Two Trichothecene Mycotoxins from Myrothecium Roridum Induce Apoptosis of Hepg-2 Cells Via Caspase Activation and Disruption of Mitochondrial Membrane Potential

molecules

Article Two Trichothecene Mycotoxins from Myrothecium roridum Induce Apoptosis of HepG-2 Cells via Caspase Activation and Disruption of Mitochondrial Membrane Potential

Wei Ye †, Yuchan Chen †, Haohua Li †, Weimin Zhang *, Hongxin Liu, Zhanghua Sun, Taomei Liu and Saini Li State Key Laboratory of Applied Microbiology Southern China, Guangdong Provincial Key Laboratory of Microbial Culture Collection and Application, Guangdong Open Laboratory of Applied Microbiology, Guangdong Institute of Microbiology, Guangzhou 510070, China; [email protected] (W.Y.); [email protected] (Y.C.); [email protected] (H.L.); [email protected] (H.L.); [email protected] (Z.S.); [email protected] (T.L.); [email protected] (S.L.) * Correspondence: [email protected]; Tel.: +86-20-8768-8309 † These authors contributed equally to this work.

Academic Editor: Mary Fletcher Received: 26 April 2016; Accepted: 13 June 2016; Published: 17 June 2016 Abstract: Trichothecene mycotoxins are a type of sesquiterpenoid produced by various kinds of plantpathogenic fungi. In this study, two trichothecene toxins, namely, a novel cytotoxic epiroridin acid and a known trichothecene, mytoxin B, were isolated from the endophytic fungus Myrothecium roridum derived from the medicinal plant Pogostemon cablin. The two trichothecene mytoxins were confirmed to induce the apoptosis of HepG-2 cells by cytomorphology inspection, DNA fragmentation detection, and flow cytometry assay. The cytotoxic mechanisms of the two mycotoxins were investigated by quantitative real time polymerase chain reaction, western blot, and detection of mitochondrial membrane potential. The results showed that the two trichothecene mycotoxins induced the apoptosis of cancer cell HepG-2 via activation of caspase-9 and caspase-3, up-regulation of bax gene expression, down-regulation of bcl-2 gene expression, and disruption of the mitochondrial membrane potential of the HepG-2 cell. This study is the first to report on the cytotoxic mechanism of trichothecene mycotoxins from M. roridum. This study provides new clues for the development of attenuated trichothecene toxins in future treatment of liver cancer.

Keywords: epiroridin acid; mytoxin B; apoptosis; caspase cascade; mitochondrial membrane potential

1. Introduction Primary liver cancer is a common malignant tumor, and about 260,000 people die from liver cancer all over the world every year. The five-year survival rate of liver cancer patients after surgery remains below 40%. Thus, effective therapeutic agents for the treatment of liver cancer must be developed. Chlorotoxin, extracted from scorpions, was reported to be used for the treatment of neuroglioma with evident clinical efficacy and low side-effects [1]. Botulinum toxin A was also reported to treat overactive bladder with high efficiency [2], which demonstrated the great potential of toxins in cancer treatment combined with targeting factors such as EGFR and single-chain variable fragments (scFvs) [3,4]. MT-2H74 is an engineered toxin body comprised of scFv and a modified ribosome-inactivating protein derived from Shiga-like toxin 1 A. MT-2H74 demonstrated effective cell killing at picomolar concentrations on cell lines expressing high levels of HER2, showing great therapeutic efficacy against breast carcinomas [5]. rGel/EGF is a type of chimeric toxin, which is composed of the recombinant plant toxin gelonin and epidermal growth factor receptor (EGFR). The photochemical internalization

Molecules 2016, 21, 781; doi:10.3390/molecules21060781 www.mdpi.com/journal/molecules Molecules 2016, 21, x 2 of 11

cell killing at picomolar concentrations on cell lines expressing high levels of HER2, showing great therapeutic efficacy against breast carcinomas [5]. rGel/EGF is a type of chimeric toxin, which is Moleculescomposed2016 of, 21 the, 781 recombinant plant toxin gelonin and epidermal growth factor receptor (EGFR).2 ofThe 11 photochemical internalization of rGel/EGF was shown to be highly effective against EGFR-expressing cell lines, including head and neck squamous cell carcinoma cell lines [6]. Attenuated diphtheria toxin of rGel/EGF was shown to be highly effective against EGFR-expressing cell lines, including head and A has great potential to be used as a drug for cancer treatment with the advantage of lower side-effect [7]. neck squamous cell carcinoma cell lines [6]. Attenuated diphtheria toxin A has great potential to be Therefore, different types of attenuated toxins with high efficacy should be developed against tumor used as a drug for cancer treatment with the advantage of lower side-effect [7]. Therefore, different cell lines and reduced toxicity toward human normal cells, thus promoting the application of toxins types of attenuated toxins with high efficacy should be developed against tumor cell lines and reduced in cancer therapy. toxicity toward human normal cells, thus promoting the application of toxins in cancer therapy. Trichothecene mycotoxins are a family of chemically-related mycotoxins produced by various Trichothecene mycotoxins are a family of chemically-related mycotoxins produced by various species of Fusarium, Trichoderma, Trichthecium, Cephalosporium, Myrothecium, Verticillium, and species of Fusarium, Trichoderma, Trichthecium, Cephalosporium, Myrothecium, Verticillium, and Stachybotrys [8]. The trichothecene mycotoxins are the main pathogenic factors of pathogenic fungus Stachybotrys [8]. The trichothecene mycotoxins are the main pathogenic factors of pathogenic fungus Fusarium graminearum, the virulence of which will be attenuated dramatically if this fungus could not Fusarium graminearum, the virulence of which will be attenuated dramatically if this fungus could produce trichothecene mycotoxins [9]. Trichothecene mycotoxins can inhibit and disturb the not produce trichothecene mycotoxins [9]. Trichothecene mycotoxins can inhibit and disturb the synthesis of DNA and proteins. T-2 and Don toxins are famous trichothecene mycotoxins produced synthesis of DNA and proteins. T-2 and Don toxins are famous trichothecene mycotoxins produced by F. graminearum. T-2 toxin could cause the damage of cell membrane and induce the apoptosis of by F. graminearum. T-2 toxin could cause the damage of cell membrane and induce the apoptosis of human lymph nodes and hematopoietic cells [10]. human lymph nodes and hematopoietic cells [10]. Trichothecenes were found to display significant cytotoxic activity against tumor cell lines. Trichothecenes were found to display significant cytotoxic activity against tumor cell lines. Trichothecene mycotoxins, including T-2 and DON toxins, were reported to show strong Trichothecene mycotoxins, including T-2 and DON toxins, were reported to show strong cytotoxicities cytotoxicities against HepG-2 cells with IC50 values lower than 0.1 μM [11,12]. In our previous study, against HepG-2 cells with IC50 values lower than 0.1 µM[11,12]. In our previous study, a novel a novel trichothecene, i.e., epiroridin acid, together with two known trichothecene toxins, i.e., mytoxin trichothecene, i.e., epiroridin acid, together with two known trichothecene toxins, i.e., mytoxin B and B and epiroridin E, were isolated from the fermentation liquid of Myrothecium roridum derived from epiroridin E, were isolated from the fermentation liquid of Myrothecium roridum derived from the the medicinal plant Pogostemon cablin [13]. Epiroridin acid, mytoxin B, and epiroridin E showed medicinal plant Pogostemon cablin [13]. Epiroridin acid, mytoxin B, and epiroridin E showed strong strong cytotoxicities toward HepG-2 tumor cell line with IC50 values of 0.38, 0.005, and 0.004 μM, cytotoxicities toward HepG-2 tumor cell line with IC values of 0.38, 0.005, and 0.004 µM, respectively. respectively. Therefore, trichothecene mycotoxins have50 shown great potential in cancer treatment [12]. Therefore, trichothecene mycotoxins have shown great potential in cancer treatment [12]. However, However, the cytotoxic mechanism of trichothecene mycotoxins against tumor cells remains unclear. the cytotoxic mechanism of trichothecene mycotoxins against tumor cells remains unclear. In this In this study, the cytotoxic mechanisms of mytoxin B and the novel epiroridin acid against HepG-2 study, the cytotoxic mechanisms of mytoxin B and the novel epiroridin acid against HepG-2 tumor tumor cells were investigated by quantitative real time polymerase chain reaction (qRT-PCR), cells were investigated by quantitative real time polymerase chain reaction (qRT-PCR), Western blot, Western blot, and flow cytometry assay. The investigation on the apoptosis mechanism of HepG-2 and flow cytometry assay. The investigation on the apoptosis mechanism of HepG-2 cells induced cells induced by epiroridin acid and mytoxin B would shed light on the utilization of trichotecene by epiroridin acid and mytoxin B would shed light on the utilization of trichotecene toxins in future toxins in future treatment of liver cancer combined with targeting technology. treatment of liver cancer combined with targeting technology.

