Investigating the Functional Role of Tick Antioxidants in Hematophagy and Vector Competence

The University of Southern Mississippi The Aquila Digital Community

Dissertations

Fall 12-2016

Deepak Kumar University of Southern Mississippi

Follow this and additional works at: https://aquila.usm.edu/dissertations

Part of the Entomology Commons, Genomics Commons, and the Molecular Biology Commons

Recommended Citation Kumar, Deepak, "Investigating the Functional Role of Tick Antioxidants in Hematophagy and Vector Competence" (2016). Dissertations. 905. https://aquila.usm.edu/dissertations/905

This Dissertation is brought to you for free and open access by The Aquila Digital Community. It has been accepted for inclusion in Dissertations by an authorized administrator of The Aquila Digital Community. For more information, please contact [email protected]. INVESTIGATING THE FUNCTIONAL ROLE OF TICK ANTIOXIDANTS IN

HEMATOPHAGY AND VECTOR COMPETENCE

Deepak Kumar

A Dissertation Submitted to the Graduate School and the Department of Biological Sciences at The University of Southern Mississippi in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

Approved:

______Dr. Shahid Karim, Committee Chair Associate Professor, Biological Sciences

______Dr. Glen Shearer Jr, Committee Member Professor, Biological Sciences

______Dr. Yanlin Guo, Committee Member Professor, Biological Sciences

______Dr. Robert C Bateman Jr, Committee Member Professor Emeritus, Chemistry and Biochemistry

______Dr. Faqing Huang, Committee Member Professor, Chemistry and Biochemistry

______Dr. Karen S. Coats Dean of the Graduate School

December 2016

Deepak Kumar

2016

Published by the Graduate School

ABSTRACT

INVESTIGATING THE FUNCTIONAL ROLE OF TICK ANTIOXIDANTS IN

HEMATOPHAGY AND VECTOR COMPETENCE

by Deepak Kumar

December 2016

Ticks are obligate hematophagous arthropods and harbor several pathogens which transmit various diseases to humans and their domesticated animals. Host blood- digestion in a tick midgut (MG) generates several reactive oxygen species (ROS), which are extremely toxic to essential macromolecules

(e.g. DNA, proteins, and lipids) within the cell, resulting in high oxidative stress.

Thus, this dissertation focuses on the questions of how tick homeostasis responds to high oxidative stress, and how ticks and their harbored pathogens survive the high surge of oxidative stress during blood digestion. We are specifically interested in the tick-pathogen, Rickettsia parkeri (R. parkeri, Rp), harbored by Gulf Coast ticks, which has medical and veterinary significance.

Recent literature has suggested the role of redox-switches in tick-pathogen interaction (vector competence). However, the actual mechanism is not well understood. The overall purpose of this study is to investigate the roles of tick antioxidants in tick physiology and their role in facilitating R. parkeri survival during blood feeding. Previous work from our lab has indicated that the manipulation of antioxidants by R. parkeri is required for its survival. Reverse genetics approach was used for the characterization of antioxidants, including selenogenes (SelO and SelS), in uninfected and Rp-infected ticks. The tissue-

specific roles of SelO and SelS were demonstrated in Rp colonization. SelO, hypothetically a mitochondrial kinase, likely exploits its antioxidant property for the colonization and survival of Rp in tick MGs. ER stress sensitivity of R. parkeri and tick microbiota were also demonstrated in tick midgut. Prior to this work, exogenous and endogenous oxidative stress were induced into separate groups of ticks in order to investigate the response of tick antioxidant machinery as well as the oxidative stress tolerance of ticks. The antioxidant genes, which demonstrated a high shift in their expression, are currently being characterized by our lab. Our results reveal the robustness of the tick antioxidant machinery by exhibiting a high fold upregulation of the antioxidant genes, and as a result, oxidative stress remains very close to control. As a part of this work, antioxidant catalase in ticks is characterized and its role in tick reproductive fitness is demonstrated.

iii

ACKNOWLEDGMENTS

I am extremely grateful to my advisor Dr. Shahid Karim for giving me an opportunity to work with him, and always being willing to discuss science. I would like to thank all the committee members (Dr. Robert Bateman, Dr. Glen Shearer,

Dr. Faqing Huang and Dr. Yanlin Guo) who agreed to serve despite of their busy schedule. I would like to thank all the past and present lab members (Steve

Adamson, Rebecca Browning, Khemraj BC, Nabanita Mukherjee, Rebekah

Bullard, Jaclyn Williams, Gary Crispell and Nicholas Rinderer) for helping me in making my research better. I would also like to thank all the undergraduates for being supportive and helpful. I would also take this privilege to thank all the supporting staffs from the Biological Sciences for answering all my questions regarding rules and regulations of the department and USM. To all whom I have mentioned above, and to all whom I couldn’t mention here but helped me in some or other way, my heartfelt thanks to all of them for their contributions in making my science better and helped me in becoming a better person.

TABLE OF CONTENTS

ABSTRACT ...... ii

ACKNOWLEDGMENTS ...... iv

LIST OF TABLES ...... x

LIST OF ILLUSTRATIONS ...... xi

CHAPTER I - STATE OF KNOWLEDGE ...... 1

Importance of Tick Study ...... 1

Tick Biology ...... 2

Biology of Tick Blood Feeding (Hematophagy) ...... 3

Biological Significance of ROS and Antioxidant Machinery ...... 5

Superoxide Dismutase (SOD) ...... 7

Catalase and its H2O2 Detoxification ...... 7

Glutathione (GSH) and Glutathione Peroxidase (GPx) ...... 9

Glutathione-S-Transferase (GST) ...... 9

Selenoproteins ...... 10

Hematophagy, ROS and Pathogen Transmission (Vector Competence) .... 12

Impact of Blood Digestion on Tick-Pathogen Transmission ...... 16

Redox-Dependent Responses during Host-Pathogen Interaction ...... 17

Surge of Oxidative Stress when Rickettsia Interacts with Human

Endothelial Cells ...... 18

Tick–Host–Pathogen Interactions ...... 19

Gulf Coast Ticks ...... 24

Life Cycle of Gulf Coast Ticks ...... 25

Medical and Veterinary Significance of Gulf Coast Ticks ...... 26

Effects of Spotted Fever Group Rickettsiae on Ticks ...... 27

Rickettsia Parkeri ...... 30

Impact of Selenoproteins selS and selO on R. Parkeri-Tick Interaction ... 31

Statement of Problem, Experimental Approach and Hypothesis ...... 34

Hypothesis1 ...... 34

Experimental Approach...... 34

To Induce Optimum (sub-lethal) Oxidative Stress within the Gulf Coast

...... 34

Acquire a Gene Expression Profile of Tick Antioxidant Genes for Sub-

Lethal Oxidative Stress ...... 35

Select 5-10 Tick Antioxidant Genes, which Demonstrate the Highest

Upregulation at a Sub-Lethal Level of Oxidative Stress ...... 35

Characterize those Selected Genes by Using the Strategy of Reverse

Genetics (Knocking Down Gene by using an RNA Interference and

Studying the Change in Phenotype)...... 35

How does R. Parkeri Colonize and Survive Inside the Gulf-Coast Ticks

Under the High Oxidative Stress (Blood Feeding Conditions)? ...... 36

CHAPTER II - ASSESSMENT OF TICK ANTIOXIDANT RESPONSES TO

EXOGENOUS OXIDATIVE STRESSORS AND INSIGHT INTO THE ROLE OF

CATALASE IN THE REPRODUCTIVE FITNESS OF THE GULF COAST TICK,

AMBLYOMMA MACULATUM ...... 38

Abstract ...... 38

Introduction ...... 39

Materials and Methods ...... 42

Ticks ...... 42

Exogenous Induction of Oxidative Stress ...... 42

Endogenous Induction of Oxidative Stress through CAT RNA Interference

and Inhibition ...... 43

Tick Tissue Dissection ...... 45

Quantification of Oxidative Stress ...... 48

Statistical Analysis ...... 49

Results ...... 50

Bioinformatics Analysis ...... 50

Antioxidant Response to Exogenous Oxidative Stressors ...... 52

Impact of CAT Knockdown ...... 56

vii

CAT Involvement in Tick Reproductive Fitness ...... 59

Discussion ...... 60

Conclusions ...... 64

CHAPTER III – INVESTIGATE THE ROLE OF SELO AND SELS IN TICK

PHYSIOLOGY AND VECTOR COMPETENCE IN GULF COAST TICKS

(AMBLYOMMA MACULATUM) ...... 66

Abstract ...... 66

Introduction ...... 67

Materials and Methods ...... 70

Ethics Statement ...... 70

Ticks and Other Animals ...... 70

Tick MG and SG Preparation ...... 71

RNA Preparation, cDNA Synthesis and Quantitative Reverse

Transcriptase (qRT)-PCR ...... 71

Double-Stranded RNA (dsRNA) Synthesis, Tick Injections and

Hematophagy ...... 72

Quantification of Total Bacterial Load ...... 73

Quantification of R. Parkeri Copy Numbers in Tick Tissues...... 74

Quantification of Oxidative Stress ...... 74

Quantification of ER Stress ...... 74

viii

Data Analysis ...... 75

Results ...... 75

Time-Dependent and Tissue-Specific Transcriptional Gene ...... 75

Impact of SelO and SelS Depletion on Hematophagy ...... 78

SelO, and SelS Silencing in R. Parkeri-Infected Ticks ...... 79

Unfolded Protein Response (UPR) in Uninfected and Rp-Infected Ticks 83

Discussion ...... 83

Conclusion ...... 88

CHAPTER IV – CONCLUSIONS AND FUTURE DIRECTION ...... 90

REFERENCES ...... 94

LIST OF TABLES

Table 1 Gene-Specific Quantitative Reverse Transcriptase PCR Primers used for

RT-PCR in Chapter II...... 65

Table 2 Gene-Specific Quantitative Reverse Transcriptase PCR Primers used for

RT-PCR in Chapter III...... 89

LIST OF ILLUSTRATIONS

Figure 1. Major defenses of hematophagous arthropods against oxidative stress.

...... 6

Figure 2. The multiple sequence alignment of Amblyomma maculatum catalase.

...... 50

Figure 3. Phylogenetic analysis of catalase from various eukaryotes using the neighbor-joining method...... 52

Figure 4. Effect of H2O2 injection on modulation of the antioxidant gene network in Amblyomma maculatum tissues...... 54

Figure 5. Effect of paraquat (PQ) injection on modulation of the antioxidant gene network in Amblyomma maculatum tissues...... 55

Figure 6. Microbial load estimation within tick tissues following sublethal doses of paraquat (PQ) and H2O2 injection in Amblyomma maculatum...... 57

Figure 7. Estimation of the time-dependent catalase (CAT) expression in natıve tick tissues upon infestation and the effect on total oxidative stress and bacterial colonization upon CAT silencing...... 58

Figure 8. Effect of catalase (CAT) knockdown [double stranded RNA of CAT gene (dsCAT)] on the antioxidant gene network in Amblyomma maculatum. .... 60

Figure 9. Elucidation of the role played by catalase (CAT) in the ovipositing of

Amblyomma maculatum...... 61

Figure 10. Temporal gene expression of SelO (A) and SelS (B) in uninfected

(naïve) tick tissues (midgut, MG and salivary glands,SG) during blood-feeding. 75

Figure 11. Compensatory regulation of antioxidants in uninfected A. maculatum ticks when (A) SelO and (B) SelS are knocked down...... 77

Figure 12. Effect of SelO and SelS knockdown on total bacterial load in naïve ticks...... 78

Figure 13. Impact of individual silencing of tick SelO and SelS in Rp-infected tick tissues (Salivary gland, SG and Midgut, MG)...... 80

Figure 14. The impact of silencing of tick SelO and SelS individually on total tick bacterial load and Rickettsia parkeri colonization in tick tissues (Salivary gland,

SG and Midgut, MG)...... 82

Figure 15. Unfolded protein response (UPR) in uninfected and Rp-infected ticks.

...... 83

xii

CHAPTER I - STATE OF KNOWLEDGE

Importance of Tick Study

Ticks are economically one of the most important obligate hematophagous ectoparasites on this earth because of their ability to act as vectors of various human and animal pathogens, including spirochetes, rickettsia, protozoa, nematodes and viruses (Bratton & Corey, 2005; Swanson et al., 2006; Flicek,

2007; Vorou et al., 2007). They use humans, animals, and other organisms as their host. They have medical and veterinary importance because they can transmit a variety of pathogens into their hosts, unlike other arthropod blood- feeders. In the case of humans, they are economically one of the most important arthropods, second only to mosquitoes. While in the case of livestock, they are economically the most important arthropods. Studies have estimated that almost

80% of the world’s total cattle population is infected by ticks at any given moment. The severity of this situation can be understood by the fact that almost

$650 million USD per annum is invested in tick control products in North America alone (Graf et al., 2004). Ticks also transmit several diseases to humans, such as Rocky Mountain spotted fever, Rickettsiosis, Colorado tick fever, Tularemia,

Ehrlichiosis and Babesiosis (Braton & Corey, 2005; Swanson et al., 2006; Flicek,

2007). In the USA, there are several tick-borne human diseases which have recently caught attention. Lyme disease is the most common tick-borne disease in the USA.

Tick Biology

Approximately 850 species of ticks are currently known (Furman &

Loomis, 1984). Ticks are classified into two families, Ixodidae (commonly known as ‘hard ticks’) and Argasidae (commonly known as ‘soft ticks’). Altogether, 683 hard tick species and 183 soft tick species which feed on various animals as hosts have been identified. There are four developmental stages in the life cycle of hard ticks - egg, larva, nymph and adult. At each stage of their life cycle, they require blood feeding in order to metamorphose to next stage. For hard ticks, only one blood meal is necessary in order to proceed to the next stage, while soft ticks feed intermittently upon their hosts (Parola & Raoult, 2001; Sonenshine,

1991). Six-legged larvae emerge from eggs after a blood meal and molt into eight-legged nymphs. Finally, nymphs molt into an adult. Adult females require blood feeding in order to lay eggs after mating with a male. Studies have revealed that mating accelerates the rate of blood feeding (Sonenshine, 1991).

After laying between 2,000 and 6,000 eggs, female ticks die. The hard tick completes its entire life cycle within 1 to 2 years in tropical regions and over three years for regions with a cold climate. Due to the unfavorable environmental conditions found within cold regions, hosts are not always available for blood feeding (which drives their life cycle), therefore, it undergoes a period of diapause until it finds a host. Hard ticks are further divided into two groups, metastriate and prostriate ticks. Metastriate ticks (for example, the ticks from the

Dermacentor or Rhipicephalus genera) have shorter mouthparts and secrete copious amounts of cement protein which acts as a glue and aids in firm

attachment the tick to the host (Francischetti et al., 2010). Prostriate ticks (for example, the ticks from the Ixodes genera) have relatively longer and barbed mouthparts, which aid in firmly attaching the tick, via a physical incision, into the host skin. Hard ticks are generally classified on the basis of the number of hosts

(generally one, two or three) required to complete their life cycle. One-host ticks

(For example, Rhipicephalus microplus) generally depend on upon a single host for all of their blood feeding during various developmental stages of their life- cycle. Two-host ticks (for example, Hyalomma species) depend on upon two hosts for the entire blood feeding process during their life-cycle. Their larvae and nymph stages use one host for blood feeding, while another host is used during adult mating and further engorgement. Three-host ticks (For example,

Amblyomma maculatum and Ixodes scapularis) complete each of the developmental stages of their life-cycle by blood feeding upon different hosts

(Sonenshine, 1991).

Biology of Tick Blood Feeding (Hematophagy)

Blood feeding, or hematophagy, is a fundamental biological process for ticks, and the tick’s gut is the primary vector–pathogen interface and blood digestion site. Therefore, a better understanding of tick hematophagy and blood- digestion could help develop novel strategies for controlling tick and tick-borne pathogens. As mentioned in the previous section, the physiology of blood feeding is significantly different between soft and hard ticks. In soft ticks, nymphs and adult ticks (both male and female) complete their feeding within hours and then drop off. In these ticks, blood feeding and egg laying are regular cyclic

processes. In contrast, female hard ticks feed only once in each stage of its life cycle and die after several days of egg laying (Coons & Alberti, 1999). Blood feeding in hard ticks consists of two phases, the rapid phase, and the slow phase. The slow phase consists comprises the first 6-9 days, while the final 1-2 days are known as the rapid phase, which accounts for almost two-thirds of the total volume of blood ingested before the tick detaches. In contrast to soft ticks, mated hard ticks engorge rapidly due to a possible hormonal triggering mechanism, although this is not well understood (Sonenshine, 1991). In comparison to insect blood feeding, tick feeding is a slower process and blood digestion takes place in the gut under an acidic pH. For insects, blood digestion takes place at a neutral pH (Grandjean & Aeschlimann, 1973). It has been hypothesized that only one multifunctional cell type exists during the slow feeding phase, which differentiates and contributes to blood protein digestion by endocytosis, and later heme waste is managed by hemosome formation (Coons et al., 1986; Agyei & Runham., 1995; Caperucci et al., 2010; Remedio et al.,

2013). After blood intake, blood hemoglobin is released into the tick’s gut lumen by an enzymatic hemolysis, which is also not well understood (Ribeiro, 1988).

After the release of the host’s hemoglobin into the tick’s gut lumen, a relatively large crystal of hemoglobin is formed (Smit et al., 1977). Although physiological significance of this crystallization is not clear, it is possible that it is a remedy for avoiding potential dangers associated with food preservation and other toxic effects of hemoglobin surplus (Sojka et al., 2013). At least two endocytic mechanisms have been investigated by which a tick’s digestive gut cells absorb

host blood proteins (for albumin and hemoglobin) and undergo heterophagy

(Sonenshine, 1991; Lara et al., 2005). The mechanism for processing hemoglobin is extremely specific; It is recognized by specific cell-receptors and targeted to large endosomal vesicles, while albumin is processed in a non- specific manner by fluid-phase endocytosis and delivered to small acidic vesicles

(Lara et al., 2005). The specific processing of hemoglobin has probably evolved as a detoxification mechanism against the release of potential toxic heme during hemoglobin digestion (Graca-Souza et al., 2006; Lara et al., 2003).

Biological Significance of ROS and Antioxidant Machinery

It is widely accepted that reactive oxygen species (ROS) are continuously generated by the reduction of molecular oxygen of single electrons liberated from the electron transport chain. Reactive oxygen species production is a normal part of the defense mechanism against pathogens. Under normal conditions in the cell, ROS generation is a part of aerobic metabolism process, but in the case of the environmental stress (Monaghan et al., 2009), they are generated in excessive amount. Excessive production of ROS may cause chronic damage to the cells which is collectively known as oxidative stress. Thus, whenever there is an imbalance between the production and elimination of ROS levels, oxidative stress occurs (Kregal & Zhang, 2007). Oxidative stress causes cellular damage because of the high reactivity of the ROS. The damages caused by ROS result in cell aging (Harman, 2003), tumorigenesis and other complications (DeJong et al.,

2007). In arthropods, this may occur as a result of several factors, such as compensatory growth (Mangel et al., 2005), aging (Kregal & Zhang, 2007), plant

Figure 1. Major defenses of hematophagous arthropods against oxidative stress.

Image adopted from Graca-Souza et al., 2006. photo-oxidants (Aucoin et al., 1995), heme digestion and severe environmental conditions (Zaman et al., 1995; Rojas & Leopald, 1996; Joanisse & Storey,

1996). Several antioxidant enzymes, such as superoxide dismutase (SOD), glutathione peroxidase, catalase, and selenoproteins help detoxify ROS.

Superoxide anion, which is a very toxic and reactive anion, is converted into a less toxic hydrogen peroxide (H2O2) by SOD, and then the hydrogen peroxide is

detoxified by a catalase and peroxidases. A number of these antioxidant enzymes are discussed below.

Superoxide Dismutase (SOD)

The dominant ROS, superoxide anion (O2.−), is converted into hydrogen peroxide (H2O2) by SOD. Superoxide dismutase is commonly found within the cytoplasm of the cell and has non-specific peroxidase activity. It is one of the main antioxidant enzymes against ROS produced within organisms. It dismutates the superoxide ion into O2 and H2O2. Its peroxidase activity is CO2 dependent, and exhibits relatively little activity in the absence of CO2 (Liochev & Fridovich,

2010). Then the catalase (CAT) helps transforms the SOD into water. Apart from its common role as an antioxidant, a recent study from our lab has revealed its role in the pathogen colonization of ticks as well (Crispell et al., 2016).

Catalase and its H2O2 Detoxification

The catalase enzyme converts H2O2 into water and oxygen without producing any reactive oxygen species. One catalase enzyme molecule contains four ferriprotoporphyrin groups. Its expression is tissue specific and varies greatly

(David et al., 2008). Each monomer of catalase contains one heme and one nicotinamide adenine dinucleotide phosphate (NADPH). The NADPH binds to each catalase monomer by 12 amino acids (Putnam et al., 2000) and protects it from oxidation by its own substrate, H2O2. Catalase is ubiquitous and found in

Archaea (Kawasaki & Aguirre, 2001), prokaryotes and eukaryotes (Manduzio et al., 2004., Kashiwagi et al., 1997). Its structure, function, and regulation within several organisms including bacteria (Storz & Tartaglia, 1992), plants (McClung,

1997) and mammals (Bryant & Wilson, 1995) have been widely studied. H2O2 is mainly produced in the cell’s mitochondria due to the superoxide ion dismutation by superoxide dismutases. A number of other oxidases enzymes such as peroxiredoxins, peroxidases, catalase-peroxidases, catalases, NADPH oxidases and xanthine oxidase also produce H2O2. The Km (Michalis Menton’s constant) values vary widely for these enzymes, which indicates that cells have well- developed enzymes with which to dispose off H2O2 at various concentrations.

Studies have revealed that Peroxiredoxins function at <10 micromolar, while catalase is functional at higher concentrations of H2O2 (Jones & Sugget et al.,

1968). H202 is less toxic than a superoxide ion and also works as a secondary messenger in the regulation of cell activities. H2O2 enters into cells through membranes and aquaporin. H2O2 is toxic, mainly because it emanates several reactive species, such as hydroxyl radical and singlet oxygen. Transition metals such as Fe(+2) and Cu(+1) can bind to the free DNA and protein and then react with H2O2 to produce a hydroxyl free radical (also called Fenton’s reaction).

Catalase is a commonly studied antioxidant enzyme and has several impacts upon arthropods. The overexpression of catalase and SOD found in mice (specifically, Drosophila melanogaster and Caenorhabditis elegans) has explained their enhanced longevity (Orr & Sohal, 1994; Schriner et al., 2005;

Melov et al., 2000; and Sampayo et al., 2003). Studies have also displayed that

ROS detoxification by catalase determines the fecundity in Anopheles gambiae

(DeJong et al., 2007). Surprisingly, catalase-lacking mice have normal fertility

(Ho et al., 2004), indicating that ROS doesn’t affect fertility in vertebrates. In the

case of Drosophila, flies lacking catalase were exceedingly weak and died soon after eclosion, while hypomorphic mutants exhibited normal viability (Griswold et al., 1993; Mackay & Bewley, 1989). Recently, catalase has been characterized in

Amblyomma maculatum ticks, and the role it plays within the reproductive fitness of the ticks has been discovered (Kumar et al., 2016).

Glutathione (GSH) and Glutathione Peroxidase (GPx)

Glutathione peroxidase (GPx), predominant within arthropods, performs the same function as catalase, in addition to several other functions (Felton &

Summers, 1995). One important component of antioxidant machinery is glutathione (GSH), which is a non-enzyme molecule and provides reducing equivalents for GPx: two reduced GSH gets converted into oxidized glutathione

(GSSG), and GSSG is then regenerated using NADPH (Schafer & Buettner,

2001). The GSH:GSSG ratio has already been established as an indication of the level of oxidative stress within plants (Kocsy et al., 1996). A higher ratio indicates lower oxidative stress (Rojas & Leopold, 1996., Korsloot et al., 2004). When organisms are exposed to high oxidative stress, this ratio is decreased by the high accumulation of GSSG and consumption of GSH (Rojas & Leopold,

1996).This ratio could be valuable during the creation of an antioxidant defense strategy (Joanisse & Storey, 1996).

Glutathione-S-Transferase (GST)

In arthropods, there are three metabolic pathways for detoxifying xenobiotic compounds which involve carboxylesterases, cytochrome P450 and

GST (Chevillon et al., 2007; Shahein et al., 2008; Rosario-Cruz et al., 2009;

Leeuwen et al., 2010). Glutathione-S-Transferases are known as the ubiquitous gene family which encodes detoxification enzymes. They recognize reactive electrophilic xenobiotic substances and chemicals of endogenous origin and detoxify them. They detoxify the chemicals by catalyzing their conjugation to

GSH, which makes the chemical less toxic and increases its solubility in water.

