ABSTRACT
THERIOT, CASEY MICHELLE. The Structure and Function of Thermostable Prolidases from Pyrococcus sp. (Under the direction of Dr. Amy M. Grunden).
Prolidase is a metallopeptidase that is ubiquitous in nature and has been isolated from mammals, bacteria and archaea. Prolidase specifically hydrolyzes dipeptides with a prolyl residue in the carboxy terminus (NH2-X-/-Pro-COOH). Current applications using prolidase to detoxify OP nerve agents include its incorporation into enzyme-based cocktails, fire- fighting foams and as biosensors for OP compound detection. Prolidases are also employed in the cheese ripening process to improve cheese taste and texture. In humans, prolidase deficiency (PD) is a rare autosomal recessive disorder that affects the connective tissue.
Symptoms of PD include skin lesions, mental retardation and recurrent respiratory infections.
Enzyme replacement therapies are currently being studied in an effort to optimize enzyme delivery and stability for this application. Previously, prolidase has been linked to collagen metabolism and more recently is being associated with melanoma. Increased prolidase activity in melanoma cell lines has lead investigators to create cancer prodrugs targeting this enzyme. Thus, there are many biotechnological applications using recombinant and native forms of prolidase.
The first solved structure of prolidase was from the hyperthermophilic archaeon
Pyrococcus furiosus, but more recently the structures from Pyrococcus horikoshii and
Alteromonas sp. strain JD6.5 have been solved. Prolidase is able to degrade toxic organophosphorus compounds, namely by cleaving the P-F and P-O bonds in the nerve agents sarin and soman. However, current applications that include an enzyme-based
cocktail are limited by long-term enzyme stability and reactivity over a broad range of temperatures. To obtain a better enzyme for organophosphorus nerve agent decontamination and to investigate the structural factors that may influence protein thermostability and thermoactivity, randomly mutated P. furiosus prolidases were prepared by using both XL1- red-based mutagenesis and error prone PCR. An Escherichia coli strain JD1 ( DE3)
(auxotrophic for proline [ proA] and with deletions in pepQ and pepP dipeptidases with specificity for proline-containing dipeptides) was constructed for screening mutant P. furiosus prolidase expression plasmids. By using this positive selection, Pyrococcus prolidase mutants with improved activity at low temperatures were isolated. These mutants were further characterized to obtain better understanding of substrate catalysis with proline- dipeptides and OP nerve agents over a range of temperatures, and the relationship of these features with thermoactivity and thermostability is discussed.
The advantages of using hyperthermophilic enzymes in biodetoxification strategies are based on their enzyme stability and efficiency. Therefore, it is advantageous to examine new thermostable prolidases for potential use in biotechnological applications. Two thermostable prolidase homologs, PH1149 and PH0974, were identified in the genome of P. horikoshii based on their sequences having conserved metal binding and catalytic amino acid residues that are present in other known prolidases, such as the previously characterized P. furiosus prolidase. These P. horikoshii prolidases were expressed recombinantly in the E. coli strain BL21 (λDE3), and both were shown to function as proline dipeptidases.
Biochemical characterization of these prolidases shows they have higher catalytic activities over a broader pH range, higher affinity for metal and are more stable compared to P.
furiosus prolidase. This study has important implications for the potential use of these enzymes in biotechnological applications and provides further information on the functional traits of hyperthermophilic proteins, specifically metalloenzymes.
The Structure and Function of Thermostable Prolidases from Pyrococcus sp.
by Casey Michelle Theriot
A dissertation submitted to the Graduate Faculty of North Carolina State University in partial fulfillment of the requirements for the degree of Doctor of Philosophy
Microbiology
Raleigh, North Carolina
2010
APPROVED BY:
______Dr. Jonathan Olson Dr. Robert Kelly
______Dr. James Brown Dr. Amy M. Grunden Chair of Advisory Committee
BIOGRAPHY
Casey Michelle Theriot was born and raised in New Orleans, Louisiana for the first 10 years of her life and then moved to Washington D.C., finally settling in Atlanta, Georgia with her family in 1994. From there she eventually moved onto college at The University of Georgia in Athens, GA and eventually received her Bachelor‟s in Environmental Health Science in
2001. Under the tutelage of Dr. Anne Summers, she was first introduced to microbiology research and how it can impact public health issues, when she joined the Summers lab in the summer of 2000. It is here that Casey learned to love research and microbiology. After graduating from UGA, Casey went on to work for The Centers for Disease Control and
Prevention in Atlanta, Georgia. At the CDC, she worked on another pressing public health issue, antibiotic resistance. She was a part of the NARMS group, the National Antimicrobial
Resistance Monitoring System, tracking antibiotic resistance in food borne organisms. It was here that Casey realized she wanted to eventually direct research and decided getting her
Ph.D. was the next best step. Before applying to graduate schools in the Fall of 2004, Casey traveled and lived in South Lake Tahoe, California for a year, enjoying the wonders of the west. Casey made the move to Raleigh, North Carolina in July 2005 to attend the
Microbiology Ph.D. program at North Carolina State University. Shortly thereafter, she found her home in the department when she joined the lab of Dr. Amy Grunden in January
2006. Casey Theriot will complete her Ph.D. career under the direction of Dr. Amy Grunden in May 2010.
ii ACKNOWLEDGMENTS
I would first like to thank my family and friends for all of their support through the last 5 years of graduate school. It has been a long journey. I especially would like to thank my father and mother, Donald and Penny Theriot, for always being there when I was stressed out and for always believing in me, always telling me that I could do anything. To my many friends in Atlanta (Michelle, Amy and Steph), around the country and the world for their many kind words and conversations over the years. To my best friend and co-worker
Michael Taveirne for always understanding and being there for me when I needed it most.
A special thanks to Dr. Amy Grunden for allowing me to come into her lab and giving me a strong foundation in microbiology research that I will be able to build on in the future. To all the lab members in the Grunden lab that were there from the beginning, past and present, Dr. Sherry Tove, Dr. Xuelian Du, Dr. Alice Lee, Dr. Mikyoung Ji, Dr. Drew
Devine, Dr. Jimmy Gosse, Oscar Tirado-Acevado, and our newest member Rushyannah
Killens. The Grunden lab has always been my home away from home and I thank all the members for making it a special time in my life. Thanks to all the graduate students in the
Department of Microbiology for enduring the long journey together. I have made lifelong friends. I would like to also thank my committee members, Dr. Jon Olson, Dr. Bob Kelly and Dr. Jim Brown, for supporting and leading me in the right direction over the years.
A special thanks goes to Saumil Shah of the U.S. Army-Edgewood Chemical
Biological Center for helping me with the OP nerve agent assays and always being there to promptly answer all of my questions.
iii A special thanks goes to our funding agency, the Army Research Office, for their continued funding and support over the past 4 years of my graduate career (contract number
44258LSSR).
iv TABLE OF CONTENTS
LIST OF TABLES………………………………………………………………………....viii
LIST OF FIGURES……………………………………………………………………….....x
CHAPTER 1. Literature Review……………………………………………………………1
Abstract………………………………………………………………………………..2
1.1 Introduction………………………………………………………………………..3
1.2 Prolidase…………………………………………………………………………...6
1.2.1 Mechanism of Substrate Specificity and Catalysis………………………….…..6
1.2.2 Proposed Reaction Mechanism………………………………………………….9
1.2.3 Structure-function Information Provided by the Solved P. furiosus
Prolidase Structure………………………………………………………….….10
1.2.4 Molecular and Catalytic Properties of Recombinant Prolidases…………….…13
1.3 Applications of Prolidases……………………………………………………….15
1.3.1 Detoxification of Organophosphorus Compounds….…………………………15
1.3.2 Uses in the Food Industry……………………………………………………...21
1.3.3 Impact on Human Health………………………………………………………23
1.3.3a Prolidase Deficiency…………………………………………………….……23
1.3.3b Collagen Catabolism………………………………………………………….26
1.4 Advances in and Limitations of the Use of Prolidase for Biotechnological
Applications……………………………………………………………………...28
1.5 Conclusions………………………………………………………………………31
v
Acknowledgments…………………………………………………………………....32
References Cited……………………………………………………………………..33
CHAPTER 2. Improving the Catalytic Activity of Hyperthermophilic Pyrococcus
Prolidases for Detoxification of OP Nerve Agents over a Broad Range of Temperatures…………………………………………………………………………….64
Abstract………………………………………………………………………………65
2.1 Introduction………………………………………………………………………66
2.2 Materials and Methods…………………………………………………………...70
2.3 Results……………………………………………………………………………77
2.4 Discussion………………………………………………………………………..87
Acknowledgments…………………………………………………………………....93
References Cited……………………………………………………………………..94
CHAPTER 3. Characterization of Two Proline Dipeptidases (Prolidases) from the Hyperthermophilic Archaeon Pyrococcus horikoshii…………………………….…110
Abstract……………………………………………………………………………..111
3.1 Introduction……………………………………………………………………..112
3.2 Materials and Methods………………………………………………………….116
3.3 Results…………………………………………………………………………..123
3.4 Discussion………………………………………………………………………129
Acknowledgments…………………………………………………………..………136
References cited…………………………………………………………………….137
vi
APPENDIX. Screening Pyrococcus horikoshii Prolidase (Ph1prol) Mutants for
Increased Activity over a Broad Range of Temperature with OP Nerve Agents….….155
Abstract……………………………………………………………………………..156
A.1 Introduction…………………………………………………………………….157
A.2 Materials and Methods…………………………………………………………158
A.3 Results and Discussion…………………………………………………………162
References Cited……………………………………………………………………166
vii LIST OF TABLES
CHAPTER 1. Literature Review
Table 1-1 Pita-bread enzymes and their substrates……………………………………..54
Table 1-2 Specific activity of purified OPAAs/prolidases when DFP, other G-type
nerve agents and the proline dipeptides, Leu-Pro and Ala-Pro, are used
as substrates…………………………………………………………………55
Table 1-3 Effects of Alteromonas sp. strain JD6.5 enzyme in the presence or absence of
various biodegradable and water-soluble wetting agents, degreasers,
or foams……………………………………………………………………..56
CHAPTER 2. Improving the Catalytic Activity of Hyperthermophilic Pyrococcus
Prolidases for Detoxification of OP Nerve Agents over a Broad Range of Temperatures
Table 2-1 PCR primers used in this study……………………………………………..100
Table 2-2 Kinetic parameters of wild type and mutated prolidases from Pyrococcus
furiosus………………………………....…………………………………...101
Table 2-3 Pot-life reactivity of recombinant wild type and mutant P. furiosus prolidases
at 70°C……………………………………………………………………...102
Table 2-4 Substrate specificity of recombinant wild type and mutant P. furiosus
prolidase with different proline dipeptides…………………………………103
Table 2-5 Specific activity of OP nerve agents and Gly-Pro with Alteromonas sp. strain
JD6.5 OPAA/prolidase and P. furiosus prolidases……………….………...104
viii
CHAPTER 3. Characterization of Two Proline Dipeptidases (Prolidases) from the
Hyperthermophilic Archaeon Pyrococcus horikoshii
Table 3-1 Substrate specificity of recombinant P. furiosus and P. horikoshii prolidases
with different dipeptides……………………………………………………142
Table 3-2 Kinetic parameters of prolidases from P. furiosus and P. horikoshii………143
Table 3-3 Effect of metal ions on Ph1prol activity……………………………………144
Table 3-4 Effect of metal ions on Phprol activity……………………………………..144
Table 3-1S Metal content of purified prolidases from P. horikoshii……………………149
Table 3-2S Metal reconstitution assay under anaerobic conditions…………………….150
APPENDIX. Screening Pyrococcus horikoshii Prolidase (Ph1prol) Mutants for
Increased Activity over a Broad Range of Temperature with OP Nerve Agents
Table A-1 Relative activity of recombinant Pyrococcus prolidases with OP nerve agent
DFP…………………………………………………………………………168
Table A-2 Relative activity of recombinant Pyrococcus prolidases with p-nitrophenyl
soman……………………………………………………………………….168
ix LIST OF FIGURES
CHAPTER 1. Literature Review
Figure 1-1 Structure of basic R-group amino acid and cyclic proline……………….…..57
Figure 1-2 Proline-specific peptidase cleavage map………………………………….…58
Figure 1-3 Proposed reaction mechanism for P. furiosus prolidase……………………..59
Figure 1-4 The structure of a monomer and dimer of P. furiosus prolidase…………….60
Figure 1-5 Dinuclear metal center active site of P. furiosus prolidase…………………..61
Figure 1-6 Alignment of P. furiosus prolidases with other prolidases………………...... 62
Figure 1-7 Chemical structures of G-type nerve agents and proline dipeptides…………63
CHAPTER 2. Improving the Catalytic Activity of Hyperthermophilic Pyrococcus
Prolidases for Detoxification of OP Nerve Agents over a Broad Range of Temperatures
Figure 2-1 Mapping of mutations in the monomer structure of P. furiosus prolidase…105
Figure 2-2 Effects of temperature on the activities of wild type Pfprol, G39E-,
R19G/K71E/S229T-, R19G/G39E/K71E/S229T- prolidases………………106
Figure 2-3 Effects of pH on the activities of wild type and mutant prolidases………...107
Figure 2-4 Relative activity of wild type and mutant prolidases with OP nerve agent
DFP…………………………………………………………………………108
Figure 2-5 Relative activity of wild type and mutant prolidases with OP nerve agent p-
nitrophenyl soman………………………………………………………….109
x
CHAPTER 3. Characterization of Two Proline Dipeptidases (Prolidases) from the
Hyperthermophilic Archaeon Pyrococcus horikoshii
Figure 3-1 Alignment of P. horikoshii prolidases with other prolidases……………….145
Figure 3-2 Effects of pH on the activites of P. horikoshii prolidases…………………..146
Figure 3-3 Effects of different metals on the activities of P. horikoshii prolidases……147
Figure 3-4 Effects of cobalt and manganese concentrations on the activities of P.
horikoshii prolidases ……………………………………………………….148
Figure 3-1S Purification scheme and SDS-PAGE of P. horikoshii prolidases…..………151
Figure 3-2S Effects of temperature on the activities of P. horikoshii prolidases………..153
Figure 3-3S Effects of different metals on the activities of P. horikoshii prolidases under
anaerobic conditions………………………………………………………..154
APPENDIX. Screening Pyrococcus horikoshii Prolidase (Ph1prol) Mutants for
Increased Activity over a Broad Range of Temperature with OP Nerve Agents
Figure A-1 Effects of temperature on the activities of Pyrococcus prolidases with
Met-Pro……………………………………………………………………..169
Figure A-2 Relative activity of Pyrococcus prolidases with DFP………………………170
Figure A-3 Relative activity of Pyrococcus prolidases with p-nitrophenyl soman …….171
Figure A-4 Screening of Ph1prol mutants using crude extracts………………………...172
Figure A-5 SDS-PAGE of Ph1prol mutants overexpressed in BL21 (λDE3)………….173
Figure A-6 Mapping of mutations in the monomer structure of P. horikoshii prolidase.174
xi
CHAPTER 1
Literature Review
Biotechnological Applications of Recombinant Prolidases
Casey M. Theriot, Sherry R. Tove, Amy M. Grunden
Department of Microbiology, North Carolina State University, Raleigh, NC 27695
Citation: Theriot, C.M., S.R. Tove, A.M. Grunden. (2009) Biotechnological
Applications of Recombinant Microbial Prolidases. In Advances in Applied Microbiology
(Laskin, A., Gadd, G. and Sariaslani, S., eds), p. 99-132. Academic Press, New York
1 Abstract
Prolidase is a metallopeptidase that is ubiquitous in nature and has been isolated from mammals, bacteria and archaea. Prolidase specifically hydrolyzes dipeptides with a prolyl residue in the carboxy terminus (NH2-X-/-Pro-COOH). Currently, the only solved structure of prolidase is from the hyperthermophilic archaeon Pyrococcus furiosus. This enzyme is of particular interest because it can be used in many biotechnological applications. Prolidase is able to degrade toxic organophosphorus compounds, namely by cleaving the P-F and P-O bonds in the nerve agents sarin and soman. Applications using prolidase to detoxify OP nerve agents include its incorporation into fire fighting foams and as biosensors for OP compound detection. Prolidases are also employed in the cheese ripening process to improve cheese taste and texture. In humans, prolidase deficiency (PD) is a rare autosomal recessive disorder that affects the connective tissue. Symptoms of PD include skin lesions, mental retardation and recurrent respiratory infections. Enzyme replacement therapies are currently being studied, in an effort to optimize enzyme delivery and stability for this application.
Previously, prolidase has been linked to collagen metabolism and more recently is being associated with melanoma. Increased prolidase activity in melanoma cell lines has lead investigators to create cancer prodrugs targeting this enzyme. Thus, there are many biotechnological applications using recombinant and native forms of prolidase, and this review will describe what is known about the biochemical and structural properties of prolidases as well as discuss their most current applications.