2.2. Results Results

2.1.2.1. CytotoxicityCytotoxicity DetectionDetection ofof EpiroridinEpiroridin AcidAcid andand MytoxinMytoxin BB TheThe structuresstructures ofof epiroridinepiroridin acidacid andand mytoxinmytoxin B,B, togethertogether withwith anotheranother knownknown trichothecenetrichothecene epiroridinepiroridin EE areare shownshown inin FigureFigure1 [113 [13].].

Figure 1. The structures of mytoxin B, epiroridin acid and epiroridin E. Figure 1. The structures of mytoxin B, epiroridin acid and epiroridin E.

The cytotoxicity assay results showed that epiroridin acid, mytoxin B, and epiroridin E exhibited signiﬁcant cytotoxic activities against HepG-2 tumor cells [13]. And the IC50 values of mytoxin B and epiroridin acid towards human hepatic stellate cell line LX-2 were 0.004 ˘ 0.0003 µM, 0.477 ˘ 0.056 µM, Molecules 2016, 21, 781 3 of 11 Molecules 2016, 21, 781 3 of 10 respectively.respectively. MytoxinMytoxin BB showedshowed thethe samesame cytotoxicitycytotoxicity towardstowards LX-2LX-2 and HepG-2, whereas epiroridin acid showed Molecules 2016 weaker weaker, 21, 781 cytotoxicity cytotoxicity towards towards LX-2 LX-2 cells cells than than that that towards towards HepG-2 HepG-2 cells. cells. Round Round3 cellsof 10 cells and apoptosis bodies were observed with laser confocal microscopy in epiroridin acid- and mytoxin B- and apoptosisrespectively. bodies Mytoxin were B showed observed the withsame lasercytotoxici confocalty towards microscopy LX-2 and in HepG-2, epiroridin whereas acidepiroridin and mytoxin B-treatedtreatedacid HepG-2 showed HepG-2 cells, weaker cells, and cytotoxicity and more more round towards round and shrinking andLX-2 shrinkingcells thancells thatwere cells towards observed were HepG-2 observed in mytoxin cells. in Round mytoxin B-treated cells B-treated and HepG-2 HepG-2cells apoptosis(Figure cells 2C) (Figurebodies than were2 inC) epirorid thanobserved inin epiroridin withacid-treated laser confocal acid-treated cells, microscopywhereas cells, no whereasin such epiroridin phenomenon no suchacid- and phenomenon was mytoxin observed B- was in observedthe controltreated in (FigureHepG-2 the control 2A).cells, (Figure DNAand more fragments2A). round DNA and were fragments shrinking also de werecellstected were also by observed detected agarose in bygel mytoxin agarose electrophoresis B-treated gel electrophoresis HepG-2 in mytoxin inB- mytoxinandcells epiroridin (Figure B- and 2C) acid-treated epiroridinthan in epirorid acid-treatedHepG-2in acid-treated cells, HepG-2 an cells,d slightly cells,whereas and more no slightlysuch DNA phenomenon morefragments DNA was were fragmentsobserved detected in were in detectedHepG-2the controlcells in HepG-2 treated (Figure cells with 2A). treated DNAmytoxin fragments with B for mytoxin were48 h thanalso B forde thosetected 48 h in thanby epiroridin agarose those gel in acid-treated electrophoresis epiroridin acid-treatedcells, in mytoxin whereas cells, no whereassuch B-DNA and no fragments suchepiroridin DNA acid-treatedwere fragments detected HepG-2 were in detectedthe cells, control an ind (Figure theslightly control 3).more (Figure DNA 3fragments). were detected in HepG-2 cells treated with mytoxin B for 48 h than those in epiroridin acid-treated cells, whereas no such DNA fragments were detected in the control (Figure 3).

Figure 2. HepG-2 cells were treated with mytoxin B and epiroridin acid for 24 h, respectively, and FigureFigure 2. HepG-2 2. HepG-2 cells cells were were treated treated with with mytoxinmytoxin B B and and epiroridin epiroridin acid acid for for24 h, 24 respectively, h, respectively, and and observedobserved by aa by laserlaser a laser confocalconfocal confocal microscopy:microscopy: microscopy: ((AA)) untreateduntreateduntreated HepG-2 HepG-2HepG-2 cells; cells;cells; (B ) (( BHepG-2)) HepG-2HepG-2 cells cellscells treated treatedtreated with withwith epiroridinepiroridinepiroridin acid;acid; acid; ((CC)) ( HepG-2HepG-2C) HepG-2 cellscells cells treatedtreated treated withwith with mytoxin mytoxinmytoxin B. B.

