In Vitro Antioxidant and Antiproliferative Effects of Ellagic Acid and Its Colonic Metabolite, Urolithins, on Human Bladder Cancer T24 Cells

Food and Chemical Toxicology 59 (2013) 428–437

Contents lists available at SciVerse ScienceDirect

Food and Chemical Toxicology

journal homepage: www.elsevier.com/locate/foodchemtox

In vitro antioxidant and antiproliferative effects of ellagic acid and its colonic metabolite, urolithins, on human bladder cancer T24 cells

Zhenpeng Qiu a,1, Benhong Zhou b,1, Long Jin b, Honglian Yu a, Lijuan Liu a, Youyi Liu a, Chengchen Qin a, ⇑ Shuixiang Xie c, Fan Zhu a, a Department of Medical Microbiology, School of Medicine, Wuhan University, No. 185 Donghu Road, Wuhan 430071, People’s Republic of China b Department of Pharmacy, Renmin Hospital, Wuhan University, No. 238 Jiefang Road, Wuhan 430060, People’s Republic of China c Department of Pathogenic Biology, Gannan Medical University, Jiangxi 341000, People’s Republic of China article info abstract

Article history: Urolithins were the metabolites of ellagic acid by intestinal ﬂora in gastrointestinal tract. In previous Received 27 March 2013 research, it was found that urolithins could mainly inhibit prostate cancer and colon cancer cell growth. Accepted 14 June 2013 However, there is no report about bladder cancer therapy of urolithins. In this paper, three urolithin-type Available online 26 June 2013 compounds (urolithin A, urolithin B, 8-OMe-urolithin A) and ellagic acid were evaluated for antiprolifer-

ative activity in vitro against human bladder cancer cell lines T24. The IC50 values for T24 cell inhibition Keywords: were 43.9, 35.2, 46.3 and 33.7 lM for urolithin A, urolithin B, 8-OMe-urolithin A and ellagic acid, respec- Urolithin tively. After the administration of urolithins and ellagic acid, we found these compounds could increase Ellagic acid mRNA and protein expression of Phospho-p38 MAPK, and decrease mRNA and protein expression of Antioxidant Apoptosis MEKK1 and Phospho-c-Jun in T24 cells. Caspase-3 was also activated and PPAR-c protein expression Antiproliferative increased in drug-induced apoptosis. And what’s more, the antioxidant assay afforded by three urolithins and EA treatments were associated with decreases in the intracellular ROS and MDA levels, and increased

SOD activity in H2O2-treated T24 cells. The results suggested that these compounds could inhibit cell proliferation by p38-MAPK and/or c-Jun medicated caspase-3 activation and reduce the oxidative stress status in bladder cancer. Ó 2013 Elsevier Ltd. All rights reserved.

1. Introduction hydroxylation patterns, in gastrointestinal tract (Mertens-Talcott et al., 2006). Phenolic compounds are the secondary metabolite of fruits and Recently, anti-tumor activity of EA and urolithins has been ex- vegetables and it is confirmed that their beneficial effects for hu- plored in human or other mammal cells. A recent research has man health related to antioxidant activity, anti-inflammatory, po- found EA could inhibit the proliferation of Caco-2, MCF-7, Hs tential tumorous prevention (Larrosa et al., 2010; Nandi et al., 578T and DU 145 cells. There antiproliferative activities were re- 2007; Rice-Evans et al., 1997). The consumption of vegetables lated to the decrease of ATP (Losso et al., 2004). Ellagic acid was and fruits with high content polyphenols is considered to be the confirmed to be effective in decreasing the lipid peroxidation and prevention of various forms of tumor. increasing the GSH. This antioxidant effect is essential for Anticar- Intestinal flora plays an essential role in not only deconjugation cinogenic potential of ellagic acid (EA) against N-nitrosodiethyl- of glycosyl or glucuronosyl moiety from the phenolic backbone, amine-induced lung tumorigenesis in mice (Khanduja et al., but also in structural modification, such as decarboxylation, 1999). Activation of the cdk inhibitory protein p21 by EA suggests demethylation and dehydroxylation (Gusman et al., 2001). As the an important role for EA in cell cycle regulation of cancer cells hydrolysis product of ellagitannins (ET), Ellagic acid (EA) was fur- (Narayanan et al., 1999). EA also shows its anti-tumor activity by ther metabolized to urolithins, a family of metabolites of the 6H- eliminating the multiple drug resistance (MDR), inducing apopto- dibenzo-[b, d] pyran-6-one structure with different phenolic sis and the expression of caspase-3 (Hayeshi et al., 2007; Larrosa et al., 2006; Mertens-Talcott et al., 2006). Researchers found that urolithins released in the colon could potentially curtail the risk ⇑ Corresponding author. Tel.: +86 27 68759906. of colon cancer development, by inhibiting cell proliferation and E-mail address: [email protected] (F. Zhu). 1 These authors contributed equally to this work. inducing apoptosis (Kumar et al., 2010). Selma showed that