As such, it is easy to recognize and excrete them. They also have several non- catalytic functions, such as the sequestration of carcinogens, intracellular transport of hydrophobic ligands and the modification of several signal transduction pathways (Sherratt & Hayes, 2002). A recent study on the brown dog tick, Rhipicephalus sanguineus, has demonstrated that GST plays a role in the detoxification of tick repellent permethrin (Duscher et al., 2014). Because of its role in detoxification, GST might be used as a potential candidate for vaccine development (Dougall et al., 2005; Guerrero et al., 2012).

Few studies have shown its role in tick vector competence. It protects the lyme disease spirochete from mice neutrophils and facilitates its acquisition from infected mice to the tick Ixodes scapularis (Narasimhan et al., 2007; Anderson et al. 2007). Recently two glutathione peroxidase isoenzymes have been isolated from the embryo of camel tick Hyalomma dromedarii (Ibrahim et al., 2016). Both of them have the same function of detoxifying H2O2 with varying Km values of 24 and 49 μM (Ibrahim et al., 2016).

Selenoproteins

Selenium, an essential trace element, is necessary for the proper functioning of the human brain, immune system and muscles (Rayman, 2012;

Papp et al., 2010). Several epidemiological studies have demonstrated that low levels of selenium may increase the risk of various types of cancers including prostate, lung and colon cancer (Touat-Hamici et al., 2014). Selenium is incorporated as selenocysteine within selenoproteins, which play a role in antioxidant defense (Kryukov et al., 2003), redox homeostasis and redox signaling (Touat-Hamici et al., 2014). Roughly half of the selenoproteins are still uncharacterized. The presence of selenoproteins has been found in bacteria, archaea, and eukaryotes. Their expression pattern and localization are also very diverse (Kryukov et al., 2003). In different organisms, their number varies widely, such as 23-25 in mammals, 10-57 in algae and 30-37 in fish. In arthropods, they are either absent or their number is drastically reduced (Lobanov et al., 2009;

Mariotti et al., 2012). Insect species such as Apis mellifera, Drosophila willistoni,

Tribolium castaneum, Bombyx mori and Nasonia vitripennis are without selenoproteins, possibly because they don’t have the machinery necessary to incorporate selenocysteine into selenoproteins (Chapple & Guigo, 2008; Lobanov et al., 2008). Information concerning tick selenoproteins is limited, but studies have indicated that GPx (Salp25D), a selenoprotein in the tick Ixodes scapularis’s saliva, plays role in hydrogen peroxide detoxification and the acquisition of Borrelia burgdorferi from the host (Narasimhan et al., 2007),

Selenogene M (SelM) contributes to the pathogen infection in Dermocenter variabilis (Kocan et al., 2009) and SelK plays role in Ca2+ influx during the activation of the immune system (Huang et al., 2011; Verma et al., 2011).

Hematophagy, ROS and Pathogen Transmission (Vector Competence)

When ticks are attached to the host body during bloodmeal, the host’s immune system activates phagocytes such as neutrophils, monocytes, macrophages and eosinophils to prevent foreign microorganisms by producing ample amounts of superoxide ions – one of the components responsible for high oxidative stress in ticks (Halliwell & Gutteridge, 1989). Hosts have a variety of defense mechanisms which increase oxidative stress in ticks, such as releasing arachidonic acid; activation of lipoxygenases which cause generation of ROS such as peroxides, RNS species, cyclooxygenase enzymes; the release of metal ions such as Fe and Cu ions to produce hydroxyl free radicals; and the release of heme (Halliwell et al., 1992) which disturbs the tick’s antioxidant system (Ghosh et al., 2014). Hydrogen peroxide is known to be poorly oxidative and weakly reactive to ROS, but its ability to release iron ions from the heme bound to blood hemoglobin and make them available for Fenton’s reaction (Fig. 1) makes it extremely harmful to the cell (Gutteridge, 1986; Nagababu & Rifkind, 2000;

Spencer et al., 1995). Its ability to react with metal ions, such as iron and copper, and make hydroxyl-free radicals (OH•) (known as Fenton’s reaction) also makes it exceedingly toxic to the cell. It can rapidly damage cellular DNA, proteins, and lipids. Digestion of hemoglobin in MG releases large amounts of free heme, which reacts with lipid hydroperoxides to stimulate lipid peroxidation. Lipid peroxidation results in the production of a large amount of free radicals which get converted into highly toxic alkoxyl and peroxyl radicals (Tappel, 1955).

Release of iron from the porphyrin ring through the reactions mentioned above can result in the generation of hydroxyl free radicals (OH•). Therefore, several studies have suggested blood-digestion as the main reason for oxidative stress in hematophagous (Dansa-Petretski et al., 1995; Paes et al., 2001; Graca-

Souza et al., 2006). Several antioxidant and heme detoxification mechanisms have been revealed, which help these hematophagous in adaptation (Lara et al.,

2003; Oliveira et al., 1999; Maya-Monteiro et al., 2000, 2004). It is essential for the ticks’ survival that they detoxify all of the oxidative stress produced by the host. To counteract this stress, ticks contain several molecules in their saliva such as varied immunomodulators, antioxidants, anticoagulants and other biologically active proteins (Ribeiro et al., 2006, 2003). Several reports have indicated that proteins secreted from tick saliva and salivary glands (SG) may inhibit humoral immunity and inflammation (Lai et al., 2004; Narasimhan et al.,

2007; Gillepspie et al., 2001; Frauenschuh et al., 2007; De´ruaz et al., 2008;

Budachetri and Karim, 2015; Adamson et al., 2013, 2014) in order to facilitate the tick’s transmitted pathogens (Hovius et al., 2008a, 2008b; Das et al., 2001;

Juncadella et al., 2007; Cavassani et al., 2005; Kotsyfakis et al., 2006; Adamson et al., 2013; Crispell et al., 2016). An interesting work was published by

Narasimhan et al. in 2007, which revealed how a pathogen traverses from the infected mammalian host to the feeding ticks while facing the hostile environment at the tick-host interface created by tick and mammalian immune systems. They demonstrated that a salivary antioxidant protein, Salp25D, facilitates the acquisition of spirochete Borrelia burgdorferi from the infected mice to the tick

vector Ixodes scapularis (Narasimhan et al., 2007). When Salp25D is inactive within the SG, the acquisition of the pathogen to the tick decreased significantly.

Later, it was demonstrated that Salp25D protects the pathogen by neutralizing the ROS created by activated mice neutrophils and provides Borrelia burgdorferi a smooth acquisition to the infected mice (Andesron et al., 2007). Several studies have reported that proteins secreted from tick saliva and SGs can inhibit the host’s inflammatory responses by preventing cytokine secretion or blocking its activities (Hovius et al., 2008a, 2008 b; Juncadella et al., 2007; Kotsyfakis et al.,

2006; Leboulle et al., 2002; Bergman et al., 1998). A recent work on the SGs of the hard tick Hyalomma asiaticum has indicated that immunoregulatory peptides, hyalomin-A and -B suppress the host’s inflammatory response by inhibiting cytokine secretion and neutralizing ROS (Wu et al., 2010). One of the heme detoxification mechanisms found within the cattle tick, Rhipicephalus microplus, demonstrated heme sequestration into a non-crystalline form and then storage within a specific type of intracellular vesicle, different from the digestive vesicle called hemosome (Lara et al., 2003) (Fig. 1). Ticks have a particularly strong detoxification system which suppresses the effects of acaricides and the host’s immune system. In order to develop new control methods, it is necessary to understand ecology, behaviour and physiology of ticks. Due to their ability to develop pesticide resistance rapidly (Davey et al., 1998), the study of tick physiology related to their detoxification mechanism has been given a lot of attention (Hemingway, 2000; Kostaropoulos et al., 2001). These mechanisms are not only specific to the detoxification of toxins, but also help ticks maintain better

physiological homeostasis and neutralize the damage caused by oxidative stress or ROS (Freitas et al., 2007). Two antioxidant systems have been found within ticks: Enzymatic and non-enzymatic. A non-enzymatic system uses several kinds of antioxidizing scavenger molecules, such as GSH (Sies et al.,1999), α- tocopherol (vitamin E) and ascorbic acid (vitamin C) (Dandapat et al., 2003). The enzymatic system is represented by several well-known antioxidant enzymes, such as SOD (superoxide dismutase), CAT (catalase), GPx (Rikans &

Hornbrook, 1997), GST (Ketterer et al., 1983) and Selenoproteins (Adamson et al., 2013, 2014). Among them, GSTs are the antioxidants which detoxify xenobiotic and endogenous compounds (Agianian et al., 2003) by acting in conjugation with glutathione and other molecules (Freitas et al., 2007). Possibly, glutathione conjugates to pesticides by GST and then the resultant compound acts in detoxification (Beall et al., 1992; Wei et al., 2001). A work on Boophilus microplus indicated that GST probably plays role in the protection of egg and larvae against oxidative stress in conjunction with catalase and glutathione

(GSH) (Freitas et al., 2007).

A portion of the life cycle of all pathogens harbored by hematophagous arthropod vectors pass through their MG, implying their adaptation to high heme concentrations and oxidative stress generated within the MG due to heme digestion. In congruence, studies concerning flavivirus vector competence have also demonstrated that MG cells are the most important barriers towards successful infection of the arthropod vector (Black IV et al., 2002). Other studies have also supported this hypothesis. One of the studies revealed that a strain of

Anopheles gambiae does not get infected by the malarial parasite Plasmodium falciparum because of high oxidative stress, as evidenced by elevated H2O2 and superoxide ions within the hemolymph. An increase in the survival of

Plasmodium within a MG was demonstrated upon ingestion of antioxidants which block the melanotic encapsulation of ookinete, a mechanism that blocks parasite development (Kumar et al., 2003). The same research group has reported that ookinete invasion to the MG cells resulted in a high expression of Nitric oxide synthase (NOS) and peroxidase, which eventually induced apoptosis of the epithelial cells by promoting protein tyrosine nitration by using nitrite and H2O2, respectively (Kumar et al., 2004; Kumar & Barillas-Mury, 2005). The existence of an adequate balance between ROS production and detoxification is of paramount importance to the survival of the pathogen inside the vector MG. This hypothesis has also been supported by a study in Drosophila which revealed that the ingestion of a bacterial pathogen within a catalase-knocked-out fly, led to the death of the fly as a consequence of uncontrolled oxidative stress (Ha et al.,

2005). Therefore, the balance between ROS production and the detoxification mechanism in the MG plays a pivotal role in arthropod vector-pathogen interaction and vector competence.

Impact of Blood Digestion on Tick-Pathogen Transmission

Although tick pathogens are not directly exposed to the intracellularly located tick MG enzymes, their fates are indirectly linked to blood digestion. It is necessary for the pathogens to resist the high surge of ROS, generated by free heme during blood digestion, and antimicrobial activity of several antimicrobial

peptides such as hemocidins, a hemoglobin derivative and protease inhibitors

(Graca-Souza et al., 2006; Toh et al., 2010). Several mechanisms, such as absence of heme synthesis (Braz et al., 1999; Koreny et al., 2013), the formation of hemosome to aggregate heme (Lara et al., 2003, 2005) and a specific pathway for iron metabolism (Hajdusek et al., 2009) have evolved in ticks as a means of protection. In addition to this, ticks also maintain various antioxidant enzymes and ROS scavengers in their MGs, which mitigate oxidative stress and help in maintaining redox homeostasis (Anderson et al., 2008) required for their survival. A recent study in Anopheles gambiae has also demonstrated that a balance between ROS and antioxidants in its MG affects its capacity to transmit malaria pathogens (Kumar et al., 2010; Oliveira et al., 2012). In Chapter 3, antioxidant genes (selO, and selS ) were knocked down, and its impact on R. parkeri load and tick homeostasis were investigated. Further research is necessary in order to understand the interdependence between antioxidants and vector competence.

Redox-Dependent Responses during Host-Pathogen Interaction

Reactive oxygen species generation and signaling play important roles in unicellular and multicellular organisms including host-pathogen interaction.

Redox molecules can activate the different receptors, and multiple cell types as an innate immune response. Within this context, pathogenic microorganisms are able to activate multiple signaling pathways which induce several physiological processes in the host including ROS generation, antioxidants regulation, inflammation and apoptotic pathways.

Surge of Oxidative Stress when Rickettsia Interacts with Human Endothelial

Cells

Human endothelial cells (ECs) may be injured due to a rickettsial infection.

This results in a significant dilation of the intracellular membranes, particularly of the rough endoplasmic reticulum. This injury also costs the osmoregulatory control of the cell and after 5-6 days of infection, cell lysis occurs (Silverman,

1984). Rickettsia-infected cells exhibit noticeable changes in the structural organization of the endoplasmic reticulum-nuclear envelope complex and cytoskeleton, indicating the probable induction of oxidative stress during infection. Subsequent biochemical assays also confirm the presence of accumulated ROS within the infected tissues, as well as altered transcriptional gene expression of the antioxidant enzymes (Eremeeva et al., 2000; Rydkina et al., 2002). Although, typhus group Rickettsia-infected cells did not demonstrate any significant change in structural morphology prior to cell death (Sahni &

Rydkina, 2009). The adaptive alteration studies and an in vitro study indicate the beneficial effects of antioxidant molecule α-lipoic acid in R. rickettsia-infected

ECs (Eremeeva et al., 2000; Eremeeva & Silverman, 1998a,1998b). In an in vivo study, where a mouse model of Rocky Mountain spotted fever (RMSF) was used, important cellular antioxidants such as superoxide dismutase, glutathione reductase, GPx and glucose-6-phosphate dehydrogenase, demonstrated differential and selective modulation in correspondence with Rickettsial titers from host tissues. It was discovered that a α-lipoic acid treatment rescues infection-induced oxidative injuries (Rydkina et al., 2004). Other relevant

responses of Rickettsia-induced oxidative stress include higher expression of an isoform of heme oxygenase (HO) and ferritin. Ferritin is a multimeric protein which stores free intracellular iron and is an important antioxidant and anti- apoptotic agent (Rydkina et al., 2002; Rydkina et al., 2005), while HO cleaves heme which results in the release of ferrous ion, and generation of biliverdin and carbon monoxide (CO). Biliverdin later gets converted into bilirubin. Ferritin traps ferrous ion in order to avoid Fenton’s reaction, which generates an extremely toxic ROS, hydroxyl radical. Thus, HO and ferritin complement one another within Rickettsia-infected cells and effectively mitigate oxidative stress.

Endothelial cells contain two HO genes, and studies have suggested their importance, since the products of HO activity not only contribute as antioxidants

(as previously mentioned), but also aid in decreasing inflammation, vascular constriction and protecting cells from cell death (apoptosis). Heme oxygenase also regulates vascular cyclooxygenase (COX), which in turn influences the generation of prostaglandins, causing higher vascular permeability and edema – a feature of severe inflammation during Rickettsial infections. Thus, the above- mentioned molecules are the potential agents which mitigate the oxidative surge due to a Rickettsia infection. Hypothetically, these molecules might be novel targets in controlling Rickettsial diseases (Sahni & Rydkina, 2009).

Tick–Host–Pathogen Interactions

It is widely accepted that tick saliva factors suppress host hemostatic, immune and inflammatory responses so that they can complete blood feeding successfully which prolongs for longer periods of time, and in order to achieve

successful infection, multiplication and transmission, pathogens also manipulate several biological processes within ticks and hosts (Da la Fuente et al., 2016).

Studies have indicated that intracellular pathogenic bacteria suppress host responses through different molecular mechanisms, including manipulation of the cytoskeleton and immune system, apoptosis inhibition and regulation of host epigenetics at the cellular level so as to facilitate infection, reproduction

(multiplication) and transmission (Fuente et al., 2016a). A recent study has exhibited how manipulation of a tick gut’s microbiome affects tick feeding, development and tick immune response (Budachetri and Karim, 2015;

Narasimhan et al., 2015). Within this study, it has been demonstrated that microbiota and the tick-pathogen, Anaplasma phagocytophilum, induced ROS for controlling bacterial infection and activating tick immune response, as well as for regenerating epithelial cells which repair and protect the ticks. However, ROS- mediated gut epithelial cell damage induces JAK/STAT [Janus kinase (JAK) and two Signal Transducer and Activator of Transcription (STAT)] pathways, which result in inhibition of apoptosis, and facilitates the bacterial infection to a tick’s SGs (Ayllón et al., 2015, Narasimhan & Fikrig, 2015). During infection, tick pathogens activate several mechanisms which favor tick survival, infection and pathogen transmission (Busby et al., 2012; Neelakanta et al. 2010). Among these mechanisms, induction of antifreeze glycoprotein (AFGP) and heat shock proteins (HSP) are important. Antifreeze glycoproteins protect ticks under cold conditions (Neelakanta et al., 2010), and HSPs protect ticks in stressful conditions and prevent desiccation at high temperatures (Busby et al., 2012).

HSPs also contribute by increasing a tick’s questing speed so that they may find a host for blood feeding (Busby et al., 2012). Pathogen infection generally occurs during tick blood feeding, therefore ticks have a protective mechanism for inhibiting the pathogens and increasing the chances of their own survival (Busby et al., 2012; Villar et al., 2015; Ayllón et al., 2015). Pathogen A. phagocytophilum destabilizes a tick’s defense against pathogens by interfering with their RNA interference machinery (for inhibiting the pathogens), but does not reduce the expression levels of tudor staphylococcal nuclease (required for tick survival) because its protein form is necessary for ticks during blood feeding (Ayllón et al.,

2015). Similarly, the subolesin protein, a component of a tick’s innate immune system which inhibits pathogen infection (Fuente & Contreras, 2015) is not manipulated during A. phagocytophilum infection because of its other roles necessary for tick survival such as blood feeding, reproduction and in fighting infection (Fuente & Contreras, 2015). To counteract a tick’s response to infection,

A. phagocytophilum generates endoplasmic reticulum (ER) stress by misfolding proteins, but tick cells mitigate ER stress through an endoplasmic reticulum- associated degradation (ERAD) pathway and thus, avoid cell apoptosis (Villar et al., 2015). This process facilitates pathogen infection (Villar et al., 2015). A tick’s ability to inhibit Rickettsial infection by inhibiting phosphoenolpyruvate carboxykinase (PEPCK) is exploited by A. phagocytophilum. Inhibition of the

PEPCK results in a decreased glucose metabolism, and as a result, availability of metabolites increases for tick microbiome resulting in the inhibition of cell apoptosis, which in turn supports infection of tick cells (Villar et al., 2015).

Ticks suppress host immunity by impairing the activity of natural killer cells, basophils, T-lymphocytes, neutrophils and eosinophils (Chmelař et al.,

2016; Wikel et al., 2013). The host responds to tick infestation by activating several mechanisms, such as blood coagulation and platelet aggregation, which might affect blood feeding. Pathogens also respond to hosts in such a way that several signaling pathways get activated in order to facilitate infection, multiplication and transmission (De la Fuente et al., 2016). The proteins present in tick saliva modulate host immunity and inflammatory responses so that ticks can feed on the host and successfully transmit the pathogen (De la Fuente et al.,

2016). Studies have indicated that molecular mechanisms by which pathogen A. phagocytophilum suppresses host responses and facilitates infection, multiplication and transmission are common for tick and vertebrate hosts, suggesting an evolutionary adaptation of both the vector and the hosts (De la

Fuente et al., 2016). Neutrophils infected with A. phagocytophilum have demonstrated upregulation in inflammatory, interleukins and chemokines genes as a protective mechanism from the host. However, they simultaneously trigger the recruitment of neutrophils and granulocytic phagocytosis, which play a role in pathogen dissemination (Borjesson et al., 2005; Severo et al., 2015).

Thus, it becomes necessary to question whether or not there are any benefits for the host when it gets i) infested by ticks, and ii) infected by pathogens. In cases of tick infestation, one of the hypotheses is that hosts benefit via manipulation of their immune system by ticks (Wikel et al., 2013; Cabezas-

Cruz et al., 2015; Soares and Yilmaz, 2016; Yilmaz et al., 2014). For example, as

a result of tick infestation, alpha-gal antibody response increases significantly in humans. Although this alpha-gal antibody response causes anaphylactic responses to red meat, it also protects hosts from pathogen infection since the presence of modified alpha-gal proteins on the surface is a common feature for a majority of tick-borne pathogens. Increased α-gal antibody response also inhibits pathogen multiplication within the host (Cabezas-Cruz et al., 2015; Soares &

Yilmaz, 2016; Yilmaz et al., 2014). While it may be difficult to believe that pathogen infection may benefit a host, it has been suggested that mechanisms have evolved which benefit the host after a pathogen infection. Pathogen infections may decrease the host’s susceptibility to much lethal pathogens

(Vayssier-Taussat et al., 2015). Pathogen-induced epigenetic modification in hosts may cause pathogen persistence and survival, and may also strengthen a host’s defense against pathogens (Bierne et al., 2012; Adamson et al., 2013).

For example, an infection of A. phagocytophilum results in the induction of IL-10 which controls histopathologic lesions induced by gamma interferon produced by the host (Dumler, 2012; Brown, 2012).

Studies have indicated that the molecular interactions among ticks, hosts and pathogens have evolved with both mutual cooperation and conflicts.

Previous studies have discussed the coevolutionary mechanisms by which pathogens manipulate the defense system of the ticks in order to facilitate infection, multiplication and transmission, while continuing the bloodmeal and keeping the vectorial competence machinery necessary for tick and pathogen survival intact (De la Fuente et al., 2016). Conflicts among tick, host, and

pathogen interactions have been described explicitly, but descriptions concerning their mutual co-operations and beneficial effects are rare. Thus, it is necessary to characterize the mutual benefits of their molecular interactions. As tick–borne pathogens have broader impacts upon the health of humans and livestock, an understanding of the mutual interactions between vertebrate hosts, tick vectors, and transmitted pathogens would provide necessary information for the treatment of tick–borne diseases, and aid in eliminating tick–borne pathogens.

Gulf Coast Ticks

Amblyomma maculatum, also known as the Gulf Coast tick, is primarily found in coastal areas of the southeastern states of the USA, as well as Central and South American countries such as Guatemala, Costa Rica, Venezuela,

Mexico, Colombia, Nicaragua, Honduras, etc. Amblyomma maculatum is a three- host tick, which can feed on various rodents, birds and mammals. It can be seen within literature that the first description of Amblyomma maculatum was written in

1844. Over the last century, research concerning Amblyomma maculatum has received considerable attention after the recognition of its detrimental economic impact on livestock within the USA. Despite the discovery of novel tick-borne pathogens during the 1970s to the 1990s, the medical and veterinary significance of Gulf Coast ticks were only noticed when it was identified as a vector of pathogen Hepatozoon americanum what was causing American canine hepatozoonosis (Mathew et al., 1998). Again in 2002, identification of Rickettsia parkeri as a human pathogen (Paddock et al., 2004) initiated its pathogenic studies, since the Gulf Coast tick is a vector for Rickettsia parkeri.

Life Cycle of Gulf Coast Ticks

The life cycle of the Gulf Coast tick consists of the egg stage and three active life stages - larvae, nymphs, and adults. Gulf Coast ticks are known as three-host ticks because they require a different host for feeding within each stage of their life cycle. Generally, larvae and nymphs feed on smaller animals, while adults feed on larger animals (Teel et al., 2010). These ticks infest a host by inserting their hypostome into the host’s skin, preferentially the ears (Hooker et al., 1912). After eight days of infestation on a host, male Gulf Coast ticks complete spermatogenesis, and release a pheromone so as to alert females located on the same host for potential mating (Rechav et al., 2000). At this point, females attach to the host in aggregation near males for mating. Blood feeding and mating take place in succession. After the completion of blood feeding and mating, females detach and lay their eggs under appropriate conditions. After they detach, egg laying lasts approximately 26 days (Drummond & Whetstone,

1970). After egg laying, it takes almost three weeks within appropriate incubation conditions (27°C at 70-98% humidity) for larvae to hatch. The larvae then search for a host, and this behavior is known as questing. Gulf Coast ticks, being xerophilic, can quest for a suitable host for an extended period of time even under high-temperature conditions (Yoder et al., 2008). After finding a suitable host, they feed on them until they replete. Repleted larvae detach and remain hidden within a suitable environment until they molt into the next life stage, nymph. The same process is then repeated and they molt into an adult male or

female. These ticks have veterinary and medical importance because of their ability to transmit several pathogens to human and their domesticated animals.