Figure 3. DNA fragmentation of HepG-2 cells treated with mytoxin B and epiroridin acid: M. DNA Figure 3. DNA fragmentation of HepG-2 cells treated with mytoxin B and epiroridin acid: M. DNA ladder; (1) control; (2) HepG-2 cells treated with epiroridin acid for 48 h; (3) HepG-2 cells treated with ladder; (1) control; (2) HepG-2 cells treated with epiroridin acid for 48 h; (3) HepG-2 cells treated with Figuremytoxin 3. DNA B for fragmentation 48 h; (4) HepG-2 of HepG-2 cells treated cells with treated mytoxin with B mytoxinfor 24 h; (B5 )and HepG-2 epiroridin cells treated acid: withM. DNA mytoxin B for 48 h; (4) HepG-2 cells treated with mytoxin B for 24 h; (5) HepG-2 cells treated with ladder;epiroridin (1) control; acid for(2) 24HepG-2 h. cells treated with epiroridin acid for 48 h; (3) HepG-2 cells treated with epiroridin acid for 24 h. mytoxin B for 48 h; (4) HepG-2 cells treated with mytoxin B for 24 h; (5) HepG-2 cells treated with epiroridin2.2. qRT-PCR acid Analysis for 24 h.of Mytoxin B- and Epiroridin Acid-treated HepG-2 Cells 2.2. qRT-PCR Analysis of Mytoxin B- and Epiroridin Acid-treated HepG-2 Cells The total RNAs of mytoxin B- and epiroridin acid-treated cells were extracted, and the expression 2.2. qRT-PCRThelevels total of genes Analysis RNAs related of of mytoxin Mytoxin to the apoptosis B- B- and and epiroridin Epiroridinof HepG-2 acid-treated Acid-treatedcells were investigated. cellsHepG-2 were Cells As extracted, shown in and Figure the expression4, the relative expression level of bcl-2 gene compared with β-actin in control was 0.97 ± 0.05 fold, and levelsThe of genestotal RNAs related of tomytoxin the apoptosis B- and epiroridin of HepG-2 acid cells-treated were investigated. cells were extracted, As shown and in the Figure expression4, the relativethe expressionrelative expression level oflevelsbcl-2 in mygenetoxin compared B- and epiroridin with β -actinacid-treated in control HepG-2 was cells 0.97 were˘ 0.300.05 ± fold,0.02 fold and the levelsand of 0.42genes ± 0.01 related fold, torespectively. the apoptosis This findingof HepG-2 demon cellsstrates were that investigated. treatment with As epiroridin shown in acid Figure could 4, the relativerelative expressionexpression levels level in of mytoxin bcl-2 gene B- andcompared epiroridin with acid-treated β-actin in HepG-2control cellswas were0.97 ± 0.30 0.05˘ fold,0.02 foldand andthe relative 0.42 ˘ 0.01expression fold, respectively. levels in my Thistoxin ﬁnding B- and epiroridin demonstrates acid-treated that treatment HepG-2 with cells epiroridin were 0.30 acid± 0.02 could fold and 0.42 ± 0.01 fold, respectively. This finding demonstrates that treatment with epiroridin acid could

MoleculesMolecules 201 20166, ,2 211, ,x x 44 of of 1 111

Molecules 2016, 21, 781 4 of 11 0.300.30 ±± 0.020.02 foldfold andand 0.42 0.42 ±± 0.010.01 foldfold,, respectively. respectively. This This finding finding demonstrates demonstrates that that treatment treatment with with epiroridinepiroridin acidacid couldcould downdown--regulateregulate thethe expressionexpression levellevel ofof bcbcll--22 genegene inin HepGHepG--22 cells.cells. TheThe relativerelative down-regulateexpressionexpression levellevel the ofof expressionbaxbax genegene inin level thethe controlcontrol of bcl-2 waswasgene aboutabout in HepG-2 1.091.09 ±± 0.040.04 cells. foldfold The,, thethe relative relativerelative expression expressionexpression level levelslevels of bax ofof genebaxbax genegene in the inin mytoxincontrolmytoxin was BB-- andand about epiroridinepiroridin 1.09 ˘ 0.04 acidacid fold,--treatedtreated the HepGrelativeHepG--22 expressioncellscells werewere 104.0104.0 levels ±± of2.52.5bax foldfoldgene andand in 68.268.2 mytoxin ±± 2.092.09 B-foldfold and,, respectively respectively epiroridin (Fig acid-treated(Figureure 4 4).). The The HepG-2 results results showed cellsshowed were that that 104.0 the the expression ˘expression2.5 fold andlevel level 68.2 of of bax bax˘ 2.09gene gene fold, was was significantly respectivelysignificantly (Figureupup--regulatedregulated4). The byby results thethe treatmenttreatment showed that withwith the mytoxinmytoxin expression BB andand level epiroridinepiroridin of bax gene acid.acid. was TheThe signiﬁcantly resultsresults shownshown up-regulated inin FigureFigure 4 by4CC themanifestedmanifested treatment that that with no no significant mytoxinsignificant B anddifferencedifference epiroridin exists exists acid. between between The results th thee expression expression shown in level level Figure of of Fasl 4FaslC manifested gene gene in in the the thatcontrol control no signiﬁcantandand inin HepGHepG difference--22 cellscells treated existstreated between withwith mytoxinmytoxin the expression BB andand epiroridinepiroridin level of Fasl acid,acid,gene whichwhich in the waswas control inin accordanceaccordance and in HepG-2 withwith cells thethe treatedfeaturefeature with of of apoptosis. apoptosis. mytoxin B The The and above above epiroridin results results acid, demonstrated demonstrated which was in that that accordance the the treatment treatment with the wit wit featurehh mytoxin mytoxin of apoptosis. B B and and Theepiroridinepiroridin above acid resultsacid induc induc demonstratedeedd the the apoptosis apoptosis that theof of HepG HepG treatment--22 cell cell withss by by the the mytoxin up up--regulationregulation B and epiroridin of of bax bax gene gene acid and and induced the the down down the-- apoptosisregulationregulationof ofofHepG-2 bclbcl--22 gene.gene. cells by the up-regulation of bax gene and the down-regulation of bcl-2 gene.

FigureFigure 4. 4. qRT qRT-PCRqRT--PCRPCR analysisanalysis ofof thethe expressionexpression levelslevels ofof bcl-2bcl bcl--22,, bax bax,, andand Fasl Fasl in in HepG HepG-2HepG--22 cells cells treated treated with with mytoxinmytoxin B B andand epiroridinepiroridin acidacid forfor 2424 h,h, respectively:respectivelyrespectively:: ( (AA)) the the expressionexpression level level of of bcl-2bclbcl--22 gene;gene; ((BB)) thethe expressionexpression levellevel ofofbaxbax gene;gene; ( (CC)) the thethe expression expressionexpression level levellevel of ofof FaslFaslFasl gene.gene.

2.3.2.32.3.. WesternWestern BBlotBlotlot AAnalysisAnalysisnalysis ofof MytoxinMMytoxinytoxin B-BB-- andand EpiroridinEEpiroridinpiroridin Acid-treatedAAcidcid--treatedtreated HepG-2 HepGHepG--22 CellsCCellsells TheThe expression expression levels levels of of proteins proteins related related to to apoptosis apoptosisapoptosis were were investigated investigated by by western western blot blot analysis. analysis. TheThe bandsbands correspondingcorresponding toto pro-caspase-3propro--caspasecaspase--33 andand pro-caspase-9propro--caspasecaspase--99 were were detecteddetected in in untreateduntreated cellscells andand treatedtreated cellscellscells with withwith nearly nearlynearly the thethe same samesame intensity, intensity,intensity, and andand strong strongstrong bands bandband correspondingss correspondingcorresponding to activated toto activatedactivated caspase-9 caspasecaspase (37--99 and(37(37 andand 35 kD) 3535 kD) andkD) and activatedand activatedactivated caspase-3 caspasecaspase (17--33 kD) (17(17 were kD)kD) were detectedwere detecteddetected in HepG-2 inin HepGHepG cells--22 treated cellscells treatedtreated with mytoxin withwith mytoxinmytoxin B and epiroridinBB and and epiroridin epiroridin acid, whereas acid, acid, whereas whereas only very only only weak very very corresponding weak weak corresponding corresponding bands were bands bands detected were were detected detected in untreated in in untreated untreated HepG-2 cellsHepGHepG (Figure--22 cellscells5 A). (Figure(Figure 5A5A).).