0278-6915/$ - see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fct.2013.06.025 Z. Qiu et al. / Food and Chemical Toxicology 59 (2013) 428–437 429 urolithin A could inhibit the canonical wnt signal pathway and 2.2. Cell culture and treatment interfer with b-catenin/TCF-dependent transcription in human co- Cells of T24 were purchased from American Type Culture Collection (Manassas, lon cancer cell lines HT29 (Selma et al., 2009). In other study, it has VA, USA). Cells were maintained in RPMI-1640 (GIBCO BRL, MD, USA) supple- been showed that urolithins exhibits inhibiting activity on 22Rv1 mented with 10% fetal bovine serum, 100 units/ml penicillin, and 100 lg/ml strep- prostate cancer cells by interfered with the expression of CYP1B1 tomycin sulfate at 37 °C with 5% CO2 (Urech et al., 2006). T24 cells were plated in protein (Kasimsetty et al., 2009). 96-, 12- or 6-well plates at appropriate fusion rate 12 h prior to administration of Nowadays, finding low toxicity and efficient anticancer com- UroA, UroB, 8-OMe-UroA and EA, soluted in 3 lL dimethyl sulfoxide. To perform cell counting kit (CCK) assay, serial dilutions of compounds were prepared in ratios rel- pounds from natural drugs is one of the hotspot of medical re- ative to the IC50 of cells and incubated for 48 h. Crystal violet assay were carried out search. Bladder cancer is the most common malignant tumor of with a time-effect course from 0 to 72 h and IC50 of the chemicals was used as the urinary system. The biological behavior of bladder tumors is experimental dosage. To perform flow cytometry, transmission electron microscope so complicated and changeable that it makes the bladder cancer assay, semi-quantitative RT-PCR, real-time quantitative PCR, western blot analysis and caspase-3 activity assay, cells were treated with the chemicals in their IC vulnerable to relapse, invasion and metastasis. In addition to sur- 50 for 48 h added in culture medium with DMSO. The drugs were appropriately solut- gery, systemic chemotherapy has become the standard treatment ed and the concentration was 43.9, 35.2, 46.3 and 33.7 lM in culture medium, of metastatic bladder cancer. Chemotherapy drugs commonly used respectively. The final concentration of DMSO in each well was 0.8% and it’s no ob- in the treatment of bladder cancer include doxorubicin, hydroxy- servable toxicity in our study as previously described (Aiken et al., 2004). T24 cells camptothecin, mitomycin and gemcitabine. However, due to the without treatment and DMSO-added (the same volume as drug treated groups) were used as blank control (Control) and negative control. drug resistance, the tumor cells showed insensitive to these drugs. Mitogen-activated protein kinase (MAPK) is the transmitter of cell 2.3. CKK and crystal violet assay signal conduction from the cell surface to the nucleus. Research has shown that p38, one of four MAPK subfamilies, is mainly involved Cell viability was determined by CCK (WST-8) assay in accordance with stan- in malignant invasion and metastasis of bladder neoplasms (Roux dard procedures (Wu et al., 2012). 10 lL of CCK solution was added to each well, and Blenis, 2004). The gene encoding MEK kinase 1 (MEKK1) has and the mixture was cultured for another 1 h at 37 °C. Absorbance at 450 nm was measured using the Multiskan FC plate reader and analyzed with Skanlt for Multi- important biological functions, such as cell survival and apoptosis, scan FC software (Thermo Scientific). For a time-effect evaluation of 4 chemicals, also involved in the movement and migration of bladder cancer. cells were seeded in 24 well at 60–70% fusion rate. After 0, 24, 48 and 72 h admin- Activated MEKK1 can also activate its downstream pathway, such istration of 4 chemicals, culture medium was removed and cells were washed with as p38, JNK, and ERK signal pathway (Yujiri et al., 1998). The p53 phosphate-buffered saline (PBS). The remaining viable attached cells were stained gene is one of the most systematic and widely studied tumor sup- with 0.5% crystal violet in 50% methanol for 30 min. The plates were then gently rinsed with methanol until no dye dissolved and dried in room temperature. Cells pressor genes. The wild-type p53 involves in cell cycle regulation, were lysed with 10% SDS for 30 min. Then, the absorbance of supernate was read DNA repair, apoptosis and angiogenesis. Decreased expression or at 570 nm using a spectrophotometer (Thermo Scientific). The percentage of cell mutation of p53 gene makes the loss of function, leading to forma- survival was defined as the relative absorbance versus cells before administration tion of bladder tumor (Roychowdhury et al., 2012). (0 h of each drug group) (Liu et al., 2011). The aim of present study was to investigate antiproliferative properties of urolithin A, urolithin B, 8-OMe-urolithin A and ellagic 2.4. Measurement of intracellular ROS, MDA and SOD level acid in T24 human bladder cancer cells. We also assayed the anti- Antioxidant activity was evaluated by using hydrogen peroxide mediated oxi- oxidant ability of these compounds against H2O2 induced intracel- dative stress model. When the drug treatment was finished, cells were washed 3 lular oxidative stress, their effects on caspase-3 activation and times in PBS, and incubated for 3 h with 100 mM H2O2 at 37 °C. DCFH-DA was used mRNA and/or protein of p38-MAPK (mRNA, phosphorylated pro- in the measurement of intracellular ROS level (Yokozawa et al., 2007). DCFH-DA is a non-fluorescent compound that is converted by enzyme catalysis to the fluorescent tein), MEKK1 (mRNA, protein), c-Jun (mRNA, phosphorylated and compound DCF in the presence of ROS. Briefly, T24 cells were seeded onto a 96-well non-phosphorylated protein), p53 (mRNA), cleaved caspase-3 culture plate at 90% fusion per well. At the end of the H2O2 incubation, the cells (protein) and peroxisome proliferator-activated receptors Gamma were washed with PBS and incubated with DCFH-DA at the concentration of (PPAR-c, protein). 10 lM for 30 min at 37 °C in the dark. The cells were then washed 3 times with PBS, and the fluorescence intensity of the DCF was measured with microplate reader (Thermo scientific) at an excitation and emission wavelength of 485 nm and 538 nm, respectively. The MDA content was measured as previously described (Ohkawa et al., 1979) with some modification. Briefly, 3 mL of 20% acetic acid, 3 mL of 0.8% thiobarbituric 2. Materials and methods acid, 400 lL of 8% sodium dodecyl sulfate, 500 lL pretreated cell supernatant was mixed and heated for 60 min at 95 °C. Then 6 mL of n-butanol was added into the 2.1. Reagents and compounds mixture. After extraction and centrifugation at 4000g for 15 min, n-butanol layer was obtained and the absorbance was measured at 532 nm. Commercial standards of ellagic acid (EA) and chemicals used for syntheses of The SOD activity was measured using a SOD activity assay kit (CellBiolabs, San the urolithin derivatives (2-bromobenzoic, 2-bromo-5-methoxybenzoic and acetic Diego, CA) according to the manufacturer’s protocol. The protein content was mea- acids, resorcinol, etc.) were obtained from Sigma–Aldrich (St. Louis, MO). Urolithins sured using the Bradford method with BSA (bovine serum albumin) as standard (Urolithin A, UroA; Urolithin B, UroB; 8-OMe-Urolithin A, 8-OMe-UroA) were syn- (Bradford, 1976). thesized according to methods previously reported (Bialonska et al., 2009) and identified by nuclear magnetic resonance (NMR). The NMR data was showed as fol- 1 2.5. RNA extraction and reverse transcription low: UroA H NMR: (400 MHz, (CD3)2SO): d 8.11 (d, J = 8.8 Hz,1H,OH), 8.02 (d, J = 8.7 Hz, 1H,OH), 7.51 (d, J = 2.6 Hz, 1H), 7.32 (dd, J = 8.8, 2.6 Hz, 1H), 6.81 (dd, 13 After 48 h treatment with IC of UroA, UroB, 8-OMe-UroA and EA, total RNA of J = 8.7, 2.4 Hz,1H), 6.72 (d, J = 2.4 Hz, 1H); C NMR: (300 MHz, (CD3)2SO): d 50 cells in 6 well plates was extracted using TRIzolÒ reagent (Invitrogen) according to 160.5, 158.5, 156.9, 150.8, 126.8, 124.1, 123.9, 123.2, 120.1, 113.4,112.5, 109.7, 1 the manufacturer’s recommendation. Extracted total RNA were treated with RQ1 102.3. UroB H NMR: (400 MHz, (CD3)2SO) d 10.32 (s, 1H,OH), 8.12 (d, J = 8.5 Hz, RNase-Free DNase (Promega, Madison, WI) at 37 C for 30 min to eliminate genomic 1H), 8.04 (d, J = 8.4 Hz, 1H), 7.80(t, J = 8.5 Hz,1H), 7.45(t, J = 8.5 Hz,1H), 6.80(d, ° 13 DNA contamination. About 1.0 lg of the total RNA was used as template in reverse- J = 8.0 Hz,1H), 6.71(s,2H); C NMR: (100MHZ,(CD3)2SO) d 165.77, 165.06, 157.30, 140.33, 140.24, 134.82, 132.72, 129.90, 126.71, 124.12, 118.33, 114.53, 108.14. 8- transcription reaction by ReverTra Ace (Toyobo, Japan) with an oligo (dT) 18 at 1 37 °C for 60 min (Huang et al., 2011). The cDNA was stored at 80 °C for further use. OMe-UroA H NMR: (400 MHz, (CD3)2SO) d 10.24 (s, 1H,OH), 8.15 (d, J = 8.7 Hz, 1H), 8.04 (d, J = 8.4 Hz, 1H), 7.56 (s, 1H), 7.45 (d, J = 8.5 Hz, 1H), 6.81 (d, J = 8.0 Hz, 1H), 6.73 (s, 1H), 3.90 (d, J = 22.3 Hz, 3H). 13C NMR: (100 MHz, (CD3)2SO) d 2.6. Semi-quantitative RT-PCR and real-time quantitative PCR 160.47, 158.91, 158.43, 151.11, 128.46, 124.08, 123.87, 123.49, 119.96, 113.05, 110.73, 109.44, 102.79, 55.49. 20,70-Dichlorofluorescin diacetate (DCFH-DA) was Primers used in PCR assay are listed in Table 1 as described in previous research purchased from Invitrogen (Carlsbad, CA, US). 5,5-Dithiobis (2-nitrobenzoic acid) (Asur et al., 2010; Cai et al., 2000; Hong et al., 2010; King et al., 2001; Teng et al., and thiobarbituric acid were purchased from Sigma–Aldrich (St. Louis, MO, US). 2007). PCR amplification was carried out in a MyCycler™ Thermal Cycler (Bio- All other chemicals and reagents were of analytical grade. Rad Laboratories) as follows: 94 °C for 5 min; 94 °C for 30 s, 60 °C for 30 s, 72 °C 430 Z. Qiu et al. / Food and Chemical Toxicology 59 (2013) 428–437