2 1.1 Introduction
Proteases are defined as enzymes that are able to catalyze the hydrolysis of proteins into smaller peptide fractions and amino acids. There are very few proteases that can cleave a peptide bond adjacent to a proline residue because of the conformational constraint that the structure of proline puts on the backbone of a peptide bond. Because of its cyclic nature, proline is one of the most unique of the 20 amino acids (Cunningham and
O'Connor, 1997). The cyclic structure limits the angle of rotation about the -carbon and nitrogen so that it introduces a fixed bend into the peptide chain (Cunningham and O'Connor,
1997) (Fig. 1-1). Physiologically, proline is important due to its location within the peptide chain, which is thought to protect biologically active peptides against excessive degradation
(Vanhoof et al., 1995); Cunningham and O‟Connor 1997). Creating a polypeptide is a very ordered process involving endopeptidases to cleave precursors at specific sites and exopeptidases for trimming the polypeptide chains to their functional lengths (Cunningham and O'Connor, 1997). Proline residues are often found near the amino termini of many biologically active peptides, which suggest again that they could play a role in regulating proteolytic degradation (Bradbury et al., 1982; Mentlein, 1988; Persson et al., 1985; Yaron,
1987). Because of the uniqueness of proline, there are few enzymes that can cleave proline- containing peptides (Walter et al., 1980). Enzymes that are able to cleave a proline bond are very rare and specific for the substrate they target. These enzymes include: proline-specific endopeptidases, which hydrolyze peptides on the carboxyl side of the proline residue within a polypeptide (-X--Pro-/-X-); prolyl aminopeptidase, which cleaves the N-terminal amino acid
3 and a penultimate proline in both short and long peptides (NH2-X-/-Pro--X-); proline iminopeptidase, that cleaves the N-terminal proline residue from any length polypeptide
(Pro-/-X-); proline specific C-terminal exopeptidase, which releases an amino acid from the
C terminus of a peptide with a penultimate proline (-X--Pro-/X-COOH); and prolidase,
(NH2-X-/-Pro-COOH) (Ghosh et al., 1998) (Fig. 1-2). Prolidase is a proline specific peptidase that can hydrolyze dipeptides with proline at the C-terminus and a non-polar amino acid at the N-terminus (X-Pro). Some prolidases have also shown the ability to hydrolyze substrates with proline in the N-terminus as well as the C-terminus.
Prolidases are ubiquitous in nature and can be found in Archaea (Ghosh et al.,
1998), Bacteria (Fernandez-Espla et al., 1997; Fujii et al., 1996; Kabashima et al., 1999;
Park et al., 2004; Suga et al., 1995) and in Eukarya (Browne and O'Cuinn, 1983; Endo et al.,
1989; Jalving et al., 2002; Myara et al., 1994; Sjostrom et al., 1973). In archaea and bacteria the role of prolidase is not well understood; however, it has been suggested that it aids in protein degradation and could be responsible for the recycling of proline (Ghosh et al.,
1998). Due to its reaction mechanism, it could also play a role in regulating biological processes. In humans, it is known that prolidase is involved in the final stage of the degradation of endogenous and dietary protein and is important in collagen catabolism (Endo et al., 1989; Forlino et al., 2002). Prolidase deficiency in humans is a recessive disorder and is characterized by skin ulcerations, mental retardation and recurrent infections of the respiratory tract (Endo et al., 1989; Forlino et al., 2002). Prolidases have many biotechnological applications. One important application is that it has been shown to be active against organophosphorus nerve agents or OPs. OP nerve agents act by inhibiting
4 acetylcholinesterase (AChE), which leads to a buildup of acetylcholine in the body and can result in hypersecretion, convulsions, respiratory problems, coma and finally death.
Previously, enzymes that catalyze the hydrolysis of OPs from the species Alteromonas were known as OPAAs or organophosphorus acid anhydrolases. OPAAs were shown to be capable of cleaving the P-F, P-O, P-CN and P-S bonds of the nerve agents, sarin and soman
(Cheng et al., 1998). However, OPAA has been reclassified as a prolidase because it is able to efficiently hydrolyze specific X-Pro dipeptides, which is characteristic of prolidases. OP compounds appear to mimic X-Pro substrates in shape, size and surface charges (Cheng and
DeFrank, 2000). Based on the activity that prolidases have against some OP agents, prolidases are being studied for use as biodecontaminants for detoxification of OP nerve agents in the field.
Prolidase is also important to the food and dairy industry because it can be used in ripening processes to reduce bitterness of cheese. The reduction in bitterness is due to the release of proline when prolidase is added in the cheese ripening process (Bockelmann,
1995). It can also be a critical enzyme for degrading proline-containing peptides generated in fermentation processes, which is important for creating desired flavor and texture attributes for fermented foods (Sullivan and Jago, 1972; Yang and Tanaka, 2008).
In addition, prolidase has been linked to human health disorders such as the syndrome prolidase deficiency, or PD. Prolidase deficiencies in humans have been linked to skin disorders and even mental retardation (Endo et al., 1982; Royce and Steinmann, 2002).
Prolidase is essential for collagen breakdown, and when the enzyme is absent, serious skin
5 abnormalities result. While an increase in prolidase activity and a decrease in collagen in breast cancer tissue may cause increased cancer risk (Cechowska-Pasko et al., 2006).
The use of prolidase as a potential biomarker for melanoma is currently being considered, as is its use as a potential therapeutic (Lupi et al., 2006; Mittal et al., 2007; Mittal et al., 2005).
Although there have been a number of important biotechnological applications that prolidases have been identified as being potentially suitable for, there are currently limitations preventing the wide-spread use of prolidases in all of these applications.
However, by using appropriate bioengineering techniques, candidate prolidases can be tailored to each specific application. This review will provide an update on experimentally defined properties of a number of native and recombinant prolidases, as well as a discussion of current and future applications of prolidase enzymes.
1.2 Prolidase
1.2.1 Mechanism of Substrate Specificity and Catalysis
Prolidases belong to a group of enzymes called metallopeptidases, enzymes that require a metal for activity. A review by Lowther and Matthews in 2002, which compared metallopeptidases functionally and structurally, classified prolidase into a subclass of metallopeptidases that contain a dinuclear active-site metal cluster. Other members of this subclass that have been studied with solved structures include: Escherichia coli methionine aminopeptidase (MetAP) (Roderick and Matthews, 1993), E. coli proline aminopeptidase
(APPro) (Wilce et al., 1998), bovine lens leucine aminopeptidase (bLeuAP) (Strater and
Lipscomb, 1995), Aeromonas proteolytica aminopeptidase (ApAP) (Chevrier et al., 1994),
6 Streptomyces griseus aminopeptidase (SgAP) (Gilboa et al., 2001), human methionine aminopeptidase-2 (HsMetAP) (Liu et al., 1998), P. furiosus methionine aminopeptidase-1
(PfMetAP) (Tahirov et al., 1998), and carboxypeptidase G2 from Pseudomonas sp. strain RS-
16 (Rowsell et al., 1997). These enzymes share a dinuclear metal center bridged by a water molecule or hydroxide ion. The metal cluster is essential for the activation of catalysis. It functions to activate a nucleophile for the reaction, as well as participating in substrate binding and stabilizing the transition state (Maher et al., 2004). Some enzymes require two metals in the active site to activate catalysis and others only need one (Maher et al., 2004).
Based upon structural homologies of these enzymes, prolidases can be further categorized into a smaller class of metalloenzymes known as the “pita-bread enzymes”.
Other enzymes within this class include methionine aminopeptidase (MetAP) (Roderick and
Matthews, 1993), aminopeptidase P (APP) (Taylor, 1993) and creatinase (Coll et al., 1990), each of which have slightly different substrate specificity (Table 1-1), but the same conserved metal binding pocket suggesting they might have a conserved catalytic mechanism
(Lowther and Matthews, 2002). These enzymes all contain a characteristic pita bread fold that encompasses a highly conserved metal center and substrate-binding pocket that is located in the enzyme‟s C-terminal domain. The substrate specificity of individual prolidases is dependent on the nature of the metal occupying the metal centers (Table 1-1).
The first pita-bread enzyme structures solved were E. coli, human and P. furiosus
MetAP and E. coli APP (Lowther and Matthews, 2002). These structures confirmed the pita bread fold and the conserved metal center with metal binding residues (Aspartate-97,
Aspartate-108, Histidine-172, Glutamate-204 and Glutamate-235) (E. coli MetAP
7 numbering) (Bazan et al., 1994; Chang et al., 1992; Tsunasawa et al., 1997). P. furiosus prolidase (Pfprol) has a similar metal binding center to MetAP and APP. Pfprol also has similar N-terminal domains to those seen for APPro and creatinase, whereas E. coli MetAP lacks this N-terminal domain. MetAP is active as a monomer, while Pfprol and creatinase are dimers, and APPro functions as a tetramer.
MetAP is specific for dipeptides with N-terminal methionine in the P1 position and a small uncharged residue such as Gly, Ala, Ser, Thr, Pro, Val or Cys in the P1 position
(Graham et al., 2006; Hirel et al., 1989). Prolidases are specific for dipeptides with proline in the trans configuration in the P1 position and non-polar residues in the P1 position (Ghosh et al., 1998; Grunden et al., 2001; King et al., 1986; Lin and Brandts, 1979), whereas APPro has affinity for substrates with a hydrophobic or basic residue in the P1 position and a trans
Pro at P1 (Lowther and Matthews, 2002). The reaction centers of APP and prolidase require the occupancy of two divalent ions such as Co2+ and Mn2+ in order to catalyze their reactions.
Although, two cations must be bound in the metal sites, the relative binding affinity of the metals differs, with there being one tightly bound metal atom and one more loosely bound
(Lowther and Matthews, 2002).
E. coli MetAP has been shown to be maximally active when bound with 2 atoms of Co2+ per monomer under aerobic assay conditions or when bound with one Fe2+ atom per monomer under anaerobic assay conditions, suggesting that it could have a mononuclear iron center in vivo (D'Souza V et al., 2000). It is not currently well understood why these enzymes exhibit different reaction efficiencies depending on the cations bound in their metal centers.
8 APP and prolidase demonstrate the highest activities when bound with Co2+ and Mn2+, whereas MetAP‟s highest activities are observed when it is loaded with Fe2+ (Lowther and
Matthews, 2002). Although initially E. coli and P. furiosus MetAPs were described as requiring the occupancy of two metals for activity, more recent studies have indicated that they actually function more efficiently as Fe-containing monometallic hydrolases under anaerobic assay conditions (Copik et al., 2005; Cosper et al., 2001; D'Souza V and Holz,
1999). A study by Du et al. demonstrated that P. furiosus prolidase also showed the highest activity when assayed anaerobically with Fe2+, and the second highest activity when Co2+ was bound to the enzyme under aerobic assay conditions (Du et al., 2005). This suggests that both Pfprol and E. coli and P. furiosus MetAPs could preferentially use an iron mononuclear metal center in vivo under anaerobic conditions but switch to the use of a dimetal Co2+ reaction center under iron limitation or aerobic/oxidizing conditions.
1.2.2 Proposed Reaction Mechanism
From comparisons of inhibited and native forms of E. coli MAP, kinetic analyses of MAP mutants, and spectral analyses of MAP metal centers in response to substrate binding, a reaction mechanism for the cleavage of N-terminal methionine residues by E. coli
MAP has been proposed (Lowther and Matthews, 2000; Lowther and Matthews, 2002;
Lowther et al., 1999). Given the structural correspondence that exists between the E. coli
MAP and Pfprol metal centers as well as the similarity in MAP and prolidase activities, with both involving hydrolysis of peptide bonds, it is reasonable to presume that an analogous reaction mechanism can be ascribed to prolidase. Thus, from analogy, it is predicted that cleavage of the X-Pro peptide bond occurs as follows: (1) substrate binds to the active site
9 and is thought to activate the nucleophile (ON) and facilitate proton transfer to glutamate residue 313 (E-313), (2) the carboxy anion of the resultant tetrahedral intermediate, originating from the oxygen of the scissile bond (OC) is stabilized by the expanded coordination sphere of Co1 and interactions with histidine-192 (H-192) and histidine-291 (H-
291), (3) resolution of the intermediate to products returns the coordination of Co1 to five, while the metal bridging and H-291 interactions are maintained, and (4) the active site is fully regenerated upon release of the proline and deprotonation of solvent molecules. Note that the amino acid residues refer to P. furiosus prolidase numbering (Fig. 1-3).
1.2.3 Structure-function Information Provided by the Solved P. furiosus
Prolidase Structure
Pyrococcus furiosus prolidase is currently the only solved crystal structure for this enzyme. P. furiosus is a hyperthermophilic organism which grows optimally at 100 C.
While there are many biochemically characterized mesophilic prolidases, at this time, there are no solved structures. From the crystal structure of Pfprol, it is clear that the enzyme is composed of two domains. It has an N-terminal domain (domain I, residues 1-112), an alpha-helical linker region (113-123) and a C-terminal domain (domain II, residues 124-348), which contains the traditional “pita-bread” type fold (Maher et al., 2004). The N-terminal domain contains a six-stranded mixed -sheet flanked by five -helices. The C-terminal region contains the active site where metal binding occurs and is made up of a six-stranded
-sheet with four -helices on the outer surface (Fig. 1-4). The strongly curved conformation in which the -sheet exists in Pfprol gives rise to the enzyme‟s inclusion in the
10 „pita bread‟ family of proteins. There are a number of hydrogen bonds between the two domains, possibly enhancing stability. Locations where hydrogen bonds are present include the end of small helix domain I (residues 24-32) and -turn domain II (residues 284-294)
(Maher et al., 2004). The proposed determinants for substrate specificity are thought to be localized to a region containing amino acid residues 113-123 in Pfprol. These residues link the two domains, and the angle is more acute with respect to the C-terminal domain when overlaid with the APPro domain. The active site of Pfprol is further crowded by the N- terminal domain of the subunits (residues 36B-39B). This suggests that the substrates coming in to the active site will be discriminated primarily based on size, where greater specificity will occur for smaller proline-containing peptides such as dipeptides versus polypeptides (Maher et al., 2004).
The active site of Pfprol is located in an oval depression formed on the inner surface of the curved -sheet of the C-terminal domain of the protein. The primary feature of the active site is the presence of a dinuclear cobalt cluster, and as predicted by analogy to MAP and aminopeptidase metal centers, the amino acids Asp-209, Asp-220, His-284, Glu-313, and
Glu-327 were shown to coordinate the metal ions (Maher et al., 2004; Willingham et al.,
2001). Specifically, it was shown that His-284 and Glu-313 are monodentate ligands binding solely to the first Co center (Co1), Asp-209 is a monodentate ligand binding solely to the second Co (Co2), and Asp-220 and Glu-327 serve as bidentate ligands of both metal sites.
The structure analysis also indicated that a water molecule identified as W176 functions as a bridging molecule for the metal center (Fig. 1-5).
11 When isolated in either a native or recombinant form, Pfprol contains one Co(II) atom per monomer (Ghosh et al., 1998). During the crystallization process, Zn(II) replaced
Co(II) in the prolidase active site as a consequence of the crystallization method used (Maher et al., 2004). However, Zn could be replaced with Co in the crystallized prolidase, and it restored enzyme activity.
Although the X-ray crystal structure analysis of Pfprol was able to definitively establish the structure of the enzyme‟s metal center-containing active site, the question as to which of the metal sites (Co1 or Co2) is the tightly-bound and which is the loosely-bound (Kd
0.24 mM) site remained unresolved. Therefore, further studies were undertaken which analyzed key site-directed Pfprol mutants to differentiate the binding affinities between the two Co atoms (Du et al., 2005). To look at different affinities of the metal binding sites, targeted mutations were made in the following locations: Asp209Ala, His284Ala,
His284Leu, and Glu327Leu within Pfprol, where the three-letter code preceding the indicated amino acid position indicates the original amino acid and the three-letter code following the number indicates the mutated residue (Du et al., 2005). Results showed that
Co1 is the tightly bound metal and Co2 is the looser bound metal (Kd 0.24 mM) (Du et al.,
2005). Similar findings were observed for E. coli MetAP where the Co1 site is the tight binding site, and the dissociation constants, Kd of Co1 and Co2 were estimated to be 0.3
0.2 and 2.5 0.5 mM, respectively (D'Souza V and Holz, 1999). For P. furiosus MetAP, the reported dissociation constants are 0.05 0.015 and 0.35 0.02 mM (Meng et al., 2002).
12 1.2.4 Molecular and Catalytic Properties of Recombinant Prolidases
The first prolidase both structurally and biochemically characterized was isolated from the hyperthermophilic archaeon P. furiosus (Ghosh et al., 1998; Grunden et al., 2001;
Maher et al., 2004). It is a homodimer, with a molecular mass of 39.4 kDa per subunit, and as purified, it was determined to contain one bound Co2+ per subunit (Ghosh et al., 1998).
With the addition of cobalt, it shows maximum activity at 100 C and pH 7.0 with Met-Pro as the substrate (Ghosh et al., 1998; Grunden et al., 2001). Pfprol has a narrow substrate specificity, only hydrolyzing dipeptides with a proline in the C-terminus and non-polar amino acids (Leu, Met, Val, Phe or Ala) in the N-terminal position (Ghosh et al., 1998). The dipeptidase is maximally active with the addition of the divalent cations Co2+ and Mn2+, and it cannot be substituted with other divalent cations (Mg2+, Ca2+, Fe2+, Ni2+, Cu2+ or Zn2+)
(Ghosh et al., 1998).
Pfprol is the most thermostable and thermoactive of all the prolidases isolated to date (Adams and Kletzin, 1996). Other isolated mesophilic prolidases have shown activity up to 55 C (Adams and Kletzin, 1996; Browne and O'Cuinn, 1983; Endo et al., 1989;
Fernandez-Espla et al., 1997; Suga et al., 1995). Among the prolidases that have been characterized, there are variations in subunit numbers and metal requirements. For instance
Pfprol is active as a dimer as are the human and Xanthomonas maltophilia prolidases (Endo et al., 1989; Suga et al., 1995). Yet Lactococcus lactis and Lactococcus casei prolidases function as monomers (Fernandez-Espla et al., 1997). Although many prolidases function most efficiently when bound with cobalt, L. casei, X. maltophilia, and human prolidases are
13 most active with manganese, while Lactobacillus delbrueckii prolidase requires zinc (Morel et al., 1999; Stucky et al., 1995).
Besides the differences in metal requirements, prolidases also demonstrate differences in substrate specificities. Pfprol has the greatest affinity for dipeptides with proline in the C-terminus and cannot cleave dipeptides with proline in the N-terminus.
Likewise, L. delbrueckii pepQ prolidase can also only cleave X-Pro dipeptides (Stucky et al.,
1995). However, L. lactis prolidase can cleave dipeptides with proline in either the C- or N- terminal positions (Cheng et al., 1996). On the other hand, L. casei and guinea pig brain prolidase can cleave substrates without a prolyl residue.
