accessed 30 December, 2012. Available from: http://www.ntbg.info/gardens/media/LK_MarineResources_Survey_ LawaiBay_May07.pdf Fu Y-X. 1997. Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics. 147:915–925. PMid:9335623. Gaither MR, Jones SA, Kelley C, Newman SJ, Sorenson L, Bowen BW. 2011. High connec- tivity in the deepwater snapper Pristipomoides filamentosus (Lutjanidae) across the Indo- Pacific with isolation of the Hawaiian Archipelago. PLoS One. 6(12):e28913. http://dx.doi. org/10.1371/journal.pone.0028913 Gaither MR, Toonen RJ, Robertson DR, Planes S, Bowen BW. 2010. Genetic evaluation of marine biogeographic barriers: perspectives from two widespread Indo-Pacific snappers (Lutjanus spp.). J Biogeogr. 37:133–147. http://dx.doi.org/10.1111/j.1365-2699.2009.02188.x Grant WS, Bowen BW. 1998. Shallow population histories in deep evolutionary lineages of marine fishes: insights from sardines and anchovies and lessons for conservation. J Hered. 89:415–426. http://dx.doi.org/10.1093/jhered/89.5.415 Guindon S, Gascuel O. 2003. A simple, fast and accurate method to estimate large phylog- enies by maximum-likelihood. Syst Biol. 52:696–704. PMid:14530136. http://dx.doi. org/10.1080/10635150390235520 Harpending HC. 1994. Signature of ancient population growth in a low-resolution mitochon- drial DNA mismatch distribution. Hum Biol. 66:591–600. PMid:8088750. Horne JB, van Herwerden L, Choat JH, Robertson DR. 2008. High population connectiv- ity across the Indo-Pacific: congruent lack of phylogeographic structure in three reef fish congeners. Mol Phylogen Evol. 49:629–638. PMid:18804542. http://dx.doi.org/10.1016/j. ympev.2008.08.023 Hourigan TF, Reese ES. 1987. Mid-ocean isolation and the evolution of Hawaiian reef fishes. Trends Ecol Evol. 2:187–191. http://dx.doi.org/10.1016/0169-5347(87)90018-8 Johns GC, Avise JC. 1998. A comparative summary of genetic distances in the vertebrates from the mitochondrial cytochrome b gene. Mol Biol Evol. 15:1481–1490. http://dx.doi. org/10.1093/oxfordjournals.molbev.a025875 Johnson GD, Gill AC. 1998. In: Paxton JR, Eschmeyer WN, editors. Encyclopedia of fishes Diego: Academic Press. p. 186. PMid:9516022. Szabó et al.: Phylogeography of the manybar goatfish 511
Karl SA, Toonen RJ, Grant WS, Bowen BW. 2012. Common misconceptions in molecular ecology: echos of the modern synthesis. Mol Ecol. 21:4171–4189. PMid:22574714. http:// dx.doi.org/10.1111/j.1365-294X.2012.05576.x Kendall WC, Radcliff L. 1912. Memoirs of the Museum Zoölogy at Harvard College XXXV. p. 122. Leis JM, Hay AC, Gaither MR. 2011. Swimming ability and its rapid decrease at settlement in wrasse larvae (Teleostei: Labridae). Mar Biol. 158:1239–1246. http://dx.doi.org/10.1007/ s00227-011-1644-4 Leray M, Beldade R, Holbrook SJ, Schmitt RJ, Planes S, Bernardi G. 2010. Allopatric divergence and speciation in coral reef fish: the three-spot Dascyllus, Dascyllus trimaculatus, species complex. Evolution. 64:1218–1230. PMid:20002167. Lo-Yat A, Meekan MG, Carleton JH, Galzin R. 2006. Large-scale dispersal of the larvae of near- shore and pelagic fishes in the tropical oceanic waters of French Polynesia. Mar Ecol Prog Ser. 325:195–203. http://dx.doi.org/10.3354/meps325195 Meeker ND, Hutchinson SA, Ho L, Trede NS. 2007. Method for isolation of PCR-ready ge- nomic DNA from zebrafish tissues. Biotechniques. 