Medical and Veterinary Significance of Gulf Coast Ticks

Gulf Coast ticks are historically important because of the substantial impact they have on livestock infestations. A tick bite can cause severe inflammation, lethargy, temporary paralysis and altered body composition (Teel et al. 2010). Gulf Coast tick infestation on cattle cause their ears to be gotched, resulting in a significant reduction of their market value at the sale (Hertz et al.,

2014). The impact of these ticks is even more profound because of their ability to transmit various pathogens to humans and their domesticated animals. Before

2002, RMSF was the only known tick-borne spotted fever caused by Rickettsia rickettsii. Yet in 2002, another rickettsial species, Rickettsia parkeri, which was identified 60 years earlier and primarily transmitted by Gulf Coast ticks, was recognized as a human pathogen causing rickettsiosis (Paddock et al., 2004).

Several cases of rickettsiosis were detected within the southeastern states of the

USA, such as Mississippi, Virginia and others (Walker et al., 2008; Cragun et al.,

2010; Parola et al., 2013). A number of reports have indicated that infection rates increased up to 55% within a number of states, which is a serious public health concern (Nadolny et al., 2014; Paddock & Goddard, 2015). Another pathogen carried by the Gulf Coast ticks is Hepatozoon americanum, a protozoan patho¬gen causing American canine hepatozoonosis in the southeastern states of the USA (Ew¬ing & Panciera, 2003). In a majority of cases, this pathogen was not transmitted to canines directly via a tick bite, but through the consumption of

infected ticks (Hertz et al., 2014). Another pathogen transmitted by the Gulf

Coast ticks is, Leptospira pomona, which causes Leptospira pomona in livestock.

Gulf Coast ticks are also the potential vectors of Ehrlichia ruminantium, which causes the fatal disease Heartwater (Mahan et al., 2000) in ruminants.

Heartwater is prevalent in sub-Saharan Africa and Carribean islands. Although no case of Heartwater has been detected within the USA, principal vectors

(Amblyomma variegatum and Amblyomma hebraeum) of the disease have been reported in Florida on imported wildlife. These principal vectors can easily introduce pathogens to uninfected hosts. Once introduced to the hosts

(ruminants), they can be maintained in the disease cycle by Gulf Coast ticks.

During blood feeding, ticks release toxins which cause temporary malfunctioning of a host’s motor neurons and can lead to paralysis and respiratory failure

(Espinoza-Gomez et al., 2011). After tick detachment, hosts recover completely within 24 hours. In this study, the Gulf Coast ticks’ oxidative stress machinery has been investigated in order to understand the impact of antioxidant molecules on tick homeostasis by designing in vitro and in vivo experiments (Chapter 2).

This study would aid in finding potential antioxidant molecules, which can be targeted in order to control the Gulf Coat ticks.

Effects of Spotted Fever Group Rickettsiae on Ticks

Hard ticks are known as the primary vectors of the spotted fever group

Rickettsiae (SFGR). Recent studies have indicated that soft ticks also harbor

SFGR, however, information regarding their pathogenicity is yet unclear (Milhano et al., 2014). Ticks might have one, two or three hosts during their life cycle. One-

host ticks feed on one host, and as such, different stages of a tick life cycle may be found on the infested host simultaneously. In one-host ticks, nymphs and adults remain attached to the host for so long that they can transmit Rickettsiae if infected (Troughton & Levin, 2007). Larvae and nymphs become infected if they are feeding on an infected host. They also become infected frequently and efficiently through co-feeding transmission of other tick species which are infected and feeding on the same host (Nonaka et al., 2010; Randolph, 2011). It appears to be essential to aggregate the ticks on the same host for feeding so that environmentally sustainable levels of Rickettsial infection can be maintained in ticks (Harrison & Bennett, 2012). However, in reality, this is one of the basic mechanisms of maintaining Rickettsia in nature. Humans and other animals can also get infected accidentally by Rickettsia-infected ticks, and become

Rickettsiemic and in turn, infect feeding ticks. However, this way of maintaining rickettsia in nature is not effective compared to transovarial, transtadial and co- feeding mechanisms (Eremeeva & Dasch, 2015). For a majority of the SFGR, transovarial and transstadial transmissions are more reliable mechanisms for maintaining their level within the environment because it is independent of tick density. Even a single infected tick can cause significant expansion of Rickettsiae through its progenies via the above-mentioned transmissions. Although the genomes of several pathogens have been sequenced, host-pathogen tolerance and mutualism are still not well understood. Host-pathogen interaction varies significantly because Rickettsial species have varied pathogenic potential towards animals and humans, possibly because these Rickettsial species are

harbored by several tick species and hosts, and these tick species respond variably to them (Eremeeva & Dasch, 2015).

Interaction diversity depends on upon the effects of the different pathogens on the ticks themselves. Two exceedingly different scenarios are known in the case of tick-pathogen interaction, and their occurrence might be parallel or synergistic depending specifically upon the type of pathogen and the tick’s host. The first scenario is one of transovarial transmission, which provides a maintenance mechanism for Rickettsia in a particular species of ticks. This type of maintenance is understood for Rickettsia which cannot be cultivated outside the ticks (except within continuous tick cell lines) and is known as “obligate endosymbionts” (Simser et al., 2001). One hundred percent infection of rickettsia is easily achievable through this method for certain tick species, such as Ixodes scapularis and Ixodes pacificus, yet they are not transmissible to other hosts.

Within the second scenario, Rickettsia has varying effects upon ticks’ hosts and infects uninfected ticks from either an infected vertebrate host or through co- feeding from infected ticks. For example, it was found that the transmission of R. rickettsii by D. andersoni to its progeny (transovarial transmission) varies from 35 to 100% depending upon whether female ticks are mildly or severely infected

(Price, 1954; Burgdorfer and Brinton, 1975; Eremeeva & Dasch, 2015). However, in the case of tick Amblyomma americanum being infected with R. amblyommii, transovarial transmission is approximately 100% (Stromdahl et al., 2008). These mechanisms play an important role in the natural maintenance of pathogens.

There are several factors associated with experimental conditions which affect

the transovarial transmission of a pathogen (Telford, 2009). Although, how these experimental conditions affect the natural maintenance of R. rickettsii is not clear.

Rickettsia Parkeri

Rickettsia parkeri is one of the obligate intracellular bacteria harbored by invertebrate vectors, and when transmitted to humans and other animals can cause SFGR. This was first discovered in the Gulf Coast tick, Amblyomma maculatum, by Koch in 1937 (Parker et al., 1939). Its pathogenicity to humans was discovered in 2002 when it was isolated from a man in Virginia (Paddock et al., 2004). Since this incident, several cases of R. parkeri infection have been found within the USA (Paddock & Goddard, 2015). It is difficult to differentiate between the infections caused by R. parkeri and other SFGR due to the cross- reactivity of serological tests resulting in misreports of the pathogen. The primary vector R. parkeri is found within Amblyomma macultaum, but other ticks such as

Dermacentor variabilis and Amblyomma americanum (L.) have also been reported to harbor R. parkeri within the USA (Cohen et al., 2009; Henning et al.,

2014). In the USA, the prevalence of R. parkeri in Amblyomma maculatum (also known as Gulf Coast ticks) varies widely between 5% and 56% (Nadolny et al.,

2014). Previous studies have described the occurrence of these ticks in the southeastern states of the USA, but recent studies have revealed their expansion into northern states as well (Paddock & Goddard, 2015). Interestingly, the northern population of Amblyomma maculatum ticks maintains a higher prevalence of R. parkeri (41–55%) than those of southern population (5–33%).

Reasons for this variation are still unclear. It is an established fact that R. parkeri

is an SFGR primarily transmitted by A. maculatum, yet information is lacking with regard to its enzootic cycle, how it interacts with its host tick and how it is maintained within the tick. The process of pathogen transmission is a complex process and not well understood. Pathogen transmission might be either vertical

(parents to offspring) or horizontal (to and from a vertebrate host)

Impact of Selenoproteins selS and selO on R. Parkeri-Tick Interaction

The host-pathogen interaction between a tick and an SFGR has been moderately studied, as previously discussed, yet the interaction between Gulf

Coast ticks and R. parkeri has almost not been studied at all. While information concerning the impact of antioxidants on vector-pathogen interaction is limited, a number of studies have suggested the role of antioxidants as redox-switches in pathogen entry (Crispell et al., 2016; Adamson et al., 2013; Stolf et al., 2011;

Walczak et al., 2012). An innate immune system also induces apoptosis in order to prevent pathogen infection (Yuan, 2006). Upon infection, ER stress is generated by an innate immune response resulting in an unfolded protein response, or ERAD if normal ER function could not be restored. Endoplasmic reticulum stress mitigation is required for the successful dissemination of R. parkeri, and R. parkeri mitigates ER stress by manipulating the expression of selenogenes selS and selM (Adamson et al., 2013). These selenoproteins (selS and selM) are ER resident proteins, and the literature has discussed their role in

ER stress mitigation. A recent study has also indicated the role of the antioxidant

SOD in R. parkeri colonization within ticks (Crispell et al., 2016). All of these studies strongly indicate the impact of antioxidants on tick-pathogen interaction.

Studies have also indicated the interrelationship between oxidative stress and

ER stress and suggested a physical interaction between ER and mitochondria.

Previous studies of mammalian systems have reported that SelS is an ER membrane protein which plays role in mitigating ER stress by removing misfolded proteins (Valentina et al., 2010). Recently, Selenoprotein O (SelO) has been characterized in humans and is found to be localized within mitochondria

(Hans et al., 2014). However, its functional role is, as of yet, unknown. Studies have also indicated its kinase activity. Apart from the functional characterization of SelO and SelS, the main purpose of this study is to understand how these antioxidant molecules contribute to the survival of R. parkeri (an aspect of vector competence) within Gulf Coast ticks. Recent studies involving the ticks’ selenocysteine elongation factor (eEFSec) demonstrate the involvement of selenoproteins in gene regulation as well as a putative role in a tick’s vectorial competence (Adamson et al., 2013). Evidence of a well-organized tick antioxidant system (TAS) lends support to the idea that tick-borne pathogens manipulate the system so that it is beneficial to their survival and multiplication within the tick before transmission into the mammalian host. The generation of

ROS is among the first lines of defense against invading microbes. While the role of ROS and antioxidants in a tick’s vectorial competence has not yet been elucidated, these ticks are vectors of several pathogens and transmit several diseases by transmitting the pathogens to humans and their domesticated animals. The present study aims to provide potential insight into R. parkeri- caused diseases by developing an understanding between redox switches and

vector-pathogen interactions. The available literature has provided evidence which suggests the involvement of redox signals or modification of redox switches within vector-pathogen interactions including pathogen infection. As previously mentioned, studies have revealed a physical and biochemical interaction between ER and mitochondria and that high mitochondrial ROS can induce ER stress. The available literature has also indicated that pathogen infection may result in elevated ER stress. In cases of high ER stress, an unfolded protein response (UPR) is activated, and if the function of ER cannot be restored, ERAD mediated protein degradation begins. SelS has been characterized as an ER membrane protein which is involved in the removal of misfolded proteins. Within the context of host-pathogen interaction, previous work from our lab has revealed that SelS is upregulated within R. parkeri infected tick’s MGs (Adamson et al., 2013). It is possible that SelS contributes to the successful dissemination of R. parkeri by mitigating ER stress (by removing the misfolded proteins from the ER membrane). Therefore, it could be hypothesized that SelS is required for the successful dissemination of R. parkeri within ticks. In another part of the work, Selenoprotein O would be characterized in ticks. Since

Selenoprotein O is localized in mitochondria (where 70% of the ROS are generated) and predicted to have kinase activity, and similar to all other selenoproteins, it has an oxidoreductase property. Based on these facts, it can be hypothesized that SelO mitigates the oxidative stress by exploiting its kinase activity. In summary, as an extension of the previous study (Chapter 2), the

characterization of tick SelO and SelS and their impacts on tick-R. parkeri interaction is investigated in this chapter.

Statement of Problem, Experimental Approach and Hypothesis

As we know, ticks are not the model organism. The purpose of tick research is to control the ticks by finding novel targets. Being an obligate hematophagous arthropod, it is assumed that tick has a robust antioxidant system which is required for survival. Blocking potential antioxidant molecules in

Gulf Coast ticks might be a novel approach to control the ticks. It is then necessary to question what is the approach to target tick antioxidant system

(TAS) in order to control the ticks.

Hypothesis1

Being an obligate hematophagous arthropod, induction of a sub-lethal level of oxidative stress in ticks would activate its antioxidants to their optimum level.

Experimental Approach

To Induce Optimum (sub-lethal) Oxidative Stress within the Gulf Coast

Ticks. Hydrogen peroxide (H2O2) and paraquat (PQ) are environmental oxidative stressors which could be used to induce lethal oxidative stress in ticks. By using different increasing concentrations of hydrogen peroxide and paraquat, and injecting them into the ticks hemocoel, lethal concentrations of these oxidative stressors could be determined. Previous studies have covered this aspect in other organisms including Drosophila (Hosamani & Muralidhara, 2013) and humans (Touat-Hamici et al., 2014) by inducing oxidative stress which provided

useful insight into their antioxidant machinery. Phosphate-buffered saline (PBS) injection in the ticks would be the control for H2O2 injected ticks, and a 5% sucrose injection would be the control for PQ injected ticks.

Acquire a Gene Expression Profile of Tick Antioxidant Genes for Sub-

Lethal Oxidative Stress. After injecting the sub-lethal concentrations of Hydrogen peroxide and paraquat into a separate group of ticks, they would be left to acclimatize to the room temperature (RT) for 24 hours. After that, the tick SG,

MG and ovary (OV) would be dissected. After dissection of these tick tissues,

RNA would be isolated, cDNA would be synthesized and RT-PCR would be run with all the appropriately designed antioxidant primers in order to acquire the expression profile of tick antioxidant genes. β-Actin would be used as a housekeeping gene for normalization.

Select 5-10 Tick Antioxidant Genes, which Demonstrate the Highest

Upregulation at a Sub-Lethal Level of Oxidative Stress. After obtaining a gene expression profile for the tick antioxidant genes under optimum induced oxidative stress, 5-10 antioxidant genes, which demonstrate highest upregulation would be chosen for further characterization of the ticks.

Characterize those Selected Genes by Using the Strategy of Reverse

Genetics (Knocking Down Gene by using an RNA Interference and Studying the

Change in Phenotype). After choosing the highly upregulated antioxidant genes, the role of these genes in tick physiology would be characterized by using RNAi methodology.

How does R. Parkeri Colonize and Survive Inside the Gulf-Coast Ticks Under the

High Oxidative Stress (Blood Feeding Conditions)?

The purpose of this study is to understand how a pathogen survives under high oxidative stress inside the tick, which could help in planning strategy to control pathogen-infection. In our lab, preliminary work has indicated that during blood feeding, there is a reduction in the population of other endosymbionts, except R. parkeri. Overall bacterial population decreases during blood feeding, but the R. parkeri population increases. Therefore, it is necessary to understand the interaction between a tick and R. parkeri and how it manages to survive under high oxidative stress (blood feeding conditions), which would help in designing a strategy with which both ticks and R. parkeri could be controlled. A study from our lab has revealed that a knock down of the Selenocysteine-

Specific Elongation Factor (SEF), an essential factor in selenoprotein biosynthesis, alters the pathogen burden of Rickettsia parkeri in Gulf Coast ticks

(Adamson et al., 2013). As a result of SEF knockdown, no antioxidant activity was detected in the tick saliva. In R. parkeri-infected Amblyomma maculatum ticks, the transcriptional expression of catalase decreased after 3 days of feeding

(possibly to colonize R. parkeri), but then increased after 5 days of feeding

(possibly to avoid killing from high oxidative stress). The transcriptional gene expression was reduced for selM, but increased for selO, selS, and selT within the MG (Adamson et al., 2013). Again, the transcriptional expression of selO and selS in R. parkeri infected tick tissues were significantly upregulated (fig. 3.4 A).

It is possible that R. parkeri modulates the transcriptional gene expression of

catalase, selM, selO and selS for self as well as tick survival from oxidative stress. Research is currently being undertaken within our lab with regard to all of the above-mentioned genes. However, this study primarily concentrates on selO and selS, in chapter 3. Based on the above facts, a hypothesis may be formulated as follows:

Hypothesis.

SelO and selS play a substantial role in the colonization of R. parkeri in the ticks and (This can be tested by knocking down selO and selS in R. parkeri- infected ticks and analyzing the level of R. parkeri.)

CHAPTER II - ASSESSMENT OF TICK ANTIOXIDANT RESPONSES TO

EXOGENOUS OXIDATIVE STRESSORS AND INSIGHT INTO THE ROLE

OF CATALASE IN THE REPRODUCTIVE FITNESS OF THE

GULF COAST TICK, AMBLYOMMA MACULATUM

Abstract

As blood-sucking ectoparasites, in order to avoid tissue damage, ticks must neutralize the ROS generated from the uptake and digestion of a bloodmeal. Consequently, ticks utilize a battery of antioxidant molecules, including catalase (CAT), an enzyme that converts hydrogen peroxide (H2O2) into water and oxygen. Here, we investigate the tick antioxidant machinery by exogenous injection of sublethal doses of H2O2 or paraquat. The relative transcript levels of selected Amblyomma maculatum antioxidant targets in tissues were determined by the quantitative reverse transcriptase, PCR, following treatment. The results displayed 2–16 fold increases within the target antioxidant gene transcripts, signifying the ability of A. maculatum to regulate its antioxidant machinery when exposed to increased ROS levels. Next, RNA interference was used to determine the functional role of CAT in hematophagy, redox homeostasis, and reproductive fitness. CAT gene silencing was confirmed by transcript depletion within tick tissues; However, CAT knockdown alone did not interfere with tick hematophagy or phenotype, as confirmed by the resulting differential expression of antioxidant genes, thereby indicating an alternative mechanism for ROS control. Interestingly, double-stranded RNA of the CAT gene

(dsCAT) and the CAT inhibitor, 3- aminotriazole, together rates, reduced tick reproductive fitness via a marked reduction in egg mass and larval eclosion highlighting the role of CAT within tick redox homeostasis, and thus, making it a potential target for tick control.

Introduction

The Gulf Coast tick (Amblyomma maculatum) is an arthropod that has emerged as an increasingly significant public health risk within recent years

(Paddock & Goddard, 2015). Its range includes the American states surrounding the Gulf of Mexico as well as in the Eastern Atlantic region, where it is a confirmed vector of the Rickettsial pathogen Rickettsia parkeri, which causes a disease similar to RMSF (Paddock et al., 2004). The ability of A. maculatum to offset starvation stress and blood feeding-related stress makes it likely that it possesses a proactive antioxidant system. Complete studies concerning the tick interactive antioxidant network are currently lacking, but the available literature implicates the extensive arsenal of antioxidant and redox-associated selenoproteins in the ability of the tick to tolerate extreme alterations in redox homeostasis associated with long periods of starvation, as well as the acquisition and digestion of blood and bloodmeal-related products (Adamson et al., 2013,

2014; Budachetri & Karim, 2015).

Higher eukaryotes possess an intricate enzymatic antioxidant system consisting of catalase (CAT), SOD, glutathione peroxidase, peroxiredoxins and selenoproteins. These proteins play critical roles in detoxifying elevated levels of

ROS, thereby maintaining redox equilibrium. Reactive oxygen species play a significant role in the overall sustainability of an organism since low levels are integral to signaling pathways involved in cell proliferation and survival

(Holmstom & Finkel, 2014). However, when ROS levels become excessive and imbalanced relative to an organism’s antioxidant response, it can lead to chronic damage of major cellular biomolecules, and extended exposure to a pro-oxidant environment interrupts cellular homeostasis. This critical shift in the cellular redox equilibrium towards a more oxidized environment is defined as ‘oxidative stress’

(Lismont et al., 2015). If an organism is not capable of adapting to environmentally induced oxidative stress through the proper detoxification of

ROS, high levels of oxidative stress can result in and initiate cell death, with eventual impairment to the overall fitness of the organism (Jones & Go, 2010;

Lismont et al., 2015). CAT is a ubiquitous enzyme found in Archaea, prokaryotes and eukaryotes (Kashiwagi et al., 1997; Kawasaki & Aguirre, 2001; Manduzio et al., 2004). Within eukaryotic cells, CAT is localized in the peroxisome where it catalyzes the conversion of reactive hydrogen peroxide (H2O2) to water and molecular oxygen; its expression is tissue-specific and highly variable (Zamocky et al., 2008). Production of H2O2 is critical for normal cellular signaling, but its presence can become disruptive in excessive amounts. Excessive H2O2 can damage cells and their surrounding tissues. As such, proper clearance of it is imperative. CAT has been identified as a contributing factor to the enhancement

of longevity in both flies and mice (Orr & Sohal, 1994; Melov et al., 2000;

Sampayo et al., 2003; Schriner et al., 2005).

Tick blood feeding, which generates toxic levels of ROS, can damage lipids, proteins and DNA, and as a result, promote mutation, cellular dysfunction and cell death. In order to successfully feed and survive, ticks must prevent the detrimental effects of ROS and utilize any beneficial effects that ROS may have.

Hence, there must be precise regulatory strategies for maintaining proper ROS levels within the tick and possibly at the tick–host interface. Several studies have indicated the importance of native microbiota in regulating several aspects of host physiology, including host immunity, obesity and glucose homeostasis

(Kimura et al., 2013). Blood-related oxidative stress has a negative impact on the overall bacterial load within tick tissues (Budachetri & Karim, 2015). This study provides strong evidence that ticks have a well orchestrated, robust antioxidant machinery which can alleviate the ROS generated in response to endogenous or exogenous stressors. We report that antioxidant levels in ticks increase following exposure to H2O2 and paraquat (PQ). Our data contributes further evidence in support of our hypothesis that an induction of elevated ROS into tick tissues triggers a differential regulation of antioxidant machinery within these arthropods in order to alleviate stress.

Materials and Methods

Ticks

Unfed adult female Gulf Coast ticks (Am. maculatum) were obtained from the tick rearing facility within Oklahoma State University’s National Tick Research and Education Resource. Ticks were maintained according to the methods described previously (Patrick & Hair, 1975). The ticks were maintained in the laboratory in an incubator at 24–26°C and 90% relative humidity (RH) under a 14 hrs light and 10 hrs dark daily cycle, as previously described (Karim et al., 2002).

Ticks blood fed on sheep were handled using Protocol #10042001 approved by the Institutional Animal Care and Use Committee of the University of Southern

Mississippi. All animal experiments were performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the

National Institutes of Health (USA) and with the effort made to minimize animal suffering.

Exogenous Induction of Oxidative Stress

For both H2O2 and PQ experiments, 60 unfed adult females of Am. maculatum were divided into four groups, each containing 15 ticks. Three previously determined sublethal doses of 3, 5 or 7% H2O2, or 1, 10 or 20 mM PQ, plus their respective controls of PBS or 5% sucrose, were administered to each of the four experimental groups. A Hamilton syringe was used to inject 1 µl of each of the concentrations into the tick hemocoel through the posterior dorsal cuticle. Each group of ticks was placed at RT for 24 hrs following their injections

and then dissected in order to obtain their SGs. For each experimental and control group, the SGs were pooled and stored for RNA extraction and protein assays (see tick tissue dissection section below).