Table 1 Sequences of polymerase chain reaction (PCR) primer. Except 2 pairs of primer were used in p53 expression, all primers were used in both real time and semi-quantitative PCR.

Forward primer Reverse primer p38 AAGCACGAGAACGTCATCGG TCACCAAGTACACTTCGCTGA MEKK1 TGCGGGCCAGACTGTACTTACT TGCAGTTCTGAGGCCCAATAA c-Jun TGCCTCCAAGTGCCGAAAAA TGACTTTCTGTTTAAGCTGTGCC p53 ATGTGTAACAGTTCCTGC (Real time) GCTCGCTTAGTGCTCC (Real time) CTGAGGTTGGCTCTGACTGTACCACCATCC (Semi-quantitative) CTCATTCAGCTCTCGGAACATCTCGAAGCG (Semi-quantitative) b-actin CCTGGCACCCAGCACAAT GGGCCGGACTCGTCATACT for 30 s, 33 cycles; followed by 72 °C for 10 min. PCR products were visualized on mean 6 standard error of the mean, obtained from at least 5 independent trials, 2% EtBr-stained agarose gels, and the band intensity was quantitated using the Mini and the difference was considered significant if the corresponding P value was Bis Pro (Bio-Imaging Systems, Ltd., Israel). Quantification Real-time RT-PCR was <.05. All the experiments were performed blindly. performed on the iCycler System (Bio-Rad, USA) (Huang et al., 2011). Target gene expression levels were normalized by b-actin gene. The results were given as d- 3. Results Ct values. Except the p53 primer, other primers used were the same to the semi- quantitative RT-PCR. A Two Step Real-Time PCR method was employed for gene amplification and the cycling conditions were as follow: Initial denaturation at 3.1. Urolithins and EA could inhibit the proliferation of T24 cells 95 °C for 2 min, then 95 °C for 15 s and 56 °C for 30 s, for 40 cycles. Antiproliferative activities of urolithin compounds on the growth of T24 cells in vitro were summarized in Fig. 1. When the 2.7. Western blot assay T24 cells were administrated with different urolithin compounds Western blot assay was performed as described previously (Vicente-Sanchez and EA concentrations in vitro from 1 to 120 lM, all compounds et al., 2008). After the floating and the adherent cells were collected and combined, showed consistent concentration-dependent but nonlinear growth cells protein were obtained by using M-PER regent (Pierce, Rockford, IL) and protein inhibition in CCK assay. The IC50 values for T24 cell inhibition were concentration was determined by the Bradford method(Bio-Rad, Hercules, CA) with BSA as the standard. Twenty micrograms of protein lysate was separated by 10% 43.9, 35.2, 46.3 and 33.7 lM for UroA, UroB, 8-MeO-UroA and EA, SDS-PAGE, and then electrophoretically transferred to a nitrocellulose membrane respectively. In the crystal violet staining test, cell proliferation (Amersham Biosciences, USA). The membranes with proteins were blocked at room was blocked in all the drug groups (Fig. 2). As shown in Fig. 2A, temperature for 1 h in blocking buffer and then were hybridized with the following all the chemicals led to a marked decrease in cell proliferation after primary antibodies: Phospho-p38 MAPK (Thr180/Tyr182) Antibody (CST, US), 48 h treatment. Further quantitative analysis demonstrated the MEKK1 Antibody (ABcam, UK), Phospho-c-Jun (Ser73) Antibody (CST, US), c-Jun Antibody (CST, UK), cleaved caspase-3 antibody (ABclonal, UK), PPAR-c and rabbit colorimetric value in drug-treated cells is approximately 50–70% polyclonal antibody to b-actin (Abcam, UK). Peroxidase-conjugated goat antirabbit of that in the control and DMSO group at 0 h (Fig. 2B). Moreover, IgG (Abcam, UK) were used as second antibody for immunoblotting analysis. After T24 cell viability with 72 h treatment showed no significant differ- extensive washing, the protein was visualized with enhanced chemiluminescence ence to 48 h administration. These findings strongly suggested that substrate solution (Amersham Biosciences). b-actin served as the internal standard for all experiments. The bands were quantified by densitometric analysis (Gel Pro antiproliferative effect of UroA, UroB, 8-OMe-UroA and EA was reli- 4.5, USA). able in IC50 of each chemical at 48 h.

3.2. The level of H2O2-induced oxidative stress was reduced by 2.8. Flow cytometry and morphological observation by transmission electron microscope Urolithins and EA

After combining the floating and adherent cells, cells were treated by an Annex- To confirm the antioxidant activity of urolithins and EA, all in V-FITC/propidium iodide (PI) apoptosis detection kit (Sungene Biotech, China) test teams were employed an negative control (cells without according to the manufacturer’s protocol (Liu et al., 2012). Cells were analyzed by flow cytometer (Epics Altra II; Beckman Coulter, California, USA). The apoptosis rate of cells was measured by a Beckman Coulter Epics Altra with Expo32 software (Beckman Coulter). For electron microscope observation, T24 cells were incubated with drugs by the same method as flow cytometry analysis before harvest. Samples were prepared as described previously (Azuma et al., 2002) and viewed with an H- 600 electron microscope (Hitachi, Japan).