OPAA-2, previously listed as an organophosphorus acid anhydrolase, from the species Alteromonas shows 44% similarity to P. furiosus prolidase (Ghosh et al., 1998).
OPAAs can hydrolyze organophosphorus nerve agents such as sarin and soman. OPAA has been reclassified as a prolidase because it can also efficiently hydrolyze X-Pro dipeptides
(Cheng et al., 1997; Cheng et al., 1999; Cheng et al., 1996). Like Lactococcus prolidases,
OPAA is a monomer and requires Mn2+ for activity. OPAA, like other prolidases, has a conserved binuclear metal center and shows activity with P-F, P-C and P-O bonds (Cheng et al., 1993). It can also preferentially cleave the dipeptides Leu-Pro and Ala-Pro and is specific for dipeptides with proline in the C-terminal position (Cheng et al., 1996). No activity was observed when OPAA was assayed with the substrates Pro-Leu and Pro-Gly
(Cheng et al., 1997). Figure 1-6 shows an alignment of previously characterized prolidases from Alteromonas, L. delbrueckii, Human and E. coli, newly characterized prolidase from
14 Pyrococcus horikoshii and E. coli MetAP. Percent similarities compared to Pfprol for all listed prolidases are included.
1.3 Applications of Prolidases
1.3.1 Detoxification of Organophosphorus Compounds
Organophosphorus nerve agents or OPs act by covalently binding and inhibiting acetylcholinesterase (AChE), preventing the breakdown of the neurotransmitter acetylcholine
(Ach) to choline. This leads to a buildup of acetylcholine in the body and as a result causes continuous nerve impulses and muscle contractions (Grimsley et al., 2000). An OP exposed victim can suffer from convulsions, brain seizures and eventually die from neuronal death.
The U.S. Army has a stockpile of 32,000 tons of chemical agents consisting of the nerve agents GB (sarin or O-isopropyl methylphosphonofluoridate), VX and blister agent HD
(sulfur mustard) (DeFrank et al., 2000). Under the International Chemical Weapons Treaty, the U.S. was slated to destroy the stockpile by 2007. OP nerve agents were initially employed during World War II and are still being used by various organizations. Sarin gas was used by the Aum Shinrikyo cult in the Tokyo subway attack of 1995. U.S. soldiers deployed in Iraq during the first Iraq conflict were exposed to nerve agents. Such exposure incidents underscore the need for effective nerve agent detoxification methods to protect civilians and soldiers. Other OP compounds being used in the U.S. include OP pesticides of which over 40 million kilograms are land applied and 20 million kilograms are produced for export each year (Chen et al., 2000). There is concern that these pesticides could leak into ground water and pollute surrounding environments.
15 Previous forms of disposal have consisted of chemical treatment, open-pit burning, evaporative burial, and deep ocean dumping, and presently, the EPA has approved incineration (Chen et al., 2000). Incineration is an expensive process, and it has raised environmental concerns. As a result, other environmentally friendly technologies are now being considered to degrade the stockpiles, including enzyme-based decontamination systems (Cheng and DeFrank, 2000).
In 1946 Mazur described the first work investigating hydrolysis of DFP
(diisopropylfluorophosphate), an analogue of G-type nerve agents, by enzymes found in rabbit and human tissue extracts (Mazur, 1946). Most of these enzymes were first labeled
DFPases and sarinases specific to the nerve agents they degraded. In 1992 they were listed in the category of Phosphoric Triester Hydrolases, named by the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology. These enzymes were further separated into two subgroups based on their substrate specificities. The first subgroup is the organophosphate hydrolases (also referred to as paraoxonase and phosphotriesterase), which prefer the substrates paraoxon, and P-esters, which have a P-O bond. The second subgroup is diisopropyl-fluorophosphatases (also including OPAA or organophosphorus acid anhydrolase) which are most active against OP compounds with P-F or P-CN bonds (Cheng and DeFrank, 2000).
Organophosphate hydrolase or OPH, encoded by the opd (organophosphate degrading) gene, was isolated first from Pseudomonas diminuta MG and Flavobacterium
(Mulbry et al., 1986). It has been shown to degrade organophosphate pesticides with P-O bonds and is the only enzyme known to cleave the P-S bond (Cheng and DeFrank, 2000; Lai
16 et al., 1995). It can also cleave the P-F and P-CN bonds, and the hydrolysis rates are 40-
2450 times faster than chemical hydrolysis at temperatures up to 50 C (Munnecke, 1979).
OPH is able to degrade a broad list of substrates including organophosphate pesticides
(paraoxon and coumaphos) and OP nerve agents (DFP and sarin) (Chen et al., 2000; Cheng and DeFrank, 2000; Dumas et al., 1989; Dumas et al., 1990). Of its substrates, OPH can hydrolyze paraoxon the fastest with a rate of 104 s-1 (Grimsley et al., 1997). OPH mutants have been constructed in order to increase the substrate specificity with nerve agents. The following mutations were made in the metal binding center area of OPH: His257Leu,
His257Val and His254Arg, resulting in even higher activity with soman and VX (Lai et al.,
1996; Vanhooke et al., 1996).
OPH enzymes have been used in various applications to cleanup and/or detect OP nerve agents. For large scale clean up of organophosphorus compounds, the OPH enzyme has been incorporated into fire-fighting foams (LeJeune et al., 1998). Large scale use of
OPH for decontamination of nerve agents has been limited by high cost and poor enzyme stability (Chen et al., 2000). OPH has also been used in detection methods. Biosensors with immobilized recombinant E. coli cells expressing OPH are being used for recognizing OP nerve agents (Mulchandani et al., 1998a; Mulchandani et al., 1998b; Rainina et al., 1996).
New technology for biosensing and detoxification of OPs is focusing on immobilized cells expressing OPH on the cell surface (Mulchandani et al., 1999). To date, studies involving immobilized E. coli (Richins et al., 1997), Moraxella sp. (Shimazu et al., 2001),
Saccharomyces cerevisiae (Takayama et al., 2006) and Cyanobacteria (Chungjatupornchai
17 and Fa-Aroonsawat, 2008) expressing OPH enzymes have been conducted. Both native and recombinant OPH can also be immobilized onto surfaces such as nylon (Caldwell and
Raushel, 1991a), porous glass, and silica beads (Caldwell and Raushel, 1991b) as well as added to enzyme reactors, but this method still requires pure OPH enzyme which is very costly (Mulchandani et al., 1999; Mulchandani et al., 1998b). In recombinant E. coli with active OPH on the cell surface, the enzyme was stable and remained 100% active for more than a month (Chen and Mulchandani, 1998). Immobilized cells expressing OPH were used in batch reactors to test against many OP chemicals. It showed 100% hydrolysis of OP pesticides paraoxon and diazinon in less than 3.5 hours (Chen et al., 2000; Cheng and
DeFrank, 2000). OPH is being used in medical applications as well. It can be used as an antidote or a therapeutic in preventing OP poisoning (Grimsley et al., 2000). Mice treated with OPH intravenously prevented cholinesterase inhibition when exposed to DFP, sarin or soman (Tuovinen et al., 1994; Tuovinen et al., 1996). When mice were pre-treated with
OPH they were able to resist even higher doses of nerve agents.
Structural data shows that organophosphorus hydrolase is a homodimer (35 kDa per monomer) with active sites in the C-terminus (Benning et al., 1994; Benning et al., 1995;
Vanhooke et al., 1996). It is a characterized metalloenzyme that contains one or two metal ions needed for catalysis (either zinc or cobalt) (Dumas et al., 1989; Omburo et al., 1993).
Zinc is the native metal present in purified OPHs and provides full activity. However, activity can also be supported by Co2+, Cd2+, Ni2+ and Mn2+ when these metals are substituted into the enzyme in place of Zn (Omburo et al., 1992). Unlike prolidases, OPH does not hydrolyze dipeptides with proline at the C-terminus (Cheng et al., 1997).
18 Organophosphorus acid anhydrolases or OPAAs have been isolated from squid
(Hoskin and Roush, 1982), protozoa (Landis et al., 1987), clams (Anderson et al., 1988), mammals (Little et al., 1989), and soil bacteria (Attaway et al., 1987). OPAAs have been shown to hydrolyze a variety of OP agents including, soman (GD; O- pinacolylmethylphosphonofluoridate), sarin (GB; O-isopropylmethylphosphonofluoridate),
GF (O-cyclohexyl methylphosphonofluoridate), and cyanide containing tabun (GA; ethyl
N,N-dimethylphosphoramidocyanidate) (Cheng et al., 1999). OPAAs isolated from
Alteromonas species: Alteromonas haloplanktis, Altermonas sp. JD6.5 and Alteromonas undina have been the most extensively studied. (Cheng et al., 1997; Cheng and DeFrank,
2000; Cheng et al., 1999; Cheng et al., 1996; Cheng et al., 1993; Cheng et al., 1998;
DeFrank and Cheng, 1991). The OPAAs from these species are structurally and functionally similar to each other. They share molecular weights between 50-60 kDa, an optimum pH between 7.5-8.5, a temperature optimum between 40-55 C, a requirement for the metal Mn2+, and they are inhibited by the DFP analog, mipafox (Cheng et al., 1997). These enzymes are highly active against the OP nerve agents soman and sarin. OPAAs show higher soman activities, and OPHs show higher activity against the OP pesticide paraoxon (Cheng et al.,
1993; DeFrank et al., 1993; Dumas et al., 1990). Comparisons of their activities with nerve agents DFP, GB, GD and GF can be seen in Table 1-2. OPAAs from Alteromonas sp. JD6.5 and A. undina show the highest activity against GD and lowest against GB, while A. haloplanktis OPAA showed lower activity against DFP, GB, GD and GF (Cheng et al.,
1997).
19 OPAA from A. haloplanktis and OPAA-2 from Alteromonas sp. JD6.5 are very similar with 81% amino acid sequence identity and 91% similarity (Cheng et al., 1997).
Both OPH and OPAA enzymes can hydrolyze many of the same substrates; however, there is no significant sequence homology found between any of the known OPH and OPAA enzymes (Cheng and DeFrank, 2000; Cheng et al., 1996), suggesting they are not the same enzyme.
The amino acid sequence from A. haloplanktis OPAA and Alteromonas sp. JD6.5
OPAA-2 showed high sequence similarity, 51% and 49%, to E. coli [X-Pro] dipeptidase or prolidase (Cheng and DeFrank, 2000). Alteromonas OPAA has now been classified as a prolidase due to similarities in amino acid sequence and biochemical properties (Cheng et al.,
1997; Cheng and DeFrank, 2000). Alteromonas OPAAs or prolidases are able to hydrolyze
OP nerve agents and dipeptides with proline in the C-terminus, but not dipeptides with proline in the N-terminus (Cheng et al., 1997). Like prolidase, OPAA from Alteromonas sp.
JD6.5 has the conserved metal cluster center featuring amino acid residues: Asp244, Asp255,
His336, Glu381 and Glu420 (Cheng and DeFrank, 2000). OPAAs from A. undina, A. haloplanktis and Alteromonas sp. JD6.5 can all use the dipeptide Leu-Pro as a substrate and activities of 810 U/mg, 988 U/mg, and 636 U/mg, respectfully, have been reported for the cleavage of Leu-Pro by these OPAAs (Table 1-2) (Cheng and DeFrank, 2000). While the substrate Leu-Pro and the G-type nerve agent soman may seem to be very different based on their chemical formulas, they are actually very similar in relation to their three-dimensional structure and electrostatic density maps (Cheng and DeFrank, 2000). The structural similarities in the proline dipeptide and OP substrates used by OPAAs and prolidases
20 suggests that Alteromonas OPAAs and prolidases may have evolved from the same ancestral gene (Cheng et al., 1997).
In order to effectively incorporate prolidases into an acceptable decontamination formulation, the enzyme has to be stable over time and not be inhibited by the water-based system employed. Table 1-3 shows the current systems including fire-fighting foams or sprays, degreasers, laundry detergent, and aircraft deicing solutions (Cheng and DeFrank,
2000). Foams appear to be the best delivery option because they have surface-active agents that help with the solubilization of the substrate, and they are able to adhere to vertical surfaces, enabling the enzyme to have significant contact time with substrates over a large surface area.
Currently to detoxify nerve agent exposed environments, a decontamination solution known as DS2 is being used in conjunction with bleach (Cheng et al., 1999). DS2 is environmentally harmful because it is corrosive and contributes additional hazardous waste to the environment. Since the use of current decontamination solution formulations is not a good long-term decontamination strategy, there is a perceived need to optimize an enzyme- based decontamination system. However, limitations of the enzymes that have thus far been examined for use in this process include poor activity at low pH and over a broad temperature range, and instability of the enzymes in the presence of harsh solvents, metals, detergents and or denaturants.
1.3.2 Uses in the Food Industry
During fermentation there are many chemical changes that food undergoes that contribute to taste and nutritional quality. The cheese making and ripening process relies
21 heavily on microbial metabolism. Cheese is made by the coagulation of milk using starter culture bacteria, usually Lactic Acid Bacteria (LAB), and the enzyme rennet. LAB acidifies milk by converting lactose into lactic acid, and the rennet coagulates the mixture. Ripening is driven by the microbial proteolysis process and results in casein protein being broken down into many different peptides and amino acids (Stucky et al., 1995). Some amino acids are known to produce a bitter taste. Hydrophobic peptides ranging from 2-23 residues play a significant role in the bitterness of cheddar cheese (Sullivan and Jago, 1972). Peptides isolated from casein hydrolysate and cheese result in high hydrophobicity and a high number of aromatic amino acids, causing bitterness (Agboola et al., 2004). In the study by Agboola et al., the role that a number of hydrophobic peptides play in determining the bitterness of ovine milk cheese was examined. To reduce the overall bitterness of the cheese, particular peptides need to be removed by proteolysis. Because of their unique structure, most of the remaining dipeptides are Xaa-Pro and or Pro-Xaa type dipeptides. These proline-containing dipeptides have been shown to significantly contribute to bitterness, especially the Xaa-Pro class of dipeptides (Yang and Tanaka, 2008).
A study by Ishibashi et al, examined how the proline structure contributes to the bitterness of cheese. Pure amino acid L-proline exhibited a sweet flavor, whereas proline containing peptides were bitter (Ishibashi et al., 1988). They suggested that the imino ring of proline creates a hydrophobic feature that plays a role in bitterness. Prolidases or proline specific dipeptidases play a critical role in cheese ripening. In cheese the proteolytic process described above works to degrade casein, resulting in amino acids essential for growth and metabolism. This process is essential for ripening and formation of flavor as well as texture
22 (El Soda, 1993). Lactic acid bacteria (LAB) are used in the fermentation of foods, especially dairy products, and they contain many peptidases specific for proline including: proline iminopeptidase (PepI), prolinase (PepR), X-prolyl dipeptidyl aminopeptidase (PepX) and prolidase (PepQ) (Christensen et al., 1999; Sousa et al., 2001). By using prolidase to hydrolyze the bond of Xaa-Pro dipeptides, bitterness in cheese and other fermented foods can be reduced. In a study by Courtin et al., a Lactococcus lactis proteolytic system was investigated for its ability to increase the ripening process of cheese. By adding excess proline specific peptidases from lactobacilli, including prolidases, they were able to increase the total amount of free amino acids 3-fold, in turn speeding up cheese ripening (Courtin et al., 2002). The role of proline specific dipeptides in the flavor of cheese has been explored, but the role that the single amino acid proline plays is still unknown and requires further examination.
1.3.3 Impact on Human Health
1.3.3a Prolidase Deficiency
Prolidase deficiency is a rare autosomal recessive disorder of the connective tissue that gives rise to skin lesions, mental retardation and recurrent respiratory infections
(Kokturk et al., 2002; Rao et al., 1993; Royce and Steinmann, 2002). Most cases go misdiagnosed, but it is estimated that 1-2 cases per million births are diagnosed with PD
(Lupi et al., 2006; Royce and Steinmann, 2002). The human prolidase gene (Peptidase D,
PEPD, AC008744), is located on chromosome 19p13.2 and is made up of 15 exons (Tanoue et al., 1990) and contains a polypeptide spanning 493 amino acids (Endo et al., 1989). Point mutations, exon splicing, deletions and duplications of key amino acids in the human
23 prolidase gene are linked to this deficiency (Ledoux et al., 1996; Lupi et al., 2006). Key point mutations Arg184Gln (Arg122 in Pfprol), Asp276Asn (Asp209 in Pfprol), Gly278Asp
(Gly211 in Pfprol), and Gly448Arg (Gly323 in Pfprol) have been found in patients with this disorder (Maher et al., 2004). These mutations were carefully compared to the Pfprol enzyme to evaluate what impact they have on the enzyme‟s structure and function. The same point mutations in Pfprol result in disruption of function and structure of the enzyme (Maher et al., 2004). Diagnosis of PD in the past has been difficult and has resulted in significant numbers of misdiagnosed cases (Lupi et al., 2006; Viglio et al., 2006). Presently, detection methods include screening for prolidase activity in erythrocytes, leukocytes and skin fibroblast cultures and also screening urine for excess X-Pro imidodipeptides (Viglio et al.,
2006). Therapeutic approaches have been explored for PD in the past. Topical treatments with glycine and proline have been used with minimal effectiveness on leg ulcers (Arata et al., 1986; Jemec and Moe, 1996). Oral administration of L-proline was also tried, however, this treatment failed to prevent the ulcerations (Isemura et al., 1979; Ogata et al., 1981;
Sheffield et al., 1977). Other methods in preventing PD have included blood transfusions and aphaeresis (Endo et al., 1982; Lupi et al., 2002), the use of corticosteroids (Shrinath et al., 1997; Yasuda et al., 1999), application of growth hormone (Monafo et al., 2000), and an antibiotic topical treatment (Ogata et al., 1981).