Endogenous Induction of Oxidative Stress through CAT RNA Interference and

Inhibition

The dsRNA specific to A. maculatum CAT transcripts (AmCAT) was generated using CAT-specific primers (Table 1) in order to amplify the CAT gene from cDNA previously obtained from partially blood-fed SGs. The thermocycler settings were 94°C for 2 min, 30 cycles at 94°C for 15 s, 55°C for 30 s, 72°C for

50 s and 72°C for 8 min followed by a 10°C hold. The PCR product, purified using a QIAquick PCR purification kit (Qiagen, Valencia, CA, USA), was used in a secondary PCR reaction using the same primers with the same CAT specific sequence (Table 1) but with the addition of flanking T7 sequences that allow for the binding of reverse transcriptase and the production of dsRNA. The thermocycler settings for the secondary PCR reaction were 94°C for 90 s, 30 cycles at 94°C for 15 s, 61°C for 30 s, 72°C for 60 s and 72°C for 8 min followed by a 10°C hold. The secondary PCR product was purified using a QIAquick PCR purification kit (Qiagen) and then sequenced (Eurofins MWG Operon, Louisville,

KY, USA) in order to ensure the proper addition of the T7 sequences. After confirming the T7-flanked CAT gene sequence, the secondary PCR product was reverse transcribed into RNA using a T7 Quick High Yield RNA synthesis kit

(New England Biolabs, Ipswich, MA, USA) by incubating the PCR product with

T7 polymerase overnight at 37°C. The resulting dsRNA was purified by ethanol precipitation and its concentration measured spectrophotometrically using a

Nanodrop (Thermo Fisher Scientific Wilmington, DE 19810 U.S.A.) set to the

DNA setting. The product was also visualized by gel electrophoresis using a 2% agarose gel. The CAT dsRNA (dsCAT) was diluted to a working concentration of

1 µg/µl. The same protocol was used to synthesize dsRNA-LacZ (dsLacZ) in order to be utilized as a control. Forty-five unfed adult female ticks were microinjected with 1 ml dsCATor dsLacZ using a 27-gauge needle and then kept overnight within an incubator at 37°C to alleviate needle trauma and promote survival. Surviving ticks were placed in designated and contained cotton cells on a sheep and allowed to blood feed in the presence of A. maculatum males. For a sample collection, 10 partially fed experimental and control ticks were removed on days 5 and 7 post-tick infestations, with the remaining ticks allowed to remain attached and blood feeding until repletion. The feeding success of the individual ticks was evaluated by recording the attachment duration, repletion weight and the ability to oviposition (Karim & Adamson, 2012). Partially fed ticks removed from the dsLacZ or dsCAT groups were dissected in order to obtain their MGs and SG tissues. For each time point, of the 10 ticks, five had their tissues pooled for RNA extraction, whereas the tissues from the other five were pooled for use in enzymatic assays. Twenty females that reached engorgement were divided into two groups with 10 ticks in each group. A cocktail of 1 µg/µl dsCAT and 20 mM 3-AT CAT inhibitor was injected into one group of ticks, whereas the other

group was injected with PBS as a control. Replete ticks were separated into individual vials and kept in an incubator (RT, 90% RH) for ovipositing.

Tick Tissue Dissection

The dissection of unfed and partially fed adult female tissues (Am.

Maculatum) was performed. The experimental assessments of exogenous oxidative stress via H2O2 or PQ injections required the dissection of unfed SGs following a 24 hrs incubation period post injection. The CAT-RNA interference experiment required the dissection of partially fed ticks removed from the sheep on day 5, post infestation. Tick MGs and SGs were dissected within 4 hrs of the removal of these insects from the sheep. For both the unfed and partially fed ticks, the dissections were performed in an ice-cold M-199 buffer (Sigma-Aldrich,

St Louis, MO, USA) and tracheal material within the individual tissues was rinsed away with the same ice-cold M-199 buffer, as described by Villarreal et al.

(2013). The dissected MGs an SGs were pooled based upon the experimental sample type described above and then stored in either an RNAlater (Ambion,

Austin, TX, USA) for later mRNA extraction or in a protein storage buffer (0.5 M piperazine-N, N0-bis-2-ethane sulphonic acid, 20 mM Ethylene glycol tetraacetic acid, protease inhibitor cocktail; Roche, Indianapolis, IN, USA; 40% glycerol, pH

6.8) followed by storage at 280°C. A bioinformatics analysis of the full-length

AmCAT coding sequence (GenBank accession no. JO843741.1) was obtained previously through the pyrosequencing of an Am. maculatum SG cDNA sequence (Karim et al., 2011). The AmCAT nucleotide sequence was

conceptually translated into its amino acid sequence and a ClustalX2 multiple sequence alignment was performed with the protein sequences from I. scapularis

(XM_002400585.1), C. elegans (X82175.1), D. melanogaster NM_080483.3), An.

Gambiae (DQ986315.1) and H. sapiens (NM_001752.3) obtained through

GenBank. The multiple sequence alignment was refined manually and graphically and presented using JALVIEW 2.8 (Larkin et al., 2007; Waterhouse et al., 2009). Phylogenetic relationships were inferred via MEGA6 using the neighbour-joining clustering method (Tamura et al., 2013) with the following protein sequences from eukaryotic organisms obtained from GenBank: chimpanzee (Pan troglodytes; JAA41878.1), human (H. sapiens; NP_001743.1),

Sumatran orangutan (Pongo abelli; NP_001124739.1), Rhesus macaque

(Macaca mullatta; AFI34641.1), cattle (Bos taurus; NP_001030463.1), brown rat

(Rattus norvegicus; NP_036652.1), chicken (Gallus gallus; NP_001026386.2), zebra finch (Taeniopygia guttata; XP_002189160.1), zebrafish (Danio rerio;

NP_570987.1), fruit fly (D. melanogaster; AAF49228.1), yellow fever mosquito

(A. aegypti; XP_001663600.1), malaria mosquito (A. gambiae; ABL09378.1), southern house mosquito (C. quinquefasciatus; EDS28616.1), Gulf Coast tick (A. maculatum; AEO35358.1), Lone Star tick (Am. americanum; JAG91014.1), black-legged tick (I. scapularis; EEC02741.1) and red flour beetle (Tr. castaneum; EEZ97738.1).

RNA Isolation, cDNA Synthesis and Transcriptional Expression via Quantitative

Reverse Transcriptase PCR (qRT-PCR)

Total RNA isolation, cDNA synthesis and qRT-PCR were performed as previously described (Browning et al., 2012; Villarreal et al., 2013; Budachetri &

Karim, 2015). Briefly, the total RNA was extracted from the tick SGs or MGs and stored in RNAlater using an Illustra RNAspin Mini RNA isolation kit (GE

Healthcare, Piscataway, NJ, USA) following the manufacturer’s instructions. The total RNA quantity was determined via a Nanodrop analysis. Total RNA (_1 mg) was reverse transcribed into cDNA using the Moloney murine leukemia virus reverse transcriptase (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. Target gene specific primers were designed in order to amplify the cDNA fragments from Am. Maculatum’s tissues. All primer sequences used are listed in Table 1. Target mRNA levels were determined using qRT-PCR with the CFX96 Real-Time system (Bio-Rad Inc., Hercules, CA,USA).

The cDNA (25 ng), 10 mM of gene-specific primers and 2XiTaq Universal

SYBR green supermix (Bio-Rad Inc.) were used in each qRT-PCR reaction mixture and the following thermocycler protocol was used for the reactions: 50°C for 3 min, 95°C for 10 min and the final entry is part of the 40 cycles at 95°C for

15 s, 60°C for 30 s and 72°C for 30 s. All of the samples were run in triplicate along with nontemplate controls (NTCs) for each set of primers. Actin was used as a reference gene (Browning et al., 2012) in order to calculate the relative expression of various antioxidant genes. Bio-Rad software was used for the data

analysis with the 2DDCt (delta-delta-Ct or ddCt algorithm, is a convenient method for analyzing the relative changes in gene expression) method (BIO-RAD

CFX MANAGER v. 3.1).

Quantification of Oxidative Stress

A Protein Carbonyl Content Assay Kit (Sigma-Aldrich) was used to quantify the relative oxidative stress levels of the tick SGs obtained for the exogenous H2O2 experiment and from the MGs and SGs obtained for the CAT-

RNA interference experiment. The total protein content of the tick tissues was extracted, as described by Budachetri and Karim (2015). The protein concentration of the samples was estimated via a Bicinchoninic Acid Protein

Assay Kit (Thermo Scientific, product #23227, Rockford, IL, USA). Salivary gland extract (430 mg/ml) and MG extract (4210 mg/ml) were used for the protein carbonyl content assays for the RNA interference samples. The principle of

Beer–Lambert’s law was used to calculate the incorporation of 2, 4- dinitrophenylhydrazine (DNPH). The DNPH reacts with carbonyl groups to form a stable adduct known as 2,4-dinitrophenyl hydrazone, thereby indicating the number of carbonyl groups formed as a result of oxidative stress. A 2, 4- dinitrophenyl hydrazone was detected by spectrophotometric analysis at a wavelength of 375 nm. The carbonyl content determined for each experimental sample was normalized to the relative carbonyl content of each experiment’s respective controls for graphical representation and interpretation.

Quantification of the Total Bacterial Load

The total bacterial load in the tick tissues was estimated, as previously described (Narasimhan et al., 2014; Budachetri et al., 2015). Briefly, 25 ng tick tissue cDNA, 200 mM 16S rRNA gene primers and 2X iTaq Universal SYBR green supermix (Bio-Rad Inc.) were mixed and run on a CFX96 Real-Time system (Bio-Rad Inc.) using the following thermocycler parameters: 94°C for 5 min and the final value is part of 35 cycles at 94°C for 30 s, 60°C for 30 s and

72°C for 30 s. Standard curves were used to estimate the copy numbers of each gene. The bacterial copy numbers were normalized against Am. maculatum actin expression and NTCs were used to ensure the purity of the water used in the reactions.

Statistical Analysis

All data is expressed by the mean expression ± SEM. Statistical significance between the two experimental groups or their respective controls was determined using the Mann–Whitney rank sum test (P-value<0.05).

Comparative differences amongst multiple experimental groups were determined by analyzing the variance with statistically significant P-values of<0.05

(SIGMAPLOT v. 11, San Jose, CA, USA). Transcription expression levels were determined using Bio-Rad software (BIO-RAD CFX MANAGER v. 3.1), and expression values were considered statistically significant if P-value < 0.05 when compared to the control.

Results

Bioinformatics Analysis

The full-length A. maculatum CAT sequence (AmCAT; GenBank accession no.: JO843741.1) was identified in a previous sialotranscriptome project on Am. Maculatum (Karim et al., 2011).

Figure 2. The multiple sequence alignment of Amblyomma maculatum catalase. clustal-X2 sequence alignment was imported into Jalview 2.8 and highlighted blue in order to indicate conservation based on percent identity for the following catalase amino acid sequences obtained from GenBank: Amblyomma maculatum catalase (JO843741.1) was aligned with Ixodes scapularis (XM_002400585.1), Caenorhabditis elegans (X82175.1)

Drosophila melanogaster (NM_080483.3), Anopheles gambiae (DQ986315.1) and Homo sapiens (NM_001752.3). All seven conserved residues composing the catalase heme binding domain have been indicated using red boxes.

The AmCAT transcript (1500 bp) was translated into its amino acid sequence (499 aa) and compared with the arthropod CAT sequences available in the GenBank using ClustalX2 multiple sequence alignments (Larkin et al., 2007).

Figure 2 displays the AmCAT amino acid sequence alignment against Ixodes scapularis, Caenorhabditis elegans, Drosophila melanogaster, Anopheles gambiae and Homo AmCAT shares 68% amino acid sequence identity with CAT from I. scapularis and 68–72% amino acid sequence identity with other arthropod species, signifying that the CAT enzyme sequence is conserved amongst species. Conserved heme-binding residues critical to AmCAT stability and maintenance of a high oxidation state are indicated by red boxes (Figure 1). A phylogenetic analysis of the AmCAT protein depicts the generally expected pattern that recapitulates the species phylogeny for eukaryotic organisms, indicating that it behaves similarly to an orthologous protein. Only a single CAT gene was found in each of the examined species. Figure 2 displays the pattern of speciation of the eukaryotic organisms, with AmCAT placed between the vertebrates and invertebrates. A single ancestral AmCAT gene, represented by arthropods and chordates, has probably diverged into two subgroups, chordates, and arthropods (Figure 2). The AmCAT proteins group within the arthropods as expected and were related to I. scapularis, Tribolium castaneum, Aedes aegypti,

An. gambiae and Culex quinquefasciatus (Figure 2).

Antioxidant Response to Exogenous Oxidative Stressors

In order to investigate the antioxidant response and potential alterations in the natural microbiota associated with Am. maculatum, incremental doses of the exogenous oxidant, H2O2, were administered to unfed female Am. maculatum ticks to induce oxidative stress.

Figure 3. Phylogenetic analysis of catalase from various eukaryotes using the neighbor-joining method.

Eukaryotic organisms involved in the phylogenetic analysis are the species (names include both common and scientific): chimpanzee (Pan troglodytes), human (Homo sapiens), Sumatran orangutan (Pongo abelli), Rhesus macaque (Macaca mullatta), cattle (Bos taurus), brown rat (Rattus norvegicus), chicken (Gallus gallus), zebra finch (Taeniopygia guttata), zebrafish (Danio rerio), fruit fly (Drosophila melanogaster), yellow fever mosquito (Aedes aegypti ), malaria mosquito

(Anopheles gambiae), southern house mosquito (Culex quinquefasciatus), Gulf Coast tick (Amblyomma maculatum),

Lone Star tick (Amblyomma americanum), black-legged tick (Ixodes scapularis), red flour beetle (Tribolium castaneum).

Bootstrap values (1000 replicates) are displayed next to the branches. The scale bar represents the rate of amino acid substitution per position.

Microinjections of 3, 5 or 7% H2O2 were used for assessment since 9%

H2O2 was previously determined to be lethal for ticks following a 24 hrs incubation period at room temperature (data not displayed). The transcriptional expression of tick antioxidants was checked following exposure to H2O2 injections within the ticks’ MGs (Figure 4A) and SGs (Figure 4B). Only Dual oxidase (Duox) (11-fold) or SelM (9-fold) were upregulated in the MGs upon sublethal doses of H2O2. However, within the SGs almost all of the tick antioxidants, including the selenoproteins, were up-regulated, ranging from 2–30 folds (Figure 4B).

Figure 4. Effect of H2O2 injection on modulation of the antioxidant gene network in Amblyomma maculatum tissues.

The transcriptional gene expression of antioxidant genes in tick salivary gland, SG (B) and midgut, MG (A) when 3%, 5% and 7% H2O2 are injected in separate group of unfed Amblyomma maculatum ticks followed by 24-hour incubation at room temperature. The gene expression values of all the genes except SEF (5% H2O2 injection), SelX (7% H2O2 injection) are statistically significant (P<0.05) when compared with the control. Tick β-actin was used as the reference gene for normalization. SG, salivary glands; MG, MG; CAT, catalase; Duox, dual oxidase; salp25D, Glutathione peroxidase; Mn-SOD, Manganese (Mn)-superoxide dismutase; Cu/Zn SOD, Copper/zinc-superoxide dismutase; SEF, selenocysteine-specific elongation factor; SelM, Selenogene M; SelO, Selenogene O; SelS, Selenogene S; SelK,

Selenogene K; SelN, Selenegene N; SelT, Selenegene T; SelX, Selenegene X; SPPre, Salivary gland precursor; TrxR,

Thioredoxin reductase; Cas1, caspase 1; Cas2, caspase 2. All of the tick antioxidants, including the selenoproteins, were upregulated, ranging from 2–30 folds (Figure 4B). The sublethal dose of the H2O2 injected did not impact the total oxidative stress level inside the tick tissues (data not displayed); this may be a result of robust increases in antioxidants following administration of the injections (Figure 4B), whereas interestingly, the total bacterial load increased in the tick SGs following exposure to H2O2 compared with the phosphate-buffered saline (PBS) control (Figure 6D). Since the tick antioxidant response was only related to Duox and SelM within the tick MGs

(Figure 4A), the bacterial load in the tick MGs was depleted after administering the H2O2 injections (Figure 6C). As a secondary means of understanding the interplay between ROS and the robust antioxidant system of Am. maculatum, unfed ticks were injected with sublethal doses of 1, 10 or 20 mM PQ and then dissected following a 24 hrs incubation period. In a previous experiment, 25 mM

PQ was found to be lethal to ticks within 6 hrs post injection (data not displayed).

It is not surprising then, to observe a 2–12 fold up-regulation of antioxidant genes

in tick SGs exposed to the environmental stressor, PQ, while a 2–5-fold upregulation of transcript levels was apparent in the gut tissues of the ticks (Figure

5A, B). Somewhat surprisingly, up-regulation of both mitochondrial and cytosolic superoxide dismutases suggests that superoxide was generated within the ticks’

SGs, and this process required an increased demand for Mn-SOD and Cu/Zn-

SOD in order to catalyze the superoxide ions into the comparatively less reactive

ROS, H2O2.

Figure 5. Effect of paraquat (PQ) injection on modulation of the antioxidant gene network in Amblyomma maculatum tissues.

The transcriptional gene expression of antioxidant genes in tick salivary gland, SG (B) and midgut, MG (A) when 1, 10 and 20 mM PQ are injected in separate group of unfed Amblyomma maculatum ticks followed by 24 hour incubation at room temperature. The gene expression values for all of the genes except SelT (20 mM PQ SG injection), Cas2 (at all

PQ concentrations injection in SG) are statistically significant (P<0.05) when compared with the control. In midgut tissue, only few genes (SalpD25, Mn-SOD, SelO, SelT, SelX) demonstrated significant upregulation. Tick β-actin was used as the reference gene for normalization. SG, salivary glands; MG, MG; CAT, catalase; Duox, dual oxidase; salp25D,

Glutathione peroxidase; Mn-SOD, Manganese (Mn)-superoxide dismutase; Cu/Zn SOD, Copper/zinc-superoxide dismutase; SEF, selenocysteine-specific elongation factor; SelM, Selenogene M; SelO, Selenogene O; SelS, Selenogene

S; SelK, Selenogene K; SelN, Selenegene N; SelT, Selenegene T; SelX, Selenegene X; SPPre, Salivary gland precursor;

TrxR, Thioredoxin reductase; Cas1, caspase 1; Cas2, caspase 2.

The clearance of H2O2 by the tick antioxidants is represented by the increased expression of CAT (3- to 11-fold) and glutathione peroxidase/salp25D, both of which are capable of converting H2O2 into the water and molecular oxygen. The antioxidant gene response within the tick MG tissues upon PQ injection revealed that only Salp25D and SelO were up-regulated (Figure 5A).

Colonization by bacteria increased in the presence of PQ, as observed by the quantification of the overall bacterial load in the tick SGs; this may have been caused by aggressive antioxidants (Figure 6B). However, in the MG tissues, the bacterial load depleted upon receipt of increased PQ concentrations, as a lesser response to the external stressors (Figure 6A).

Impact of CAT Knockdown

The temporal transcriptional expression of the CAT gene in tick tissues

(MGs, SGs and ovaries) was determined across the bloodmeal period (Figure

7A). The temporal expression of the CAT gene in the tick MG exhibited its highest expression during the unfed state followed by a significant down- regulation upon slow-phase blood transitioned into fast-phase blood feeding 56

through day 7 (Figure 7A). Intriguingly, the transcriptional expression of the CAT gene in tick ovarian tissues increased over the duration of the bloodmeal, suggesting a potential role for it in egg development and reproductive fitness

(Figure 7A).

Figure 6. Microbial load estimation within tick tissues following sublethal doses of paraquat (PQ) and H2O2 injection in Amblyomma maculatum.

The effects of sublethal doses of PQ were tissue-specific in the MG tissues (A) and SG tissues (B). The H2O2 injections affected the bacterial colonization in a tissue-specific manner in the MG tissues (C) and SG tissues (D). The bacterial load was estimated based on quantification of the overall 16S rRNA genes per 100 ticks and β-actin by the quantitative reverse transcriptase PCR method. (**; very low values). PBS, phosphate-buffered saline To further understand the role of CAT in tick blood feeding and reproductive fitness, CAT was knocked down using an RNA interference, and its 57

effect upon the transcriptional gene expression of other tick antioxidant genes, bacterial load and tick ovipositing was investigated (Figure 7 and 8). Despite the

CAT knockdown, there were no significant changes in tick weight or ovipositing as determined by egg mass (Figure 9C).

Figure 7. Estimation of the time-dependent catalase (CAT) expression in natıve tick tissues upon infestation and the effect on total oxidative stress and bacterial colonization upon CAT silencing.

Temporal transcriptional gene expression of CAT within Amblyomma maculatum midgut (MG), salivary glands (SG) and ovarian (Ov) tissues during the bloodmeal days postinfestation (dpi). Relative expression levels across the bloodmeal 58

were compared with the CAT expression within unfed tissues. (A) Temporal transcriptional gene expression of CAT within

Amblyomma maculatum midgut (MG), salivary glands (SG) and ovarian (Ov) during the bloodmeal. Relative expression of

CAT during bloodmeal were measured by comparing the CAT expressions during the unfed stage in respective tissues

(SG/MG/Ov). (B) The total oxidative stress in ticks upon silencing of the CAT in Am. Maculatum was determined by protein carbonyl content. (C) Total bacterial load estimation upon silencing of CAT in Am. maculatum. The bacterial load was estimated via the quantification of the 16S rRNA gene per 100 ticks and the β-actin gene. The level of oxidative stress, as quantified by a protein carbonyl content assay, revealed a 10-fold increase in the carbonyl content level in the SG tissues, indicative of increased oxidative stress as a result of CAT gene knockdown; This suggests a vital role for CAT in preventing protein damage in ticks (Figure 7B). The transcriptional expression of selected tick antioxidant genes was estimated upon depletion of CAT in SGs and MG tissues (Figure 8).

Interestingly, the CAT transcript depletion impacted the down-regulation of SelS,

Duox, and both of the SODs (Figure 8).

CAT Involvement in Tick Reproductive Fitness

Depletion of the CAT transcript in unfed ticks did not solely impact the tick phenotype. However, a decrease in the average weight of tick eggs was noticed

(Figure 9C). In this experiment, we attempted to deplete both transcript and residual protein activity by using a double-stranded RNA (dsRNA) and a CAT inhibitor on engorged female ticks. Interestingly, inhibition of transcripts and protein together significantly decreased the total egg weight and eclosion of the larvae (Figure 9A, B). Control ticks laid eggs from which larvae were successfully hatched, whereas comparatively, the ticks injected with the combined double-

stranded RNA of a CAT gene (dsCAT)/3-amino-1, 2, 4-triazole (3-AT) oviposited significantly fewer eggs (P50.002).

Figure 8. Effect of catalase (CAT) knockdown [double stranded RNA of CAT gene (dsCAT)] on the antioxidant gene network in Amblyomma maculatum.

Evidence of CAT knockdown upon double-stranded RNA-based silencing of the target gene in tick midgut (MG) and salivary glands (SG). Transcriptional expression of tick antioxidant genes including selenoproteins was estimated in the

CAT-silenced tick tissues. Transcriptional expression was estimated by quantitative reverse transcriptase PCR using β- actin as a reference gene. Transcription level of selected target genes in control tick tissues was given a normalized fold expression value of 1, as represented by the dashed line. CAT, catalase; Duox, dual oxidase; GSHR, Glutathione reductase; salp25D, Glutathione peroxidase; Mn-SOD, Manganese (Mn)-superoxide dismutase; Cu/Zn SOD,

Copper/zinc-superoxide dismutase; SelM, Selenogene M; SelO, Selenogene O; SelS, Selenogene S; SelK, Selenogene

K; SelT, Selenegene T; SelX, Selenegene X; Cas1, caspase 1; Cas2, caspase 2. Discussion

An imbalance between the generation and detoxification of ROS causes oxidative stress, and this has either positive or negative repercussions for living organisms. Ticks experience a variety of oxidative stress conditions while attached to the vertebrate host. When free living, they must respond to these

conditions before the highly reactive oxidative molecules damage their cellular structures, since both severe and prolonged oxidative stress can trigger cellular apoptosis. Compared to the MG, antioxidant genes are much more highly upregulated within the SGs upon PQ and H2O2 treatment.

Figure 9. Elucidation of the role played by catalase (CAT) in the ovipositing of Amblyomma maculatum.

(A) Effect on tick ovipositioning when double stranded RNA-CAT (dsRNA-CAT) and 3-amino-1, 2, 4-triazole (3-AT) were injected as a cocktail into engorged female ticks. (B) Effect on tick ovipositing when double-stranded RNA-LacZ (dsRNA-

LacZ) was injected into engorged female ticks. (C) Egg weights after dsRNA-CAT silencing (injected at unfed stage) and depletion of mRNA (dsRNA-CAT) and proteins (dsRNA-CAT+AT). The cocktail of dsRNA-CATand 3-AT depleted mRNA and protein level of catalase simultaneously, which resulted in a significant impairment in the oviposition of Gulf Coast ticks (P=0.002). Triangles indicate the mean egg weight values.

The higher upregulation of antioxidant genes provides favorable conditions for the growth of native bacterial load by mitigating high oxidative stress. This is a probable reason for why the native microbial load within the tick

MG was depleted. An understanding of the tick antioxidant machinery should provide insight into how ticks avoid tissue damage when experiencing oxidative stress. Such knowledge could be useful for investigating new ways to control tick populations in the absence of effective established methods. Here, we investigated the potential of tick CAT as a target for tick control. A bioinformatics analysis of AmCAT indicated its amino acid sequence homology to other known arthropod and vertebrate genes (Figure 2). Moreover, the Am. maculatum CAT sequence is similar, with regard to phylogenetic lineage, to Amblyomma americanum and I. scapularis (Figure 3). The tick SGs demonstrated much more robust antioxidant response than the MG when unfed ticks were treated with environmental stressors paraquat (Figure 5A, B), in comparison to increased microbial load within the SGs (Figure 6B, D). In general, PQ is toxic to a majority of vertebrates, but has often been used in biological research as an inducer of oxidative stress because of its ability to induce the generation of superoxide ions within eukaryotic cells and tissues (Bus & Gibson, 1984).