2.9. Caspase-3 activity assay

The colorimetric assay kits from R&D Systems (Minneapolis, MN, USA) were used to determine the activities of caspase-3 (Yeh et al., 2007). Brieﬂy, the cells were seeded in a whole 6-well plate of each group. After 48 h administration of

IC50 of each chemical, the cells were harvested and cell lysates were centrifuged at 14,000 rpm for 10 min. After determination of protein concentration, 100 lgof the protein of each sample were incubated with 50 lL of the colorimetric tetrapep- tides Asp-Glu-Val-Asp (DEAD)-p-nitroaniline for caspase-3 for 3 h at 37 °C. The T24 cells were also pretreated with the cell permeable broad-spectrum caspase inhibitor z-VAD-fmk 3 h prior to treatment with urolithins and EA as a control. The reac- tions were measured by changes in absorbance at 405 nm using the Multiskan FC plate reader and analyzed with Skanlt for Multiscan FC software (Thermo Scientiﬁc).

2.10. Statistical analyses Fig. 1. Antiproliferative effects of UroA, UroB, 8-MeO-UroA and EA on human Two-tailed Student t test was used for statistical comparison. Data from exper- bladder cancer T24 cells. After cultured with compounds in different concentrations iments involving multiple samples subjected to different treatments were analyzed for 48 h, cells were added with 10 lL WST-8 solution for CCK assay. Negative for multiple pairwise comparisons by the Mann-Whitney U test and the Kruskal- control cells get 0.8% of DMSO in culture medium (v/v) (shows no proliferative Wallis one-way analysis of variance test. The signed Wilcoxon rank sum test was effects on cells as Control group). The average ± SD was obtained from ﬁve used to analyze cytokine messenger RNA (mRNA) levels. Data were expressed as independent experiments. Z. Qiu et al. / Food and Chemical Toxicology 59 (2013) 428–437 431

Fig. 2. (A) Crystal violet cell viability assay of UroA, UroB, 8-MeO-UroA and EA on human bladder cancer T24 cells. Cells were plated about 60–70% fusion rate in 24-well plate with 1 mL culture medium for 12 h. Then cells were stained with crystal violet after 0, 24, 48, 72 h urolithins or EA administration. Each drug was dissolved in 8 lL and added into wells, 8 lL DMSO was also added in another well as a control (DMSO), and cells with no treatment was a blank control (Control). Data were obtained from three independent experiments, and representative results are shown. (B) Cell viability was quantitatively assessed using a colorimetric assay (see Section 2). Differences in colorimetric values were subjected to statistical analysis. p < 0.05.

Fig. 3. Effects of UroA, UroB, 8-MeO-UroA and EA on H2O2-induced oxidative stress in T24 cells. Oxidative stress was assessed by measuring the intracellular ROS level (A), MDA level (B), SOD level (C) (see Methods). The values given are the mean ± SD of ﬁve independent experiments. n =5p < 0.05 (compared with the Control group).

H2O2 treatments) in ordering to eliminate the other effects of urolithins and EA. 48 hours after administration, we examined urolithins and EA. As shown in Fig. 3, oxidative stress was esti- the expression of p38-MAPK, MEKK1, c-Jun and p53 at the mRNA mated by measuring the intracellular ROS level, MDA level, and levels by reverse transcription PCR (RT-PCR), respectively. Using

SOD activity. After the presence of 100 m M H2O2 for 3 h, the Quantitative RT-PCR, we found that the mRNA levels of MEKK1 intracellular ROS level and MDA level of the T24 cells increased and c-Jun are lower in urolithins and EA administrated cells than to 437% and 211% of the control value, respectively, whereas in the control (Fig. 6A–D). The gene expression of 48 h after admin- SOD activity, significantly decreased to 26.3% of the control va- istration, urolithins and EA decreased the mRNA expression of lue, respectively, suggesting that H2O2 may induce oxidative MEKK1 by 3-, 4-, 0.6- and 2-fold, c-Jun by 1-, 2.5-, 3- and 2-fold, stress. When the T24 cells were incubated with different urolit- respectively (Fig. 6B,C). The p38-MAPK gene expression, however, hins and EA in the presence of 100 mM of H2O2 for 3 h, both the was up-regulated by 6-, 5-, 2.5- and 3-fold after dosing, and signif- intracellular ROS level (43.2%, 17.7%, 33.8% and 53.3% of the con- icantly higher than in the control (Fig. 6A). Semi-quantitative RT- trol value, respectively) and the MDA level (41.6%, 35.9%, 34.3% PCR was used to confirm the results. We also found that the mRNA and 43.2% of the control value, respectively) significantly levels of p38-MAPK, MEKK1, c-Jun showed similar change in the decreased, whereas the SOD activity significantly increased urolithins and EA administrated cells contrast in the control (120%, 149%, 83.4% and 188% of the control value, respectively) (Fig. 6E). Even though two specific primers were used to amplify compared with negative control. the p53 gene, there was no significant difference of p53 gene expression between administration group and control (Fig. 6D). 3.3. Urolithins and EA enhance the gene expression of p38-MAPK, and reduce the expression of MEKK1 and c-Jun, but have no effects on p53 expression 3.4. Urolithins and EA increase the phosphorylated p38 MAPK and decrease the MEKK1, phosphorylated c-Jun in T24 cells Considering activation of MAPK and other signaling pathway in bladder cancer, it would be intriguing to determine whether urolit- Furthermore, we analyzed the protein amounts of phosphory- hins affect the expression of genes, such as p38, MEKK1, c-Jun and lated p38-MARK, MEKK1, phosphorylated-c-Jun after 48 h admin- p53 in T24 cell lines. To do so, T24 cells were administrated with istration with urolithins and EA by western blot assay (Fig. 7). In 432 Z. Qiu et al. / Food and Chemical Toxicology 59 (2013) 428–437

Fig. 4. Urolithins and EA induced T24 cells apoptosis. Cells were seeded in 6-well plate in 60% fusion rate for 12 h, and then cells were treated with urolithins or EA at their