Enzyme replacement therapy is currently under investigation with delivery of active prolidase into fibroblasts of PD patients being specifically examined. In a study by Ikeda et al., 1997, an adenovirus-mediated gene transfer with human prolidase cDNA was used to provide enzyme replacement therapy in the fibroblasts (Ikeda et al., 1997). This gene
24 transfer resulted in 7.5 times the normal activity of prolidase in the fibroblasts. The main consideration in enzyme replacement therapy is in the type of enzyme delivery system and the stability of the enzyme once it is delivered to the target location. Prolidase enzyme delivery using micro- and nano-particulate systems has been done, and the delivery efficiency of the enzyme into fibroblasts was poor (Colonna et al., 2007; Genta et al., 2001;
Lupi et al., 2004). More recently, enzyme replacement studies have been done using liposomes to deliver native prolidase trancellularly into fibroblasts in PD patients (Perugini et al., 2005). Although, the delivery of the enzyme to fibroblasts was efficient, the enzyme was only active for 6 days (Perugini et al., 2005). A study by Colonna, et al., addressed the issue of enzyme stability and efficient enzyme delivery, using PEGylated prolidase loaded in chitosan nanoparticles to restore the normal prolidase activity in PD patient cells (Colonna et al., 2008).
Generating enough recombinant human prolidase for enzyme replacement therapy and structural studies has been a significant challenge. The human prolidase enzyme has been expressed and purified in both eukaryotic and prokaryotic systems including,
Sarccharomyces cerevisiae, Pichia pastoris, Chinese Hamster Ovary (CHO) cells, and E. coli. (Lupi et al., 2006; Lupi et al., 2008; Wang et al., 2005; Wang et al., 2006). The recombinant prolidase purified from E. coli showed the most promise due to its low production cost, high yield, and its structural and catalytic properties (Lupi et al., 2006). In enzyme replacement therapy, the stability of the enzyme is critical. Based on current studies the best candidate recombinant human prolidase generated using an E. coli expression
25 system, showed stability and activity at 37 C for up to 6 days (Lupi et al., 2006). While these findings represent progress in enzyme replacement therapy, clearly further advances in enzyme stability need to occur for human prolidase replacement therapy to be a viable therapeutic option in the treatment of PD.
1.3.3b Collagen Catabolism
Primarily produced in fibroblasts, collagen is the main fibrous structural protein that makes up connective tissue in vertebrates (Bornstein and Sage, 1989). Up to 25% of total body protein is collagen (Di Lullo et al., 2002). ECM or extracellular matrix is made up of
80% collagen, and connective tissue and the organic part of bone are made of 90-95% collagen (Dixit et al., 1977). Hydroxylproline and proline make up over 25% of collagen amino acids (Dixit et al., 1977). Collagen has also been recognized as a ligand for integrin
( 1-integrin) cell surface receptors, which are important for regulating ion transport, lipid metabolism, kinase activation and gene expression (Akiyama et al., 1990; Bissell et al.,
1982; Carey, 1991; Donjacour and Cunha, 1991; Surazynski et al., 2008). When collagen structure is affected, it can have an impact on cell signaling, metabolism and function, which can lead to tumorigenicity and invasiveness (Surazynski et al., 2008). The secretion of matrix metalloproteinases or MMPs, which break down ECM or collagen, is also an important event in the progression and metastasis of cancer (Cechowska-Pasko et al., 2006).
Intracellular prolidase plays a major role, which might be a step-limiting factor, in the final stage of degradation of collagen into free amino acids (Jackson et al., 1975).
Extracellular collagenases break down the initial collagen, which is then followed by
26 prolidase facilitated degradation. Prolidase is able to hydrolyze the most abundant substrate
Gly-pro from degraded procollagen and collagen (Surazynski et al., 2008). It is suggested that prolidase plays a role in metabolism of collagen and recycling of proline for collagen resynthesis (Jackson et al., 1975; Palka, 1996; Yaron and Naider, 1993). The mechanism to explain this is currently being investigated but at this time is unclear.
The absence of prolidase, or PD, has been associated with slow wound healing, due to an abnormal nitric oxide (NO) signaling pathway. NO is associated with collagen metabolism and matrix degradation because it shows high expression when tissues need repair (Lupi et al., 2008; Surazynski et al., 2005). Overexpression of prolidase has been linked to increased levels of nuclear hypoxia inducible factor (HIF-1 ), which plays an important role in stress responsive gene expression (Jaakkola et al., 2001; Semenza, 2001;
Surazynski et al., 2008). Prolidase activity has also been implicated as a factor in other diseases such as osteogenesis imperfecta (Galicka et al., 2005; Galicka et al., 2001), pancreatic diseases (Palka et al., 2002), lung carcinoma planoepitheliale (Karna et al., 2000) and metastasis of breast cancer MCF-7 cells (Miltyk et al., 1999; Palka and Phang, 1998).
In a study by Cechowski-Pasko et al., it was observed that increased prolidase activity in breast cancer tissue correlated with deficiencies in collagen and 1-integrin receptors, and it was suggested that alteration in collagen metabolism in breast cancer tissue may be causing tissue remodeling, and therefore, leading to invasiveness and progression of cancer (Cechowska-Pasko et al., 2006). Increased prolidase activity may be the cause of the
ECM breakdown, and thus, it is likely that new drugs will be designed to target prolidase. In
27 a study by Mittal et al, high expression of prolidase activity in melanoma cell lines was also observed (Mittal et al., 2005). Prolidase was selected as a drug target due to its consistently high expression in melanoma cell lines and its high substrate specificity (Mittal et al., 2005).
Prodrugs are being used to decrease the toxicity and side effects of chemotherapeutic agents in cancer patients. Currently, using prolidase as a drug target for selective activation of the prodrug, melphalan, for specific drug delivery to the tumor is being evaluated (Mittal et al.,
2007; Mittal et al., 2005).
1.4 Advances in and Limitations of the Use of Prolidase for Biotechnological
Applications
There are advantages and disadvantages of using certain prolidases in all of the applications previously discussed. The advantages of using Alteromonas recombinant prolidase in biodecontamination foams are due to its high activity against G-type nerve agents, such as soman and sarin. The limitations in using a mesophilic prolidase in the DS2 foam formulation owe to its limited stability under harsh conditions. The formulation includes solvents and other denaturing solutions that reduce the enzyme‟s ability to function and hydrolyze the target nerve agents optimally. The enzyme also requires the addition of a metal for maximum activity.
The advantage in using the P. furiosus prolidase in the DS2 foam composition is in its thermostability. Like the Alteromonas prolidase, it too requires the addition of a metal for maximum activity. The native Pfprol shows no loss of activity after incubation for 12 hours at 100 C (Ghosh et al., 1998). The recombinant prolidase produced in E. coli exhibits
28 a 50% loss of activity after incubation for 6 hours at 100 C (Ghosh et al., 1998). The disadvantages in using Pfprol enzyme for application purposes are due to its thermoactivity.
At 80 C there is a 50% loss of activity of Pfprol, and there is little activity detected below
50 C (Ghosh et al., 1998). Although the enzyme‟s thermoactivity currently limits its use at low temperatures, this enzyme is of particular interest because of its stability at high temperatures and because it may be able to remain active in a decontamination formulation containing organic solvents and/or other denaturants. Purified Pfprol was tested against
DFP, a G-series OP nerve agent, and it exhibited a specific activity of 30 U/mg at 55 C. This is comparable to human and squid prolidases, which have been evaluated and were shown to have specific activities averaging between 10-75 U/mg at 30 C (data provided by Dr. Joseph
DeFrank of the U.S. Army Edgewood Research, Development and Engineering Center).
Enzymes isolated from hyperthermophilic organisms have become important in industrial applications in the past decade due to their extreme thermostability. Thermophilic enzymes are proving to be more active and efficient then previously used enzymes isolated from mesophiles and psychrophiles. Their appeal comes from their ability to function in the most extreme environments that include: high temperature, high/low salt concentrations and extreme pH‟s (Niehaus et al., 1999). By using thermostable enzymes in industrial processes, reaction rates are increased, contamination is minimal, and the enzyme is very hard to degrade, which enables the enzymes to withstand some of the most extreme conditions encountered in industrial processes.
29 The limitations of using P. furiosus prolidase as a potential biodecontaminant include its low activity at temperatures below 50ºC and its need for cobalt metal for activity. Using the structural information provided from Pfprol, there are bioengineering strategies that could address the enzyme‟s negligible activity at temperatures below 50ºC. The Pfprol gene has been altered using both random and targeted mutation strategies. Random mutagenesis strategies that have been used include: error-prone PCR, hydroxylamine mutagenesis, serial passage of the Pfprol expression plasmid in the E.coli XL1-Red mutator strain, and the
Genemorph II mutagenesis method (Stratagene, La Jolla CA) (Theriot et al., 2008). The mutated prolidase genes were transformed into E. coli host strain, JD1(λDE3), which is auxotrophic for proline and does not express E. coli encoded prolidases. This strain was used to select and screen mutants at 30°C. Targeted site-directed mutagenesis was also performed, using the solved crystal structure of P. furiosus prolidase as a model. Mutants were screened to determine if key amino acid changes affected catalytic activity, metal dependency, and substrate specificity. The goal is to generate a prolidase with increased ability to hydrolyze OP nerve agents at lower temperatures (35 C-55 C).
OPH or organophosphate hydrolase has been genetically modified using the solved crystal structure as a model to target key amino acids in the metal binding site. Changing specific amino acid residues that are located in the metal binding pocket enhances the hydrolysis of certain chemical nerve agents and their analogues. OPH metal binding pocket mutations include His254Arg and His257Leu (Grimsley et al., 2000; Lai et al., 1994). They have shown a 2-30 fold increase in substrate specificity for demeton (P-S bond), which is a
30 VX analogue, and a decrease in hydrolysis of DFP (P-F bond). Both His257Leu and the double mutant His254Arg/His257Leu demonstrated 11- and 18-fold increased activity for
NPPMP, an analogue of soman (P-S bond), respectively (diSioudi et al., 1999; Grimsley et al., 2000). By changing the amino acid residues, hydrogen bonds are disrupted along with electrostatic interactions with side-chains (Vanhooke et al., 1996). It has been suggested that this could add flexibility for larger substrates entering the binding pocket and decrease the affinity for smaller substrates such as DFP (Grimsley et al., 2000).
Genetic engineering of OPH is a good example of how changing one or two amino acids can produce a new enzyme that is altered in its metal binding and substrate specificity properties. Enzyme engineering could be the solution to generating an optimum prolidase suitable for each application. For the detoxification of OPs, a prolidase that shows increased hydrolytic cleavage of OP nerve agents can be made. It would also be useful to consider generating a highly expressed prolidase in lactic acid bacteria for reducing bitterness and enhancing flavor during the cheese making process. For enzyme replacement therapy studies, a more stable recombinant human prolidase is needed for treatment of patients suffering from Prolidase Deficiency.
1.5 Conclusions
Prolidase, a proline dipeptidase, is a metalloenzyme that hydrolyzes the peptide bond between a non-polar amino acid and a prolyl residue. It has also been shown to hydrolyze the P-F, P-O, P-CN and P-S bond in sarin and soman OP nerve agents. Other applications that rely on prolidase include the degradation of larger peptides to create texture and flavor and aid in the overall cheese ripening process. Prolidase is also being investigated
31 as a potential therapeutic for Prolidase Deficiency and currently is being studied for its role in tumorgenesis. Each application that uses prolidase requires an enzyme with particular properties for optimum performance. Genetic engineering of prolidase is being conducted in order to tailor each enzyme for each application. Currently, the only solved crystal structure model of prolidase is from the hyperthermophile P. furiosus, and as such, it is being used as the model for directed mutation studies for the improvement of prolidases for a variety of applications. Furthermore, studies designed to alter the structure of prolidases will not only provide better optimized enzymes but will also provide critical information about metalloenzymes, hyperthermophilic enzymes, and enzyme catalysis that can be applied to other important technologies.
Acknowledgments
The authors thank Tatiana Quintero-Varca, Zeltina O‟Neal, Prashant Joshi and Eli Tiller for their help in analyzing Pyrococcus prolidase homologs. We also thank Joseph DeFrank and
Saumil Shah for their assistance in evaluating DFP degradation by Pyrococcal prolidases.
Support for the studies conducted in the Grunden laboratory that are discussed in this review was provided by the Army Research Office (contract number 44258LSSR).
32 References Cited
Adams, M. W., Kletzin, A., (1996). Oxidoreductase-type enzymes and redox proteins
involved in fermentative metabolisms of hyperthermophilic Archaea. Adv Protein
Chem. 48, 101-80.
Agboola, S., Chen, S., Zhao, J., (2004). Formation of bitter peptides during ripening of ovine
milk cheese made with different coagulants. Lait 84. 567-578.
Akiyama, S. K., Nagata, K., Yamada, K. M., (1990). Cell surface receptors for extracellular
matrix components. Biochim Biophys Acta. 1031, 91-110.
Anderson, R. S., Durst, H. D., Landis, W. G., (1988). Organofluorophosphate-hydrolyzing
activity in an estuarine clam, Rangia cuneata. Comp Biochem Physiol C. 91, 575-8.
Arata, J., K. , Hatakenaka, K., Oono, T., (1986). Effect of topical application of glycine and
proline on recalcitrant leg ulcers of prolidase deficiency. Arch Dermatol. 122, 626-
627.
Attaway, H., Nelson, J. O., Baya, A. M., Voll, M. J., White, W. E., Grimes, D. J., Colwell, R.
R., (1987). Bacterial detoxification of diisopropyl fluorophosphate. Appl Environ
Microbiol. 53, 1685-9.
Bazan, J. F., Weaver, L. H., Roderick, S. L., Huber, R., Matthews, B. W., (1994). Sequence
and structure comparison suggest that methionine aminopeptidase, prolidase,
aminopeptidase P, and creatinase share a common fold. Proc Natl Acad Sci U S A. 91,
2473-7.
33 Benning, M. M., Kuo, J. M., Raushel, F. M., Holden, H. M., (1994). Three-dimensional
structure of phosphotriesterase: an enzyme capable of detoxifying organophosphate
nerve agents. Biochemistry. 33, 15001-7.
Benning, M. M., Kuo, J. M., Raushel, F. M., Holden, H. M., (1995). Three-dimensional
structure of the binuclear metal center of phosphotriesterase. Biochemistry. 34, 7973-
8.
Bissell, M. J., Hall, H. G., Parry, G., (1982). How does the extracellular matrix direct gene
expression? J Theor Biol. 99, 31-68.
Bockelmann, W., (1995). The proteolytic system of starter and non-starter bacteria:
Components and their importance for cheese ripening. International Dairy Journal. 5,
977-994.
Bornstein, P., Sage, H., (1989). Regulation of collagen gene expression. Prog Nucleic Acid
Res Mol Biol. 37, 67-106.
Bradbury, A. F., Finnie, M. D., Smyth, D. G., (1982). Mechanism of C-terminal amide
formation by pituitary enzymes. Nature. 298, 686-8.
Browne, P., O'Cuinn, G., (1983). The purification and characterization of a proline
dipeptidase from guinea pig brain. J Biol Chem 258, 6147-54.
Caldwell, S. R., Raushel, F. M., (1991a). Detoxification of organophosphate pesticides using
a nylon based immobilized phosphotriesterase from Pseudomonas diminuta. Appl
Biochem Biotechnol. 31, 59-73.
34 Caldwell, S. R., Raushel, F. M., (1991b). Detoxification of organophosphate pesticides using
an immobilized phosphotriesterase from Pseudomonas diminuta. Biotechnol Bioeng.
37, 103-9.
Carey, D. J., (1991). Control of growth and differentiation of vascular cells by extracellular
matrix proteins. Annu Rev Physiol. 53, 161-77.
Cechowska-Pasko, M., Palka, J., Wojtukiewicz, M. Z., (2006). Enhanced prolidase activity
and decreased collagen content in breast cancer tissue. Int J Exp Pathol. 87, 289-96.
Chang, Y. H., Teichert, U., Smith, J. A., (1992). Molecular cloning, sequencing, deletion,
and overexpression of a methionine aminopeptidase gene from Saccharomyces
cerevisiae. J Biol Chem. 267, 8007-11.
Chen, W., Mulchandani, A., (1998). The use of live biocatalysts for pesticide detoxification.
Trends Biotechnol. 16, 71-6.
Chen, W., Richins, R. D., Mulchandani, P., Kaneva, I., Mulchandani, A., (2000).
Biodegradation of organophosphorus nerve agents by surface expressed
organophosphorus hydrolase. Enzymes in Action Green Solutions for Chemical
Problems. 33, 211-221.
Cheng, T., Liu, L., Wang, B., Wu, J., DeFrank, J. J., Anderson, D. M., Rastogi, V. K.,
Hamilton, A. B., (1997). Nucleotide sequence of a gene encoding an
organophosphorus nerve agent degrading enzyme from Alteromonas haloplanktis. J
Ind Microbiol Biotechnol. 18, 49-55.
35 Cheng, T. C., DeFrank, J. J., (2000). Hydrolysis of Organophosphorus Compounds by
Bacterial Prolidases. Enzymes in Action Green Solutions for Chemical Problems. 33,
243-261.
Cheng, T. C., DeFrank, J. J., Rastogi, V. K., (1999). Alteromonas prolidase for
organophosphorus G-agent decontamination. Chem Biol Interact. 119-120, 455-62.
Cheng, T. C., Harvey, S. P., Chen, G. L., (1996). Cloning and expression of a gene encoding
a bacterial enzyme for decontamination of organophosphorus nerve agents and
nucleotide sequence of the enzyme. Appl Environ Microbiol. 62, 1636-41.
Cheng, T. C., Harvey, S. P., Stroup, A. N., (1993). Purification and Properties of a Highly
Active Organophosphorus Acid Anhydrolase from Alteromonas undina. Appl
Environ Microbiol. 59, 3138-3140.
Cheng, T. C., Rastogi, V. K., DeFrank, J. J., Sawiris, G. P., (1998). G-type nerve agent
decontamination by Alteromonas prolidase. Ann N Y Acad Sci. 864, 253-8.