FigureFigure 5.55.. WesternWestern blot blot analysis analysis of of the the activation activation of of caspases caspases and and the the expression expression of of Bax Bax and and Bcl-2Bcl Bcl--22 proteinsproteins in in in HepG-2 HepG HepG--2 cells2 cells cells treated treated treated with with with mytoxin mytoxin mytoxin B and B B epiroridin and and epiroridinepiroridin acid for acid acid 24 h, for for respectively: 24 24 h, h, respectively: respectively: (A) detection ((AA)) ofdetectiondetection caspase-3 ofof andcaspasecaspase caspase-9:--33 andand caspase (caspase1) control;--9:9: (( 112)) control mytoxincontrol;; ((2 B-treated2)) mytoxinmytoxin HepG-2 BB--treatedtreated cells; HepGHepG (3) epiroridin--22 cellscells;; ((33 acid-treated)) epiroridinepiroridin HepG-2acidacid--treatedtreated cells; HepGHepG (B) detection--22 cells;cells; ((BB of)) detectiondetection Bcl-2 protein: ofof BclBcl- (-212 ) protein:protein: epiroridin ((11)) epiroridinepiroridin acid-treated acidacid HepG-2--treatedtreated cells; HepGHepG (2--)22 mytoxincellscells;; ((22)) B-treatedmytoxinmytoxin BB HepG-2--treatedtreated cells; HepGHepG (-3-2)2 control;cellscells;; ((33)) ( control;Ccontrol;) detection ((CC)) detectiondetection of Bax protein: ofof BaxBax (protein1protein) epiroridin:: ((11)) epiroridinepiroridin acid-treated acidacid HepG-2--treatedtreated cells;HepGHepG (-2-2)2 cells mytoxincells;; ((22)) mytoxin B-treatedmytoxin BB HepG-2--treatedtreated cells; HepGHepG (3--2)2 control.cellscells;; ((33)) control.control.

Molecules 2016, 21, x 5 of 11 Molecules 2016, 21, 781 5 of 11 The relative intensity of Bcl-2 protein band in the control was 2.18 ± 0.16 fold and 1.39 ± 0.21 fold,The respectively, relative intensity as that in of the Bcl-2 HepG protein-2 cells band treated in the with control mytoxin was B 2.18 and˘ epiroridin0.16 fold acid and 1.39(Figure˘ 0.21 5B). fold,Meanwhile, respectively, the relative as that inintensit the HepG-2ies of Bax cells protein treated bands with mytoxinin mytoxin B and B- epiroridinand epiroridin acid (Figureacid-treated5B). Meanwhile,cells were 4.51 the ± relative 0.29 fold intensities, 2.67 ± 0.18 of fold, Bax proteinrespectively, bands as in that mytoxin in the B-control and epiroridin(Figure 5C) acid-treated, which was cellsanalyzed were 4.51by gel˘ 0.29 analy fold,sis 2.67software˘ 0.18 Bandscan fold, respectively, 5.0 (BioMarin as that Pharmaceutical in the control (FigureInc., Novato,5C), which CA, wasUK), analyzedand protein by gellevels analysis were softwarenormalized Bandscan against 5.0 those (BioMarin of β-actin Pharmaceutical respectively, Inc., data Novato, were expressed CA, USA), as andmean protein ± SD ( levelsn = 3). wereThe western normalized blot analysis against thoseresults of provedβ-actin that respectively, trichotecene data mycotoxins were expressed mytoxin as B meanand epiroridin˘ SD (n = acid 3). The induced western the blotapoptosis analysis of HepG results-2 provedcells by that the trichoteceneactivation of caspase mycotoxins-3 and mytoxin caspase B-9 andprotein epiroridin as well acid as induced by the thedown apoptosis-regulation of HepG-2 of Bcl- cells2 protein by the expression activation of and caspase-3 up-regulation and caspase-9 of Bax proteinprotein. as well as by the down-regulation of Bcl-2 protein expression and up-regulation of Bax protein.

2.4.2.4. Flow Flow Cytometry Cytometry Assay Assay of of HepG-2 HepG-2 Cells Cells Treated Treated With With Epororidin Epororidin Acid Acid and and Mytoxin Mytoxin B B TheThe untreated untreated cells cells and and trichothecene trichothecene mycotoxins-treated mycotoxins-treated HepG-2HepG-2 cellscells werewere stained stained by by Annex-V Annex-V andand propidium propidium iodideiodide (PI)(PI) and loaded onto onto flow ﬂow cytometry. cytometry. It It was was shown shown that that most most cells cells were were in the in theQ3 Q3 reg regionion in inthe the control, control, whereas whereas much much less less cells cells were were detected detected in in the Q3Q3 regionregion inin HepG-2HepG-2 cells cells treatedtreated with with epororidin epororidin acid acid and and mytoxin mytoxin B, B, indicating indicating the the cytotoxicities cytotoxicities of of these these two two compounds compounds towardstowards HepG-2 HepG-2 cells cells (Figure (Figure6 ).6). The The early early apoptosis apoptosis rates rates of of HepG-2 HepG-2 cells cells treated treated with with mytoxin mytoxin B B andand epiroridin epiroridin acid acid were were 11.7% 11.7% and and 17.3%, 17.3%, respectively. respectively. The The terminal terminal apoptosis apoptosis rates rates of of HepG-2 HepG-2 cells cells treatedtreated with with mytoxin mytoxin B B and and epiroridin epiroridin acid acid were were 22.3% 22.3% and and 11.7%, 11.7%, respectively respectively (Figure (Figure6). 6). Untreated Untreated HepG-2HepG-2 cells cells showed showed early early apoptosis apoptosis raterate andand terminalterminal apoptosisapoptosis raterate ofof 3.4%3.4% andand 5%,5%, respectively,respectively, whichwhich was was probably probably due due to to the the natural natural cellular cellular metabolism. metabolism. The The results results showed showed the the higher higher terminal terminal apoptosisapoptosis rate, rate, whereas whereas lower lower early early apoptosis apoptosis rate rate of of mytoxin mytoxin B-treated B-treated cells cells compared compared with with those those of of epiroridinepiroridin acid-treated acid-treated cells, cells, which which was was in accordancein accordance with with the strongerthe stronger cytotoxicity cytotoxicity of mytoxin of mytoxin B than B epiroridinthan epiroridin acid against acid against HepG-2 HepG cells.-2 cells.

FigureFigure 6. 6Flow. Flow cytometry cytometry assay assay of apoptosis of apoptosis rate of rate HepG-2 of HepG cells treated-2 cells with treated mytoxin with B mytoxin and epiroridin B and acidepiroridin for 24 h, acid respectively. for 24 h, respectively.