The injection of PQ increased superoxide levels in SGs, but depleted

Cu/ZnSOD and MnSOD in the tick MG tissues (Figure 5). Exogenous PQ has also been known to induce toxicity in cells by oxidizing NADPH and generating superoxide ions (Bus & Gibson, 1984). In eukaryotes, the CAT enzyme is a

tetramer of four polypeptide chains with each monomer composed of more than

500 amino acids that collectively contribute to the formation of four porphyrin heme groups and the binding of a protective NADPH that protects each monomer from being oxidized by its target substrate, H2O2 (Putnam et al., 2000).

The dsCAT injection of unfed ticks and ticks allowed to feed on a host did not impact tick physiology in terms of blood feeding success; This may be caused by a reduced physiological need of CAT after attachment, and possibly the dilution effect also on injected dsRNA. The increased transcript levels displayed in tick ovarian tissues (Figure 7A) compared with relatively lower levels in the MGs and

SGs suggest that CAT is more important in ovarian tissues. Radulovic´ et al.

(2014) have revealed that time-dependent and tissue-specific expression is upregulated at the transcript level in the SGs during early phase feeding, suggesting a role for AmCAT in detoxifying the excess H2O2 generated as a result of the high protein synthesis which occurred during the salivary secretion and establishment of the tick feeding site. The gene expression levels in the tick

MGs and SGs after CAT silencing demonstrate a depletion in the expression of a majority of the antioxidant genes (Figure 8). Surprisingly, although increased oxidative stress upon CAT silencing occurred (Figure 7B), a depletion of the microbiome in the silenced tick tissues was not observed (Figure 7C). The depletion of CAT mRNA alone did not impact tick oviposition; This may have been caused either by dilution of the injected dsRNA-CAT over a prolonged time or simply by the presence of an active protein synthesized before the

degradation of endogenous mRNA. Hence, we designed a set of experiments for engorged Am. maculatum that targeted both mRNA and proteins. The dsRNA-

CAT and 3-AT combination injection severely impacted oviposition in Am. maculatum (Figure 9); The exact mechanism for this has yet to be determined, but one study has reported that the enzymatic activity of CAT in removing H2O2 is associated with heme detoxification (Galay et al., 2015). Furthermore, Citelli et al. (2007) have reported that an injection of the 3-AT CAT inhibitor into engorged

Rhiphicephalus microplus females resulted in the inhibition of heme aggregation within hemosomes, as evidenced by heme dispersal throughout the cytoplasm of digestive cells and an alteration in heme detoxification. This finding bears similarities to a previous study in which the reproductive output of female A. gambiae CAT knockdown mutants was found to be significantly reduced, indicating that CAT plays a central role in protecting mosquito oocytes and early embryos from ROS damage (DeJong et al., 2007).

Conclusions

Our experiments have shown that Am. maculatum possesses tissue- specific and strong antioxidant armaments and that these include a range of selenoproteins that are activated by the external stressors, H2O2 and PQ. The silencing of tick CAT achieved by transcript and protein depletion resulted in a marked impairment of reproductive fitness in Am. maculatum, as observed by tick ovipositioning. This study reveals the role played by CAT within the reproductive fitness of ticks

Table 1

Gene-Specific Quantitative Reverse Transcriptase PCR Primers used for RT-

PCR in Chapter II.

Gene GenBank ID Forward Primer (5'-3') Reverse Primer (5'-3') Size (bp) Actin JO842238 TGGCTCCTTCCACCATGAAGATCA TAGAAGCACTTGCGGTGCACAATG 169 Catalase JO843741 AAAGGACGTCGACATGTTCTGGGA ACTTGCAGTAGACTGCCTCGTTGT 173 GPx / Salp25D JO843645 TGCCGCGCTGTCTTTATTATTGGC AGTTGCACGGAGAACCTCATCGAA 102 GSHR JO844062 ACCTGACCAAGAGCAACGTTGAGA ATCGCTTGTGATGCCAAACTCTGC 170 SEF KC989559 TGGCTCCAGAAATGCTGCTCATTG ACGCCTTTGCGACTCTTCTCCTTA 157 SelK JO843326 AGTTCCAGCAGGTCATCAGTGTCA TCCAGGAATAGGGCAGTCCATTGT 132 SelM JO842653 ATGATACCTGAATGGCCATCCGCA TGATCGCGGGTCATCTTCTCCAAA 171 SelN KC989560 TTAGTTTGGACACTGTGGACGGGT AGGCTTCTCTAACAACGGCACTCA 150 SelO KC989561 AAGCTCGGCCTTGTGAAGAGAGAA TACAGCACGACAAGAGCTTGGACA 190 SelS JO842687 AGAACAAGTGCACCACAACAGCAG ATTTCTTGCATCCTTCGACGTGCC 107 SelT KC989562 TCTTTGTGTGTGGAGCCATCGAGA ACCACACCCGCACGTCATTAAAGT 81 SelX JO845128 ACCACTCTCCTTGGCCATCATTCA TGCACTTCCCACAGTACACCTTGA 108 Cu-Zn SOD/SOD1 JO844140 GGAACCGAAGACAGCAAGAA GAGAAGAGGCCGATGACAAA 143 Mn- SOD/SOD3 JO843979 AGGCTGTCTGTGTGTTGAAG TTGCCGAGGCCCTTTATTT 112 Duox AmSigP-102197 ATG ACG CAC AGC CTG TAT ATT TGT CCA GAG TGA AGA CGA TTG 123 TrxR JO843723 TGTGACTACACCAACGTGCCTACA AGTAGCCTGCATCCGTTCCTCTTT 175 Caspase1 Am-2600 GAGGAGTCTAGCAGGATGTTTC ACTGTCATGCTCCGTGTAATC 127 Caspase2 Am-29082 GGTGATCGTGATGTCCTGTATG CGACAGGCCTGAATGAAGAA 128

CHAPTER III – INVESTIGATE THE ROLE OF SELO AND SELS IN TICK

PHYSIOLOGY AND VECTOR COMPETENCE IN

GULF COAST TICKS (AMBLYOMMA MACULATUM)

Abstract

The importance of Gulf Coast ticks is profound because of their ability to transmit various pathogens, most importantly R. parkeri, to humans and their domesticated animals. The rickettsial infection rate is found up to 55% in parts of the southeastern USA, which is a serious public health concern. A number of recent reports have brought this to the attention of the biomedical community by revealing that Rickettsial diseases affect approximately one billion people worldwide. Therefore, it is necessary to understand tick-Rickettsia interaction (in terms of Rickettsia acquisition, colonization and transmission), which can help in the development of a controlling strategy. The available literature has suggested the involvement of redox signals within vector-pathogen interactions, including the entry of pathogens. A recent study from our lab has also indicated the possible modulation of tick antioxidants, including selenoproteins by R. parkeri

(Rp), for their colonization and survival. Upon eEFSec knockdown (eEFSec, the eukaryotic elongation factor for selenocysteine and an essential factor in selenoprotein biosynthesis), the transcriptional gene expression increased for

SelO, SelS and selt in tick MGs. It is probably that these molecules play a significant role in R. parkeri colonization inside ticks. Using this information, within the present study selenogenes SelO and SelS were investigated in order to study the collaboration between their antioxidant property and tick vector

competence. The purpose of this study is to investigate the roles of these selenoproteins in tick physiology, their contribution to tick antioxidant machinery and how they felicitate R. parkeri survival during blood feeding. A reverse genetics approach was used to investigate these selenogenes (SelO, SelS ) within uninfected and infected R. parkeri ticks. Knocked down uninfected ticks did not reveal any significant change in either egg viability or ovipositing for any of these selenogenes. Our results indicate the tissue-specific role of SelO and SelS in Rp colonization. It was demonstrated that SelO and SelS contribute significantly to the R. parkeri colonization in tick MGs. It appears that SelO, hypothetically a mitochondrial kinase, exploits its antioxidant property for Rp colonization and survival within tick MGs. In consonance, SelO and SelS knockdown reduce bacterial load and Rp-infection significantly in Rp-infected

MGs, indicating their role in microbiota maintenance and Rp survival. It is probable that this is due to high ER stress, as evident from high unfolded responses (ER stress). This is the first study which has reported the role of tick selenogenes (SelO and SelS) in Rp colonization and survival in a tissue-specific manner. It is necessary to research the correlation between ER-stress and Rp- infection further. This study could provide strategic insight for future tick- pathogen interaction and vector competence studies.

Introduction

In modern circumstances, the rate and ease of global movement create the risk of transporting ticks and tick-borne diseases which may have previously been isolated to one region. A dynamic interaction occurs between tick vector

and associated disease-causing agents, regarded as a continuous “bellum omnium contra omes” or “war of all against all” (Chmelař et al., 2016). The tick- borne pathogens manipulate the gene expression of their vector to ensure their survival, colonization and transmission (vector competence) into the mammalian host. Little is known about the relationship between redox balance and the growth and viability of intracellular bacteria. In mammals, invading bacterial pathogens infect neutrophils and professional phagocytes and stimulate the assembly of an NADPH oxidase complex into the vacuole that destroys the bacteria (Hong et al., 1998; Rada & Leto, 2008). R. rickettsia, a close relative of

R. parkeri, generates ROS as a means of pathogenesis in human ECs (Hong et al., 1998). In contrast, Anaplasma phagocytophilum, another Rickettsiales, scavenges ROS extracellularly by secreting SOD1 (Dumler et al., 2005). Studies using other vector-borne models have indicated that the initial stage of the transmission of a pathogen by an arthropod vector is influenced by gene expression changes in both vectors and pathogens (Hovius et al., 2007).

Gulf Coast ticks are historically important due to the huge impact they have upon livestock infestations. The available literature has suggested the involvement of redox signals or modification of redox switches in vector-pathogen interactions including entry of pathogens (Stolf et al., 2011; Walczak et al., 2012).

A recent study from our lab has also indicated the possible modulation of tick antioxidants including selenoproteins by R. parkeri (Rp) for their colonization and the oxidative stress mitigation required for their survival (Adamson et al., 2013). It is possible that R. parkeri modulates the transcriptional gene expression of

catalase and selM because it interferes with the colonization of R. parkeri.

Currently, a majority of the selenogenes have demonstrated their roles in mitigating oxidative stress, but their roles at the physiological level have yet to be elucidated. The same tick study mentioned above has also indicated the role of selenoproteins in tick vector competence by demonstrating that the knockdown of eukaryotic elongation factor for selenocysteine (eEFSec), an essential factor in selenoprotein biosynthesis, alters the pathogen burden of Rickettsia parkeri in

Gulf Coast ticks (Adamson et al., 2013). Upon eEFSec knockdown, the transcriptional gene expression of selM was reduced, but increased for selO, selS and selT within tick MGs (Adamson et al., 2013). It is probably that these molecules play a significant role in R. parkeri acquisition and dissemination.

Thus, SelO and SelS were investigated in order to study the collaboration between their antioxidant property and vector competence. SelS has been characterized as an ER membrane protein which plays a role in mitigating ER stress through the removal of misfolded proteins. Therefore, on the basis of the previous work from our lab, it has been suggested that SelS might be useful for the successful dissemination of R. parkeri by removing the misfolded proteins from the ER membrane. SelO is localized within the mitochondria (where 70% of the ROS are generated) and predicted to have kinase activity (Hans et al., 2014).

Based on these facts and previous study from our lab, it could be hypothesized that SelO mitigates the oxidative stress by exploiting its kinase activity which aids in the survival of R. parkeri. The purpose of this study is to investigate the roles of these selenoproteins in tick physiology, their contribution towards tick

antioxidant machinery as well as how they felicitate R. parkeri survival during blood feeding. Our results indicate the tissue-specific role of SelO and SelS in

Rp-infected ticks, as their knockdown in tick MG indicate a much significant change (Rp-growth, compensatory regulation of other antioxidants, and UPR) than that of SG tissue.

Materials and Methods

Ethics Statement

All of the animal experiments were performed in strict accordance with the recommendations found in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health, USA. The protocol for tick blood feeding on sheep was approved by the institutional Animal Care and Use Committee of the

University of Southern Mississippi (protocol#15101501 & 15011402). All efforts were made to minimize animal suffering.

Ticks and Other Animals

Gulf Coast ticks (A. maculatum) were maintained at the University of

Southern Mississippi according to established methods (Patrick & Hair, 1975).

Unfed adult ticks were obtained from Oklahoma State University’s Tick Rearing facility (Stillwater, OK). R. parkeri-infected A. maculatum ticks were maintained within the laboratory, as previously described (Budachetri et al., 2014). Adult ticks were kept at room temperature with approximately 90% RH under a photoperiod of 14 hrs light and 10 hrs dark before infestation on sheep. Ticks were blood fed on sheep and were either allowed to feed to repletion or were removed between 3 to 10 days after attachment, depending upon the

experimental protocol. Adult ticks were fed on sheep and immature ticks were fed on hamsters (specifically used for this study). The animal studies were performed in accordance with protocols approved by the Institutional Animal Care and Use

Committee (IACUC) at the University of Southern Mississippi.

Tick MG and SG Preparation

The unfed and partially blood-fed female adult ticks were isolated within 4 hrs of removal from the animal. The tick tissues were dissected in an ice-cold M-

199 buffer as described by Morgan et al. (1955, 1950). After isolation, the tissues were gently washed in the same ice-cold buffer. The tissues were either stored immediately after dissection in RNAlater (Invitrogen, Carlsbad, CA, USA) prior to extracting the mRNA from them, or in a protein extraction buffer.

RNA Preparation, cDNA Synthesis and Quantitative Reverse Transcriptase

(qRT)-PCR

Extraction of total RNA, cDNA synthesis, and qRT-PCR were conducted as previously described (Browning & Karim, 2013). The tick MGs and SG tissues stored in RNAlater were used for total RNA extraction using an Illustra™

RNAspin Mini Isolation kit (GE Healthcare, Piscataway, NJ, USA) according to the manufacturer’s instructions. The RNA concentration was determined using a

Nanodrop spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA).

Total RNA (1 µg) was reverse transcribed into cDNA using the Moloney murine virus reverse transcriptase according to the manufacturer’s instructions

(Invitrogen, Carlsbad, CA, USA). The gene-specific primer sequences designed to amplify specific cDNA fragments from A. maculatum tissues are listed in the

Table 2. The transcriptional gene expression of SelO and SelS in uninfected

(naïve) ticks was normalized against the β-actin gene, while the glyceraldehyde

3-phosphate dehydrogenase (GAPDH) was used to normalize gene expression in R. parkeri-infected tick tissues. The selection of β-actin and GAPDH-reference genes was based upon their stable gene expression levels in uninfected and

Rickettsial-infected ticks (Browning et al., 2012). All of the genes used in this study were first amplified using gene-specific primers (Table 2), and their sequences were confirmed by sequencing prior to the dsRNA synthesis or conducting the gene expression studies. The first-strand cDNA was used to measure mRNA levels using qRT-PCR. The SYBR Green qPCR Master Mix

(Bio-Rad Inc., Hercules, CA, USA), 25ng of cDNA, and 150nM of gene-specific primers were used in each reaction mixture. The qRT-PCR mixtures were subjected to 10 min at 95°C, followed by 35 cycles of 15 s at 95°C, 30 s at 60°C, and 30 s at 72°C using the CFX96 Real-Time System (Bio-Rad Inc.).

Double-Stranded RNA (dsRNA) Synthesis, Tick Injections and Hematophagy

Synthesis of dsRNA for the SelO and SelS analysis and tick manipulations was performed according to the methods described previously (Bullard et al.,

2016; Kumar et al., 2016). Briefly, the PCR product, purified using a QIAquick

PCR purification kit (Qiagen, Valencia, CA, USA), was used within a secondary

PCR using the same primers with the SOD-specific sequences (Table 2), but with the addition of flanking the T7 sequences that allow for the binding of reverse transcriptase and the generation of dsRNA. After confirming the T7- flanked SOD gene sequence, the secondary PCR product was reverse

transcribed into RNA using a T7 Quick High Yield RNA synthesis kit (New

England Biolabs, Ipswich, MA, USA) by incubating the PCR product with T7 polymerase overnight at 37°C. The resulting dsRNA was purified by ethanol precipitation and its concentration measured spectrophotometrically using a

Nanodrop device (Thermo Fisher Scientific). The product was visualized via gel electrophoresis, using a 2% agarose gel. The dsRNAs (dsSelO, dsSelS) were diluted to working concentrations of 1µg/µL. The same protocol was used to synthesize dsRNA-LacZ to be used as an irrelevant dsRNA control. Forty-five unfed adult female ticks (uninfected or R. parkeri-infected) were microinjected with 1 µl of dsRNA-SOD or dsLacZ using a 27-gauge needle, after which they were kept overnight at 37°C in order to alleviate needle trauma and promote survival. The surviving ticks were used to infest a sheep and allowed to blood feed in the presence of male ticks. For a sample collection, 10 partially fed experimental control ticks were removed on days 5 and 7 post tick infestation, and the remaining ticks were allowed to remain attached and blood feed until repletion. The feeding success of the individual ticks was evaluated by recording their attachment duration, repletion weight and ability to oviposition (Karim et al.,

2012). Partially fed ticks removed from the dsLacZ or dsSel groups were dissected in order to obtain their MG and SG tissues.

Quantification of Total Bacterial Load

The bacterial load in each tick tissue was estimated as previously described (Budachetri & Karim, 2015; Narasimhan et al., 2014). In order to properly estimate, 25ng of cDNA from the tick tissues, 200 µM 16sRNA gene

primers, and 2X iTaq Universal SYBR green mix (Bio-Rad Inc.) in a 25-µl volume reaction was used with the following thermocycler parameters: 94°C for 5 min followed by 35 cycles at 94°C for 30 s, 60°C for 30 s and 72°C for 30 s. Standard curves were used to estimate the copy numbers of each gene. The bacterial copy numbers were normalized against an A. maculatum actin expression in the uninfected ticks and GAPDH in the R. parkeri-infected ticks.

Quantification of R. Parkeri Copy Numbers in Tick Tissues

The level of infection of R. parkeri within the tick tissues (MGs and SGs) was quantified using the probe-based qPCR method described previously

(Budachetri et al., 2014). Briefly, 0.4 µM of probe, 0.7 µM of each forward and reverse primer (Rpa129F, Rpa224R) (Table) and 8 mM of the MgSO4 reaction mixture was subjected to one cycle each of 50°C for 2 min and 95°C for 2 min, as well as 45 cycles of 95°C for 15s and 60°C for 30s. A standard curve was used to calculate the R. parkeri copy numbers in the tick samples. All of the samples were run in triplicate.

Quantification of Oxidative Stress

An MDA assay (fig. 7) was used to quantify the relative oxidative stress level within tick tissues. In this assay, lipid peroxidation was estimated using an

MDA assay kit (Sigma-Aldrich, St. Louis, MO, USA). All of the instructions were followed within the manual provided by the manufacturer.

Quantification of ER Stress

Unfolded protein response transcriptional assay (fig. 6) was used to quantify ER stress in tick tissues. The transcriptional gene expression of sensor

genes ATF6 and IRE1 was performed in order to quantify unfolded protein response.

Data Analysis

All of the data is expressed as mean ± SD, unless otherwise mentioned.

Statistical significance between the two experimental groups or their respective controls was determined by either the Mann-Whitney rank sum test or t-test (P- value≥0.05). Comparative differences amongst multiple experimental groups were determined by an analysis of the variance with statically significant P-values of <0.05 (Graphpad Prism6.05, La Jolla, CA). Transcriptional expression levels were determined via Bio-Rad software (Bio-Rad CFX MANAGER v.3.1), and expression values were considered significant if P-value ≤ 0.05, when compared to the control.

Results

Time-Dependent and Tissue-Specific Transcriptional Gene

Figure 10. Temporal gene expression of SelO (A) and SelS (B) in uninfected (naïve) tick tissues (midgut, MG and salivary glands,SG) during blood-feeding.

The relative transcriptional expression of SelO and SelS during the blood meal were determined by comparing the transcript levels of the MG and SG tissues in the unfed-stage ticks. The change in transcriptional activity of (A) SelO and 75

(B) SelS in A. maculatum MG and SG tissues was normalized to the unfed developmental stage using β-actin as a reference gene. The transcript level of each gene for control samples (unfed tick tissues) were made 1 for reference

(indicated by dotted line in the figure).

The temporal and tissue specific transcript levels of the SelO and SelS were assessed in unfed and partially blood-fed midguts and salivary glands

(Figure 10). Interestingly, the expression of SelO gene in the midgut tissues remained up-regulated 2-2.5 folds while the salivary glands showed down- regulation of transcript level from day 2 to day 8 post infestation (Figure 10A). In contrast, the transcript level of SelS was 4 folds up-regulated in early phase of tick feeding than in the unfed tissues in the 2 day fed ticks (Figure 10B).

Surprisingly, the expression of SelS remained unchanged in midgut tissues from day 2 to 8; however, the transcript level significantly reduced in day 8 fed salivary glands (Figure 10B).

Figure 11. Compensatory regulation of antioxidants in uninfected A. maculatum ticks when (A) SelO and (B) SelS are knocked down.

Gene expression in naïve ticks was normalized against tick β-actin as the reference gene. The compensatory antioxidant expressions were measured in eukaryotic elongation factor (eEFSec), selenoproteins (SelM, SelK, SelS, SelO, TrxR,

SelN, SelT), mitochondrial SOD (Mn-SOD), Cytosolic SOD (Cu/Zn-SOD), Catalase (Cat), glutathione reductase (GSHR),

GPx (Salp25D). dsRNA-LacZ treated ticks were used as non-target control in RNAi experiments. The transcript level of each gene for control samples was made 1 for reference (indicated by dotted line in the figure).

Impact of SelO and SelS Depletion on Hematophagy

Figure 12. Effect of SelO and SelS knockdown on total bacterial load in naïve ticks.

Tick β-Actin was used as a reference gene for normalization in clean ticks. dsRNA-lacZ (indicated as dsLacZ in the figures) was used as non-target control in RNAi experiments. In order to examine the functional role of SelS and SelO, the genes were deleted using an RNA interference, and the impact of the individual gene knockdowns upon the transcript level of superoxide dismustases (Mn-SOD,

Cu/Zn-SOD), catalase, GPx (Salp25D), GSHR, Duox, eEFSec, Thioredoxin reductase, SelK, SelM, SelN, SelO, SelS and SelT were determined, as well as the total bacterial load (Figure 11 and 12). Regardless of SelO or SelS knockdowns, there were no significant changes in tick behavior and phenotypes in terms of tick engorgement, weight, the attachment duration or egg mass size

(data not displayed). The knockdown of SelO in partially blood-fed MGs upregulated: Mn-SOD and SelK expression in MG tissues increased 8 and 6.6 folds, respectively (Figure 11A). However, the expression of other tested genes remained down-regulated. In contrast, the expression of Catalase, Duox and 78

SelT was upregulated 2-7 folds within partially fed tick SG tissues upon SelO gene knockdown (Figure 11A). On the other hand, the knockdown of SelS in partially blood-fed ticks displayed a 5-fold upregulation of SelO within MG tissues. However, the expression of Duox, SelN and SelT displayed 1.5-2 fold increases within SG tissues (Figure 11B). The expression of other tested genes remained down-regulated for both tick tissues (Figure 11B). In order to further understand the role of SelO and SelS in the maintenance and colonization of native microbial load within tick tissues, the overall bacterial load was quantified using the 16S rRNA assay. We observed that the knockdown of SelO and SelS did not impact the bacterial load in MG tissues. In contrast, knockdown of SelS significantly reduced the total bacterial load in partially fed SGs (Figure 12), suggesting a hypothetical role of this gene in the colonization of microbes within tick SGs.

SelO, and SelS Silencing in R. Parkeri-Infected Ticks

The transcriptional expressions level of SelO, and SelS were examined within the tick tissues (MG and SGs) for R. parkeri-infected unfed and partially blood fed adult ticks (Figure 13A). Intriguingly, the R. parkeri-infected tick tissues exhibited tissue-specific transcriptional regulation of SelO and SelS. SelO and

SelS were upregulated by 5 and 3 folds respectively in R. parkeri-infected MG tissues (Figure 13A). Furthermore, the silencing of the SelS gene exhibited a decrease in total bacterial load in both MGs and SG tissues (Figure 14C).