Chevrier, B., Schalk, C., D'Orchymont, H., Rondeau, J. M., Moras, D., Tarnus, C., (1994).
Crystal structure of Aeromonas proteolytica aminopeptidase: a prototypical member
of the co-catalytic zinc enzyme family. Structure. 2, 283-91.
Christensen, J. E., Dudley, E. G., Pederson, J. A., Steele, J. L., (1999). Peptidases and amino
acid catabolism in lactic acid bacteria. Antonie van Leeuwenhoek. 76, 217-246.
Chungjatupornchai, W., Fa-Aroonsawat, S., (2008). Biodegradation of organophosphate
pesticide using recombinant Cyanobacteria with surface- and intracellular-expressed
organophosphorus hydrolase. J Microbiol Biotechnol. 18, 946-51.
36 Coll, M., Knof, S. H., Ohga, Y., Messerschmidt, A., Huber, R., Moellering, H., Russmann,
L., Schumacher, G., (1990). Enzymatic mechanism of creatine amidinohydrolase as
deduced from crystal structures. J Mol Biol. 214, 597-610.
Colonna, C., Conti, B., Perugini, P., Pavanetto, F., Modena, T., Dorati, R., Genta, I., (2007).
Chitosan glutamate nanoparticles for protein delivery: development and effect on
prolidase stability. J Microencapsul. 24, 553-64.
Colonna, C., Conti, B., Perugini, P., Pavanetto, F., Modena, T., Dorati, R., Iadarola, P.,
Genta, I., (2008). Site-directed PEGylation as successful approach to improve the
enzyme replacement in the case of prolidase. Int J Pharm. 358, 230-7.
Copik, A. J., Waterson, S., Swierczek, S. I., Bennett, B., Holz, R. C., (2005). Both
nucleophile and substrate bind to the catalytic Fe(II)-center in the type-II methionyl
aminopeptidase from Pyrococcus furiosus. Inorg Chem. 44, 1160-2.
Cosper, N. J., D'Souza V, M., Scott, R. A., Holz, R. C., (2001). Structural evidence that the
methionyl aminopeptidase from Escherichia coli is a mononuclear metalloprotease.
Biochemistry. 40, 13302-9.
Courtin, P., Nardi, M., Wegmann, U., Joutsjoki, V., Ogier, J. C., Gripon, J. C., Palva, A.,
Henrich, B., Monnet, V., (2002). Accelerating cheese proteolysis by enriching
Lactococcus lactis proteolytic system with lactobacilli peptidases. International
Dairy Journal 12, 447-454.
Cunningham, D. F., O'Connor, B., (1997). Proline specific peptidases. Biochim Biophys Acta.
1343, 160-86.
37 D'Souza V, M., Bennett, B., Copik, A. J., Holz, R. C., (2000). Divalent metal binding
properties of the methionyl aminopeptidase from Escherichia coli. Biochemistry. 39,
3817-26.
D'Souza V, M., Holz, R. C., (1999). The methionyl aminopeptidase from Escherichia coli
can function as an iron(II) enzyme. Biochemistry. 38, 11079-85.
DeFrank, J. J., Beaudry, W. T., Cheng, T. C., Harvey, S. P., Stroup, A. N., Szafraniec, L. L.,
(1993). Screening of halophilic bacteria and Alteromonas species for
organophosphorus hydrolyzing enzyme activity. Chem Biol Interact. 87, 141-8.
DeFrank, J. J., Cheng, T. C., (1991). Purification and properties of an organophosphorus acid
anhydrase from a halophilic bacterial isolate. J Bacteriol. 173, 1938-43.
DeFrank, J. J., M., G., Harvey, S., Fry, I. J., Earley, J. P., Lupton, F. S., (2000).
Biodegradation of hydrolyzed chemical warfare agents by bacterial consortia.
Enzymes in Action Green Solutions for Chemical Problems. 33, 193-209.
Di Lullo, G. A., Sweeney, S. M., Korkko, J., Ala-Kokko, L., San Antonio, J. D., (2002).
Mapping the ligand-binding sites and disease-associated mutations on the most
abundant protein in the human, type I collagen. J Biol Chem. 277, 4223-31. diSioudi, B., Grimsley, J. K., Lai, K., Wild, J. R., (1999). Modification of near active site
residues in organophosphorus hydrolase reduces metal stoichiometry and alters
substrate specificity. Biochemistry. 38, 2866-72.
Dixit, S. N., Seyer, J. M., Kang, A. H., (1977). Covalent structure of collagen: amino-acid
sequence of chymotryptic peptides from the carboxyl-terminal region of alpha2-CB3
of chick-skin collagen. Eur J Biochem. 81, 599-607.
38 Donjacour, A. A., Cunha, G. R., (1991). Stromal regulation of epithelial function. Cancer
Treat Res. 53, 335-64.
Du, X., Tove, S., Kast-Hutcheson, K., Grunden, A. M., (2005). Characterization of the
dinuclear metal center of Pyrococcus furiosus prolidase by analysis of targeted
mutants. FEBS Lett. 579, 6140-6.
Dumas, D. P., Caldwell, S. R., Wild, J. R., Raushel, F. M., (1989). Purification and properties
of the phosphotriesterase from Pseudomonas diminuta. J Biol Chem. 264, 19659-65.
Dumas, D. P., Durst, H. D., Landis, W. G., Raushel, F. M., Wild, J. R., (1990). Inactivation
of organophosphorus nerve agents by the phosphotriesterase from Pseudomonas
diminuta. Arch Biochem Biophys. 277, 155-9.
El Soda, M., (1993). The role of lactic acid bacteria in accelerated cheese ripening FEMS
Microbiol Rev 12, 239-252.
Endo, F., Matsuda, I., Ogata, A., Tanaka, S., (1982). Human erythrocyte prolidase and
prolidase deficiency. Pediatr Res. 16, 227-31.
Endo, F., Tanoue, A., Nakai, H., Hata, A., Indo, Y., Titani, K., Matsuda, I., (1989). Primary
structure and gene localization of human prolidase. J Biol Chem. 264, 4476-81.
Fernandez-Espla, M. D., Martin-Hernandez, M. C., Fox, P. F., (1997). Purification and
characterization of a prolidase from Lactobacillus casei subsp. casei IFPL 731. Appl
Environ Microbiol. 63, 314-6.
Forlino, A., Lupi, A., Vaghi, P., Icaro Cornaglia, A., Calligaro, A., Campari, E., Cetta, G.,
(2002). Mutation analysis of five new patients affected by prolidase deficiency: the
39 lack of enzyme activity causes necrosis-like cell death in cultured fibroblasts. Hum
Genet. 111, 314-22.
Fujii, M., Nagaoka, Y., Imamura, S., Shimizu, T., (1996). Purification and characterization of
a prolidase from Aureobacterium esteraromaticum. Biosci Biotechnol Biochem. 60,
1118-22.
Galicka, A., Surazynski, A., Wolczynski, S., Palka, J., Popko, J., Gindzienski, A., (2005).
Phenotype variability in a daughter and father with mild osteogenesis imperfecta
correlated with collagen and prolidase levels in cultured skin fibroblasts. Ann Clin
Biochem. 42, 80-4.
Galicka, A., Wolczynski, S., Anchim, T., Surazynski, A., Lesniewicz, R., Palka, J., (2001).
Defects of type I procollagen metabolism correlated with decrease of prolidase
activity in a case of lethal osteogenesis imperfecta. Eur J Biochem. 268, 2172-8.
Genta, I., Perugini, P., Pavanetto, F., Maculotti, K., Modena, T., Casado, B., Lupi, A.,
Iadarola, P., Conti, B., (2001). Enzyme loaded biodegradable microspheres in vitro ex
vivo evaluation. J Control Release. 77, 287-95.
Ghosh, M., Grunden, A. M., Dunn, D. M., Weiss, R., Adams, M. W., (1998).
Characterization of native and recombinant forms of an unusual cobalt-dependent
proline dipeptidase (prolidase) from the hyperthermophilic archaeon Pyrococcus
furiosus. J Bacteriol. 180, 4781-9.
Gilboa, R., Spungin-Bialik, A., Wohlfahrt, G., Schomburg, D., Blumberg, S., Shoham, G.,
(2001). Interactions of Streptomyces griseus aminopeptidase with amino acid reaction
products and their implications toward a catalytic mechanism. Proteins. 44, 490-504.
40 Graham, S. C., Lilley, P. E., Lee, M., Schaeffer, P. M., Kralicek, A. V., Dixon, N. E., Guss,
J. M., (2006). Kinetic and crystallographic analysis of mutant Escherichia coli
aminopeptidase P: insights into substrate recognition and the mechanism of catalysis.
Biochemistry. 45, 964-75.
Grimsley, J. K., Disioudi, B. D., Holton, T. R., Sacchettini, J. C., Wild, J. R., (2000). Active
site modifications of organophosphorus hydrolase for improved detoxification of
organophosphorus neurotoxins.
Enzymes in Action Green Solutions for Chemical Problems. 33, 223-242.
Grimsley, J. K., Scholtz, J. M., Pace, C. N., Wild, J. R., (1997). Organophosphorus hydrolase
is a remarkably stable enzyme that unfolds through a homodimeric intermediate.
Biochemistry. 36, 14366-74.
Grunden, A. M., Ghosh, M., Adams, M. W., (2001). Proline dipeptidase from Pyrococcus
furiosus. Methods Enzymol. 330, 433-45.
Hirel, P. H., Schmitter, M. J., Dessen, P., Fayat, G., Blanquet, S., (1989). Extent of N-
terminal methionine excision from Escherichia coli proteins is governed by the side-
chain length of the penultimate amino acid. Proc Natl Acad Sci U S A. 86, 8247-51.
Hoskin, F. C., Roush, A. H., (1982). Hydrolysis of nerve gas by squid-type diisopropyl
phosphorofluoridate hydrolyzing enzyme on agarose resin. Science. 215, 1255-7.
Ikeda, K., Tohyama, J., Tsujino, S., Sato, K., Oono, T., Arata, J., Endo, F., Sakuragawa, N.,
(1997). Amelioration of prolidase deficiency in fibroblasts using adenovirus mediated
gene transfer. Jpn J Hum Genet. 42, 401-8.
41 Isemura, M., Hanyu, T., Gejyo, F., Nakazawa, R., Igarashi, R., Matsuo, S., Ikeda, K., Sato,
Y., (1979). Prolidase deficiency with imidodipeptiduria. A familial case with and
without clinical symptoms. Clin Chim Acta. 93, 401-7.
Ishibashi, N., T., K., Chino, M., Fukui, H., Shinoda, I., Kikuchi, E., Okai, H., Fukui, S.,
(1988). Taste of Proline-containing Peptides. Agric. Biol. Chem. 52, 95-98.
Jaakkola, P., Mole, D. R., Tian, Y. M., Wilson, M. I., Gielbert, J., Gaskell, S. J., Kriegsheim,
A., Hebestreit, H. F., Mukherji, M., Schofield, C. J., Maxwell, P. H., Pugh, C. W.,
Ratcliffe, P. J., (2001). Targeting of HIF- to the von Hippel-Lindau ubiquitylation
complex by O2-regulated prolyl hydroxylation. Science. 292, 468-72.
Jackson, S. H., Dennis, A. W., Greenberg, M., (1975). Iminodipeptiduria: a genetic defect in
recycling collagen; a method for determining prolidase in erythrocytes. Can Med
Assoc J. 113, 759, 762-3.
Jalving, R., Bron, P., Kester, H. C., Visser, J., Schaap, P. J., (2002). Cloning of a prolidase
gene from Aspergillus nidulans and characterisation of its product. Mol Genet
Genomics. 267, 218-22.
Jemec, G. B., Moe, A. T., (1996). Topical treatment of skin ulcers in prolidase deficiency.
Pediatr Dermatol. 13, 58-60.
Kabashima, T., Fujii, M., Hamasaki, Y., Ito, K., Yoshimoto, T., (1999). Cloning of a novel
prolidase gene from Aureobacterium esteraromaticum. Biochim Biophys Acta. 1429,
516-20.
42 Karna, E., Surazynski, A., Palka, J., (2000). Collagen metabolism disturbances are
accompanied by an increase in prolidase activity in lung carcinoma planoepitheliale.
Int J Exp Pathol. 81, 341-7.
King, G. F., Middlehurst, C. R., Kuchel, P. W., (1986). Direct NMR evidence that prolidase
is specific for the trans isomer of imidodipeptide substrates. Biochemistry. 25, 1054-
62.
Kokturk, A., Kaya, T. I., Ikizoglu, G., Koca, A., (2002). Prolidase deficiency. Int J Dermatol.
41, 45-8.
Lai, K., Dave, K. I., Wild, J. R., (1994). Bimetallic binding motifs in organophosphorus
hydrolase are important for catalysis and structural organization. J Biol Chem. 269,
16579-84.
Lai, K., Grimsley, J. K., Kuhlmann, B. D., Scapozza, L., Harvey, S. P., DeFrank, J. J.,
Kolalowski, J. E., Wild, J. R., (1996). Rational enzyme design: Computer modeling
and site-directed mutagenesis for the modification of catalytic specificity in
organophosphorus hydrolase. Chimia. 50, 430-431.
Lai, K., Stolowich, N. J., Wild, J. R., (1995). Characterization of P-S bond hydrolysis in
organophosphorothioate pesticides by organophosphorus hydrolase. Arch Biochem
Biophys. 318, 59-64.
Landis, W. G., Haley, D. M., Haley, M. V., Johnson, D. W., Durst, H. D., Savage, R. E., Jr.,
(1987). Discovery of multiple organofluorophosphate hydrolyzing activities in the
protozoan Tetrahymena thermophila. J Appl Toxicol. 7, 35-41.
43 Ledoux, P., Scriver, C. R., Hechtman, P., (1996). Expression and molecular analysis of
mutations in prolidase deficiency. Am J Hum Genet. 59, 1035-9.
LeJeune, K. E., Wild, J. R., Russell, A. J., (1998). Nerve agents degraded by enzymatic
foams. Nature. 395, 27-8.
Lin, L. N., Brandts, J. F., (1979). Evidence suggesting that some proteolytic enzymes may
cleave only the trans form of the peptide bond. Biochemistry. 18, 43-7.
Little, J. S., Broomfield, C. A., Fox-Talbot, M. K., Boucher, L. J., MacIver, B., Lenz, D. E.,
(1989). Partial characterization of an enzyme that hydrolyzes sarin, soman, tabun, and
diisopropyl phosphorofluoridate (DFP). Biochem Pharmacol. 38, 23-9.
Liu, S., Widom, J., Kemp, C. W., Crews, C. M., Clardy, J., (1998). Structure of human
methionine aminopeptidase-2 complexed with fumagillin. Science. 282, 1324-7.
Lowther, W. T., Matthews, B. W., (2000). Structure and function of the methionine
aminopeptidases. Biochim Biophys Acta. 1477, 157-67.
Lowther, W. T., Matthews, B. W., (2002). Metalloaminopeptidases: common functional
themes in disparate structural surroundings. Chem Rev. 102, 4581-608.
Lowther, W. T., Zhang, Y., Sampson, P. B., Honek, J. F., Matthews, B. W., (1999). Insights
into the mechanism of Escherichia coli methionine aminopeptidase from the
structural analysis of reaction products and phosphorus-based transition-state
analogues. Biochemistry. 38, 14810-9.
Lupi, A., Casado, B., Soli, M., Bertazzoni, M., Annovazzi, L., Viglio, S., Cetta, G., Iadarola,
P., (2002). Therapeutic apheresis exchange in two patients with prolidase deficiency.
Br J Dermatol. 147, 1237-40.
44 Lupi, A., Della Torre, S., Campari, E., Tenni, R., Cetta, G., Rossi, A., Forlino, A., (2006).
Human recombinant prolidase from eukaryotic and prokaryotic sources. Expression,
purification, characterization and long-term stability studies. Febs J. 273, 5466-78.
Lupi, A., Perugini, P., Genta, I., Modena, T., Conti, B., Casado, B., Cetta, G., Pavanetto, F.,
Iadarola, P., (2004). Biodegradable microspheres for prolidase delivery to human
cultured fibroblasts. J Pharm Pharmacol. 56, 597-603.
Lupi, A., Tenni, R., Rossi, A., Cetta, G., Forlino, A., (2008). Human prolidase and prolidase
deficiency: an overview on the characterization of the enzyme involved in proline
recycling and on the effects of its mutations. Amino Acids. 35, 739-752.
Maher, M. J., Ghosh, M., Grunden, A. M., Menon, A. L., Adams, M. W., Freeman, H. C.,
Guss, J. M., (2004). Structure of the prolidase from Pyrococcus furiosus.
Biochemistry. 43, 2771-83.
Mazur, A., (1946). An enzyme in animal tissues capable of hydrolyzing the phosphorus-
fluorine bond of alkyl fluorophosphates. J. Biol. Chem. 164, 271-289.
Meng, L., Ruebush, S., D'Souza V, M., Copik, A. J., Tsunasawa, S., Holz, R. C., (2002).
Overexpression and divalent metal binding properties of the methionyl
aminopeptidase from Pyrococcus furiosus. Biochemistry. 41, 7199-208.
Mentlein, R., (1988). Proline residues in the maturation and degradation of peptide hormones
and neuropeptides. FEBS Lett. 234, 251-6.
Miltyk, W., Anchim, T., Wolczynski, S., Palka, J., (1999). Estrogen-dependent regulation of
prolidase activity in breast cancer MCF-7 cells. Gynecol Endocrinol. 13, 166-74.
45 Mittal, S., Song, X., Vig, B. S., Amidon, G. L., (2007). Proline prodrug of melphalan
targeted to prolidase, a prodrug activating enzyme overexpressed in melanoma.
Pharm Res. 24, 1290-8.