2.5.2.5. Detection Detection of of Mitochondrial Mitochondrial Transmembrane Transmembrane Potential Potential TheThe mitochondrial mitochondrial transmembrane transmembrane potentials potentials ofof trichotecene trichotecene mycotoxins-treated mycotoxins-treated cells cells were were analyzedanalyzed by by the the comparison comparison of intensities of intensities of green of green fluorescence fluorescence and red and fluorescence. red fluorescence. Very low Veryintensity low ofintensity green fluorescence of green fluorescence intensity and intensity high intensity and high of intensity red fluorescence of red fluorescence were observed were byobserved laser confocal by laser microscopyconfocal microscopy in untreated in untreated HepG-2 cells, HepG whereas-2 cells, green whereas fluorescence green fluorescence was observed was withobserved much with stronger much intensitystronger inintensity mytoxin in B-mytoxin and epiroridin B- and epiroridin acid-treated acid HepG-2-treated HepG cells (Figure-2 cells7 (Figure), indicating 7), indicating much lower much mitochondriallower mitochondrial transmembrane transmembrane potential. potential. The mitochondrial The mitochondrial transmembrane transmembrane potentials potential in mytoxins in B-mytoxin and epiroridin B- and epirori acid-treateddin acid HepG-2-treated cells HepG were-2 cells 1.23 ˘were0.09 1.23 and ± 1.97 0.09˘ and0.13, 1.97 respectively, ± 0.13, respectively, whereas thewhereas mitochondrial the mitochondrial transmembrane transme potentialmbrane ofpotential untreated of HepG-2 untreated cells HepG was-2 3.67 cells˘ was0.61 (Figure3.67 ± 0.618). Meanwhile,(Figure 8). theMeanwhile, stronger intensity the stronger of green intensity fluorescence, of green the fluorescence lower mitochondrial, the lower transmembrane mitochondrial potentialtransmembrane and more potential round cellsand more were round observed cells in were mytoxin observed B- treated in mytoxin HepG-2 B-cells treated compared HepG-2 with cells compared with epiroridin acid-treated HepG-2 cells, indicating the stronger cytotoxicity of mytoxin

Molecules 2016, 21, 781 6 of 11

Molecules 2016, 21, x 6 of 11 epiroridin acid-treated HepG-2 cells, indicating the stronger cytotoxicity of mytoxin B than epiroridin acidB than (Figure epiroridin7). The resultsacid (Figure demonstrated 7). The thatresults the demonstr treatmentated of trichothecene that the treatment mycotoxins of trichothecene mytoxin B andmycotoxins epiroridin mytoxin acid could B anddecrease epiroridin the mitochondrial acid could transmembrane decrease the mitochondrial potential of HepG-2 transmembrane cells, thus Moleculesinducingpotential 2016 theof, 21 HepG apoptosis, 781 -2 cells, of HepG-2thus inducing cells. the apoptosis of HepG-2 cells. 6 of 10

FigureFigureFigure 7. 7.7 The.The The control control control and and and HepG-2 HepG-2 HepG cells cells-2 cells treated treated treated with with withmyto mytoxin xinmytoxin B B and and Bepiroridin epiroridin and epiroridin acid, acid, which which acid, were werewhich stained stained were withwithstained JC-10 with and JC observed -10 and observed by a laser by confocal a laser confocalmicroscopy. microscopy.

FigureFigureFigure 8. 8.8 Detection.Detection Detection of ofof mitochondrial mitochondrial mitochondrial transmembrane transmembrane transmembrane potential potential potential of of ofHepG-2 HepG-2 HepG -cells cells2 cells treated treated treated with with with mytoxin mytoxin mytoxin B B andandB andepiroridinepiroridin epiroridin acid acid acidfor for 24 24 for h, respectively. 24 h, respectively. The mitochondrialmi tochondrialThe mitochondrial transmembrane transmembrane potential was potential calculated was asascalculated the the ratio ratio ofas of red/greenthe red/green ratio of fluorescence ﬂuorescencered/green fluorescence intensity. intensity. intensity.

3.3.3. Discussion Discussion Discussion InInIn this thisthis study, study, cell cell morphology morphology morphology inspection inspection inspection and and DNA and DNA DNA fragmentation fragmentation fragmentation detection detection detection combined combined combined with thewith withflow the cytometrytheflow flow cytometry cytometryassay results assay assay demonstrated results results demonstrated demonstrated the apoptosis the the of apoptosis apoptosisHepG-2 ofcells of HepG HepG-2treated-2 cellsby cells the treated treated two trichothecene by the the two two toxins,trichothecenetrichothecene mytoxin toxins, toxins,B and epiroridin mytoxin mytoxin B Bacid, and and isolated epiroridin epiroridin from acid, acid,M. roridum isolated isolated. The from from apoptosisM. M. roridum roridum mechanisms.. The The apoptosis apoptosisof which weremechanismsmechanisms investigated of of which which by qRT-PCR, were were investigated investigated western blot by by analys qRT-PCR, qRT-is,PCR, and westernwestern flow cytometry blotblot analysis, analysis, assay. andThree and flow flow trichothecene cytometry cytometry mytoxins,assay.assay. ThreeThree mytoxin trichothecenetrichothecene B, epiroridin mytoxins,mytoxins acid and, mytoxinmytoxin epiroridin B,B, epiroridinepiroridin E were isolated acidacid andand from epiroridinepiroridin M. roridum EE werewere [13] isolatedisolated. Mytoxin fromfrom B andM.M. roridum repiroridinoridum[ 13[13]]. E Mytoxin. showedMytoxin B nearly B and and epiroridin epiroridinthe same E cytotoxici showedE showed nearlyty nearly because the the same they same cytotoxicity have cytotoxicity the same because because mother they theynucleus; have have the meanwhile,samethe same mother mothermytoxin nucleus; nucleus; B meanwhile,and epiroridin meanwhile, mytoxin acid shared mytoxin B and epiroridinmore B and structure acidepiroridinshared differences acidmore in shared structure the side more differences chain. structure Thus, in thethedifferences sidenovel chain. trichothecene in Thus, the side the epiroridin chain.novel trichothecene Thus, acid the and novel epiroridinmytoxin trichothecene B acid were and selected epiroridin mytoxin to B acidcompare were and selected their mytoxin toapoptosis- compare B were inducingtheirselected apoptosis-inducing toeffects compare towards their effects HepG-2 apoptosis towards cells-inducing and HepG-2 the effectsrelati cells andonship towards the relationshipof theirHepG structure-2 cells of their and differences, structure the relationship differences, and their of cytotoxicandtheir their structure cytotoxicmechanisms differen mechanisms towardsces, and towardsHepG their-2 HepG-2 cytotoxiccells were cells mechanismalso were investigated. alsos investigated. toward Thes HepG weaker The weaker-2 cellscytotoxicity cytotoxicity were alsoof epiroridinofinvestigated epiroridin acid. acid The towards towardsweaker human cytotoxicity human normal normal of cells epiroridin cells (LX-2) (LX-2) acidthan than tow that thata rdstowards towards human humanhuman normal tumor tumor cells (cellsLX cells-2 (HepG-2)) (HepG-2) than that suggestedsuggestedtowards human the the potential potential tumor applicationcells application (HepG -of of2) epiroridin epiroridinsuggested acidthe acid potential in in future future application treatment treatment of ofof liver liverepiroridin cancer. cancer. aci To Tod thein the future best best ofoftreatment our our knowledge, of liver this cancer. this is is the theTo first first the bestreport of on our the knowledge, apoptosis thismechanism is the first of the report novel on trichothecene the apoptosis mycotoxinmycotoxinmechanism epiroridin of the novel acid trichothecene and the firstfirst studystudymycotoxin toto compareco mpareepiroridin thethe apoptosis apoptosisacid and statusthe status first of of study epiroridin epiroridin to compare acid acid and and the a aknownapoptosis known trichothecene trichothecene status of epiroridin mytoxin mytoxin Bacid B systematically. systematically. and a known trichothecene mytoxin B systematically. EpiroridinEpiroridin acid acid andand mytoxinmytoxin B isolated fromfrom M.M. roridumroridum shared shared the the same same mother mother nucleus nucleus of of16 16member member ring ring with with epoxy epoxy structure structure [13]. [13]. The The carboxyl carboxyl groupgroup waswas found at C-9C-9 ofof epiroridinepiroridin acid, acid, whereaswhereas no no carboxyl carboxyl group group was was found found at at C-9 C-9 of of myto mytoxinxin B B [13]. [13]. The The presence presence of of carboxyl carboxyl group group at at C-9 C-9 would increase the acidity of epiroridin acid; meanwhile, this carboxyl group is near the epoxy structure in the mother nucleus, which is critical for the toxicity of trichothecene [12–14]. The higher concentration (1.0 μM) of epiroridin acid than mytoxin B (0.1 μM) showed weaker apoptosis effect towards HepG-2 cells, further demonstrating the much weaker cytotoxicity of epiroridin acid than mytoxin B towards HepG-2 cells. The structure differences among epiroridin acid, epiroridin E and