Figure 13. Impact of individual silencing of tick SelO and SelS in Rp-infected tick tissues (Salivary gland, SG and Midgut, MG).

(A) Temporal gene expression of SelO and SelS in R. parkeri infected partially fed (6 days) tick tissues. (B) Compensatory regulation of tick antioxidants and selenoproteins upon silencing of SelS (B) and SelO (C). (D) Estimation of relative oxidative stress in silenced tick tissues by lipid peroxidation malondialdehyde (MDA) assay. Tick GAPDH was used as reference gene for normalizing qRT-PCR results. dsRNA-lacZ was used as non-target control in RNAi experiments. The transcript level of each gene for control samples (tissues from dsRNA-LacZ treated ticks, in fig. D it is indicated as LacZ) were made 1 for reference (indicated by dotted line in the figure). In contrast, the R. parkeri infection within the partially blood-fed SGs triggered an up-regulation of SelS (16 folds), suggesting a putative role in pathogen colonization within the tick SGs (Figure 13A). Interestingly, the R. parkeri infection of the SG only caused a slight up-regulation of the SelO transcript level. Based on these results, and in order to further examine the proposed role of the three selenogenes in the R. parkeri colonization of A. maculatum, the three selenogenes were individually disrupted using RNAi and its 80

effect upon native bacterial load and R. parkeri colonization was determined.

Additionally, the knockdown of SelS exhibited a 2-16 fold up-regulation of Cu/Zn-

SOD and Duox within MG tissues while the transcript levels of other tested genes either remained unchanged or down-regulated within the tick tissues (Figure

13D). In contrast, the depletion of SelO only caused a 2-5 fold up-regulation of catalase, Cu-Zn/SOD and Duox in MG tissues. However, SG tissues exhibited a down-regulation of selenogenes (Figure 13C). Interestingly, the total bacterial load was significantly decreased within partially blood-fed infected MGs upon

SelO knockdown, while the bacterial load in SGs remained unaffected (Figure

13C), indicating a tissue specificity for the SelO gene. The knockdown of SelO within tick MGs revealed a significant decrease in R. parkeri copies, indicating its role in pathogen colonization within the MG tissues. In contrast, the R. parkeri copies remained the same within the SG tissues upon SelO gene depletion

(Figure 13D). Predictably, quantification of the R. parkeri within the SelS knockdown tick tissues revealed a decrease in the R. parkeri copy numbers

(Figure 14D), suggesting a potential role for SelS in R. parkeri colonization within the arthropod vector.

Figure 14. The impact of silencing of tick SelO and SelS individually on total tick bacterial load and Rickettsia parkeri colonization in tick tissues (Salivary gland, SG and Midgut, MG).

Impact on bacterial load and R. parkeri up on silencing of SelO (A, B) and SelS (C, D). GADPH was used as a housekeeping gene. dsRNA-lacZ (indicated as LacZ in the figures) was used as non-target control in RNAi experiments. In the case of SelO and SelS knockdown in uninfected ticks, a UPR transcriptional assay (Figure 15) reveals downregulation of the UPR sensor genes, while in the case of Rp-infected tick MGs, sensor genes demonstrate an upregulation of approximately 2 folds in both the cases (SelO and SelS knockdowns). However, in the case of SG, UPR remains almost unchanged.

Unfolded Protein Response (UPR) in Uninfected and Rp-Infected Ticks

Figure 15. Unfolded protein response (UPR) in uninfected and Rp-infected ticks.

Unfolded protein response estimation in salivary glands (SG) and Midgut (MG)on the basis of transcriptional gene expression of sensor genes ATF6 and IRE1, when selenogenes; SelO and SelS are knocked down in uninfected (A) and

R. parkeri infected (Rp) ticks (B). dsRNA-lacZ was used as non-target control in RNAi experiments. The transcript level of each gene for control samples (tissues from dsRNA-LacZ treated ticks) were made 1 for reference (indicated by dotted line in the figure). Discussion

The purpose of this study is to discuss the impact of tick selenoproteins

SelO and SelS upon tick physiology and vector-pathogen interactions. The impacts of the above-mentioned selenogenes (SelO and SelS) were investigated in uninfected and R. parkeri-infected Gulf Coast ticks by using the reverse genetics strategy. In this study, the transcriptional expression of SelO is consistently upregulated by approximately 2-2.5 folds within naïve tick MGs

(Figure 10A) during the entire period of blood feeding, indicating the probable role of SelO in mitigating oxidative stress during tick feeding, since mitochondrial kinases play a role in mitigating oxidative stress (Antico et al., 2009).

Upregulation of SelO in partially fed Rp-infected MGs is even higher (Figure

13A). This is likely due to a Rickettsial infection, which exacerbates oxidative stress by generating superoxide ions (Walker, 2007). These findings indicate the importance of SelO within tick MGs, irrespective of uninfected or Rp-infected ticks, and again, support the role of SelO in mitigating oxidative stress. Within uninfected tick SGs, the SelO expression declines steadily with feeding (Figure

10A). This is possibly because of organismal senescence, whereas, its expression in partially fed Rp-infected SGs remains unchanged (Figure 13A), indicating its unimportance in tick SGs. Our data has demonstrated high upregulation of SelS in Rp-infected SGs (Figure 13A), indicating their probable role in Rp-colonization. The SelS expression in uninfected tick MGs remains unaffected during blood feeding (Figure 10B), suggesting its unimportance during blood feeding. However, it is important to note that the upregulation of SelO and

SelS within Rp-infected tick tissues indicates their role in mitigating oxidative and

ER stress respectively, as previous studies have suggested the role of SelS in

ER stress mitigation, and generation of oxidative and ER stress during pathogen infection (Walker, 2007; Pillich et al., 2016, Shchedrina et al., 2010).

Furthermore, while we achieved >90% transcriptional knockdown of all of the selenogenes being investigated (except SelO within uninfected MGs, in which only approximately 40% knockdown could be achieved), we did not observe any significant changes in engorged body weight or tick oviposition for any of these selenogenes (SelO, SelS). In the case of SelO knockdown within uninfected tick SGs, few genes such as catalase (roughly 2.25 folds), duox

(roughly 7 folds), seln (roughly 1.5 folds) and selt (roughly 2 folds) were upregulated (Figure 11A). It is likely that SelO knockdown causing oxidative stress, generates a disturbance in Ca2+ signaling in ER resulting within duox upregulation (roughly 7 folds), and thus, upregulation in catalase (roughly 2.25 folds) occurs to counterbalance the generated H2O2 produced by the duox upregulation. The resulting ER disturbance mentioned above might result in ER stress, which is likely counterbalanced by an upregulation in seln and selt, ER resident selenogenes. Studies have demonstrated the role of ER resident selenogenes in mitigating ER stress (Valentina et al., 2010). As such, there was no upregulation of the UPR sensor genes (ATF6 and IRE1) within uninfected tick tissues (Figure 15A). In the case of a SelO knockdown within uninfected tick

MGs, there was no compensatory upregulation (Figure 11A) of any of the antioxidants. Actually, a majority of them were downregulated, probably due to the fact that the SelO knockdown level within uninfected MGs was not satisfactory (only roughly 40%). In spite of an unsatisfactory knockdown of SelO, a majority of the antioxidants weere downregulated in uninfected MGs indicating its essential collaboration with the antioxidant gene network in tick MG. The importance of SelO in tick MG has already been demonstrated by its constant upregulation during the entire duration of blood feeding (Figure 10A).

Most likely due to a lack of sufficient knockdown of SelO, the bacterial load remained unaffected within uninfected tick MG. In the case of a SelS knockdown within uninfected tick SG, bacterial load reduced significantly indicating the possible role of SelS in bacterial load maintenance. In another

possibility, the upregulation of duox (~2 folds), which in turn generates toxic hydrogen peroxide (H2O2) became detrimental for SG microbiota. Although, the expression of UPR sensor genes IRE1 and ATF6 did not demonstrate high ER stress within SelS knocked down uninfected tick SG (Figure 15A), likely caused by a compensatory upregulation of other ER resident selenogenes, seln and selt.

It may be that SelS has an additional role apart from ER stress mitigation, in maintaining the microbiota. In the case of SelS knockdown within uninfected tick

MG, several antioxidants demonstrated compensatory upregulation such as Mn-

SOD (roughly 8 folds), selk (roughly 6 folds), SelO (roughly 8folds), GSHR

(roughly 2 folds) and selt (roughly 1.5 folds), indicating the importance of SelS in uninfected tick MG during blood feeding. High upregulation of the mitochondrial resident antioxidants (Mn-SOD and SelO) and ER resident antioxidant (selk) indicates the importance of SelS in effecting ER and mitochondria both.

Within uninfected ticks, selenogenes knockdown did not affect bacterial load in MG (Figure 12), but in Rp-infected ticks, individual selenogene (SelS and

SelO) knockdown resulted in a significant reduction in bacterial load in tick MG

(Figure 14). Therefore, it is likely that a Rp infection plays an important role in the reduction of bacterial load by generating superoxide ions (Walker, 2007). In fact,

Rp may be competitively superior to other altered microbial communities, and use the cellular resources in a dominant manner. Previous studies have also proposed the prevalence of obligatory or facultative microbes in ticks, that could be influenced by various factors including competition (Budachetri et al., 2014).

The above reasoning is not valid for the reduction of bacterial load in Rp-infected

MG upon knockdown of both SelO and SelS, because in these individual knockdowns, a Rp infection also reduced significantly. Our results have indicated the importance of SelO and SelS in mitigating oxidative and ER stress respectively, in Rp-infected tick MG (Figure 13A). Individual SelO and SelS knockdown in Rp-infected MG elevated the oxidative and ER stress significantly as evident from high ER stress (Figure 15B), which resulted in a significant reduction of bacterial load. The mitochondrial resident selenogene, SelO knockdown, induces high oxidative stress in MG, which in turn, can induce ER stress. Studies have also indicated that there is a physical and biochemical interaction between ER and mitochondria (Csordas & Hajnoczky, 2009), and mitochondrial ROS can induce ER stress (Pierre et al., 2014). Another interesting fact revealed by SelO and SelS knockdown within Rp-infected MG is that it is probable that R. parkeri is ER stress sensitive in tick MG, because when ER stress is significantly higher in SelO and SelS knocked down MGs (Figure 15B),

Rp-infection decreases significantly in both cases (Figure 14D, 14F). In the case of a SelO and SelS knockdown within Rp-infected tick MG, no compensatory upregulations were demonstrated from any of the analyzed ER resident selenogenes, resulting in high ER stress. When SelO and SelS were knocked down in separate groups of Rp-infected ticks, Rp-infection was reduced significantly in MG in both cases (SelO knockdown, and SelS knockdown), indicating the possible role of SelO and SelS in Rp colonization or propagation in tick MG. The importance of SelO in Rp survival could be understood by the fact that even after the compensatory upregulation of antioxidants (Figure 13C) such

as catalase (roughly 2 folds), Cu/Zn-SOD (roughly 5 folds), duox (roughly 4 folds), and salp25D (roughly 1.5 folds), the effect of the SelO knockdown couldn’t be compensated and the Rp population decreased drastically within Rp-infected

MG. This suggests the importance of SelO in Rp-survival within tick MG. SelO, hypothetically known as a mitochondrial kinase (Hans et al., 2014), likely plays role in mitigating oxidative stress (Antico et al., 2009). The upregulation of duox

(roughly 4 folds) in Rp-infected MG could be a cellular mechanism for eliminating the invading pathogens (Xavier et al., 2013) by the production of toxic H2O2.

Generation of large amounts of H2O2 is also damaging for the cell. Therefore, cell machinery upregulates catalase and salp25D in order to degrade it. Our data suggests the significance of SelO in Rp-infected tick MG (as mentioned above), but SelO data does not demonstrate much regarding its role in Rp-infected tick

SG. SelO and SelS knockdown in Rp-infected SG do not reveal any significant impact upon either Rp-colonization, compensatory upregulation of antioxidants or unfolded protein response.

Conclusion

Tick selenogenes SelO and SelS are an important part of a tick’s antioxidant system and plays a role in Rickettsial colonization inside tick tissues.

The tissues’ specificity for Rickettsial colonization was observed in this study.

This study indicates the role of SelO in uninfected as well as Rp-infected tick MG during blood feeding, while SelS plays a role in Rp colonization in both the tissues (SG, MG).

Table 2

Gene-Specific Quantitative Reverse Transcriptase PCR Primers used for RT-PCR in Chapter III.

Size Gene GenBank ID Forward Primer (5'-3') Reverse Primer (5'-3') (bp) Actin JO842238 TGGCTCCTTCCACCATGAAGATCA TAGAAGCACTTGCGGTGCACAATG 169 Catalase JO843741 AAAGGACGTCGACATGTTCTGGGA ACTTGCAGTAGACTGCCTCGTTGT 173 GPx / Salp25D JO843645 TGCCGCGCTGTCTTTATTATTGGC AGTTGCACGGAGAACCTCATCGAA 102 GSHR JO844062 ACCTGACCAAGAGCAACGTTGAGA ATCGCTTGTGATGCCAAACTCTGC 170 eEFSec KC989559 TGGCTCCAGAAATGCTGCTCATTG ACGCCTTTGCGACTCTTCTCCTTA 157 SelK JO843326 AGTTCCAGCAGGTCATCAGTGTCA TCCAGGAATAGGGCAGTCCATTGT 132 SelM (dsRNA) JO842653 GACCTGATATGCTCGTCATGTAG ATAGTGTCCGTGTCCCATTTC 317 SelM (qRTPCR) JO842653 GCTGTACGATGAGAATGGAGAG AGCCAGGTGCTCAAACAA 94

89 SelN KC989560 TTAGTTTGGACACTGTGGACGGGT AGGCTTCTCTAACAACGGCACTCA 150

SelO (dsRNA) KC989561 GTTGGGCTCACCATTGACTA CGTCTCCTCCATAGCATCATAAA 321 SelO KC989561 AAGCTCGGCCTTGTGAAGAGAGAA TACAGCACGACAAGAGCTTGGACA 190 SelS (dsRNA) JO842687 CTAGCTTCGCTGATACAGTTCTC TGGTTGACACACCTCCTTTC 508 SelS JO842687 AGAACAAGTGCACCACAACAGCAG ATTTCTTGCATCCTTCGACGTGCC 107 SelT KC989562 TCTTTGTGTGTGGAGCCATCGAGA ACCACACCCGCACGTCATTAAAGT 81 SelX JO845128 ACCACTCTCCTTGGCCATCATTCA TGCACTTCCCACAGTACACCTTGA 108 Cu-Zn JO844140 GGAACCGAAGACAGCAAGAA GAGAAGAGGCCGATGACAAA 143 SOD/SOD1 Mn- SOD/SOD3 JO843979 GCATCTACTGGAC AAACCTCTC GCAGACATCAGGCCTTTGA 115 AmSigP- Duox ATG ACG CAC AGC CTG TAT ATT TGT CCA GAG TGA AGA CGA TTG 123 102197 TrxR JO843723 TGTGACTACACCAACGTGCCTACA AGTAGCCTGCATCCGTTCCTCTTT 175 Caspase1 JO842755 GAGGAGTCTAGCAGGATGTTTC ACTGTCATGCTCCGTGTAATC 127 Caspase2 JO845022 GGTGATCGTGATGTCCTGTATG CGACAGGCCTGAATGAAGAA 128

CHAPTER IV – CONCLUSIONS AND FUTURE DIRECTION

In this study, the impact of elevated oxidative stress was investigated to gain an insight into the tick’s antioxidant machinery and how these antioxidants contribute in the colonization of tick-associated microbes including pathogens of public health significance. Our results indicate the regulation of a robust antioxidant machinery upon oxidative insult by the exogenous oxidants. The antioxidant genes that demonstrated a significant upregulation in their expression are being characterized in our lab by using the RNA interference (RNAi) methodology. All significantly upregulated genes in this study must be characterized to better understand how ticks respond to oxidative stress.

As a part of this work, the antioxidant catalase was characterized and its role in tick reproductive fitness was demonstrated. It could be exploited by utilizing catalase antagonists to control the ticks. As catalase protein sequence of

Gulf Coast tick demonstrates high homology among different arthropods and humans indicating the conservation of its function. Therefore, care must be taken to avoid any side effects while designing catalase antagonists. Catalase antagonists must be designed in such a way that it is specific to ticks. Upon exogenous induction of oxidative stress in ticks, there is a significant difference in the expression pattern of antioxidants in the salivary gland and the midgut. In salivary gland, expressions of antioxidants increase between ~2-18 times when injected with H2O2, and ~2-12 times when injected with paraquat. However, in the case of the midgut, most of the genes are upregulated by ~0-2 fold in H2O2

and paraquat injected ticks (only duox ~12 folds, selM ~9 folds, selO ~5 folds).

Studies have shown that the midgut of hematophagous arthropods has evolved a very robust antioxidant system (Graca-Souza et al., 2006). Blood-digestion releases heme which generates several reactive oxygen species (ROS), which are damaging for the microbiota in the midgut (Oliveira et al., 2011). Loss of microbiota would be an extra stress on the ticks because recent literature has shown its role in immunity, development, and several other functions. Along with several antioxidant enzymes, ticks contain various detoxifying mechanisms such as heme aggregation, heme degradation and ferritin for heme and ROS detoxification (Graca-Souza et al., 2006).

Most likely, because only antioxidant genes have been considered for the study, only partial potential of antioxidant machinery of tick midgut was displayed.

To demonstrate the full potential of antioxidant machinery in tick midgut, other above mentioned antioxidant mechanisms (heme aggregation, heme degradation, and ferritin) should also be considered in a future study. Also,

Hemoxygenase (HO) is one of the main heme detoxification enzymes in midgut of hematophagous arthropods, but has not been characterized in ticks yet.

Focusing on the above mentioned antioxidant mechanisms in ticks could provide novel tick controlling strategies.

It was demonstrated that the strategy of reverse genetics would be more effective if RNA interference and corresponding protein inhibition are used simultaneously. Blocking mRNA and corresponding protein simultaneously could

serve the purpose of reverse genetics study in a much effective way, and could exhibit much proper phenotype than demonstrated by RNA interference alone.

Catalase knockdown in tick tissues demonstrated significant elevation of oxidative stress in tick tissues (salivary gland ~ 10 folds higher, midgut ~ 2.5 folds higher). Surprisingly, no other antioxidant in this study showed compensatory upregulation indicating a possible collaboration of catalase with other antioxidants required for their activity. This collaboration between catalase and other antioxidants must be investigated further for the better understanding of tick antioxidant machinery.

The significance of selO was demonstrated in tick midgut during blood- feeding irrespective of Rickettsia parkeri (Rp) infection. Being a hypothetical mitochondrial kinase, selO most likely plays a role in oxidative stress mitigation which helps ticks as well as pathogen surviving inside midgut. Although its kinase activity is yet to be confirmed, knock down studies in R. parkeri infected ticks demonstrated that selO is necessary for R. parkeri survival and colonization in the tick midgut. Rescue experiments could be designed to confirm whether selO is essential for Rp survival or not.

This study has also revealed the tissue-specific role of these selenoproteins (selO and selS). As mentioned earlier, the role of selO is specific to midgut, however selS demonstrated its role in colonization of Rp in the midgut, but more significantly in the salivary glands. The role of selS has also been revealed in the maintenance of microbiota in the salivary gland of uninfected

ticks. Previous studies have demonstrated the role of selS in ER stress mitigation, but in this case, ER stress was unaffected indicating the additional mechanism of selS for microbiota protection. However, in the case of Rp-infected tick midgut, tick microbiome and R. parkeri were found ER stress sensitive. ER stress sensitivity of R. parkeri must be investigated further by manipulating ER stress pathway components. Essential components of the pathway which could not be compensated by any other molecule must be targeted to control the pathogen. In other future studies, SelO and SelS must be expressed as protein, and in vitro assays should be performed to examine whether they demonstrate the kinase activity (SelO) and ER stress activity (SelS) or not. This information about these selenoproteins would provide some useful insight for tick antioxidant mechanism and tick-R. parkeri interaction studies.

REFERENCES

Adamson S, Browning R, Singh P, Nobles S, Villarreal A, Karim S. (2014) Transcriptional activation of antioxidants may compensate for selenoprotein deficiencies in Amblyomma maculatum (Acari: Ixodidae) injected with selK- or selM-dsRNA. Insect Mol Biol. 23:497-510.

Adamson SW, Browning RE, Budachetri K, Ribeiro JMC, Karim S. (2013) Knockdown of Selenocysteine-Specific Elongation Factor in Amblyomma maculatum Alters the Pathogen Burden of Rickettsia parkeri with Epigenetic Control by the Sin3 Histone Deacetylase Corepressor Complex. Plos One 8: e82012.

Agarwal A, Gupta S, Sharma RK. (2005). Role of oxidative stress in female reproduction. Reproductive Biology and Endocrinology 3, 28.

Agyei, A.D. and Runham, N.W. (1995) Studies on the morphological changes in the midguts of two ixodid tick species Boophilus microplus and Rhipicephalus appendiculatus during digestion of the blood meal. Int. J. Parasitol. 25, 55–62

Anderson, J.M., and Valenzuela, J.G. (2007). Spit-acular entry: Borrelia gets help from a tick salivary protein to move from the mammalian host to the arthropod vector. Cell Host and Microbe, 2: 3–4.

Anderson, J.M. et al. (2008) Exploring the mialome of ticks: an annotated catalogue of midgut transcripts from the hard tick, Dermacentor variabilis (Acari: Ixodidae). BMC Genomics 9, 552

Aucoin R, Guillet G, Murray C, Philogene BJR, Aranson JT. (1995). How do insect herbivores cope with the extreme oxidative stress of phototoxic host plants? Arch. Insect Biochem. Physiol. 29:211–226.

Ayllón N, Villar V, Galindo RC, Kocan KM, Šíma R, López JA, et al. Systems biology of tissue-specific response to Anaplasma phagocytophilum reveals differentiated apoptosis in the tick vector Ixodes scapularis. PLoS Genet. 2015; 11: e1005120.

Ayllón N, Naranjo V, Hajdušek O, Villar M, Galindo RC, Kocan KM, et al. Nuclease Tudor-SN is involved in tick dsRNA-mediated RNA interference and feeding but not in defense against flaviviral or Anaplasma phagocytophilum rickettsial infection. PLoS ONE 2015; 10: e0133038.

Babior BM. (2000). Phagocytes and oxidative stress. Am J Med. 109:33–44

Bergman, D. K., Ramachandra, R. N., and Wikel, S. K. (1998). Characterization of an immunosuppressant protein from Dermacentor andersoni (Acari: Ixodidae) salivary glands. J. Med.Entomol. 35:505–509.

Binnington, K. C., and Kemp, D. H. (1980). Role of tick salivary glands in feeding and disease transmission. Adv. Parasitol. 18:315–339.

Black IV, W.C., Bennett, K.E., Gorrocho´ tegui-Escalante, N., Barillas-Mury, C.V., Ferna´ ndez-Salas, I., Mun˜ oz, M.L., Farfa´ n-Ale´ , J.A., Olson, K.E., Beaty, B.J., 2002. Flavivirus susceptibility in Aedes aegypti. Arch. Med. Res. 33, 379–388.

Borjesson D, Kobayashi S, Whitney A, Voyich J, Argue C, Deleo F. Insights into pathogen immune evasion mechanisms: Anaplasma phagocytophilum fails to induce an apoptosis differentiation program in human neutrophils. J Immunol. 2005; 174: 6364–6372.

Bowman, A.S., Dillwith, J.W., Sauer, J.R., (1996). Tick salivary prostaglandins: presence, origin and significance. Parasitol.Today. 12:388–396.

Bratton, R.L., Corey, R., (2005). Tick-borne disease. Am. Fam. Physician 71:2323–2330.

Braz, G.R. et al. (1999) A missing metabolic pathway in the cattle tick Boophilus microplus. Curr. Biol. 9, 703–706

Briegel, H. and Lea, A.O. (1975) Relationship between protein and proteolytic activity in the midgut of mosquitoes. J. Insect Physiol. 21, 1597–1604

Browning R, Adamson S, Karim S. (2012). Choice of stable set of reference genes for qRT-PCR analysis in Amblyomma maculatum (Acari: Ixodidae). J Med Entomol, 49:1339–1346.

Brossard, M., and Wikel, S. K. (1997) Biology of interactions between ticks and hosts Med. Vet. Entomol. 11:270–276.

Brown WC. Adaptive immunity to Anaplasma pathogens and immune dysregulation: implications for bacterial persistence. Comp Immunol Microbiol Infect Dis. 2012; 35:241–52.

Bryant DD and Wilson GN. (1995). Differential evolution and expression of murine peroxisomal membrane RT protein genes. Biochem Mol Med. 55:22–30.