IC50 for 48 h. After administration, the apoptosis rates of cells were measured with Annexin V-FITC / propidium iodide by flow cytometry (A). The apoptotic cells are shown as the mean ± standard deviation based on three independent experiments. p < 0.05 (B). comparison with the control, the expression level of phosphory- administration, especially in UroB group, by above 1-fold than lated p38-MAPK protein was increased after the Uro A and B the control group (Fig. 7A). The expression level of MEKK1 in all Z. Qiu et al. / Food and Chemical Toxicology 59 (2013) 428–437 433 administration groups was at least decreased by about 1-fold than whether apoptosis induced by urolithins and EA was associated in the control (Fig. 7B). The expression level of phosphorylated c- with activation of caspase-3, Asp-Glu-Val-Asp (DEAD)-p-nitroani- Jun was lower in the UroA, B and EA group, but weakly higher in line and Ile-Glu-Thr-Asp (IETD)-p-nitroaniline were incubated 8-MeO-UroA than in the control (Fig. 7C). UroA, B and EA enhanced with T24 cells treated with uorlithins and EA. As shown in the protein expression of phosphorylated c-Jun by 35%, 28% and Fig. 8A, Cells treated with urolithins or EA significantly increased 23% of the control value, respectively. Moreover, non-phosphoryla- caspase-3 by approximately 2-fold. These results indicate that uro- tion c-Jun protein levels have no significant difference between lithins and EA induces caspase-3 dependent death in T24 cells, at control and drug-treated group (Fig. 7D). least in part through a caspase-3 pathway. Peroxisome proliferator-activated receptors Gamma (PPAR-c) was a kind of subtype of PPARs nuclear hormone receptor super- 3.5. Apoptosis and activation of caspase-3 activities by urolithins and family. As the activation of p38 MAPK, up-regulation of PPAR-c EA mediates death receptor signal pathway by decreasing the expression of survivin and XIAP, then leading to increase of cleaved cas- To investigate the antiproliferative function of urolithins and pase-3 level, ultimately resulting in tumor cell apoptosis (Schwab EA, CCK and crystal violet assay had been performed. And the role et al., 2006). As depicted in Fig. 8, with the phosphorylation of of urolithins and EA in T24 cell apoptosis was further confirmed by p38 MAPK and increase of MEKK1 protein expression (Fig. 7A flow cytometry analysis. T24 cells were treated with urolithins and and B) in drug-treated cell necrosis and apoptosis, caspase-3 was EA in IC of each chemical for 48 h and cell apoptosis were ob- 50 activated and cleaved caspase-3 protein expression were up-regu- served in all drug-induced groups. The percentage of apoptotic lated by 2.0-, 1.5-, 1.3-, and 1.8-fold, respectively (Fig. 8B and D), cells significantly increased compared to control group (Fig. 4A). combined with significantly augmented PPAR-c protein expression The average percentages of drug-induced apoptotic T24 cells were (Fig. 8C and D). These results commonly suggested that Phospho- 29.6%, 27.0% 19.8% and 28.6% for UroA, UroB, 8-MeO-UroA and EA, p38 MAPK is involved in the drug-induced caspase-3 activation, respectively, suggesting that these chemicals could promote T24 and PPAR-c also participated in p38 MAPK-mediated caspase-3 cell apoptosis in vitro (Fig. 4B). What’s more, the cell ultrastructure activation. of urolithins and EA induced apoptosis was also observed under the electron microscope. Morphological assay by electron microscope is one of the most credible methods to identify apoptosis 4. Discussion cells. At present research of apoptotic cell, nuclear chromatin change was summarized as nuclear chromatin condensation, and In recent days, polyphenols in diet, such as pomegranate and regard as one of the important morphological characteristics of raspberry (Jean-Gilles et al., 2011; Mertens-Talcott et al., 2006) apoptotic cells (Patel and Gores, 1995). In our findings, cells in con- has been demonstrated to have potential biological activity. In fact, trol and DMSO group were observed with normal chromatin in nu- most of polyphenols have been metabolized to other absorptive clei and microvilli-like structures on the cell surface (Fig. 5A and B). compound in gastrointestinal tract before intake by human or However, after administration with urolithins and EA, typical other mammals (Selma et al., 2009). apoptotic characteristics including chromatin condensation and Due to the constituent complexity and chemical instability of deficiency of microvilli-like structures on the cell surface could hydrolyzable tannins, we focus on urolithins and EA, the metabo- be found under transmission electron microscope (Fig. 5C–F). Ex- lites of hydrolyzable tannins, to evaluate their effects on bladder cept in 8-OMe-UroA group, the appearance of more intracytoplasm cancer T24 cells. vacuolus was also visualized. These findings suggest that urolithins In previous study, urolithins and EA showed strong cytotoxicity and EA treatment indeed induced apoptosis in vitro in T24 cells on other cancer cell lines, such as prostate cancer (Gasmi and San- when treated at a concentration of each IC50 of chemicals for 48 h. derson, 2010; Seeram et al., 2007) and colon cancer (Kasimsetty Caspase-3 is a trigger caspase that is involved in the degrada- et al., 2010). In our study, we have demonstrated that all tested tion of several cellular components concerned to DNA repair and compounds, UroA, B, 8-OMe-UroA and EA had antiproliferative regulation and displays a core role in cell apoptosis. To determine activities in T24 cells. UroB and 8-OMe-UroA showed lower IC50

Fig. 5. Cell substructures in T24 cancer cells treated with and without drugs, as analyzed by electron microscopy. Typical apoptotic characteristics, including fragmented nuclei with condensed chromatin, and lack of microvilli-like structures on the cell surface were observed in drug treated groups (C–F), compared with control and DMSO group (A, B). 434 Z. Qiu et al. / Food and Chemical Toxicology 59 (2013) 428–437 than UroA and EA. It suggests that the urolithin compounds and EA compounds and their hydroxyl number is no direct link in this can moderate the cancerous process in human bladder cancer T24 study. Urolithin B, lest hydroxyl number in the compounds, cells. showed the same MDA-regulated ability as EA. In fact, not only Intracellular oxidative stress is considered as imbalance be- antioxidant groups were significant for intracellular antioxidant tween the produce and elimination of reactive oxygen species activity, appropriate polarity is also essential for compounds to (ROS), or excessive intake of ROS lead to accumulation in the body cross cell membrane. This could explain EA keeps most hydroxyl to cause cell toxicity. ROS usually formed in cell energy metabo- but shows similar intracellular antioxidant activity as UroB. lism, which convert molecular oxygen to hydrone. Superoxide dis- In recent study, p38 MAPK and MEKK1 play an important role in mutase (SOD), an important antioxidant enzyme to maintain a cell differentiation, apoptosis, migration and proliferation. The c- dynamic balance between production and elimination of free rad- Jun, the member of activation protein 1, is activated according to icals, can convert the superoxide anion into oxygen and hydrogen phosphorylation by the JNK pathway, and as a transcription factor peroxide. Malondialdehyde (MDA) is a lipid peroxidation product, involved in the regulation of gene transcription. Frequently, High which is formed from a variety of unsaturated fatty acids in biolog- level of MEKK1 and c-Jun expression and low level of p38-MAPK ical membranes by ROS stimulation. MDA has a strong biological expression was found in the process of malignant tumor formation activity and stable chemical properties. The determination of the (Bradham and McClay, 2006; Das et al., 2011; Su et al., 2009). Both content of MDA can reflect the degree of lipid peroxidation of the p38 MAPK and c-Jun related pathway was activated in bladder can- organism (Finkel, 2003). Our study found that both urolithins cer (Itoh et al., 2006; Kumar et al., 2010). Based on these findings, and EA could decrease the ROS and MDA levels, and increase the we conducted pharmacological studies to examine the activity of