Molecules 2016, 21, 781 7 of 11

Epiroridin acid and mytoxin B isolated from M. roridum shared the same mother nucleus of 16 member ring with epoxy structure [13]. The carboxyl group was found at C-9 of epiroridin acid, whereas no carboxyl group was found at C-9 of mytoxin B [13]. The presence of carboxyl group at C-9 would increase the acidity of epiroridin acid; meanwhile, this carboxyl group is near the epoxy structure in the mother nucleus, which is critical for the toxicity of trichothecene [12–14]. The higher concentration (1.0 µM) of epiroridin acid than mytoxin B (0.1 µM) showed weaker apoptosis effect towards HepG-2 cells, further demonstrating the much weaker cytotoxicity of epiroridin acid than mytoxin B towards HepG-2 cells. The structure differences among epiroridin acid, epiroridin E and mytoxin B as well as the cytotoxicities of the three trichothecene mycotoxins towards HepG-2 cells [13] indicated that the oxygen atom positions in the side chain at C-15 had no great effect on the cytotoxicity. The carboxyl group at C-9 in the mother nucleus of epiroridin acid resulted in the much weaker cytotoxicity of epiroridin acid than that of mytoxin B. It was reported that the modification at C-9 of trichothecene T-2 toxin could reduce the cytotoxicity against mouse lymphoma cells [14]. Lower expression level of bcl-2 gene and higher expression level of bax gene as well as the higher apoptosis rate and lower mitochondrial transmembrane potential were observed in mytoxin B-treated cells compared with epiroridin acid-treated HepG-2 cells. These results further confirmed the stronger cytotoxicity and more significant apoptosis effect caused by mytoxin B compared with that caused by epiroridin acid. The possible reason was that carboxyl group in the side chain of epiroridin acid weakened the cytotoxicity, resulting in the weaker apoptosis effect of epiroridin acid against HepG-2 cells. The relatively lower cytotoxicity of this novel trichothecene mycotoxin epiroridin acid than the known trichothecene would provide clues for the future modification of trichothecene mycotoxin with the purpose of obtaining attenuated toxins with higher specificity and lower side-effect, thereby laying a foundation for future cancer therapy by the utilization of novel toxins [15,16]. Cysteinyl aspartate specific proteinases (caspases) play very important roles during apoptosis [17]. In this study, the mytoxin B and epiroridin acid induced the cleavage of caspase-9 protein to form 37 and 35 kD fragments. The cleaved caspase-9 activated pro-caspase-3 and 17 kD fragment were detected in trichothecene mytoxin-treated HepG-2 cells. The cleaved caspase-3 could hydrolyze target protein, thus leading to the apoptosis of HepG-2 cells. Weak bands of cleaved caspase-3 and caspase-9 were also detected in the control, which could be attributed to the very low apoptosis rate in HepG-2 cells without treatment with mytoxin B and epiroridin acid because of natural cellular metabolism. Bcl-2 and Bax proteins also play important roles in the apoptosis process [17]. We postulated that the decreased expression of Bcl-2 protein in mytoxin B- and epiroridin acid-treated HepG-2 cells could promote the release of cytochrome c, thus promoting apoptosis [17,18]. Bcl-2 protein is a kind of anti-apoptosis protein, which played an important role in the apoptosis of different cells. It was reported that Bcl-2 not only functions as an anti-apoptotic protein, but also as an anti-autophagy protein via its inhibitory interaction with Beclin 1. This anti-autophagy function of Bcl-2 may help maintain autophagy at levels that are compatible with cell survival [19]. Bax protein in mytoxin B- and epiroridin acid-treated HepG-2 cells with much higher expression level compared with control could insert into the mitochondrial outer membrane, thus altering mitochondrial membrane permeability, reducing the mitochondrial membrane potential, and finally enhancing the apoptosis rate significantly. The crude extract of Pien Tze Huang was also reported to induce the apoptosis of human osteosarcoma MG63 cells by the activation of caspase cascades and the alteration of apoptotic mediators bcl-2 and bax expression, further demonstrating the important roles of Bcl-2, Bax protein, and caspase cascades in the apoptosis of tumor cells [20].

4. Materials and Methods

4.1. Materials M. roridum was isolated from the medicinal plant P. cablin. Trichothecene toxins mytoxin B and epiroridin acid were isolated from the fermentation liquid of M. roridum in our lab [13]. HepG-2 and Molecules 2016, 21, 781 8 of 11

LX-2 cell lines were purchased from ATCC (Manassas, VA, USA). The ﬂuorochrome JC-10, PI, and Annexin-V were obtained from Sigma (St. Louis, MO, USA). The qRT-PCR mix was provided by Fermentas (Harrington, WA, USA). The anti-caspase-3 mouse monoclonal antibody, anti-caspase-9 rabbit monoclonal antibodies and rabbit anti-mouse IgG secondary antibody were purchased from CST (Danvers, MA, USA).

4.2. Cytotoxicity Detection of Epiroridin Acid and Mytoxin B HepG-2 and LX-2 cells were adjusted to 3 ˆ 104/mL and seeded onto a 96-well microtiter plate. Different concentrations of mytoxin B and epiroridin acid were dissolved in DMSO and added ˝ after 24 h of incubation at 37 C, 5% CO2. Adriamycin was employed as a positive control. After further incubation at 37 ˝C for 24 h, the inhibitory effect of the added samples on the proliferation of HepG-2 cells was determined by the sulforhodamine B (SRB) method [21]. The control group and trichothecene toxin-treated HepG-2 cells were observed by a laser confocal microscopy (LeicaAF6000, Solms, Germany). The total DNAs of the control group and trichothecene toxin-treated HepG-2 cells were extracted by DNA ladder extraction kit (Beyotime, Shanghai, China) and detected by 1.5% agarose gel electrophoresis.