43(5):610–614. PMid:18072590. http:// dx.doi.org/10.2144/000112619 Meyer A. 1993. Evolution of mitochondrial DNA in fishes. In: Hochanchka PW, Mommsen TP, editors. Biochemistry and molecular biology of fishes. Elsevier, New York. p. 1–38. Mora C, Treml EA, Roberts J, Crosby K, Roy D, Tittensor DP. 2012. High connectivity among habitats precludes the relationship between dispersal and range size in tropical reef fishes. Ecography. 35(1):89–96. http://dx.doi.org/10.1111/j.1600-0587.2011.06874.x Narum S. 2006. Beyond Bonferroni: less conservative analyses for conservation genetics. Conserv Genet. 7:783–78. http://dx.doi.org/10.1007/s10592-005-9056-y Nei M. 1987. Molecular evolutionary genetics. Columbia University Press, New York. Pavlov DA, Emel’yanova NG, Ha VT, Thuan TBL . 2013. Age and growth of the manybar goat- fishParupeneus multifasciatus (Mullidae) from the Nha Trang Bay of the South China Sea. J Ichthyol. 53:478–485. http://dx.doi.org/10.1134/S003294521304005X Pavlov DA, Emel’yanova NG, Thuan TBL , Ha VT. 2011. Reproduction and initial development of manybar goatfish Parupeneus multifasciatus (Mullidae). J Ichthyol. 51:604–617. http:// dx.doi.org/10.1134/S0032945211050134 Pavlov DA, Ha VT, Thuan TBL . 2012. Otolith morphology and periodicity of increment forma- tion on the sagitta of manybar goatfish Parupeneus multifasciatus (Mullidae). J Ichthyol. 52:463–475. http://dx.doi.org/10.1134/S003294521204008X Planes S, Fauvelot C. 2002. Isolation by distance and vicariance drive genetic structure of a coral reef fish in the Pacific Ocean. Evolution. 56:378–399. PMid:11926506. Petit RJ, El Mousadik A, Pons O. 1998. Identifying populations for conserva- tion on the basis of genetic markers. Conserv Biol. 12:844–855. http://dx.doi. org/10.1046/j.1523-1739.1998.96489.x Polzin T, Daneschmand SV. 2003. On Steiner trees and minimum spanning trees in hyper- graphs. Oper Res Lett. 31:12–20. http://dx.doi.org/10.1016/S0167-6377(02)00185-2 Posada D. 2008. jModelTest: phylogenetic model averaging. Mol Biol Evol. 25:1253–1256. PMid:18397919. http://dx.doi.org/10.1093/molbev/msn083 Ramon ML, Nelson PA, DeMartini E, Walsh WJ, Bernardi G. 2008. Phylogeography, historical demography, and the role of post-settlement ecology in two Hawaiian damselfish species. Mar Biol. 153:1207–1217. http://dx.doi.org/10.1007/s00227-007-0894-7 Randall JE. 2004. Revision of the goatfish genus Parupeneus (Perciformes: Mullidae) with de- scriptions of two new species. Indo-Pacific Fish. 36:43. Randall JE. 2005. Reef and Shore Fishes of the South Pacific. University of Hawai’i Press, Honolulu. Randall JE. 2007. Reef and Shore Fishes of the Hawaiian Islands. University of Hawai’i Sea Grant, Honolulu HI. Randall JE, Cea A. 2012. Shore fishes of Easter Island. University of Hawai’i Press, Honolulu. 512 Bulletin of Marine Science. Vol 90, No 1. 2014
Randall JE, Earle JL. 2000. Annotated checklist of the shore fishes of the Marquesas Islands. Occ Pap Bernice P Bishop Mus. 66:1–39. Randall JE, Guézé P. 1980. The goatfish Mulloidichthys mimicus n. sp. (Pisces, Mullidae) from Oceania, a mimic of the snapper Lutjanus kasmira (Pisces, Lutjanidae). Bull Mus Hist Nat. 4:603–609. Reece JS, Bowen BW, Larson A. 2011. Long larval duration in moray eels (Muraenidae) en- sures ocean-wide connectivity despite differences in adult niche breadth. Mar Ecol Prog Ser. 437:269–277. http://dx.doi.org/10.3354/meps09248 