SOD contents in the T24 cells treated with H2O2. The similar ﬁnd- Urolithins and EA in the T24 cells. We found that transcription ings were also revealed in a cell-based assay on HL-60 cell lines and protein of p38-MAPK, MEKK1, and c-Jun in T24 cells are regu- (Bialonska et al., 2009). However, the antioxidant activity of these lated by urolithins and EA. Except the effects of 8-OMe-Urolithin A

Fig. 6. RT-PCR analysis of the expression of p38, MEKK1, c-Jun and p53. Total RNA was extracted, and levels of target gene and b-actin mRNA were determined by RT-PCR. (A- D) Histograms show p38, MEKK1, c-Jun and p53 mRNA levels quantiﬁed by real-time PCR; each bar represents the mean ± SD normalized to the starting total RNA volumes and referred to the corresponding b-actin values. b-actin was used as an internal control. n =3(p < .005, except p53 expression compared to Control in D) (Student t test). (E) p38, MEKK1, c-Jun and p53 mRNA expression by Semi-quantitative RT-PCR. The statistical analysis result was coincided with real-time quantitative PCR assay. Z. Qiu et al. / Food and Chemical Toxicology 59 (2013) 428–437 435

Fig. 7. Urolithins and EA change the phosphorylated p38 MAPK, MEKK1, phosphorylated c-Jun protein expression. (A–C) Bars represent the expression of the proteins, quantitated by densitometry and normalized to b-actin. Data are expressed as the mean ± SD of triplicate determination. n =3(p < .005) (Student t test). (D) Western blot analysis for the expression of the phosphorylated p38 MAPK, MEKK1, phosphorylated-c-Jun and c-Jun after 48 h of administration.

Fig. 8. The effects of urolithins and EA on caspase-3 activation in T24 cells. (A) Activation of caspase-3 by UroA, 8-OMe-UroA, UroB and EA in T24 bladder cancer cells. Caspase-3 activities were determined following the manufacturer’s protocol. Each point represents the mean ± SD of three independent experiments. The significance was determined by Student’s t-test (p < 0.05 versus untreated control). (B) Bars represent the expression of the PPAR-c and cleaved caspase-3 protein, quantitated by densitometry and normalized to b-actin. Data are expressed as the mean ± SD of triplicate determination. n =3(p < .005) (Student t test). (C) Western blot analysis for the expression of the PPAR-c and cleaved caspase-3 after 48 h of IC50 administration of each chemical (The nitrocellulose membranes carrying PPAR-c and cleaved caspase-3 protein in this section was separated from the same batch of membranes used in western blot assay in Fig. 7.). on the protein expression of p38-MAPK and c-Jun and effects of EA tiation, inhibit cellular proliferation, induce apoptosis and inhibit on the protein expression of p38-MAPK, the compounds all modi- angiogenesis of was reported in carcinogenesis. It was also founded fied the transcription and protein expression in T24 cells. that PPAR-c is commonly expressed in bladder cancer and its level Even though the T24 cells were found to contain a p53 mutant of expression is concerned with tumor grade and stage so that it (tyrosine 126) (Rajesh et al., 1999), we evaluate the effects of was considered as a promising therapeutic target in bladder cancer urolithins and EA on the p53 gene expression. Unfortunately, our research (Mansure et al., 2009; Possati et al., 2000). Our data data showed no significant activity in p53 expression. This result showed urolithins and EA had a similar caspase-3 activated effect illustrates that the urolithins and EA may have anti-tumor effects in T24 cell line. We also found that phosphorylation of c-Jun also on the T24 cells but not employed p53 as a target. Further research decreased in UroA, UroB and EA administrated group. Indeed, will be to investigate the relationship of urolithins and p53 gene. blocking the expression of some genes potentially involved in tu- Caspase-3 is a caspase core factor, and inhibition of caspase-3 mor cell apoptosis may also affect the caspase-3 activity. Except could lead to apoptosis obstacles, and disturb the dynamic balance p38-MAPK, phosphorylation of c-Jun could be related in stimula- between cell apoptosis and proliferation. In previous studies, tion of caspase-3 activation in tumor cells (Cho et al., 2006; Wang caspase-3 was proved as a target for T24 cell apoptosis (Yeh and Friedman, 2000). et al., 2007). When caspase-activatable DNase (CAD) was activated In CCK assay and flow cytometry analysis, 8-OMe-UroA treated by caspase-3, the genomic DNA then was destroyed and finally group was moderated compared with other three chemicals and leaded to apoptosis. The activation of PPAR-c to promote differen- UroA seems showed strongest antiproliferative function of four 436 Z. Qiu et al. / Food and Chemical Toxicology 59 (2013) 428–437