Burgdorfer, W., Barbour, A. G., Hayes, S. F., Benach, J. L., Grunwaldt, E, and Davis, J. P. (1982). Lyme disease-a tick-borne spirochetosis? Science 216: 1317–1319.

Bus JS and Gibson JE. (1984). Paraquat: model for oxidant-initiated toxicity. Environmental Health Perspectives, 55:37-46.

Busby AT, Ayllón N, Kocan KM, Blouin EF, de la Fuente G, Galindo RC, et al. Expression of heat-shock proteins and subolesin affects stress responses, Anaplasma phagocytophilum infection and questing behavior in the tick, Ixodes scapularis. Med Vet Entomol. 2012; 26: 92–102.

Budachetri K and Karim S. (2015). An insight into the functional role of thioredoxin reductase, a selenoprotein, in maintaining normal native microbiota in the Gulf Coast tick (Amblyomma maculatum). Insect Molecular Biology. (Early View, Online) doi: 10.1111/imb.12184.

Cabezas-Cruz A, Mateos-Hernández L, Pérez-Cruz M, Valdés J, Fernández de Mera IG, Villar M, et al. Regulation of the immune response to α-gal and vector-borne diseases. Trends Parasitol. 2015; 31: 470–476.

Caperucci, D. et al. (2010) Ultrastructure features of the midgut of the female adult Amblyomma cajennense ticks.

Fabricius, 1787 (Acari: Ixodidae) in several feeding stages and subjected to three infestations. Micron 41, 710–721.

Cavassani, K. A., Aliberti, J. C., Dias, A. R., Silva, J. S., and Ferreira, B. R. (2005). Tick saliva inhibits differentiation, maturation and function of murine bone-marrow-derived dendritic cells. Immunology 114:235–245

Chance B, Sies H, Boveris A. (1979). Hydroperoxide metabolism in mammalian organs. Physiol. Rev. 59:527-605.

Chmelař J, Kotál J, Kopecký J, Pedra JH, Kotsyfakis M. All for one and one for all on the tick-host battlefield. Trends Parasitol. 2016, in press. pii: S1471- 4922(16)00005-2.

Chmelař J, Kotál J, Karim S, Kopacek P, Francischetti IM, Pedra JH, et al. Sialomes and mialomes: A systems-biology view of tick tissues and tick- host interactions. Trends Parasitol. 2016; 32(3):242–54.

Chen YW, Yang YT, Hung DZ, Su CC, Chen KL. (2012). Paraquat induces lung alveolar epithelial cell apoptosis via Nrf-2-regulated mitochondrial dysfunction and ER stress. Arch Toxicol 86:1547-1558.

Christie, A.E., (2008). In silico analyses of peptide paracrines/hormones in Aphidoidea. Gen. Comp. Endocrinol. 159, 67–79

Citelli M, Lara FA, da Silva Vaz I Jr, Oliveira PL. (2007). Oxidative stress impairs heme detoxification in the midgut of the cattle tick, Rhipicephalus (Boophilus) microplus. Mol Biochem Parasitol, 151:81-88.

Cohen, S.B., Yabsley, M.J., Garrison, L.E., Freye, J.D., Dunlap, B.G., Dunn, J.R., Mead, D.G.,Jones, T.F., Moncayo, A.C., 2009. Rickettsia parkeri in Amblyomma americanum ticks, Tennessee and Georgia, USA. Emerg. Infect. Dis. 15, 1471.

Coons, LB.; Alberti, G. The Acari-ticks. In: Harrison, FW.; Foelix, R., editors. Microscopic anatomy of invertebrates, vol 8B. Chelicerate Arthropoda. New York: Wiley-Liss; 1999. p. 267-514.

Coons, L.B. et al. (1986) Blood meal digestion in ticks. In Morphology, Physiology, and Behavioural Biology of Ticks (Sauer, J.R. and Hair, J.A., eds), pp. 248–279, Ellis Horwood Ltd. John Wiley & Sons.

Cragun WC, Bartlett BL, Ellis MW. (2010). The expanding spectrum of eschar- associated rickettsioses in the United States. Archives of Dermatology 146: 641-648.

Crispell G, Budachetri K, Karim S. (2016). Rickettsia parkeri colonization in Amblyomma maculatum: the role of superoxide dismutases. Parasites & Vectors (2016) 9:291

Csordas G and Hajnoczky G. (2009). SR/ER-mitochondrial local communication: calcium and ROS. Biochim. Biophys. Acta 1787:1352–1362.

Dansa-Petretski M, Ribeiro JM, Atella GC, Masuda H, Oliveira PL. (1995). Antioxidant role of Rhodnius prolixus heme-binding protein. J Biol Chem; 270:10893–6.

Das, S., Banerjee, G., DePonte, K., Marcantonio, N., Kantor, F. S., and Fikrig, E. (2001). Salp25D, an Ixodes scapularis antioxidant, is 1 of 14 immunodominant antigens in engorged tick salivary glands J. Infect. Dis. 184:1056–1064.

Davey, R.B., George, J.E., (1998). In vitro and in vivo evaluations of a strain of Boophilus microplus (Acari: Ixodidae) selected for resistance to permethrin. J. Med. Entomol. 35: 1013–1019.

David M, Munaswamy V, Halappa R, Marigoudar SR. (2008). Impact of sodium cyanide on catalase activity in the freshwater exotic carp, Cyprinus carpio (Linnaeus). Pestic. Biochem. Physiol. 92:15-18.

DeJong RJ, Miller LM, Molina-Cruz A, Gupta L, Kumar S, Barillas-Mury C. (2007). Reactive oxygen species detoxification by catalase is a major determinant of fecundity in the mosquito Anopheles gambiae. Proc Natl Acad Sci 104:2121–2126.

De la Fuente, J. et al. (2008) Overview: ticks as vectors of pathogens that cause disease in humans and animals. Front. Biosci. 13, 6938–6946.

De la Fuente J, Villar M, Cabezas-Cruz A, Estrada-Peña A, Ayllón N, Alberdi P (2016) Tick– Host–Pathogen Interactions: Conflict and Cooperation. PLoS Pathog 12(4): e1005488.

De la Fuente J, Estrada-Peña A, Cabezas-Cruz A, Kocan KM. Anaplasma phagocytophilum uses common strategies for infection of ticks and vertebrate hosts. Trends Microbiol. 2016a; 24(3):173–80.

De la Fuente J, Contreras M. Tick vaccines: current status and future directions. Expert Rev Vaccines 2015; 14: 1367–1376.

De´ruaz, M., Frauenschuh, A., Alessandri, A. L., Dias, J. M., Coelho, F. M., Russo, R. C., Ferreira, B. R., Graham, G. J., Shaw, J. P., Wells, T. N., Teixeira, M. M., Power, C. A., and Proudfoot, A. E. (2008). Ticks produce highly selective chemokine binding proteins with antiinfl ammatory activity. J. Exp. Med. 205:2019–203.

Díaz A, Muñoz-Clares RA, Rangel P, Valdés VJ, Hansberg W. (2005). Functional and structural analysis of catalase oxidized by singlet oxygen. Biochimie 87:205–214.

Díaz A, Valdés VJ, Rudiño-Piñera E, Horjales E, Hansberg W. (2009). Structure– Function Relationships in Fungal Large-Subunit Catalases. J Mol Biol 386:218–232.

Drechsel DA and Patel M. (2010). Respiration-dependent H2O2 removal in brain mitochondria via the thioredoxin/peroxiredoxin system J. Biol. Chem. 285: 27850–27858.

Drummond RO, Whetstone TM. (1970). Oviposition of the Gulf Coast tick. Journal of Economic Entomology 63: 1547-1551.

Dumler, J. S., and Bakken, J. S. (1995). Ehrlichial diseases of humans: emerging tick-borne infections. Clin. Infect. Dis. 20:1102–1110.

Dumler JS. The biological basis of severe outcomes in Anaplasma phagocytophilum infection. FEMS Immunol Med Microbiol. 2012; 64:13– 20.

Du SQ, Zhou J, Jia Y, Huang KX. (2010). SelK is a novel ER stress-regulated protein and protects HepG2 cells from ER stress agent-induced apoptosis. Arch Biochem Biophys. 502:137–143.

Eremeeva ME, Dasch GA, Silverman DJ. Interaction of Rickettsiae with eukaryotic cells. Adhesion, entry, intracellular growth, and host cell responses. Subcell Biochem 2000;33:479–516.

Eremeeva ME, Silverman DJ. Effects of the antioxidant α-lipoic acid on human umbilical vein endothelial cells infected with Rickettsia rickettsii. Infect Immun 1998a ;66:2290–2299.

Eremeeva ME, Silverman DJ. Rickettsia rickettsii infection of the EA.hy 926 endothelial cell line: morphological response to infection and evidence for oxidative injury. Microbiology 1998b;144:2037–2048.

Espinoza-Gomez F, Newton-Sanchez O, Flores-Cazares G, la Cruz-Ruiz De M, Melnikov V, Austria-Tejeda J, Rojas-Larios F. (2011). Tick paralysis caused by Amblyomma maculatum on the Mexican pacific coast. Vector- Borne & Zoonotic Diseases 11: 945-946.

Ewing SA, Panciera RJ. (2003). American canine hepatozoonosis. Clinical Microbiology Reviews 16: 688-697.

Felton GW and Summers CB. (1995). Antioxidant systems in insects. Arch Insect Biochem Physiol, 29:187-197.

Flicek, B.F., 2007. Rickettsial and other tick-borne infections. Crit. Care Nurs. Clin. North Am. 19, 27–38.

Franco R and Cidlowski JA. (2009). Apoptosis and glutathione: beyond an antioxidant. Cell Death Differ, 16:1303–1314.

Francischetti I. M. B. (2010). Platelet aggregation inhibitors from hematophagous animals. Toxicon 56, 1130–1144.

Frauenschuh, A., Power, C. A., De´ruaz, M., Ferreira, B. R., Silva, J. S., Teixeira, M. M., Dias, J. M., Martin, T., Wells, T. N., and Proudfoot, A. E. (2007)

Molecular cloning and characterization of a highly selective chemokine- binding protein from the tick Rhipicephalus sanguineus J. Biol. Chem. 282:27250–27258.

Freitas, D.R.J., Rosa, R.M., Moraes, J., Campos, E., Logullo, C., Vaz, I.D. et al. (2007). Relationship between glutathione S-transferase, catalase, oxygen consumption, lipid peroxidation and oxidative stress in eggs and larvae of Boophilus microplus (Acarina : Ixodidae). Comp. Biochem. Physiol. A, 146:688–694.

Furman DP, Loomis EC. The ticks of California (Acari: Ixodida). Bull. Calif. Insect Surv 1984;25:1– 239.

Galay RL, Umemiya-Shirafuji R, Mochizuki M, Fujisaki K, Tanaka T. (2015). Iron metabolism in hard ticks (Acari: Ixodidae): The antidote to their toxic diet. Parasitology International, 64:182-189.

Gao Y, Feng HC, Walder K, Bolton K, Sunderland T, Bishara N, Quick M, Kantham L, Collier GR. (2004). Regulation of the selenoprotein SelS by glucose deprivation and endoplasmic reticulum stress - SelS is a novel glucose-regulated protein. FEBS Lett 563:185-190.

George JE, Pound JM, Davey RB (2004) Chemical control of ticks on cattle and the resistance of these parasites to acaricides. Parasitology 129:353–366

Gern, L., Schaible, U. E., and Simon, M. M. (1993). Mode of inoculation of the Lyme disease agent Borrelia burgdorferi influences infection and immune responses in inbred strains of mice. J. Infect. Dis. 167:971–975.

Ghosh, M., Sangwan, N., Sangwan, A. K., Kumar, R. and Gaur, R. S. (2014). Tissue distribution of different minerals and antioxidant status in various organs of Hyalomma anatolicum ticks (Acari: Ixodidae) Journal of Cell and Tissue Research.14: 4273-4277.

Gillespie, R. D., Dolan, M. C., Piesman, J., and Titus, R. G. (2001) Identification of an IL-2 binding protein in the saliva of the Lyme disease vector tick, Ixodes scapularis J. Immunol. 166:4319–4326.

Graca-Souza AV, Maya-Monteiro C, Paiva-Silva GO et al. (2006). Adaptations against heme toxicity in blood-feeding arthropods. Insect Biochem Mol Biol, 36:322–35.

Graf JF, Gogolewski R, Leach-Bing N, Sabatini GA, Molento MB, Bordin EL, Arantes GJ (2004) Tick control: an industry point of view. Parasitology 129:S427–S442.

100

Grandjean, O. and Aeschlimann, A. (1973) Contribution to the study of digestion in ticks: histology and fine structure of the midgut ephithelium of Ornithodorus moubata, Murray (Ixodoidea, Argasidae). Acta Trop. 30, 193–212

Griendling KK, Sorescu D, Ushio-Fukai M. (2000). NAD(P)H oxidase: role in cardiovascular biology and disease. Circ. Res. 86:494–501.

Griswold CM, Matthews AL, Bewley KE, Mahaffey JW. (1993). Molecular characterization and rescue of acatalasemic mutants of Drosophila melanogaster. Genetics 134:781−788.

Grumolato L, Ghzili H, Montero-Hadjadje M et al. (2008). Selenoprotein T is a PACAP-regulated gene involved in intracellular Ca2+ mobilization and neuroendocrine secretion. FASEB J. 22:1756–68.

Gulia-Nuss M, Nuss AB, Meyer JM, Sonenshine DE, Roe RM, Waterhouse RM, et al. Genomic insights into the Ixodes scapularis tick vector of Lyme disease. Nature Commun. 2016; 7:10507.

Gupta S, Agarwal A, Sharma RK. (2005). The role of placental oxidative stress and lipid peroxidation in preeclampsia. Obstet Gynecol Surv 60:807–816.

Gutiérrez-Uzquiza Á, Arechederra M, Bragado P, Aguirre-Ghiso JA, Porras A. (2012). p38 mediates cell survival in response to oxidative stress via induction of antioxidant genes: effect on the p70S6K pathway. J Biol Chem 287:2632–2642.

Gutteridge JMC (1986). Iron promoters of the Fenton reaction and lipid peroxidation can be released from haemoglobin by peroxides FEBS Lett. 201:291–295

Ha, E.-M., Oh, C.-T., Ryu, J.-H., Bae, Y.-S., Kang, S.-W., Jang, I.-H., Brey, P.T., Lee, W.-J., 2005. An antioxidant system required for host protection against gut infection in Drosophila. Dev. Cell 8, 125–132.

Hajdusek, O. et al. (2009) Knockdown of proteins involved in iron metabolism limits tick reproduction and development. Proc. Natl. Acad. Sci. U.S.A. 106, 1033–1038

Halliwell, B, Cross, C.E and Gutteridge, J.M.C. (1992) Free radicals, antioxidants and human disease: Where are we now? JClin LabMed.119:598-620.

101

Harman D. (2003). The free radical theory of aging. Antioxid Redox Signal 5:557- 561.

Harrison A, Bennett NC. The importance of the aggregation of ticks on small mammal hosts for the establishment and persistence of tick-borne pathogens: an investigation using the R(0) model. Parasitology (2012) 139(12):1605–13.

Hemingway, J., (2000). The molecular basis of two contrasting metabolic mechanisms of insecticide resistance. Insect Biochem. Mol. Biol. 30:1009–1015.

Henning, T.C., Orr, J.M., Smith, J.D., Arias, J.R., Norris, D.E., 2014. Spotted fever group rickettsiae in multiple hard tick species from Fairfax County, Virginia. Vector Borne Zoonotic Dis. 14, 482–485.

Ho YS, Gargano M, Cao J, Bronson RT, Heimler I, Hutz RJ. (1998). Reduced fertility in female mice lacking copper-zinc superoxide dismutase. J Biol Chem 273:7765–7769.

Ho YS, Xiong Y, Ma W, Spector A, Ho DS. (2004). Mice lacking catalase develop normally but show differential sensitivity to oxidant tissue injury. J Biol Chem 279:32804–32812.

Hooker WA, Bishopp FC, Wood HP, Hunter WD. (1912). The life history and bionomics of some North American ticks. USDA, Bureau of Entomology.

Holmstöm KM and Finkel T. (2014) Cellular mechanisms and physiological consequences of redox-dependent signaling. Nat. Rev. Mol. Cell Biol., 15:411-421.

Hosamani R and Muralidhara (2013). Acute exposure of Drosophila melanogaster to paraquat causes oxidative stress and mitochondrial dysfunction. Arch. Insect Biochem. Physiol., 83:25–40.

Hovius, J. W., van Dam, A. P., and Fikrig, E. (2007). Tick-host-pathogen interactions in Lyme borreliosis. Trends Parasitol. 23:434–438.

Hovius, J. W., de Jong, M. A., den Dunnen, J., Litjens, M., Fikrig, E., van der Poll, T., Gringhuis, S. I., and Geijtenbeek, T. B. (2008) Salp15 Binding to DC- SIGN Inhibits Cytokine Expression by Impairing both Nucleosome Remodeling and mRNA Stabilization PLoS Pathog 4, e31

Hovius, J. W., Schuijt, T. J., de Groot, K. A., Roelofs, J. J., Oei, G. A., Marquart, J. A., de Beer, R., van ’t Veer, C., van der Poll, T., Ramamoorthi, N.,

102

Fikrig, E., and van Dam, A. P. (2008) Preferential protection of Borrelia burgdorferi sensustricto by a Salp15 homologue in Ixodes ricinus saliva. J. Infect. Dis. 198:1189–1197.

Hu Q, Corda S, Zweier JL, Capogrossi MC, Ziegelstein RC. (1998). Hydrogen peroxide induces intracellular calcium oscillations in human aortic endothelial cells. Circ. Res. 97:268–275.

Huang Z, Hoffmann FW, Norton RL, Hashimoto AC, Hoffmann PR. (2011). Selenoprotein K is a novel target of m-calpain, and cleavage is regulated by Toll-like receptorinduced calpastatin in macrophages. J Biol Chem 286:34830–34838.

Jeong D, Kim TS, Chung YM et al. (2002). Selenoprotein W is a glutathione- dependent antioxidant in vivo. FEBS Lett 517:225-228.

Jing XH, Wang XH, Kang L. (2005). Chill injury in the eggs of the migratory locust, Locusta migratoria (Orthoptera: Acrididae): the time-temperature relationship with high-temperature interruption. Insect Science 12:171– 178.

Ibrahim MA, Mohamed MM, Ghazy, A.M. et al. (2016). Purification and characterization of two glutathione peroxidases from embryo of the camel tick Hyalomma dromedarii Russ J Bioorg Chem (2016) 42: 272.

Joanisse DR and Storey KB. (1996). Oxidative stress and antioxidants during overwintering in larvae of cold-hardy goldenrod gall insects. J. Exp. Biol. 199:1483-1491.

Jones DP and Go YM. (2010). Redox compartmentalization and cellular stress. Diabetes Obes. Metab., 12:116-125.

Jones P and Suggett A. (1968). The catalase–hydrogen peroxide system. Kinetics of catalytic action at high substrate concentrations. Biochemical Journal. 110:617-620.

Juncadella, I. J., Garg, R., Ananthnarayanan, S. K., Yengo, C. M., and Anguita, J. (2007) T-cell signaling pathways inhibited by the tick saliva immunosuppressor, Salp15. FEMS Immunol. Med. Microbiol. 49:433–438.

Karim S, Essenberg RC, Dillwith JW, Tucker JS, Bowman AS, Sauer JR. (2002) Identification of SNARE and cell trafficking regulatory proteins in the salivary glands of the lone star tick, Amblyomma americanum (L.). Insect Biochem Mol Biol, 32:1711–1721.

103

Karim S, Singh P, Ribeiro JM. (2011). A deep insight into the sialotranscriptome of the gulf coast tick, Amblyomma maculatum. PLoS One; 6:e28525.

Karim S and Adamson SW. (2012). RNA interference in ticks: a functional genomics tool for the study of physiology. In Small RNAs: Their Diversity, Roles, and Practical Uses. Jockusch, EL, Ed. Elsevier, Storrs. Vol. 42:119–154.

Kumar, S. et al. (2010) A peroxidase/dual oxidase system modulates midgut epithelial immunity in Anopheles gambiae. Science 327, 1644–1648.

Kumar D, Budachetri K, Meyers VC, Karim S. (2016). Assessment of tick antioxidant responses to exogenous oxidative stressors and insight into the role of catalase in the reproductive fitness of the Gulf Coast tick, Amblyomma maculatum. Insect Molecular Biology, 25(3), 283–294.

Kashiwagi A, Kashiwagi K, Takase M, Hanada H, Nakamura M. (1997). Comparison of catalase in diploid and haploid Rana rugosa using heat and chemical inactivation techniques. Comp. Biochem. Physiol. Part B 118:499–503.

Kaufman WR. (2007) Gluttony and sex in female ixodid ticks: how do they compare to other blood-sucking arthropods? J Insect Physiol, 53:264-273.

Kawasaki L and Aguirre J. (2001). Multiple catalases genes are differentially regulated in Aspergillus nidulans. J. Bacteriol. 183:1434–1440.

Kim SH and Lee WJ. (2014). Role of DUOX in gut inflammation: lessons from Drosophila model of gut–microbiota interactions. Front. Cell Infect. Microbiol., 3:116-125.

Kimura I, Ozawa K, Inoue D, Imamura T, Kimura K, Maeda T, Terasawa K, Kashihara D, Hirano K, Tani T et al. (2013). The gut microbiota suppresses insulin-mediated fat accumulation via the short-chain fatty acid receptor GPR43. Nat Commun, 4:1829.

Kohlhaas M, Maack C. (2013). Calcium release microdomains and mitochondria. Cardiovasc Res. 98:259-268.

Kostaropoulos, I., Papadopoulos, A.I., Metaxakis, A., Boukouvala, E., Papadopoulou-Mourkidou, E., (2001). Glutathione S-transferase in the defence against pyrethroids in insects. Insect Biochem. Mol. Biol. 31:313– 319.

104

Kotsyfakis, M., Anderson, J. M., Andersen, J. F., Calvo, E., Francischetti, I. M., Mather, T. N., Valenzuela, J. G., and Ribeiro, J.M. (2008). Immunity against a “silent” salivary antigen of the Lyme vector Ixodes scapularis impairs its ability to feed. J. Immunol.181:5209–5212.

Kotsyfakis, M., Sa´-Nunes, A., Francischetti, I. M., Mather, T. N., Andersen, J. F., and Ribeiro, J. M. (2006). Antiinflammatory and immunosuppressive activity of sialostatin L, a salivary cystatin from the tick Ixodes scapularis. J. Biol. Chem. 281:26298–26307.

Kregel KC and Zhang HJ. (2007). An integrated view of oxidative stress in aging: basic mechanisms, functional effects, and pathological considerations. Am. J. Physiol. Regul. Integr. Comp. Physiol., 292:18–36.

Koreny, L. et al. (2013) Make it, take it, or leave it: heme metabolism of parasites. PLoS Pathog. 9, e1003088

Kumar, S., Barillas-Mury, C., 2005. Ookinete-induced midgut peroxidases detonate the time bomb in anopheline mosquitoes. Insect Biochem. Mol. Biol. 35, 721–727.

Labunsky VM, Yoo MH, Hatfield DL, Gladyshev VN. (2009). Sep15, a thioredoxin-like selenoprotein, is involved in the unfolded protein response and differentially regulated by adaptive and acute ER stresses. Biochemistry. 48:8458–8465.

Lai R, Takeuchi H, Lomas LO, Turner PC, Jonczy J, Rees HH (2004) A new type of antimicrobial protein with multiple histidines from the hard tick, Amblyomma hebraeum. FASEB J 18:1447–1449.

Lara FA, Lins U, Paiva-Silva G, Almeida IC, Braga CM, Miguens FC, et al. (2003). A new intracellular pathway of haem detoxification in the midgut of the cattle tick Boophilus microplus: aggregation inside a specialized organelle, the hemosome. J Exp Biol, 206:1707-1715.

Lara, F.A. et al. (2005) Tracing heme in a living cell: hemoglobin degradation and heme traffic in digest cells of the cattle tick Boophilus microplus. J. Exp. Biol. 208, 3093–3101

Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. (2007). ClustalW and ClustalX version 2.0. Bioinformatics 23:2947– 2948.

105

Lardinois OM, Mestdagh MM, Rouxhet PG. (1996). Reversible inhibition and irreversible inactivation of catalase in presence of hydrogen peroxide. Biochim. Biophys. Acta 1295:222–238.