Mittal, S., Song, X., Vig, B. S., Landowski, C. P., Kim, I., Hilfinger, J. M., Amidon, G. L.,
(2005). Prolidase, a potential enzyme target for melanoma: design of proline-
containing dipeptide-like prodrugs. Mol Pharm. 2, 37-46.
Monafo, V., Marseglia, G. L., Maghnie, M., Dyne, K. M., Cetta, G., (2000). Transient
beneficial effect of GH replacement therapy and topical GH application on skin ulcers
in a boy with prolidase deficiency. Pediatr Dermatol. 17, 227-30.
Morel, F., Frot-Coutaz, J., Aubel, D., Portalier, R., Atlan, D., (1999). Characterization of a
prolidase from Lactobacillus delbrueckii subsp. bulgaricus CNRZ 397 with an
unusual regulation of biosynthesis. Microbiology. 145 ( Pt 2), 437-46.
Mulbry, W. W., Karns, J. S., Kearney, P. C., Nelson, J. O., McDaniel, C. S., Wild, J. R.,
(1986). Identification of a plasmid-borne parathion hydrolase gene from
Flavobacterium sp. by southern hybridization with opd from Pseudomonas diminuta.
Appl Environ Microbiol. 51, 926-30.
Mulchandani, A., Kaneva, I., Chen, W., (1998a). Biosensor for direct determination of
organophosphate nerve agents using recombinant Escherichia coli with surface-
expressed organophosphorus hydrolase. 2. Fiber-optic microbial biosensor. Anal
Chem. 70, 5042-6.
46 Mulchandani, A., Kaneva, I., Chen, W., (1999). Detoxification of organophosphate nerve
agents by immobilized Escherichia coli with surface-expressed organophosphorus
hydrolase. Biotechnol Bioeng. 63, 216-23.
Mulchandani, A., Mulchandani, P., Kaneva, I., Chen, W., (1998b). Biosensor for direct
determination of organophosphate nerve agents using recombinant Escherichia coli
with surface-expressed organophosphorus hydrolase. 1. Potentiometric microbial
electrode. Anal Chem. 70, 4140-5.
Munnecke, D. M., (1979). Hydrolysis of organophosphate insecticides by an immobilized-
enzyme system. Biotechnol Bioeng. 21, 2247-61.
Myara, I., Cosson, C., Moatti, N., Lemonnier, A., (1994). Human kidney prolidase--
purification, preincubation properties and immunological reactivity. Int J Biochem.
26, 207-14.
Niehaus, F., Bertoldo, C., Kahler, M., Antranikian, G., (1999). Extremophiles as a source of
novel enzymes for industrial application. Appl Microbiol Biotechnol. 51, 711-29.
Ogata, A., Tanaka, S., Tomoda, T., Murayama, E., Endo, F., Kikuchi, I., (1981). Autosomal
recessive prolidase deficiency. Three patients with recalcitrant ulcers. Arch Dermatol.
117, 689-97.
Omburo, G. A., Kuo, J. M., Mullins, L. S., Raushel, F. M., (1992). Characterization of the
zinc binding site of bacterial phosphotriesterase. J Biol Chem. 267, 13278-83.
Omburo, G. A., Mullins, L. S., Raushel, F. M., (1993). Structural characterization of the
divalent cation sites of bacterial phosphotriesterase by 113Cd NMR spectroscopy.
Biochemistry. 32, 9148-55.
47 Palka, J., Surazynski, A., Karna, E., Orlowski, K., Puchalski, Z., Pruszynski, K.,
Laszkiewicz, J., Dzienis, H., (2002). Prolidase activity disregulation in chronic
pancreatitis and pancreatic cancer. Hepatogastroenterology. 49, 1699-703.
Palka, J. A., (1996). The role of prolidase as an enzyme participating in the metabolism of
collagen. Rocz Akad Med Bialymst. 41, 149-60.
Palka, J. A., Phang, J. M., (1998). Prolidase in human breast cancer MCF-7 cells. Cancer
Lett. 127, 63-70.
Park, M. S., Hill, C. M., Li, Y., Hardy, R. K., Khanna, H., Khang, Y. H., Raushel, F. M.,
(2004). Catalytic properties of the PepQ prolidase from Escherichia coli. Arch
Biochem Biophys. 429, 224-30.
Persson, B., Flinta, C., von Heijne, G., Jornvall, H., (1985). Structures of N-terminally
acetylated proteins. Eur J Biochem. 152, 523-7.
Perugini, P., Hassan, K., Genta, I., Modena, T., Pavanetto, F., Cetta, G., Zanone, C., Iadarola,
P., Asti, A., Conti, B., (2005). Intracellular delivery of liposome-encapsulated
prolidase in cultured fibroblasts from prolidase-deficient patients. J Control Release.
102, 181-90.
Rainina, E. I., Efremenco, E. N., Varfolomeyev, S. D., Simonian, A. L., Wild, J. R., (1996).
The development of a new biosensor based on recombinant E. coli for the direct
detection of organophosphorus neurotoxins. Biosens Bioelectron. 11, 991-1000.
Rao, V. H., Royce, P. M., Steinmann, B., (1993). Normal production, nature, and extent of
intracellular degradation of newly synthesized collagen in fibroblasts from a patient
with prolidase deficiency. Connect Tissue Res. 29, 23-30.
48 Richins, R. D., Kaneva, I., Mulchandani, A., Chen, W., (1997). Biodegradation of
organophosphorus pesticides by surface-expressed organophosphorus hydrolase. Nat
Biotechnol. 15, 984-7.
Roderick, S. L., Matthews, B. W., (1993). Structure of the cobalt-dependent methionine
aminopeptidase from Escherichia coli: a new type of proteolytic enzyme.
Biochemistry. 32, 3907-12.
Rowsell, S., Pauptit, R. A., Tucker, A. D., Melton, R. G., Blow, D. M., Brick, P., (1997).
Crystal structure of carboxypeptidase G2, a bacterial enzyme with applications in
cancer therapy. Structure. 5, 337-47.
Royce, P. M., Steinmann, B. Eds.), (2002). Prolidase deficiency. Wiley-Liss, New York.
Semenza, G. L., (2001). Hypoxia-inducible factor 1: oxygen homeostasis and disease
pathophysiology. Trends Mol Med. 7, 345-50.
Sheffield, L. J., Schlesinger, P., Faull, K., Halpern, B. J., Schier, G. M., Cotton, R. G.,
Hammond, J., Danks, D. M., (1977). Iminopeptiduria, skin ulcerations, and edema in
a boy with prolidase deficiency. J Pediatr. 91, 578-83.
Shimazu, M., Mulchandani, A., Chen, W., (2001). Simultaneous degradation of
organophosphorus pesticides and p-nitrophenol by a genetically engineered
Moraxella sp. with surface-expressed organophosphorus hydrolase. Biotechnol
Bioeng. 76, 318-24.
Shrinath, M., Walter, J. H., Haeney, M., Couriel, J. M., Lewis, M. A., Herrick, A. L., (1997).
Prolidase deficiency and systemic lupus erythematosus. Arch Dis Child. 76, 441-4.
49 Sjostrom, H., Noren, O., Josefsson, L., (1973). Purification and specificity of pig intestinal
prolidase. Biochim Biophys Acta. 327, 457-70.
Sousa, M. J., Ardo, Y., McSweeney, P. L. H., (2001). Advances in the study of proteolysis
during cheese ripening. International Dairy Journal. 11, 327-345.
Strater, N., Lipscomb, W. N., (1995). Transition state analogue L-leucinephosphonic acid
bound to bovine lens leucine aminopeptidase: X-ray structure at 1.65 A resolution in
a new crystal form. Biochemistry. 34, 9200-10.
Stucky, K., Klein, J. R., Schuller, A., Matern, H., Henrich, B., Plapp, R., (1995). Cloning and
DNA sequence analysis of pepQ, a prolidase gene from Lactobacillus delbrueckii
subsp. lactis DSM7290 and partial characterization of its product. Mol Gen Genet.
247, 494-500.
Suga, K., Kabashima, T., Ito, K., Tsuru, D., Okamura, H., Kataoka, J., Yoshimoto, T.,
(1995). Prolidase from Xanthomonas maltophilia: purification and characterization of
the enzyme. Biosci Biotechnol Biochem. 59, 2087-90.
Sullivan, J. J., Jago, G. R., (1972). The structure of bitter peptides and their formation from
caseins. Aust Journal Dairy Technology 27, 98-104.
Surazynski, A., Liu, Y., Miltyk, W., Phang, J. M., (2005). Nitric oxide regulates prolidase
activity by serine/threonine phosphorylation. J Cell Biochem. 96, 1086-94.
Surazynski, A., Miltyk, W., Palka, J., Phang, J. M., (2008). Prolidase-dependent regulation of
collagen biosynthesis. Amino Acids.
50 Tahirov, T. H., Oki, H., Tsukihara, T., Ogasahara, K., Yutani, K., Ogata, K., Izu, Y.,
Tsunasawa, S., Kato, I., (1998). Crystal structure of methionine aminopeptidase from
hyperthermophile, Pyrococcus furiosus. J Mol Biol. 284, 101-24.
Takayama, K., Suye, S., Kuroda, K., Ueda, M., Kitaguchi, T., Tsuchiyama, K., Fukuda, T.,
Chen, W., Mulchandani, A., (2006). Surface display of organophosphorus hydrolase
on Saccharomyces cerevisiae. Biotechnol Prog. 22, 939-43.
Tanoue, A., Endo, F., Matsuda, I., (1990). Structural organization of the gene for human
prolidase (peptidase D) and demonstration of a partial gene deletion in a patient with
prolidase deficiency. J Biol Chem. 265, 11306-11.
Taylor, A., (1993). Aminopeptidases: towards a mechanism of action. Trends Biochem Sci.
18, 167-71.
Theriot, C. M., Tove, S., Grunden, A. M., Construction of hyperthermophilic Pyrococcus
furiosus prolidase mutants with higher catalytic activity at lower temperatures.
American Society for Microbiology 108th General Meeting American Society for
Microbiology, Boston, MA, 2008, pp. 72.
Tsunasawa, S., Izu, Y., Miyagi, M., Kato, I., (1997). Methionine aminopeptidase from the
hyperthermophilic Archaeon Pyrococcus furiosus: molecular cloning and
overexpression in Escherichia coli of the gene, and characteristics of the enzyme. J
Biochem. 122, 843-50.
Tuovinen, K., Kaliste-Korhonen, E., Raushel, F. M., Hanninen, O., (1994).
Phosphotriesterase--a promising candidate for use in detoxification of
organophosphates. Fundam Appl Toxicol. 23, 578-84.
51 Tuovinen, K., Kaliste-Korhonen, E., Raushel, F. M., Hanninen, O., (1996). Protection of
organophosphate-inactivated esterases with phosphotriesterase. Fundam Appl
Toxicol. 31, 210-7.
Vanhoof, G., Goossens, F., De Meester, I., Hendriks, D., Scharpe, S., (1995). Proline motifs
in peptides and their biological processing. Faseb J. 9, 736-44.
Vanhooke, J. L., Benning, M. M., Raushel, F. M., Holden, H. M., (1996). Three-dimensional
structure of the zinc-containing phosphotriesterase with the bound substrate analog
diethyl 4-methylbenzylphosphonate. Biochemistry. 35, 6020-5.
Viglio, S., Annovazzi, L., Conti, B., Genta, I., Perugini, P., Zanone, C., Casado, B., Cetta, G.,
Iadarola, P., (2006). The role of emerging techniques in the investigation of prolidase
deficiency: from diagnosis to the development of a possible therapeutical approach. J
Chromatogr B Analyt Technol Biomed Life Sci. 832, 1-8.
Walter, R., Simmons, W. H., Yoshimoto, T., (1980). Proline specific endo- and
exopeptidases. Mol Cell Biochem. 30, 111-27.
Wang, S. H., Zhi, Q. W., Sun, M. J., (2005). Purification and characterization of recombinant
human liver prolidase expressed in Saccharomyces cerevisiae. Arch Toxicol. 79, 253-
9.
Wang, S. H., Zhi, Q. W., Sun, M. J., (2006). Dual activities of human prolidase. Toxicol In
Vitro. 20, 71-7.
Wilce, M. C., Bond, C. S., Dixon, N. E., Freeman, H. C., Guss, J. M., Lilley, P. E., Wilce, J.
A., (1998). Structure and mechanism of a proline-specific aminopeptidase from
Escherichia coli. Proc Natl Acad Sci U S A. 95, 3472-7.
52 Willingham, K., Maher, M. J., Grunden, A. M., Ghosh, M., Adams, M. W., Freeman, H. C.,
Guss, J. M., (2001). Crystallization and characterization of the prolidase from
Pyrococcus furiosus. Acta Crystallogr D Biol Crystallogr. 57, 428-30.
Yang, S. I., Tanaka, T., (2008). Characterization of recombinant prolidase from Lactococcus
lactis- changes in substrate specificity by metal cations, and allosteric behavior of the
peptidase. Febs J. 275, 271-80.
Yaron, A., (1987). The role of proline in the proteolytic regulation of biologically active
peptides. Biopolymers. 26 Suppl, S215-22.
Yaron, A., Naider, F., (1993). Proline-dependent structural and biological properties of
peptides and proteins. Crit Rev Biochem Mol Biol. 28, 31-81.
Yasuda, K., Ogata, K., Kariya, K., Kodama, H., Zhang, J., Sugahara, K., Sagara, Y., (1999).
Corticosteroid treatment of prolidase deficiency skin lesions by inhibiting
iminodipeptide-primed neutrophil superoxide generation. Br J Dermatol. 141, 846-
51.
53 Table 1-1
54
Table 1-2
55
Table 1-3
56
Figure 1-1: The structure of a basic R-group amino acid with chiral α-carbon (C') connected to an amino and carboxyl group (1A) and the cyclic structure of the amino acid proline (1B).
57
Figure 1-2: Characterized proline specific peptidases: APP, aminopeptidase P; DPPIV, dipeptidyl peptidase IV; DPPII, dipeptidyl peptidase II; PE, prolyl endopeptidase; CPP, carboxypeptidase P; PCP, prolyl carboxypeptidase. These enzymes cleave peptides and proteins (open circles) with a proline residue (filled circles) at specific locations within the protein (Cunningham et al., 1997). The point of cleavage is indicated by the arrow.
58
Figure 1-3: Proposed reaction mechanism for prolidase based on P. furiosus prolidase numbering, modified from Lowther and Matthews, 2002.
59
Figure 1-4: The structure of a monomer and dimer of Pfprol. (A) Ribbon drawing of Pfprol monomer showing the N-terminal domain in blue and the C-terminal domain in yellow. The gray spheres indicate the location of the metal center or Zn atoms in the C-terminal region.
(B) Ribbon drawing of the dimer of Pfprol, the two subunits A and B are in green and red, respectively. From Maher et al., 2004.
60
Figure 1-5: Stereoview of the active site of Pfprol. Gray spheres indicate zinc atoms where residues D209, D220, H284, E313, E327 are interacting. The dotted line shows the hydrogen bond between E313 and the bridging hydroxide ion. From Maher et al., 2004.
61
Figure 1-6: Clustal alignment generated using MacVector software showing the homology that exists between P. furiosus prolidase and other prolidases including P. horikoshii homolog 1 (57%), Alteromonas (OPAA-2) (44%), L. delbrueckii (59%), Human (49%),
E.coli PepP (52%), and E. coli MetAP (32%). The values in parentheses indicate the percent similarity between Pfprol and the respective prolidases or MetAP. Asterisks mark the conserved residues in the prolidase and MetAP identifying the dinuclear cobalt metal binding site.
62
Figure 1-7: The chemical structure of G-type nerve agents and proline dipeptides, Leu-Pro and Ala-Pro. Specific activities of OPAA and other prolidases with these compounds as substrates are reported in Table 1-2.
63
CHAPTER 2
Improving the Catalytic Activity of Hyperthermophilic Pyrococcus Prolidases for Detoxification of Organophosphorus Nerve Agents over a Broad Range of Temperatures
Casey M. Theriot, Xuelian Du, Sherry R. Tove, Amy M. Grunden
Department of Microbiology, North Carolina State University, Raleigh, NC 27695
Citation: Theriot, C.M., S.R. Tove, A.M. Grunden (2010) Improving the catalytic activity
of hyperthermophilic Pyrococcus prolidases for detoxification of organophosphorus nerve agents over a broad range of temperatures. Applied Microbiology and Biotechnology. April
27 (Epub ahead of print).
64
Abstract
Prolidase isolated from the hyperthermophilic archaeon Pyrococcus furiosus has potential application for decontamination of organophosphorus compounds in certain pesticides and chemical warfare agents under harsh conditions. However, current applications that use an enzyme-based cocktail are limited by poor long-term enzyme stability and low reactivity over a broad range of temperatures. To obtain a better enzyme for
OP nerve agent decontamination and to investigate structural factors that influence protein thermostability and thermoactivity, randomly mutated P. furiosus prolidases were prepared by using XL1-red-based mutagenesis and error prone PCR. An Escherichia coli strain JD1
( DE3) (auxotrophic for proline [ proA] and having deletions in pepQ and pepP dipeptidases with specificity for proline-containing dipeptides) was constructed for screening mutant P. furiosus prolidase expression plasmids. JD1 ( DE3) cells were transformed with mutated prolidase expression plasmids and plated on minimal media supplemented with 50
M Leu-Pro as the only source of proline. By using this positive selection, Pyrococcus prolidase mutants with improved activity over a broader range of temperatures were isolated.
The activities of the mutants over a broad temperature range were measured for both Xaa-Pro dipeptides and OP nerve agents, and the thermoactivity and thermostability of the mutants were determined.