changes in gene expression of downstream MAPK targets. Mutagenesis 25, 271– 279. Azuma, H., Takahara, S., Ichimaru, N., Wang, J.D., Itoh, Y., Otsuki, Y., Morimoto, J., Fukui, R., Hoshiga, M., Ishihara, T., Nonomura, N., Suzuki, S., Okuyama, A., Katsuoka, Y., 2002. Marked prevention of tumor growth and metastasis by a novel immunosuppressive agent, FTY720, in mouse breast cancer models. Cancer Res. 62, 1410–1419. Bialonska, D., Kasimsetty, S.G., Khan, S.I., Ferreira, D., 2009. Urolithins, intestinal microbial metabolites of Pomegranate ellagitannins, exhibit potent antioxidant activity in a cell-based assay. J. Agric. Food Chem. 57, 10181–10186. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. Bradham, C., McClay, D.R., 2006. P38 MAPK in development and cancer. Cell Cycle 5, 824–828. Cai, Y.C., Yang, G.Y., Nie, Y., Wang, L.D., Zhao, X., Song, Y.L., Seril, D.N., Liao, J., Xing, E.P., Yang, C.S., 2000. Molecular alterations of p73 in human esophageal squamous cell carcinomas: loss of heterozygosity occurs frequently; loss of imprinting and elevation of p73 expression may be related to defective p53. Carcinogenesis 21, 683–689. Cho, S.D., Ahn, N.S., Jung, J.W., Yang, S.R., Park, J.S., Lee, Y.S., Jo, E.H., Hwang, J.W., Lii, J., Kang, K.S., 2006. Critical role of the c-JunNH2-terminal kinase and p38 mitogen-activated protein kinase pathways on sodium butyrate-induced Fig. 9. Hypothesis of urolithin and EA of antiproliferative effects: Regulation on apoptosis in DU145 human prostate cancer cells. Eur. J. Cancer Prev. 15, 57–63. mRNA and protein of p38-MAPK, MEKK1 and c-Jun by urolithins and/or EA, which Das, M., Garlick, D.S., Greiner, D.L., Davis, R.J., 2011. The role of JNK in the in turn up-regulates PPAR-c expression, immediately following by caspase-3 development of hepatocellular carcinoma. Genes Dev. 25, 634–645. activation, finally leading necrosis, apoptosis and cell death. Finkel, T., 2003. Oxidant signals and oxidative stress. Curr. Opin. Cell Biol. 15, 247– 254. Gasmi, J., Sanderson, J.T., 2010. Growth inhibitory, antiandrogenic, and pro- apoptotic effects of punicic acid in LNCaP human prostate cancer cells. J. chemicals (Figs. 1 and 4). Though the MEKK1 protein expression Agric. Food Chem.. was significantly lower than control, both the phosphorylation of Gusman, J., Malonne, H., Atassi, G., 2001. A reappraisal of the potential chemo- p38-MAPK and c-Jun showed negative alteration in western blot preventive and chemotherapeutic properties of resveratrol. Carcinogenesis 22, 1111–1117. assay. However, in the EA-treated group, obvious decrease of Hayeshi, R., Mutingwende, I., Mavengere, W., Masiyanise, V., Mukanganyama, S., MEKK1 combined with phosphorylation of c-Jun showed the same 2007. The inhibition of human glutathione S-transferases activity by plant intensive cell apoptosis effect as UroA (Fig. 7). This interesting find- polyphenolic compounds ellagic acid and curcumin. Food Chem. Toxicol. 45, 286–295. ing implied that both p38-MAPK and c-Jun signaling may partici- Hong, P., Li, J., Li, Y., 2010. Failure to detect Xenotropic murine leukaemia virus- pate in caspase-3 mediated T24 cell apoptotic process (Fig. 9). related virus in Chinese patients with chronic fatigue syndrome. Virol. J. 7, 224. In summary, our data shows that urolithins and EA in this paper Huang, W., Li, S., Hu, Y., Yu, H., Luo, F., Zhang, Q., Zhu, F., 2011. Implication of the env gene of the human endogenous retrovirus W family in the expression of BDNF have a potential antioxidant and antiproliferative effects on T24 and DRD3 and development of recent-onset schizophrenia. Schizophr. Bull. 37, cells. Urolithins and EA were firstly found as regulators of p38- 988–1000. MAPK and c-Jun related signal pathway in T24 cells. Modification Itoh, M., Murata, T., Suzuki, T., Shindoh, M., Nakajima, K., Imai, K., Yoshida, K., 2006. Requirement of STAT3 activation for maximal collagenase-1 (MMP-1) induction of the phosphorylated p38-MAPK, MEKK1, phosphorylated c-Jun by epidermal growth factor and malignant characteristics in T24 bladder cancer and cleaved caspase-3 by urolithins and EA seems to be a signifi- cells. Oncogene 25, 1195–1204. cant and potent chemotherapeutic approach against bladder can- Jean-Gilles, D., Li, L., Ma, H., Yuan, T., Chichester, C.O., Seeram, N.P., 2011. Anti- inflammatory effects of polyphenolic-enriched red raspberry extract in an cer progression. Furthermore, the bladder, a special physiological antigen-induced arthritis rat model. J. Agric. Food Chem.. organ, is also a connate container for the topical and targeted drug Kasimsetty, S.G., Bialonska, D., Reddy, M.K., Thornton, C., Willett, K.L., Ferreira, D., delivery of synthetic urolithins and its other derivatives, rather 2009. Effects of pomegranate chemical constituents/intestinal microbial than confined to obtain urolithins from polyphenol metabolism metabolites on CYP1B1 in 22Rv1 prostate cancer cells. J. Agric. Food Chem. 57, 10636–10644. in the colon. Kasimsetty, S.G., Bialonska, D., Reddy, M.K., Ma, G., Khan, S.I., Ferreira, D., 2010. Colon cancer chemopreventive activities of pomegranate ellagitannins and urolithins. J. Agric. Food Chem. 58, 2180–2187. Conflict of Interest Khanduja, K.L., Gandhi, R.K., Pathania, V., Syal, N., 1999. Prevention of N- nitrosodiethylamine-induced lung tumorigenesis by ellagic acid and quercetin The authors declare that there are no conflicts of interest. in mice. Food Chem. Toxicol. 37, 313–318. King, A.E., Critchley, H.O., Kelly, R.W., 2001. The NF-kappaB pathway in human endometrium and first trimester decidua. Mol. Hum. Reprod. 7, 175–183. Acknowledgements Kumar, B., Koul, S., Petersen, J., Khandrika, L., Hwa, J.S., Meacham, R.B., Wilson, S., Koul, H.K., 2010. P38 mitogen-activated protein kinase-driven MAPKAPK2 regulates invasion of bladder cancer by modulation of MMP-2 and MMP-9 This work was supported by grants from the Young Scientists activity. Cancer Res. 70, 832–841. Project of Health Department of Hubei Province of China (No. Larrosa, M., Tomas-Barberan, F.A., Espin, J.C., 2006. The dietary hydrolysable tannin QJX2010-12) for Dr. F Zhu; the National Natural Sciences Founda- punicalagin releases ellagic acid that induces apoptosis in human colon adenocarcinoma Caco-2 cells by using the mitochondrial pathway. J. Nutr. tion of China (No. 30570182); the Science and Technology Depart- Biochem. 17, 611–625. ment Supported Program of Jiangxi Province of China (No. Larrosa, M., Gonzalez-Sarrias, A., Yanez-Gascon, M.J., Selma, M.V., Azorin-Ortuno, 2010BSA13500); the Science and Technology Project of Education M., Toti, S., Tomas-Barberan, F., Dolara, P., Espin, J.C., 2010. Anti-inflammatory properties of a pomegranate extract and its metabolite urolithin-A in a colitis Department of Jiangxi Province of China (No. GJJ11570); Hubei Pro- rat model and the effect of colon inflammation on phenolic metabolism. J. Nutr. vincial Natural Science Foundation for Innovative Research Team Biochem. 21, 717–725. (No. 2012FFA043); and the Project of Innovative Research Team Liu, J., Ding, X., Tang, J., Cao, Y., Hu, P., Zhou, F., Shan, X., Cai, X., Chen, Q., Ling, N., of Wuhan University (No. 274041). Zhang, B., Bi, Y., Chen, K., Ren, H., Huang, A., He, T.C., Tang, N., 2011. Enhancement of canonical Wnt/beta-catenin signaling activity by HCV core protein promotes cell growth of hepatocellular carcinoma cells. PLoS ONE 6, References e27496. Liu, L., Chen, X., Xie, S., Zhang, C., Qiu, Z., Zhu, F., 2012. Variant 1 of KIAA0101, overexpressed in hepatocellular carcinoma, prevents doxorubicin-induced Aiken, C.T., Tobin, A.J., Schweitzer, E.S., 2004. A cell-based screen for drugs to treat apoptosis by inhibiting p53 activation. Hepatology 56, 1760–1769. Huntington’s disease. Neurobiol. Dis. 16, 546–555. Losso, J.N., Bansode, R.R., Trappey, A.N., Bawadi, H.A., Truax, R., 2004. In vitro anti- Asur, R., Balasubramaniam, M., Marples, B., Thomas, R.A., Tucker, J.D., 2010. proliferative activities of ellagic acid. J. Nutr. Biochem. 15, 672–678. Bystander effects induced by chemicals and ionizing radiation: evaluation of Z. Qiu et al. / Food and Chemical Toxicology 59 (2013) 428–437 437