4.3. qRT-PCR Analysis of Genes Related to the Apoptosis HepG-2 cells were treated with 1.0 µM epiroridin acid and 0.1 µM mytoxin B for 24 h. The cells were collected and washed with phosphate sodium buffer. The total RNAs of untreated HepG-2 cells and trichothecene toxin-treated cells were extracted using a RNA extraction kit (Umagen, Guangzhou, China). The total RNAs were adjusted to the same concentration and used as templates to obtain corresponding cDNAs using the same MasterMix (ABM, Peterborough, ON, Canada). The primes (Table1) and cDNAs were added to the qPCR Mix (Fermentas) to identify the relative expression levels of genes bcl-2, bax, and Fasl. β-actin was used as a reference gene. qRT-PCR was performed using the Mastercycler ep realplex System (Eppendorf, Hamburg, Germany), and the qRT-PCR thermal cycling condition for all reactions was 95 ˝C for 1 min 50 s, followed by 40 cycles of 95 ˝C for 10 s, and 55 ˝C for 33 s. All reactions were conducted in biological triplicates, and the results were expressed as relative expression levels to β-actin gene. The CT values obtained were used as the original data to calculate the relative expression levels of different genes to histone gene by the 2´∆∆CT method [22].

Table 1. Primers for the ampliﬁcation of genes related to the apoptosis.

Primers Sequence (5’-3’) bcl-2 F TTGGCCCCCGTTGCTT bcl-2 R CGGTTATCGTACCCCGTTCTC bax F TCCCCCCCGAGAGGTCTTTT bax R CGGCCCCAGTTGAAGTTG Fasl F ATCCCTCTGGAATGGGAAGA Fasl R CCATATCTGTCCAGTACTGC β-actin F GGCATCGTAGTGAGCTCCG β-actin R GCTGGAAGTGAACGCAG

4.4. Western Blot Analysis of Caspase-3, Caspase-9 Protein HepG-2 cells were treated with 1.0 µM epiroridin acid and 0.1 µM mytoxin B for 24 h. The cells were collected; 500 µL protein extracting buffer (Pierce, Waltham, MA, USA) was added to the cells, and total proteins were extracted and adjusted to the concentration of 1.0 mg/mL. The proteins were loaded to 12% SDS-PAGE with a volume of 10 µL and then transferred onto nitrocellulose membrane at a voltage of 100 V for 45 min. The membrane was blocked by 5% non-fat milk for 3 h and then incubated at 4 ˝C overnight in anti-caspase-3 and anti-caspase-9 mouse monoclonal antibody with a dilution of 1:2000. After being washed with TBST buffer containing tween-20 for three times, Molecules 2016, 21, 781 9 of 11 the membrane was incubated in rabbit anti-mouse IgG secondary antibody at 37 ˝C for 1 h. The target band was ﬁnally visualized by ECL kit (Thermo Fisher, Waltham, MA, USA) according to the manufacturer’s instructions.

4.5. Flow Cytometry Assay of Trichothecene Mycotoxin-treated HepG-2 Cells HepG-2 cells with a concentration of 5 ˆ 104/mL were incubated at 37 ˝C for 24 h. Afterward, 1.0 µM epiroridin acid and 0.1 µM mytoxin B was added to HepG-2 cells. After 24 h of incubation, the cells were collected by centrifugation and then washed with PBS. About 300 µL of binding buffer was used to resuspend cells, and 0.4 µL of Annexin V-FITC with a concentration of 0.3 mg/mL was added and incubated at room temperature away from light for 15 min. Consequently, 2 µL of PI dye with a concentration of 50 µg/mL was added and incubated at room temperature away from light for 5 min. Finally, the stained cells were loaded onto ﬂow cytometry (FC500, Beckman, Brea, CA, USA). The apoptosis of epiroridin acid- and mytoxin B-treated HepG-2 cells were analyzed.

4.6. Detection of Mitochondrial Transmembrane Potential Epiroridin acid (1.0 µM) and mytoxin B (0.1 µM) were added to the HepG-2 cells at the logarithmic phase. After 24 h of incubation, the cells were collected and resuspended in 200 µL PBS. Approximately 0.5 µL of lipophilic cation 5,51,6,61-tetrachloro-1,11,3,31-tetraethylbenzimidazolcarbocyanine iodide (JC-10) dyed with a concentration of 10 µg/mL was added to the treated HepG-2 cells and incubated at 37 ˝C for 20 min away from light. The fluorescene of control and treated HepG-2 cells was observed by a laser confocal microscopy. Finally, the stained HepG-2 cells were loaded onto flow cytometry. The mitochondrial transmembrane potential was analyzed by detecting the intensity of red and green fluorescence, and the ratio of red/green fluorescence was calculated.

5. Conclusions In this study, the cytotoxicity mechanisms of a novel trichothecene mycotoxin, epiroridin acid, and a known trichothecene, mytoxin B, from M. roridum were investigated. The laser confocal microscopy observation results, DNA fragmentation detection and ﬂow cytometry assay results demonstrated the apoptosis of HepG-2 cells treated with epiroridin acid and mytoxin B. The results of qRT-PCR, western blot analysis and ﬂow cytometry assay showed that mytoxin B and epiroridin acid induced the apoptosis of HepG-2 cells by the activation of caspase cascades, the up-regulation of Bax protein and the down-regulation of Bcl-2 protein, thereby reducing the mitochondrial membrane potential. Epiroridin acid-treated HepG-2 cells showed lower apoptosis rate, lower expression level of bax gene, higher expression level of bcl-2 gene as well as higher mitochondrial membrane potential compared with mytoxin B-treated HepG-2 cells. The relatively lower cytotoxicity of epiroridin acid against HepG-2 cells compared with that of mytoxin B, combined with the lower cytotoxicity of epiroridin acid towards LX-2 cells than that of mytoxin B provides a new clue for the development of attenuated trichothecenes toxins, thus shedding light on the future therapy of liver cancer using attenuated toxin with lower side-effect combined with targeting technique.