Keywords: Prolidase; Pyrococcus furiosus; OP nerve agents; mutagenesis; directed evolution
65 2.1 Introduction
Organophosphorus compounds (OPs), one of the most frequently occurring components in pesticides and chemical warfare agents, are highly toxic and often hard to degrade. Examples of these OPs include the serine protease inhibitor diisopropylfluorophosphates (DFP), and different G-type nerve agents such as soman (GD;
O-pinacolyl methylphosphonofluoridate), sarin (GB; O-isopropyl methylphosphonofluoridate), and GF (O-cyclohexyl methylphosphonofluoridate). Exposure to OP compounds can irreversibly inhibit peripheral and central nervous system acetylcholinesterase (AChE). AChE is responsible for terminating the action of the neurotransmitter acetylcholine. Inhibition of this enzyme results in an accumulation of acetylcholine, which causes an over-stimulation of muscarinic and nicotinic receptors, and even produces serious nerve agent poisoning including hypersecretion, convulsions, respiratory distress, coma and death (Wetherell et al. 2006).
Currently decontamination solutions such as DS2 and bleach are used to inactivate toxic OP compounds (Cheng et al. 1998). Despite their effective decontamination of OP compounds, both DS2 and bleach are very corrosive and result in hazardous waste production. While enzyme-based decontamination cocktails are being considered, the
Defense Threat Reduction Agency (DTRA) recommends that enzymes to be used in these cocktails must have at least a 12-hour pot-life reactivity over a range of conditions including different temperatures, pH, and in the presence of salts and other surfactants (DTRA, 2008).
Previously, organophosphorus acid anhydrolase (OPAA) isolated from Alteromonas sp. strain JD6.5, a halophilic organism, has been used for detoxification of DFP, sarin, soman,
66 and tabun; however, OPAA demonstrates low hydrolysis of P-O and P-C bonds (DeFrank and Cheng 1991). Recently, the crystal structure of OPAA has been solved, and it was determined to be a prolidase (Vyas et al. 2010). The OPAA crystal structure is made up of two domains, the C-terminal region, which contains a pita-bread fold and the characteristic catalytic dinuclear metal site. These findings indicate that prolidases can and are currently being used to decontaminate and detoxify OP exposed surfaces.
Prolidase is a ubiquitous dipeptidase that specifically cleaves dipeptides with proline at the C-terminus (NH2-X-/-Pro-COOH). This enzyme has been isolated and characterized from a variety of sources, such as from mammalian tissues (Browne and O'Cuinn 1983; Endo et al. 1987; Fukasawa et al. 2001; Myara et al. 1994; Sjostrom et al. 1973) as well as from bacterial and archaeal sources (Booth et al. 1990; Fernandez-Espla et al. 1997; Fujii et al.
1996; Ghosh et al. 1998; Jalving et al. 2002; Morel et al. 1999; Suga et al. 1995). The majority of the characterized prolidases contain a common “pita-bread” fold with a dinuclear metal center, which is generated by five conserved amino acid residues (Lowther and
Matthews 2002). The structural motifs and substrate specificities prolidases have are quite similar to other metallopeptidases, such as methionine aminopeptidase (MetAP) and
Aminopeptidase P (AMPP), and so are classified into the same metallopeptidase subclass
(Lowther and Matthews 2002). The enzyme activity of prolidases requires divalent cations such as Zn2+, Mn2+, or Co2+ (Lowther and Matthews 2002; Wilcox 1996). It is unclear why prolidases from different sources use different metals in the active site; however, the combination of spectroscopic and structural data from AMPP and MetAP indicate that the metal center plays an essential role in conversion of a water molecule present in the active
67 site to a nucleophilic hydroxide ion and then stabilizing the resulting putative tetrahedral intermediate (Lowther and Matthews 2002).
The established physiological role of prolidase is to participate, in concert with other endo- and exo-peptidases, in the degradation of intracellular proteins and in proline recycling in cells. In humans, prolidase also mediates the final step of tissue collagen degradation
(Myara et al. 1984; Yaron and Naider 1993). Prolidase deficiency in humans can cause accumulation of C-terminal proline-containing dipeptides to toxic concentrations in individuals (Myara et al. 1994; Yaron and Naider 1993), and results in a disease characterized by various skin manifestations accompanied by mental retardation, facial dysmorphism and susceptibility to pyogenic infections (Myara et al. 1984; Yaron and Naider
1993).
Among all prolidases that have been characterized so far, the ones that have been isolated from mesophilic sources are only maximally active at temperatures up to 55 C.
However, prolidases that have been isolated from the hyperthermophilic archaea Pyrococcus furiosus and Pyrococcus horikoshii have maximum activity at 100 C. In addition, both recombinant Pyrococcus prolidases produced in E. coli possess long-term thermostability.
When incubated at 100 C, P. furiosus and P. horikoshii prolidases show no activity loss after
12 and 8 h, respectively (Ghosh et al. 1998; Theriot et al. 2009). P. horikoshii prolidases have a 50% activity loss after 21 h at 90 C (Theriot et al. 2009). The ability to maintain reactivity at high temperatures over long periods of time (pot-life activity) makes Pyrococcus
68 prolidases ideal candidates for OP decontamination, where harsh conditions, such as high temperatures, organic solvents and denaturants, are often required (Adams et al. 1995).
Despite the advantage P. furiosus prolidase exhibits under high temperature conditions, the use of P. furiosus prolidase for OP nerve agent decontamination is restricted by the fact that this enzyme displays a narrow functional temperature range. Like many other enzymes isolated from hyperthermophiles, P. furiosus prolidase has only 50% activity at
80 C and displays little activity at temperatures below 50 C (Ghosh et al. 1998). Therefore, it was desirable to attempt to prepare and screen P. furiosus prolidase mutants that demonstrate increased activity against OP compounds at low temperature while maintaining thermostability.
In addition to our goal of identifying a better enzyme for OP compound decontamination, we also focused on investigating the structural factors governing activity and stability of thermophilic enzymes at high temperatures. Thermophilic enzymes generally have negligible activity at low temperature (temperatures < 55 C). While cold denaturation cannot explain this behavior (Jaenicke 1991), some recent studies suggest that it might be that their conformational rigidity reduces catalytic activities at low temperature (Kohen et al.
1999; Lakatos et al. 1978; Vihinen 1987; Zavodszky et al. 1998). Isolation of low- temperature-adapted P. furiosus enzyme variants should reveal structural elements that are responsible for their conformational rigidity, and therefore provide insight into this theory. It is also noted that P. furiosus prolidase is a good model for this study, since the crystal structure and reaction mechanism of this enzyme have been well studied (Lowther and
69 Matthews 2002; Maher et al. 2004). For these reasons, we constructed a random-mutated P. furiosus prolidase gene library and screened it for production of mutants with increased activity at room temperature. P. furiosus mutant prolidases were purified and characterized to determine their substrate catalysis over a range of temperature as well as their thermoactivity and thermostability compared to the wild type enzyme.
2.2 Materials and Methods
Bacterial strains and media
E. coli K-12 derivative NK5525 (proA::Tn10) was used to construct the selective strain
JD1( DE3) for screening of low-temperature active P. furiosus prolidase mutants. E. coli strains used in this study were cultured either in Luria-Bertani (LB) broth or M9 minimal medium supplemented with 0.2% glucose, 1 mM MgSO4, 0.05% thiamin, 20 M IPTG, and
50 M Leu-Pro. Ampicillin (100 g/ml), kanamycin (50 g/ml), chloramphenicol (34 g/ml) and tetracycline (6 g/ml) were added as required.
Construction of the E. coli selection strain JD1 ( DE3)
Selection strain JD1 ( DE3) was constructed as follows: 1) Integration of DE3 prophage into NK5525 chromosome by using a DE3 lysogenization Kit (Novagen) according to the supplier‟s protocol; 2) Permanent disruption of proA in NK5525( DE3) by removal of the chromosomal proA:Tn10 transposon using positive selection on fusaric acid media as
70 described by Maloy and Nunn (Maloy and Nunn 1981); and 3) Disruption of pepP and pepQ in NK5525( DE3) by introducing chloramphenicol resistance (Cmr) and kanamycin resistance (Kmr) cassettes within each gene, respectively, using the -Red system (Datsenko and Wanner 2000). The Cmr cassette was amplified from the pKD3 plasmid using primer Ec
PepP F and primer Ec PepP R (Table 2-1). The 5‟ terminus of primer Ec PepP F and Ec PepP
R had 50 and 52 nucleotides identical to sequences on the 5‟-end and 3‟-end of pepP, respectively; the Kmr cassette was amplified from the pKD4 plasmid using primer Ec PepQ F and primer Ec PepQ R (Table 2-1). The 5‟ terminus of primer Ec PepQ F had 51 nucleotides identical to sequence upstream of pepQ, and the 5‟ terminus of primer Ec PepQ R had 50 nucleotides identical to downstream sequence of pepQ. PCR amplified products were purified using a commercial purification kit (Qiagen, Germantown, MD) and were integrated into the E. coli NK5525( DE3) strain chromosome using the method developed by Datsenko and Wanner. The pepP and pepQ disruptions in NK5525( DE3) were confirmed by PCR using primers PepP-Up and PepP-Dn and PepQ-Up and PepQ-Dn, respectively (Table 2-1).
Construction of a pool of pET-prol plasmids carrying randomly mutated P. furiosus prolidase genes
To avoid biased results generated from a single mutagenesis method, random mutations were introduced into the gene encoding P. furiosus prolidase by three independent mutagenesis methods: error-prone PCR mutagenesis, hydroxylamine mutagenesis and passage through mutation-prone E. coli XL1-red cells.
71 Error-prone PCR mutagenesis was done using the Genemorph II Random mutatgenesis kit. Mutazyme II DNA polymerase (Stratagene, La Jolla, CA) was used to amplify the P. furiosus prolidase gene with the pET-prol expression plasmid serving as template (Ghosh et al., 1998). PCR amplification was carried out for 30 cycles: (60 s at
95°C, 60 s at 55°C, 120 s at 72°C), with a 10 min final extension at 72°C. Reactions contained Mutazyme II reaction buffer, 125 ng/µl of each primer, 40 mM dNTP mix, and 2.5
U of Mutazyme II DNA polymerase. Initial DNA template amounts used were 50, 250, and
750 ng in order to select for high, medium and low mutation rates, respectively. The
Genemorph II EZClone (Stratagene, La Jolla, CA) reaction was used to clone mutated prolidase genes into expression vector pET-21b according to the supplier‟s protocol.
Hydroxylamine mutagenesis was conducted based on a previously described method
(Grunden et al. 1996). 7.5 µg of the P. furiosus prolidase gene was subjected to hydroxylamine mutagenesis. Hydroxylamine was removed using the PCR purification kit
(Qiagen). Mutated prolidase gene fragments were digested with BamHI and NotI, and were religated into pET-21b.
For XL1-red-based mutagenesis, mutation was directed against the intact pET-prol plasmid by transforming a pool of pET-prol plamsids into XL1-red cells seven times
(Stratagene La Jolla, CA) according to the supplier‟s protocol. The mutagenized prolidase genes were then isolated from the passaged pET-prol plasmids using BamHI and NotI restriction followed by religation into pET-21b vector.
72 Generation of the R19G/G39E/K71E/S229T mutant pET-prol plasmid
Production of the R19G/G39E/K71E/S229T pET-prol plasmid was carried out using the Site-
Directed Mutagenesis kit (Stratagene, La Jolla, CA). Two complementary oligonucleotide primers (Prol G39E F and Prol G39E R, Table 2-1) containing a mutation from glycine to glutamate at amino acid position 39 of R19G/K71E/S229T pET-prol plasmid were designed.
These primers were used in a PCR reaction to amplify G39E pET-prol plasmid templates for
16 cycles (30 s at 95 C, 60 s at 55 C and 7 min at 68 C). The PCR products were digested with DpnI prior to transformation into E. coli to remove un-mutated template DNA.
Screening for increased P. furiosus prolidase activity at low temperature (30°C)
pET-prol plasmids from the mutant P. furiosus library were transformed into the selection strain, JD1( DE3) and were plated on M9 selective agar plates. Colonies that grew after being incubated for 3-7 d at room temperature were isolated and grown in 10 ml of LB medium at 37°C with shaking (200 rpm) until an optical density of 0.6-0.8 was reached.
IPTG (1 mM) was then added to the cultures. Induced cultures were shaken at 37 C for 3 h before cell harvest. Cell pellets were lysed using 300 l of B-PER reagent (Thermo
Scientific, Rockford, IL), and the resulting cell extracts were used for enzyme activity assays conducted at 30 C and 100 C. Mutant colonies that exhibited at least 2-3 fold higher activities compared to wild type P. furiosus prolidase expressing cells were selected and their
73 plasmids isolated. Prolidase genes from selected clones were sequenced using T7 promoter, prol-3, prol-4 and prol-5 and T7 terminator primers. (Table 2-1) (MWG Biotech, Highpoint,
NC).
Purification of recombinant P. furiosus prolidase mutants
Production of P. furiosus prolidase and its variants G39E Pfprol, R19G/K71E/S229T Pfprol and R19G/G39E/K71E/S229T Pfprol were carried out in E. coli BL21 ( DE3) that had been transformed with the appropriate pET-prol plasmid and pRIL vector. The transformants were grown in 1 L cultures in LB media and/or autoinduction media (Studier 2005) by incubation of the cultures at 37 °C with shaking (200 RPM) until an optical density of 0.6-0.8 was reached. Expression of mutant prolidases was initiated when IPTG (1 mM) was added to the cell culture. Induced cultures were incubated at 37 C for 3 h prior to cell harvest.
Autoinduction cultures were incubated overnight with shaking.
To purify G39E-, R19G/K71E/S229- and R19G/G39E/K71E/S229T-prolidase, cell pellets were suspended in 50 mM Tris-HCl, pH 8.0 containing 1 mM benzamidine and 1 mM
DTT (each 1 g, wet wt of cell paste was suspended in 3 ml Tris-HCl buffer). Cell suspensions were passed through a French pressure cell (20000 lb/in2) twice. Lysed cell suspensions were centrifuged at 18,000 RPM for 30 min to remove any cell debris, and supernatants were heat-treated at 80°C for 30 min anaerobically. Denatured protein was removed by centrifugation at 18,000 RPM for 30 min. (NH4)2SO4 was slowly added to each heat-treated mutant prolidase extract to a final concentration of 1.5 M, and extracts were
74 applied to a 20 ml phenyl-sepharose column. Fractions containing the prolidase mutants were further purified by passage through a Q column. In the case of purification of the G39E- prolidase mutant an additional purification step through a gel-filtration column was also required. Buffers used for the phenyl-sepharose and Q column chromatography are previously described in Theriot et al. 2009. For the gel filtration column, the equilibration buffer was 50 mM Tris-HCl, 400 mM NaCl, pH 8.0. All fractions were visualized on 12.5%
SDS-polyacrylamide gels and were assayed for prolidase activity.
Enzyme activity assay
The enzyme activity assay used was based on a previously described method (Du et al. 2005;
Theriot et al. 2009) with slight modification indicated below. Assay mixtures (500 µl) contained 50 mM MOPS buffer (3-[N-morpholino]propanesulfonic acid), 200 mM NaCl pH
7.0, 4 mM Xaa-Pro (substrate), 5% (vol/vol) glycerol, 100 µg/ml BSA protein, and 1.2 mM
CoCl2. Assays were done in at least triplicate, and specific activities were calculated using the extinction coefficient of 4,570 M-1·cm-1 for the ninhydrin-proline complex (Theriot et al.
2009).
For assays conducted over a pH range, the reactions contained 200 mM NaCl and 50 mM of the following buffers: pH 4.0-5.0, Sodium Acetate; pH 6.0-8.0, MOPS; pH 9.0,
CHES; pH 10.0, CAPS. When determining substrate specificity of the prolidases, the following dipeptides were used at a final concentration of 4 mM: Met-Pro, Leu-Pro, Phe-
Pro, Ala-Pro, Gly-Pro, Arg-Pro, and Pro-Ala. To evaluate the enzyme kinetic parameters,
75 enzyme assays were conducted at 35 C, 70 C and 100 C with increasing concentrations of
Met-Pro and a final metal concentration of 1.2 mM CoCl2.
Thermostability and pot-life activity assays
To measure the thermostability of wild type P. furiosus prolidase and the mutant prolidases, each enzyme (0.04 mg/ml in 50 mM MOPS 200 mM NaCl, pH 7.0) was incubated in an anaerobic sealed vial at 90 C. Samples, taken at select time points, were used for enzyme activity assays that were conducted at 100 C and contained 4 mM Met-Pro and 1.2 mM
CoCl2. To measure the pot-life reactivity of wild type P. furiosus prolidase and the mutant prolidases, each enzyme (0.04 mg/ml in 50 mM MOPS 200 mM NaCl, pH 7.0) was incubated in an anaerobic sealed vial at 70 C. Samples were taken at 0, 6, 12, 24, 28, 32 and
48 h time points to assess the pot-life activity in reactions containing 4 mM Met-Pro and 1.2 mM CoCl2 at 100°C.
Organophosphorus nerve agent enzymatic assays
DFP (diisopropylfluorophosphate) Assay
The method used was previously described in DeFrank and Cheng, 1991. The hydrolysis of
DFP by prolidases was measured by monitoring fluoride release with a fluoride specific electrode. Assays were performed at 35 C and 50 C, with continuous stirring in 2.5 ml of buffer (50 mM MOPS, 200 mM NaCl, pH 7.0), 0.2 mM CoCl2 and 3 mM DFP. The enzyme
76 and metal were incubated at the reaction temperature 5 min prior to the start of the reaction.
The background DFP hydrolysis was measured by running a reaction without enzyme present at 35 C and 50 C. The background hydrolysis of DFP was subtracted from enzymatic hydrolysis to determine specific activity of the enzyme.
p-Nitrophenyl Soman Assay (O-Pinacolyl p-Nitrophenyl Methylphosphonate Activity)
Prolidase hydrolysis of p-nitrophenyl soman was monitored by accumulation of p- nitrophenyl (Hill et al. 2001; Vyas et al. 2010). Two ml reaction assays contained buffer (50 mM MOPS 200 mM NaCl pH 7.0), 0.2 mM CoCl2, and 3 mM p-nitrophenyl soman. The reactions were conducted at three different temperatures (35 C, 50 C and 70 C). The enzyme and metal were incubated at reaction temperature 5 min prior to the start of the reaction. Absorbance of the product p-nitrophenylolate was measured at 405 nm over a 5 min range. To calculate activity, the extinction coefficient for p-nitrophenolate of 10,101 M-1 cm-1 was used.