Reece JS, Bowen BW, Smith DG, Larson AF. 2010. Molecular phylogenetics of moray eels (Murenidae) demonstrates multiple origins of a shell-crushing jaw (Gymnomuraena, Echidna) and multiple colonizations of the Atlantic Ocean. Mol Phylogen Evol. 57:829–835. PMid:20674752. http://dx.doi.org/10.1016/j.ympev.2010.07.013 Rivera MAJ, Andrews KR, Kobayashi DR, Wren JL, Kelley C, Roderick GK, Toonen RJ. 2011. Genetic analyses and simulations of larval dispersal reveal distinct populations and direc- tional connectivity across the range of the Hawaiian grouper (Epinephelus quernus). J Mar Bio. 2011:Article ID 765353, 11 pages. Robertson DR, Grove JS, McCosker JE. 2004. Tropical transpacific shore fishes. Pac Sci. 58:507–565. http://dx.doi.org/10.1353/psc.2004.0041 Rocha LA, Bowen BW. 2008. Speciation in coral reef fishes. J Fish Biol. 72:1101–1121. http:// dx.doi.org/10.1111/j.1095-8649.2007.01770.x Rocha LA, Lindeman KC, Rocha CR, Lessios HA. 2008. Historical biogeography and specia- tion in the reef fish genus Haemulon (Teleostei: Haemulidae). Mol Phylogen Evol. 48:918– 928. PMid:18599320. http://dx.doi.org/10.1016/j.ympev.2008.05.024 Rogers AR, Harpending H. 1992. Population growth makes waves in the distribution of pair- wise genetic differences. Mol Biol Evol. 9:552–569. PMid:1316531. Schultz JK, Feldheim KA, Gruber SH, Ashley MV, McGovern TM, Bowen BW. 2008. Global phylogeography and seascape genetics of the lemon sharks (genus Negaprion). Mol Ecol. 17:5336–5348. PMid:19121001. http://dx.doi.org/10.1111/j.1365-294X.2008.04000.x Selkoe KA, Watson J, White C, Ben-Horin T, Iacchei M, Miterai S, Siegel D, Gaines SD, Toonen RJ. 2010. Taking the chaos out of genetic patchiness: seascape genetics reveals ecological and oceanographic drivers of genetic patterns in three temperate reef species. Mol Ecol. 19:3708–3726. PMid:20723063. http://dx.doi.org/10.1111/j.1365-294X.2010.04658.x Selkoe KA, Toonen RJ. 2011. Marine connectivity: a new look at pelagic larval duration and genetic metrics of dispersal. Mar Ecol Prog Ser. 436:291–305. http://dx.doi.org/10.3354/ meps09238 Tamura K, Nei M. 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol. 10(3):512–526. PMid:8336541. Toonen RJ, Andrews KR, Baums IB, Bird CE, Concepcion CT, Daly-Engel TS, Eble JA, Faucci A, Gaither MR, Iacchei M, et al. 2011. Defining boundaries for applying ecosystem-based management: a multispecies case study of marine connectivity across the Hawaiian Archipelago. J Mar Biol. Article ID 460173. http://dx.doi.org/10.1155/2011/460173 Uiblein F. 2007. Goatfishes (Mullidae) as indicators in tropical and temperate coast- al habitat monitoring and management. Mar Biol Res. 3(5):275–288. http://dx.doi. org/10.1080/17451000701687129 von Bertalanffy L. 1938. A quantitative theory of organic growth. Hum Biol. 10:181–213. Woodland DJ. 1983. Zoogeography of the Siganidae (Pisces): an interpretation of distribution- and richness patterns. Bull Mar Sci. 33:713–717. Voris HK. 2000. Maps of Pleistocene sea levels in Southeast Asia: shorelines, river systems and time durations. J Biogeogr. 27:1153–1167. http://dx.doi.org/10.1046/j.1365-2699.2000.00489.x Wyrtki K, Kilonsky B. 1983. Mean water and current structure during the Hawai’i- to-Tahiti shuttle experiment. J Phys Oceanogr. 14:242–254. http://dx.doi. org/10.1175/1520-0485(1984)014<0242:MWACSD>2.0.CO;2