Acknowledgments: We gratefully thank the support from the National Basic Research Program of China (973 Program) (No. 2014CB460613), National Natural Science Foundation of China (31500037), Natural Science Foundation of Guangdong Province (2015A030310103), Science and Technology Planning Project of Guangdong Province (2016A020222022, 2015A030302061). Author Contributions: Weimin Zhang, Wei Ye and Yuchan Chen conceived and designed the experiments; Wei Ye, Yuchan Chen, Haohua Li, Hongxin Liu, Zhanghua Sun, Taomei Liu performed the experiments; Wei Ye, Yuchan Chen, Haohua Li and Hongxin Liu analyzed the data; Wei Ye, Yuchan chen, Haohua Li and Saini Li contributed reagents/materials/analysis tools; Wei Ye and Weimin Zhang wrote the paper. Conﬂicts of Interest: The authors declare no conﬂict of interest. Molecules 2016, 21, 781 10 of 11

References

1. Veiseh, M.; Gabikian, P.; Bahrami, S.-B.; Veiseh, O.; Zhang, M.; Hackman, R.C.; Ravanpay, A.C.; Stroud, M.R.; Kusuma, Y.; Hansen, S.J. Tumor paint: A chlorotoxin: Cy5.5 bioconjugate for intraoperative visualization of cancer foci. Cancer Res. 2007, 67, 6882–6888. [CrossRef][PubMed] 2. Hsieh, P.-F.; Chiu, H.-C.; Chen, K.-C.; Chang, C.-H.; Chou, E. C.-L. Botulinum toxin A for the Treatment of Overactive Bladder. Toxins 2016, 8, 59. [CrossRef][PubMed] 3. Thakur, M.; Mergel, K.; Weng, A.; von Mallinckrodt, B.; Gilabert-Oriol, R.; Dürkop, H.; Melzig, M.F.; Fuchs, H. Targeted tumor therapy by epidermal growth factor appended toxin and puriﬁed saponin: An evaluation of toxicity and therapeutic potential in syngeneic tumor bearing mice. Mol. Oncol. 2013, 7, 475–483. [CrossRef] [PubMed] 4. Vyas, V.K.; Brahmbhatt, K.; Bhatt, H.; Parmar, U. Therapeutic potential of snake venom in cancer therapy: Current perspectives. Asian Pac. J. Trop. biomed. 2013, 3, 156–162. [CrossRef] 5. Erin, K.W.; Sangeetha, R.; Garrett, L.R.; Brigitte, B.; Jennifer, E.; William, N.; Jack, P.H. A novel targeted engineered toxin body for treatment of HER2 positive breast cancer. Cancer Res. 2015, 75.[CrossRef] 6. Berstad, M.; Cheung, L.; Berg, K.; Peng, Q.; Fremstedal, A.; Patzke, S.; Rosenblum, M.; Weyergang, A. Design of an EGFR-targeting toxin for photochemical delivery: In vitro and in vivo selectivity and efﬁcacy. Oncogene 2015, 34, 5582–5592. [CrossRef][PubMed] 7. Koshikawa, N.; Takenaga, K. HyPoxia-regulated expression of attenuated diphiheria toxinA fused with hypoxia-inducible factor-lα oxygen-dependent degradation domain preferentially induces apoptosis of hypoxic cells in solid tumor. Cancer Res. 2005, 65, 11622–11630. [CrossRef][PubMed] 8. Steinmetz, W.E.; Robustelli, P.; Edens, E.; Heineman, D. Structure and conformational dynamics of trichothecene mycotoxins. J. Nat. Prod. 2008, 71, 589–594. [CrossRef][PubMed] 9. Ward, T.J.; Bielawski, J.P.; Kistler, H.C.; Sullivan, E.; O1Donnell, K. Ancestral polymorphism and adaptive evolution in the trichothecene mycotoxin gene cluster of phytopathogenic Fusarium. Proc. Nat. Acad. Sci. USA 2002, 99, 9278–9283. [CrossRef][PubMed] 10. Ueno, Y.; Umemori, K.; Niimi, E.C.; Tanuma, S.I.; Nagata, S.; Sugamata, M.; Ihara, T.; Sekijima, M.; Kawai, K.I.; Ueno, I. Induction of apoptosis by T-2 toxin and other natural toxins in HL-60 human promyelotic leukemia cells. Nat. Toxins 1995, 3, 129–137. [CrossRef][PubMed] 11. Frankiˇc,T.; Pajk, T.; Rezar, V.; Levart, A.; Salobir, J. The role of dietary nucleotides in reduction of DNA damage induced by T-2 toxin and deoxynivalenol in chicken leukocytes. Food Chem. Toxicol. 2006, 44, 1838–1844. [CrossRef][PubMed] 12. Cetin, Y.; Bullerman, L.B. Cytotoxicity of Fusarium mycotoxins to mammalian cell cultures as determined by the MTT bioassay. Food Chem. Toxicol. 2005, 43, 755–764. [CrossRef][PubMed] 13. Liu, H.X.; Liu, W.Z.; Chen, Y.C.; Sun, Z.H.; Tan, Y.Z.; Li, H.H.; Zhang, W.M. Cytotoxic trichothecene macrolides from the endophyte fungus Myrothecium roridum. J. Asian Nat. Prod. Res. 2016, 1–6. [CrossRef] 14. Anderson, D.; Black, R.; Lee, C.; Pottage, C.; Rickard, R.; Sandford, M.; Webber, T.; Williams, N. Structure-activity studies of trichothecenes: Cytotoxicity of analogs and reaction products derived from T-2 toxin and neosolaniol. J. Med. Chem. 1989, 32, 555–562. [CrossRef][PubMed] 15. Sun, D.; Sun, M.; Zhu, W.; Wang, Z.; Li, Y.; Ma, J. The anti-cancer potency and mechanism of a novel tumor-activated fused toxin, DLM. Toxins 2015, 7, 423–438. [CrossRef][PubMed] 16. Kim, I.S.; Choi, D.-K.; Jung, H.J. Neuroprotective effects of vanillyl alcohol in Gastrodia elata Blume through suppression of oxidative stress and anti-apoptotic activity in toxin-induced dopaminergic MN9D cells. Molecules 2011, 16, 5349–5361. [CrossRef][PubMed] 17. Shimizu, S.; Narita, M.; Tsujimoto, Y. Bcl-2 family proteins regulate the release of apoptogenic cytochrome c by the mitochondrial channel VDAC. Nature 1999, 399, 483–487. [PubMed] 18. Yang, J.; Liu, X.; Bhalla, K.; Kim, C.N.; Ibrado, A.M.; Cai, J.; Peng, T.-I.; Jones, D.P.; Wang, X. Prevention of apoptosis by Bcl-2: Release of cytochrome c from mitochondria blocked. Science 1997, 275, 1129–1132. [CrossRef][PubMed] 19. Pattingre, S.; Tassa, A.; Qu, X.; Garuti, R.; Liang, X.; Mizushima, N.; Packer, M.; Schneider, M.; Levine, B. Bcl-2 antiapoptotic proteins inhibit Beclin 1-dependent autophagy. Cell 2005, 122, 927–939. [CrossRef][PubMed] Molecules 2016, 21, 781 11 of 11

20. Fu, Y.; Zhang, L.; Hong, Z.; Zheng, H.; Li, N.; Gao, H.; Chen, B.; Zhao, Y. Methanolic extract of Pien Tze Huang induces apoptosis signaling in human osteosarcoma MG63 cells via multiple pathways. Molecules 2016, 21, 283. [CrossRef][PubMed] 21. Vichai, V.; Kirtikara, K. Sulforhodamine B colorimetric assay for cytotoxicity screening. Nat. protoc. 2006, 1, 1112–1116. [CrossRef][PubMed] 22. Huang, L.; Li, G.; Mo, Z.; Xiao, P.; Li, J.; Huang, J. De Novo assembly of the Japanese Flounder (Paralichthys olivaceus) spleen transcriptome to identify putative genes involved in immunity. PLoS ONE 2015, 10, e0117642.

Sample Availability: Samples of the compounds are available from the authors.

© 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).