Leboulle G, Crippa M, Decrem Y, Mejri N, Brossard M, Bollen A, Godfroid E. (2002) Characterization of a novel salivary immunosuppressive protein from Ixodes ricinus ticks. J Biol Chem. 277:10083– 10089.

Lees, K., Bowman, A.S. (2007). Tick neurobiology: recent advances and the postgenomic era. Invert. Neurosci. 7:183–198.

Lescure A, Rederstorff M, Krol A, Guicheney P, Allamand V (2009). Selenoprotein function and muscle disease. Biochim Biophys Acta 1790:1569–1574.

Li WG, Miller FJ Jr., Zhang HJ, Spitz DR, Oberley LW, and Weintraub NL (2001) H2O2-induced O2 production by a non-phagocytic NAD(P)H oxidase causes oxidant injury. J Biol Chem 276:29251–29256.

Liochev SI, Fridovich I (2010). Mechanism of the peroxidase activity of Cu, Zn superoxide dismutase. Free Radic Biol Med. 48:1565–1569.

Lismont C, Nordgen M, Van Veldhoven PP, Fransen M. (2015) Redox interplay between mitochondria and peroxisomes. Front. Cell Dev. Biol., 3:35

Lobanov, A.V., Hatfield, D.L. and Gladyshev, V.N. (2009) Eukaryotic selenoproteins and selenoproteomes. Biochim Biophys Acta 1790: 1424– 1428.

Lu C, Qiu F, Zhou H, Peng Y, Hao W, Xu J, Yuan J, Wang S, Qiang B, Xu C, Peng X. (2006). Identification and characterization of selenoprotein K: an antioxidant in cardiomyocytes. FEBS Lett 580:5189–5197.

Mackay WJ and Bewley GC. (1989). The Genetics of Catalase in Drosophila melanogaster: Isolation and characterization of Acatalasemic Mutants. Genetics 122:643–652.

Mahan SM, Peter TF, Simbi BH, Kocan K, Camus E, Barbet AF, Burridge MJ. (2000). Comparison of efficacy of American and African Amblyomma ticks as vectors of Heartwater (Cowdria ruminantium) infection by molecular analyses and transmission trials. The Journal of Parasitology 86: 44-49.

Manduzio H, Monsinjon T, Galap C, Leboulenger F, Rocher B (2004). Seasonal variations in antioxidant defences in blue mussels Mytilus edulis collected from a polluted area: major contributions in gills of an inducible isoform of 106

Cu/Znsuperoxide dismutase and of glutathione S-transferase. Aquat Toxicol 7:83–93

Mariotti, M., Ridge, P.G., Zhang, Y., Lobanov, A.V., Pringle, T.H., Guigo, R. et al. (2012) Composition and evolution of the vertebrate and mammalian selenoproteomes. PLoS ONE 7: e33066. Maya-Monteiro CM, Daffre S, Logullo C. (2000) HeLp, a heme lipoprotein from the hemolymph of the cattle tick Boophilus microplus. J Biol Chem. 275:36584– 36589.

Maya-Monteiro CM, Alves LR, Pinhal N, Abdalla DSP, Oliveira PL (2004). HeLp, a heme-transporting lipoprotein with an antioxidant role. Insect Biochem Mol Biol. 34:81–87.

Melov S, Ravenscroft J, Malik S, Gill MS, Walker DW, Clayton PE, Wallace DC, Malfroy B, Doctrow SR, Lithgow GJ. (2000). Extension of life-span with superoxide dismutase/ catalase mimetics. Science 289:1567–1569.

Monaghan P, Metcalfe NB, Torres R. (2009). Oxidative stress as a mediator of life history trade-offs: mechanisms, measurements and interpretation. Ecol. Lett. 12: 75–92.

Mangel M and Munch SB. (2005). A life-history perspective on short- and long- term consequences of growth compensation. Am. Nat. 166:155-176.

Manduzio H, Monsinjon T, Galap C, Leboulenger F, Rocher B. (2004). Seasonal variations in antioxidant defences in blue mussels Mytilus edulis collected from a polluted area: major contributions in gills of an inducible isoform of Cu/Zn-superoxide dismutase and of glutathione S-transferase. Aquat Toxicol, 7:83–93.

McClung CR (1997). Regulation of catalases in Arabidopsis. Free Radic Biol Med, 23:489–496.

Milhano N, Palma M, Marcili A, Nuncio MS, de Carvalho IL, de Sousa R. Rickettsia lusitaniae sp. nov. isolated from the soft tick Ornithodoros erraticus(Acarina: Argasidae). Comp Immunol Microbiol Infect Dis (2014) 37(3):189–93.

Nagababu E, Rifkind JM.( 2000) Heme degradation during autoxidation of oxyhemoglobin. Biochem Biophys Res Commun. 273:839–45.

107

Nadolny RM, Wright CL, Sonenshine DE, Hynes WL, Gaff HD. (2014). Ticks and spotted fever group rickettsiae of southeastern Virginia. Ticks and Tick- Borne diseases 5: 53-57.

Nallella K, Sharma P, Rakesh K, Allamaneni, Shyam SR, Agarwal A. (2005). Identification of male factor infertility using a novel semen quality score and reactive oxygen species levels. Clinics. 60:317-324.

Narasimhan S, Rajeevan N, Liu L et al. (2014). Gut Microbiota of the Tick Vector Ixodes scapularis Modulate Colonization of the Lyme Disease Spirochete. Cell Host & Microbe., 15:58-71.

Narasimhan S, Fikrig E. Tick microbiome: the force within. Trends Parasitol. 2015; 31: 315–323.

Nava, S. et al. (2009) An overview of systematics and evolution of ticks. Front. Biosci. 14, 2857–2877.

Neelakanta G, Sultana H, Fish D, Anderson JF, Fikrig E. Anaplasma phagocytophilum induces Ixodes scapularis ticks to express an antifreeze glycoprotein gene that enhances their survival in the cold. J Clin Invest. 2010; 120: 3179–3190.

Nonaka E, Ebel GD, Wearing HJ. Persistence of pathogens with short infectious periods in seasonal tick populations: the relative importance of three transmission routes. PLoS One (2010) 5(7):e11745.

Nuttall, P. A., Paesen, G. C., Lawrie, C. H., and Wang, H. (2000) Vector-host interactions in disease transmission. J. Mol.Microbiol. Biotechnol. 2:381– 386.

Oliveira MF, Silva JR, Dansa-Petretski M (1999). Haem detoxification by an insect. Nature. 400:517–8.

Oliveira JHM, Gonc-alves RLS, Lara FA, Dias FA, Gandara ACP et al. (2011). Blood Meal-Derived Heme Decreases ROS Levels in the Midgut of Aedes aegypti and Allows Proliferation of Intestinal Microbiota. PLoS Pathog 7:e1001320.

Oliveira Gde, A. et al. (2012) Epithelial nitration by a peroxidase/NOX5 system mediates mosquito antiplasmodial immunity. Science 335, 856–859

Orr WC and Sohal RS. (1994). Extension of life-span by overexpression of superoxide dismutase and catalase in Drosophila melanogaster. Science 263:1128-1130.

108

Paddock CD, Sumner JW, Comer JA, Zaki SR, Goldsmith CS, Goddard J. et al. (2004) Rickettsia parkeri: a newly recognized cause of spotted fever rickettsiosis in the United States. Clin Infect Dis 38:805–811.

Paddock, C.D., Goddard, J., 2015. The evolving medical and veterinary importance of the Gulf Coast tick (Acari: Ixodidae). J. Med. Entomol. 52, 230–252.

Paes MC, Oliveira MB, Oliveira PL. (2001). Hydrogen peroxide detoxification in the midgut of the blood-sucking insect, Rhodnius prolixus. Arch. Insect Biochem. Physiol. 41:171–177.

Parker, R.R., Hohls, G.M., Cox, G.W., Davis, G.E., 1939. Observations on an Infectious agents from Amblyomma maculatum. Public Health Rep. 54, 1482–1484.

Parkes TL, Kirby K, Phillips JP, Hilliker AJ. (1998). Transgenic analysis of the cSOD-null phenotypic syndrome in Drosophila. Genome. 41:642–651.

Parola P, Raoult D. Tick-borne bacterial diseases emerging in Europe. Clin Microbiol Infect 2001; 7: 80–83.

Parola P, Paddock CD, Socolovschi C. (2013). Update on tick-borne rickettsioses around the world: a geographic approach. Clinical Microbiology Reviews 26: 657-702.

Patrick CD and Hair JA. (1975). Laboratory rearing procedures and equipment for multi-host ticks (Acarina: Ixodidae). J Med Entomol 12:389–390.

Pierre N, Barbe C, Gilson H, Deldcque L, Raymacker JM, Francaux M. (2014). Activation of ER stress by hydrogen peroxide. Biochem. Biophys. Res. Comm. 450:459–463.

Price WH.The epidemiology of Rocky Mountain spotted fever. II. Studies on the biological surviva lmechanism of Rickettsia rickettsii. AmJ Hyg (1954) 60(3):292–319.

Burgdorfer W,Brinton LP.Mechanisms of transovarial infection of spotted fever Rickettsiae in ticks. Ann NY Acad Sci (1975) 266:61–72.

Putnam CD, Arvai AS, Bourne Y, Tainer JA. (2000) Active and inhibited human catalase structures: ligand and NADPH binding and catalytic mechanism. J Mol Biol 296:295–309.

109

Radulović, Ž. M., Kim, T. K., Porter, L. M., Sze, S.-H., Lewis, L., & Mulenga, A. (2014). A 24-48 h fed Amblyomma americanum tick saliva immuno- proteome. BMC Genomics, 15: 518.

Ramamoorthi, N., Narasimhan, S., Pal, U., Bao, F., Yang, X. F., Fish, D., Anguita, J., Norgard, M. V., Kantor, F. S., Anderson, J. F., Koski, R. A., and Fikrig, E. (2005). The Lyme disease agent exploits a tick protein to infect the mammalian host. Nature. 436:573–577.

Randolph SE. Transmission of tick-borne pathogens between co-feeding ticks: Milan Labuda’s enduring paradigm. Ticks Tick Borne Dis (2011) 2(4):179– 82.

Raoult D and Paddock CD. (2005) Rickettsia parkeri infection and other spotted fevers in the United States. N Engl J Med. 353:626–627.

Rathore R, Zheng YM, Niu CF, Liu QH, Korde A, Ho YS, Wang YX. (2008) Hypoxia activates NADPH oxidase to increase [ROS]i and [Ca2+]i through the mitochondrial ROS-PKCepsilon signaling axis in pulmonary artery smooth muscle cells. Free Radic Biol Med 45:1223–1231.

Rechav Y, Drey C, Fielden LJ, Goldberg M. (2000). Production of pheromones by artificially fed males of the tick Amblyomma maculatum (Acari: Ixodidae). Journal of Medical Entomology 37: 761-765.

Remedio, R.N. et al. (2013) Morphology of the midgut of Rhipicephalus sanguineus (Latreille, 1806) (Acari: Ixodidae) adult ticks in different feeding stages. Parasitol. Res. 112, 415–425

Reeves MA, Bellinger FP, and Berry MJ. (2010). The neuroprotective functions of selenoprotein M and its role in cytosolic calcium regulation. Antioxid Redox Signal 12:809-18.

Ribeiro, J.M. (1988) The midgut hemolysin of Ixodes dammini (Acari:Ixodidae). J. Parasitol. 74, 532–537.

Ribeiro, J. M. (1995). Blood-feeding arthropods: Live syringes or invertebrate pharmacologists? Infect. Agents Dis. 4:143–152.

Ribeiro, J.M.,Alarcon-Chaidez, F., Francischetti, I.M., Mans, B.J.,Mather, T.N., Valenzuela, J.G. and Wikel, S.K. (2006). An annotated catalog of salivary gland transcripts from Ixodes scapularis ticks. Insect Biochem.Mol.Biol. 36:111-129.

110

Ribeiro, J. M., and Francischetti, I. M. (2003). Role of arthropod saliva in blood feeding: sialome and post-sialome perspectives: Annu. Rev. Entomol. 48: 73-88.

Rojas RR and Leopold RA. (1996). Chilling injury in the housefly: Evidence for the role of oxidative stress between pupariation and emergence. Cryobiology, 33:447–458.

Rydkina E, Silverman DJ, Sahni SK. Similarities and differences in host cell signaling following infection with different Rickettsia species. Ann NY Acad Sci 2005;1063:203–206.

Rydkina E, Sahni A, Silverman DJ, Sahni SK. Rickettsia rickettsii infection of cultured human endothelial cells induces heme oxygenase 1 expression. Infect Immun 2002;70:4045–4052.

Rydkina E, Sahni SK, Santucci LA, Turpin LC, Baggs RB, Silverman DJ. Selective modulation of antioxidant enzyme activities in host tissues during Rickettsia conorii infection. Microb Pathog 2004;36:293–301.

Ryter SW and Tyrrell RM. (2000). The heme synthesis and degradation pathways: role in oxidant sensitivity. Heme oxygenase has both proand antioxidant properties. Free Radic. Biol. Med. 28:289–309.

Sahni, S.K. and Rydkina, E. (2009) Host-cell interactions with pathogenic Rickettsia species. Future Microbiol. 4, 323–339.

Sampayo JN, Olsen A, Lithgow GJ. (2003). Oxidative stress in Caenorhabditis elegans: protective effects of superoxide dismutase/catalase mimetics. Aging Cell, 2:319–326.

Schriner SE, Linford NJ, Martin GM, Treuting P, Ogburn CE, Emond M, Coskun PE, Ladiges W, Wolf N, Van Remmen H et al. (2005). Extension of murine life span by overexpression of catalase targeted to mitochondria. Science 308:1909–1911.

Seo JS, Lee KW, Rhee JS, Hwang DS, Lee YM, Park HG, Ahn IY, Lee JS. (2006). Environmental stressors (salinity, heavy metals H2O2 modulate expression of glutathione reductase (GR) gene from the intertidal copepod Tigriopus japonicus. Aquat. Toxicol., 80:281–289.

Severo MS, Pedra JHF, Ayllón N, Kocan KM, de la Fuente J. Anaplasma. In: Tang YW, Sussman M, Liu D, Poxton I, Schwartzman J, editors. Molecular Medical Microbiology (2nd edition). Academic Press: Elsevier; 2015. Volume 3, Chapter 110, pp. 2033–2042.

111

Shchedrina VA, Zhang Y, Labunskyy VM et al. (2010). Structure function relations, physiological roles, and evolution of mammalian ER-resident selenoproteins. Antioxid Redox Signal, 12:839–849.

Shchedrina, VA., Vorbruggen, G., Lee, B.C., Kim, H.Y., Kabil, H., Harshman, L.G., Gladyshev, V.N. (2009). Overexpression of methionine-R-sulfoxide reductases has no influence on fruit fly aging. Mech. Ageing Dev. 130:429–443.

Silverman DJ. Rickettsia rickettsii-induced cellular injury of human vascular endothelium in vitro. Infect Immun 1984;4:4, 545–553.

Simser JA, Palmer AT, Munderloh UG, Kurtti TJ. Isolation of a spotted fever group Rickettsia, Rickettsia peacockii, in a Rocky Mountain wood tick,Dermacentor andersoni, cell line. Appl Environ Microbiol (2001) 67(2):546–52. Smit, J.D. et al. (1977) Haemoglobin crystals in the midgut of the tick Ornithodorus moubata Murray. Nature 266, 536–538

Soares MP, Yilmaz B. Microbiota Control of Malaria Transmission. Trends Parasitol. 2016; 32:120–30.

Sojka D, Franta Z, Horn M, Caffrey CR, Mareš M, Kopáček P. (2013) New insights into the machinery of blood digestion by ticks. Trends Parasitol, 29:276–285.

Son, Y.-O., Choi, K.-C., Lee, J.-C., Kook, S.-H., Lee, H.-J., Jeon, Y.-M., Kim, J.- G., Kim, J., Lee, W.-K. and Jang, Y.-S. (2006), Involvement of caspase activation and mitochondrial stress in trichostatin A-induced apoptosis of Burkitt's lymphoma cell line, Akata. J. Cell. Biochem., 99: 1420–1430.

Sonenshine, D.E. 1991. Biology of ticks. Vol. 1, Oxford University Press, Oxford

Spector A, Huang RR, Huang C, Wang GM, Schmidt C, Yan GZ, Chifflet S. (1987). Does elevated glutathione protect the cell from H2O2 insult? Exp. Eye Res., 45: 453-465.

Spencer JP, Jenner A, Chimel K. (1995). DNA damage in human respiratory tract epithelial cells: damage by gas phase cigarette smoke apparently involves attack by reactive nitrogen species in addition to oxygen radicals. FEBS Lett; 375:179–82.

Stanley BA, Sivakumaran V, Shi S, McDonald I, Lloyd D, Watson WH, Aon MA, Paolocci N. (2011). Thioredoxin reductase-2 is essential for keeping low

112

levels of H(2)O(2) emission from isolated heart mitochondria. J. Biol. Chem. 286:33669–33677.

Storz G and Tartaglia LA (1992). OxyR: A Regulator of Antioxidant Genes. J Nutr 122:627–630.

Stolf BS, Smyrnias I, Lopes LR, Vendramin A, Goto H et al. (2011) Protein disulfide isomerase and host-pathogen interaction. ScientificWorldJournal 11: 1749-1761.

Swanson, S.J., Neitzel, D., Reed, K.D., Belongia, E.A., 2006. Coinfections acquired from ixodes ticks. Clin. Microbiol. Rev. 19, 708–727.

Stromdahl EY, Vince MA, Billingsley PM, Dobbs NA, Williamson PC. Rickettsia amblyommii infecting Amblyomma americanum larvae. Vector Borne Zoonotic Dis (2008) 8(1):15–24.

Switala J and Loewen PC. (2002) Diversity of properties among catalases. Arch. Biochem. Biophys. 401:145–154.

Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. ( 2013 ) MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol, 30: 2725–2729.

Tappel AL (1955). Unsaturated lipid oxidation catalyzed by hematin compounds. J Biol Chem 217:721–733.

Taylor MA (2001) Recent developments in ectoparasiticides. Vet J 161:253–268

Teel PD, Ketchum HR, Mock DE, Wright RE, Strey OF. (2010). The Gulf Coast tick: a review of the life history, ecology, distribution, and emergence as an arthropod of medical and veterinary importance. Journal of Medical Entomology 47: 707-722.

Telford SR III. Status of the “east side hypothesis” (transovarial interference) 25 years later. Ann N Y Acad Sci (2009) 1166:144–50.

Touat-Hamici Z, Legrain Y, Bulteau AL, Chavatte L. (2014). Selective upregulation of human selenoproteins in response to oxidative stress. J. Biol. Chem. 289:14750–14761.

Toh, S.Q. et al. (2010) Heme and blood-feeding parasites: friends or foes? Parasit. Vectors 3, 108.

113

Troughton DR, Levin ML. Life cycles of seven ixodid tick species (Acari: Ixodidae) under standardized laboratory conditions. J Med Entomol (2007)44(5):732–40.

Valentina A, Shchedrina VA, Zhang Y, Vyacheslav M, Labunsky Y, Dolph HL, Gladyshev VN. (2010). Structure–Function Relations, Physiological Roles, and Evolution of Mammalian ER-Resident Selenoproteins. Antioxid Redox Signal 12:839–849.

Van Solingen, R.M., Evans, J. (2001). Lyme disease. Curr. Opin. Rheumatol. 13:293– 299.

Vayssier-Taussat M, Kazimirova M, Hubalek Z, Hornok S, Farkas R, Cosson JF, et al. Emerging horizons for tick-borne pathogens: from the 'one pathogen-one disease' vision to the pathobiome paradigm. Future Microbiol. 2015; 10: 2033–2043.

Verma S, Hoffmann FW, Kumar M, Huang Z, Roe K, Nguyen-Wu E. et al. (2011) Selenoprotein K knockout mice exhibit deficient calcium flux in immune cells and impaired immune responses. J Immunol, 186:2127–2137.

Villar M, Ayllón N, Alberdi P, Moreno A, Moreno M, Tobes R, et al. Integrated metabolomics, transcriptomics and proteomics identifies metabolic pathways affected by Anaplasma phagocytophilum infection in tick cells. Mol Cell Proteomics 2015; 14: 3154–3172.

Villarreal AM, Adamson SW, Browning RE, Budachetri K, Sajid MS, Karim S. (2013) Molecular characterization and functional significance of the Vti family of SNARE proteins in tick salivary glands. Insect Biochem Mol Biol, 43:483–493.

Vorou, R.M., Papavassiliou, V.G., Tsiodras, S., 2007. Emerging zoonoses and vectorborne infections affecting humans in Europe. Epidemiol. Infect. 135, 1231– 1247.

Walczak CP, Bernardi KM, Tsai B (2012) Endoplasmic reticulumdependent redox reactions control endoplasmic reticulum-associated degradation and pathogen entry. Antioxid Redox Signal 16: 809-818.

Wade MJ. The co-evolutionary genetics of ecological communities. Nat Rev Genet. 2007; 8: 185–195.

Walker DH, Paddock CD, Dumler JS. (2008). Emerging and re-emerging tick- transmitted rickettsial and ehrlichial infections. Medical Clinics of North America 92: 1345-1361.

114

Waterhouse AM, Procter JB, Martin DM, Clamp M, Barton GJ. (2009). Jalview Version 2 – a multiple sequence alignment editor and analysis workbench. Bioinformatics, 25:1189–1191.

Wen, B., Cao, W., and Pan, H. (2003). Ehrlichiae and ehrlichial diseases in china. Ann. N.Y. Acad. Sci. 990:45–53

Whitman TJ, Richards AL, Paddock CD, Tamminga CL, Sniezek PJ, Jiang J et al. (2007). Rickettsia parkeri infection after tick bite, Virginia. Emerg Infect Dis., 13:334–336.

Wikel, S.K. (1999). Tick modulation of host immunity: an important factor in pathogen transmission. Int. J. Parasitol. 29:851–859.

Wikel S. Ticks and tick-borne pathogens at the cutaneous interface: host defenses, tick countermeasures, and a suitable environment for pathogen establishment. Front Microbiol. 2013; 4:337.

Wright, C.L., H.D. Gaff, D.E. Sonenshine, and W.L. Hynes. 2015. Experimental vertical transmission of Rickettsia parkeri in the Gulf Coast tick, Amblyomma maculatum. Ticks Tick Borne Dis. Jul;6(5): 568–573.

Wu J, Wang Y, Liu H, Yang H, Ma D, Li J, Li D, Lai R,Yu H (2010). Two immunoregulatory peptides with antioxidant activity from tick salivary glands. J. Biol. Chem. 285:11606-11663.

Yang J, Dong S, Jiang Q, Si Q, Liu X. (2013). Characterization and expression of cytoplasmic copper/zinc superoxide dismutase (CuZn SOD) gene under temperature and hydrogen peroxide (H2O2) in rotifer Brachionus calyciflorus. Gene, 518:388–396.

Ye Y, Shibata Y, Yun C, Ron D and Rapoport TA. (2004). A membrane protein complex mediates retro-translocation from the ER lumen into the cytosol. Nature, 429:841-847.

Yilmaz B, Portugal S, Tran TM, Gozzelino R, Ramos S, Gomes J, et al. Gut microbiota elicits a protective immune response against malaria transmission. Cell 2014; 159: 1277–1289.

Yoder JA, Christensen BS, Croxall TJ, Schumaker LK, Tank JL. (2008). Moisture requirements for activity/survival of the Gulf Coast tick, Amblyomma maculatum Koch (Acari: Ixodidae), based on a water balance study of all life stages. International Journal of Acarology 34: 285-292.

115

Yuan J (2006) Divergence from a dedicated cellular suicide mechanism: exploring the evolution of cell death. Mol Cell 23: 1-12.

Zaman K, MacGill RS, Johnson JE, Ahmad S, Pardini RS. (1995). An insect model for assessing oxidative stress related to arsenic toxicity. Arch Insect Biochem Physiol, 29:199–209.

Zamocky M, Furtmuller PG, Obinger C. 2008. Evolution of catalases from bacteria to humans. Antioxid Redox Signal. 10: 1527-1548.

Zhao H, Yi X, Hu Z, Hu M, Chen S, Muhammad RH, Dong X, Gong L. (2013). RNAi-mediated knockdown of catalase causes cell cycle arrest in SL-1 cells and results in low survival rate of Spodoptera litura (Fabricius). PLoS One, 8:e59527.

Zhou X, Li D, Resnick M B, Behar J, Wands J, Cao W (2011). Signaling in H2O2- induced increase in cell proliferation in Barrett's esophageal adenocarcinoma cells. J Pharmacol Exp Ther, 339: 218–227.

116