Mansure, J.J., Nassim, R., Kassouf, W., 2009. Peroxisome proliferator-activated Schwab, M., Reynders, V., Ulrich, S., Zahn, N., Stein, J., Schroder, O., 2006. receptor gamma in bladder cancer: a promising therapeutic target. Cancer Biol. PPARgamma is a key target of butyrate-induced caspase-3 activation in the Ther. 8, 6–15. colorectal cancer cell line Caco-2. Apoptosis 11, 1801–1811. Mertens-Talcott, S.U., Jilma-Stohlawetz, P., Rios, J., Hingorani, L., Derendorf, H., Seeram, N.P., Aronson, W.J., Zhang, Y., Henning, S.M., Moro, A., Lee, R.P., Sartippour, 2006a. Absorption, metabolism, and antioxidant effects of pomegranate (Punica M., Harris, D.M., Rettig, M., Suchard, M.A., Pantuck, A.J., Belldegrun, A., Heber, D., granatum l.) polyphenols after ingestion of a standardized extract in healthy 2007. Pomegranate ellagitannin-derived metabolites inhibit prostate cancer human volunteers. J. Agric. Food Chem. 54, 8956–8961. growth and localize to the mouse prostate gland. J. Agric. Food Chem. 55, 7732– Mertens-Talcott, S.U., Lee, J.H., Percival, S.S., Talcott, S.T., 2006b. Induction of cell 7737. death in Caco-2 human colon carcinoma cells by ellagic acid rich fractions Selma, M.V., Espin, J.C., Tomas-Barberan, F.A., 2009. Interaction between phenolics from muscadine grapes (Vitis rotundifolia). J. Agric. Food Chem. 54, 5336– and gut microbiota: role in human health. J. Agric. Food Chem. 57, 6485–6501. 5343. Su, F., Li, H., Yan, C., Jia, B., Zhang, Y., Chen, X., 2009. Depleting MEKK1 expression Nandi, S., Vracko, M., Bagchi, M.C., 2007. Anticancer activity of selected phenolic inhibits the ability of invasion and migration of human pancreatic cancer cells. compounds: QSAR studies using ridge regression and neural networks. Chem. J. Cancer Res. Clin. Oncol. 135, 1655–1663. Biol. Drug Des. 70, 424–436. Teng, C.H., Huang, W.N., Meng, T.C., 2007. Several dual specificity phosphatases Narayanan, B.A., Geoffroy, O., Willingham, M.C., Re, G.G., Nixon, D.W., 1999. P53/ coordinate to control the magnitude and duration of JNK activation in signaling p21(WAF1/CIP1) expression and its possible role in G1 arrest and apoptosis in response to oxidative stress. J. Biol. Chem. 282, 28395–28407. ellagic acid treated cancer cells. Cancer Lett. 136, 215–221. Urech, K., Buessing, A., Thalmann, G., Schaefermeyer, H., Heusser, P., 2006. Ohkawa, H., Ohishi, N., Yagi, K., 1979. Assay for lipid peroxides in animal tissues by Antiproliferative effects of mistletoe (Viscum album L.) extract in urinary thiobarbituric acid reaction. Anal. Biochem. 95, 351–358. bladder carcinoma cell lines. Anticancer Res. 26, 3049–3055. Patel, T., Gores, G.J., 1995. Apoptosis and hepatobiliary disease. Hepatology 21, Vicente-Sanchez, C., Egido, J., Sanchez-Gonzalez, P.D., Perez-Barriocanal, F., Lopez- 1725–1741. Novoa, J.M., Morales, A.I., 2008. Effect of the flavonoid quercetin on cadmium- Possati, L., Rocchetti, R., Talevi, S., Beatrici, V., Margiotta, C., Ferrante, L., Calza, R., induced hepatotoxicity. Food Chem. Toxicol. 46, 2279–2287. Sagrini, D., Ferri, A., 2000. The role of peroxisome proliferator-activated receptor Wang, J., Friedman, E., 2000. Downregulation of p53 by sustained JNK activation gamma in bladder cancer in relation to angiogenesis and progression. Gen. during apoptosis. Mol. Carcinog. 29, 179–188. Pharmacol. 35, 269–275. Wu, J., Guan, M., Wong, P.F., Yu, H., Dong, J., Xu, J., 2012. Icariside II potentiates Rajesh, D., Schell, K., Verma, A.K., 1999. Ras mutation, irrespective of cell type and paclitaxel-induced apoptosis in human melanoma A375 cells by inhibiting TLR4 p53 status, determines a cell’s destiny to undergo apoptosis by okadaic acid, an signaling pathway. Food Chem. Toxicol. 50, 3019–3024. inhibitor of protein phosphatase 1 and 2A. Mol. Pharmacol. 56, 515–525. Yeh, C.C., Kuo, H.M., Li, T.M., Lin, J.P., Yu, F.S., Lu, H.F., Chung, J.G., Yang, J.S., 2007. Rice-Evans, C., Miller, N., Paganga, G., 1997. Antioxidant properties of phenolic Shikonin-induced apoptosis involves caspase-3 activity in a human bladder compounds. Trends Plant Sci. 2, 152–159. cancer cell line (T24). In Vivo 21, 1011–1019. Roux, P.P., Blenis, J., 2004. ERK and p38 MAPK-activated protein kinases: a family of Yokozawa, T., Kim, Y.A., Kim, H.Y., Okamoto, T., Sei, Y., 2007. Protective effect of the protein kinases with diverse biological functions. Microbiol. Mol. Biol. Rev. 68, Chinese prescription Kangen-karyu against high glucose-induced oxidative 320–344. stress in LLC-PK1 cells. J. Ethnopharmacol. 109, 113–120. Roychowdhury, A., Dey, R.K., Bandyapadhyay, A., Bhattacharya, P., Mitra, R.B., Dutta, Yujiri, T., Sather, S., Fanger, G.R., Johnson, G.L., 1998. Role of MEKK1 in cell survival R., 2012. Study of mutated p53 protein by immunohistochemistry in urothelial and activation of JNK and ERK pathways defined by targeted gene disruption. neoplasm of urinary bladder. J. Indian Med. Assoc. 110, 393–396. Science 282, 1911–1914.