2.3 Results
Isolation of P. furiosus prolidase mutants with increased activity over a broader range of temperature
P. furiosus prolidase loses 50% of its activity at 80 C and has limited activity at temperatures below 50 C (Ghosh et al. 1998). Therefore, its gene sequence must be altered in order to
77 obtain variants of P. furiosus prolidase that exhibit higher catalytic activity at lower temperatures (10°C to 70°C). To achieve this goal, the gene encoding P. furiosus prolidase was randomly mutagenized and subsequently cloned back into expression vector pET-21b to generate a pool of mutant pET-prol plasmids. Clones of the desired phenotype were positively selected by genetic complementation of an E. coli selective strain JD1( DE3) that has deletions of proA, pepP and pepQ genes ( proA, pepP, pepQ). The proA gene encodes -glutamylphosphate reductase (GPR), the enzyme responsible for the third step in proline biosynthesis, conversion of L-γ-glutamyl phosphate to γ-glutamic semialdehyde, and pepP and pepQ are the only two genes in the E. coli genome that code for dipeptidases with specificity for proline-containing dipeptides. As a consequence of these deletions,
JD1( DE3) is incapable of growing on minimal media supplied with Leu-Pro as the only proline source.
JD1( DE3) cells were transformed with plasmids carrying mutant P. furiosus prolidase genes. The transformed cells were plated on minimal media supplemented with
Leu-Pro, and the plates were incubated at room temperature. Since wild type P. furiosus prolidase could not support growth of the JD1( DE3) cells at the temperatures that permit growth of E. coli, colonies that survived and grew on the selective plates would have to have been able to produce cold-adapted variants that had higher activity than the wild type enzyme at these lower temperatures. Using this positive selection, approximately 500 colonies were isolated and screened. To avoid false results that could come from variation in enzyme production levels, the mutant prolidase expression plasmids were isolated from colonies on
78 the original selection plates and were transformed into both JD1( DE3) and BL21( DE3).
The resultant transformants were screened for prolidase activity, and those isolates that exhibited at least 2-3 fold higher activity at 30 C compared to cells expressing wild type prolidase were retained for further evaluation. Results of this study led to the identification of two mutants with increased activity at low temperature, with one containing a single mutation at amino residue 39, a change from glycine to glutamate (G39E) and the other containing a triple mutation at amino residues R19G, K71E, and S229T, a change from arginine to glycine at position 19, a change from lysine to glutamate at position 71 and serine to threonine at position 229.
To avoid biased results that may be generated from a single mutagenesis method and to construct a library of P. furiosus prolidase expression plasmid mutants with a good variety of mutation types, three mutagenesis methods were employed, which included error-prone
PCR using Genemorph mutazyme polymerase, hydroxylamine mutagenesis and passage of the prolidase expression plasmid through mutation-prone E. coli strain XL1-red. This strategy proved to be successful with the G39E-prolidase mutant arising from XL1-red cell mutagenesis and the R19G/K71E/S229T-prolidase mutant being generated using the
Genemorph II random mutagenesis method.
79 Construction and purification of a third prolidase mutant: R19G/G39E/K71E/S229T- prolidase
To gain further insight into the effects of cold-adapted substitutions on the P. furiosus prolidase, another variant R19G/G39E/K71E/S229T-prolidase (a combination of all four mutations) was produced. Specifically, the G39E-, R19G/K71E/S229T- and
R19G/G39E/K71E/S229T-prolidases were over-expressed by large-scale expression in
BL21( DE3) cells and were purified through a multi-column chromatography strategy. Each protein was successfully purified and was shown to have a molecular weight of approximately 39.4 kDa. The purified prolidases were used for subsequent enzyme assays.
Locations of amino acid substitutions in the mutants
The three-dimensional model of P. furiosus prolidase had previously been solved and its structural characteristics well evaluated (Maher et al. 2004). This structure was used to analyze the position and possible interactions of each of the amino acid substitutions found in the G39E- and R19G/K71E/S229T- and R19G/G39E/K71E/S229T-prolidase mutants (Figure
2-1 A/B).
80 Effects of the amino acid substitutions on the catalytic activity of P. furiosus prolidase at different temperatures
To study whether the substitutions affect the activity of P. furiosus prolidases over a range of temperatures, the kinetic parameters of G39E-, R19G/K71E/S229T- and
R19G/G39E/K71E/S229T-prolidase were measured at 35 C, 70 C and 100 C (Table 2-2).
All mutants performed better at 35 C compared to wild type Pfprol, as each mutant exhibited higher Vmax and kcat values than wild type prolidase. Although, these values were higher, so was the Km suggesting changes or increases in flexibility of the binding pocket. A similar trend was seen at the higher assay temperatures. At 70 C the Km‟s were observed to be 61% higher for R19G/K71E/S229T-prolidase than WT-Pfprol, and the Km for
R19G/G39E/K71E/S229T-prolidase was 32% higher than WT-Pfprol. The Vmax and the kcat values for R19G/G39E/K71E/S229T-prolidase were 217% and 215% higher than WT at
70 C. The kcat/Km value for R19G/G39E/K71E/S229T-prolidase showed the highest value at
139% higher than the wild type prolidase. This trend continued at 100 C, where the Km,
Vmax, kcat and kcat/ Km for the mutant prolidases were all higher than WT-Pfprol. At higher temperatures, as the number of mutations increase, so did the enzyme reaction rate. At
100 C the kcat/Km were higher compared to WT by 19%, 76%, and 153% for G39E-,
R19G/K71E/S229T-, and R19G/G39E/K71E/S229T-prolidase, respectively. Mutated prolidases showed overall improved enzyme activity and reaction rates at all three temperatures when compared to WT-Pfprol.
81 When examining the relative activity of prolidases with the substrate Met-Pro (4 mM)
(Figure 2-2), there were differences observed between WT-Pfprol and the mutants at temperatures ranging from 10 C-100 C. The most dramatic differences were seen in the improved activity of G39E-, R19G/K71E/S229T- and R19G/G39E/K71E/S229T-prolidase mutants at 10 C with relative activity increases of 132%, 251% and 414%, respectively, compared to wild type activity. The improved activity of R19G/G39E/K71E/S229T-prolidase was seen at all temperatures, but was especially evident at 50 C, in which it showed 185% increased activity relative to wild type prolidase. It is intriguing to find that the increased activities of the G39E mutation at the low temperature range came at the expense of decreased activity at the high temperature range. Specifically, G39E-prolidase had lower activity at 70 C, exhibiting 83% of the activity of wild type; however, it did not seem to have compromised activity when assayed at 100 C, since it was observed to have 103% of the activity detected for the wild type prolidase. This dip in activity at the higher temperatures was not seen with the R19G/K71E/S229T- and R19G/G39E/K71E/S229T-prolidase mutants.
The R19G, K71E and S229T mutations appeared to significantly increase the activity and improve the rate of catalysis of the P. furiosus prolidase.
Effect of the amino acid substitutions on the pH optimum of P. furiosus prolidase
Effects of the substitutions on the pH optima of the wild type and mutant enzymes were analyzed by measuring activities of G39E-, R19G/K71E/S229T- and
R19G/G39E/K71E/S229T-prolidase mutants at 100 C from pH 4-10 with the wild type
82 enzyme serving as the reference. As shown in Figure 2-3, the catalytic activities of G39E- and R19G/G39E/K71E/S229T-prolidase have similar responses to changes in pH, as both showed optimal activities at pH 6.0 and pH 7.0, although the activity was 60% and 89% of wild type activity, respectively. These proteins both include the mutation G39E, which strongly suggests that Gly39 plays an important role in maintaining the integrity of active site, and the substitution of this residue with glutamate greatly reduces enzyme activity at optimal pH and high temperature.
In contrast, R19G/K71E/S229T-prolidase showed increased activity over a broader pH range, from pH 5-8. At pH 5.0, the mutant activity was 64% higher than wild type activity, and at pH 7.0 it was 20% higher than wild type. In addition, the activity was somewhat less affected than the other mutants at pH 6.0 and pH 8.0, showing similar activities to wild type. It was noticed that the optimal pH for the activity of P. furiosus prolidase presented in our study is pH 6.0, which is different from previous report of pH 7.0
(Ghosh et al. 1998). The reason for the pH optimum shifting is not known; however, it might be the result of the use of different protein expression and purification methods.
Effect of the amino acid substitutions on the thermostability and pot-life activity of P. furiosus prolidase
To study whether the substitutions affected enzyme thermostability, the mutated prolidases were incubated at 90 C under anaerobic conditions, and their catalytic activities were measured at specific time points. For these activity assays Met-Pro (4 mM) was used as the
83 substrate (see materials and methods). Although the R19G/K71E/S229T- and
R19G/G39E/K71E/S229T-prolidase showed higher activity over a broad range of temperatures, the thermostability of these enzymes was less compared to wild type.
R19G/K71E/S229T- and R19G/G39E/K71E/S229T-prolidase lost 50% activity after 4 and 3 h at 90 C, respectively, whereas G39E-prolidase did not show this loss of activity until 14 h, and WT-Pfprol did not lose 50% activity until 21 h had elapsed. The increased number of substitutions resulted in decreases in long-term stability of prolidases at the physiologically relevant temperature of 90 C.
The pot-life activity was assessed over a three-day period with constant incubation at
70 C (Table 2-3). After 12 h, all the prolidases were capable of degrading Met-Pro (4 mM) with specific activities of 1563 U/mg, 1768 U/mg, 843 U/mg, and 1366 U/mg for WT-,
G39E-, R19G/K71E/S229T- and R19G/G39E/K71E/S229T-prolidase, respectively. After 48 h the prolidases were still functional and had activities of 1083 U/mg, 599 U/mg, 722 U/mg and 496 U/mg for WT-, G39E-, R19G/K71E/S229T- and R19G/G39E/K71E/S229T- prolidase, respectively.
Effect of the amino acid substitutions on the substrate specificity of P. furiosus prolidase
Table 2-4 shows the relative activity of mutants compared to WT-Pfprol with other prolidase specific dipeptides. For the substrate Met-Pro there was little difference between the activity observed for the wild type when compared to G39E-prolidase, but an increase in activity
84 occurred with R19G/K71E/S229T- and R19G/G39E/K71E/S229T-prolidase mutants, showing 137% and 143% the activity of wild type, respectively. There was a more significant increase seen for R19G/K71E/S229T-prolidase when assayed with Leu-Pro, as it had 169% of the wild type prolidase activity. This higher activity for the
R19G/K71E/S229T-prolidase mutant could be due to the addition of Leu-Pro in the positive selection method used to isolate the low temperature active mutants, in effect selecting an enzyme that prefers and is more active with Leu-Pro. When the G39E substitution was made in the prolidase, the enzyme activity decreased when Leu-Pro was used as the substrate, suggesting that this particular mutation could be hindering substrate specificity with Leu-Pro.
The dipeptide Phe-Pro showed the highest activity with R19G/G39E/K71E/S229T-prolidase at 122% activity of wild type, whereas G39E- prolidase had the lowest detected activity at
60% of wild type. The mutants all showed decreased activity with Ala-Pro and Gly-Pro.
The incorporation of mutation G39E seemed to substantially reduce activity with both substrates, showing 35% and 38% activity of wild type for Ala-Pro and 37% and 10% for
Gly-Pro for G39E- and R19G/G39E/K71E/S229T-prolidase, respectively. Activity for
R19G/K71E/S229T-prolidase with Gly-Pro was 47% of wild type, but was fairly unaffected when Ala-Pro was used as the substrate, maintaining 95% of wild type activity. Relative activities with Arg-Pro all went up with the mutants relative to the activity of wild type, which was reported as 164 U/mg. As for Pro-Ala, a substrate that is not usually hydrolyzed by prolidases, even though mutant prolidase activities increased relative to WT, it is important to note that the starting activity of WT was very low to begin with at 24 U/mg.
85 Effect of the substitutions on substrate specificity with OP nerve agents DFP and soman analog, p-nitrophenyl soman
Increases in activity at lower temperatures with Xaa-Pro dipeptides, which is thought to be the physiologically relevant substrate of prolidases, has shown the same trends with OP nerve agents, DFP and p-nitrophenyl soman. In Figure 2-4, the relative activity of the prolidase mutants and WT-Pfprol with DFP as the substrate can be seen. The G39E substituted prolidase exhibited increases in relative activities that were 102% and 123% higher than wild type activity with DFP at temperatures 35 C and 50 C. R19G/G39E/K71E/S229T-prolidase showed the highest activity at 50 C with 647% higher activity than wild type. The addition of the G39E mutation to the R19G/K71E/S229T prolidase substitutions had in this case increased the activity with DFP as the substrate, whereas R19G/K71E/S229T-prolidase had decreased activity with DFP (71% activity compared to wild type).
Activity with p-nitrophenyl soman is even more promising with all three mutant prolidases showing significant activity at 35 C, 50 C, and 70 C (Figure 2-5). As the temperature increases, there was increased hydrolysis of p-nitrophenyl soman, which is characteristic of a hyperthermophilic enzyme. The highest activity can be seen with
R19G/G39E/K71E/S229T-prolidase, with a 240% increase in activity over WT at 70 C. It is interesting to note that P. furiosus prolidase mutants all showed increased activity compared to WT-Pfprol with p-nitrophenyl soman at all temperatures that were evaluated.
86 Table 2-5 shows a comparison of the specific activities wild type and mutant P. furiosus prolidases with Alteromonas sp. strain JD6.5 OPAA/prolidase, an enzyme presently being studied for its use in enzyme decontamination cocktails. R19G/G39E/K71E/S229T- prolidase showed the highest activity with substrates DFP and soman analog, but a 90% decrease with Gly-Pro compared to WT-Pfprol. When comparing these activities to
OPAA/prolidase (Vyas et al. 2010), R19G/G39E/K71E/S229T-prolidase exhibited 1%,
267%, and 35% the total activity of OPAA/prolidase for substrates DFP, Gly-Pro and p- nitrophenyl soman, respectively.
2.4 Discussion
Using a positive selection strategy (directed evolution), three cold-adapted P. furiosus prolidase variants were screened, purified and characterized. Because the substitutions occurred at different locations in the protein structure, G39E- and R19G/K71E/S229T- and
R19G/G39E/K71E/S229T-prolidase each exhibit different responses toward the changes in temperature, pH, substrate specificity and thermostability.
Glycine-39 is an active site associated residue, as shown in Figure 2-1; Glycine-39 is located on a short peptide chain of the N-terminal domain of P. furiosus prolidase. The substitution of this residue to glutamate resulted in increased activity at temperatures below
70 C, decreased activity at optimal pH and alteration of substrate preferences. G39E- prolidase shows decreases in activity with substrates that have smaller non-polar amino acids in the N-terminal position of Xaa-Pro, including Leu-Pro, Ala-Pro, and Gly-Pro, while demonstrating increased activity with bulkier substrates like Met-Pro, Arg-Pro and Pro-Ala.
87 The Glycine-39 residue has been proposed, in concert with other hydrophobic residues
(Proline-36, Leucine-37 and Glycine-38) in this short peptide chain, to participate in crowding the active site in the neighboring subunit, and therefore, is thought to inhibit the binding of peptides longer than two residues (Maher et al. 2004). The interactions between the two subunits as monomers when they come together to form an active homodimer may contribute to the substrate specificity as well. Furthermore, its adjacent residue Leucine-37 is located in the substrate binding pocket and directly interacts with the substrate at the P1 position, together with other hydrophobic residues Isoleucine-181, Phenylalanine-178 and
Isoleucine-290 in the C-terminal domain of the neighboring subunit. For this reason, the substitution of an uncharged hydrophobic residue glycine to a charged hydrophilic residue glutamate weakens the hydrophobic environment of the active site and possibly introduces a cavity for the entry of larger substrates, thus allowing bulkier amino acid residues in the P1 position to have access. These results led to the conclusion that changes in the conformational freedom of active site residues may have larger effects on enzyme catalysis than first expected.
Arginine-19 is located within a β-sheet in the N-terminal region in close proximity to the G39E substitution in Pfprol. The mutation from arginine to glycine, in which an amino acid with a bulkier hydrophilic side chain residue is replaced with a smaller flexible hydrophobic residue, could result in increased conformational flexibility for the enzyme but have negative effects on its thermostability. By eliminating the arginine or a positively charged residue, it could negatively affect the formation of salt bridges, amino aromatic
88 interactions and hydrogen bonding, which have been proven to influence enzyme thermostability (Cupo et al. 1980; Siddiqui and Cavicchioli 2006).
Lysine-71 is also located within a β-sheet in the N-terminal region of Pfprol. The substitution from lysine, a positively charged hydrophilic residue to glutamate, a negatively charged hydrophilic residue, could also have implications for the overall stability of the protein. By removing the longer chained aromatic residue that could be involved in forming van der Waals interactions, the stability of the enzyme may be decreased. Thermophiles have tightly packed hydrophobic cores with charged surfaces, usually positively charged, so a substitution from a positively to a negatively charged residue could also further disrupt thermostability (Saelensminde et al. 2007; Saelensminde et al. 2009).
Serine-229 is located in the C-terminal region on a short peptide chain of Pfprol. This is the only mutation in the C-terminal region and is a substitution from serine to threonine, amino acids with similar properties. This is also the only substitution within close proximity to the catalytic active site, and it does not negatively affect activity. Mutations in or near the active site of Pfprol have been studied previously, and it was shown that the mutations
D209A, H284A, and E327L reduced the activity by 1300-fold and 2000-fold in the case of
D209A and H284A and completely eliminated activity in the E327L prolidase mutant. The loss of activity in these mutants was shown to result from disruption of metal binding in their active sites (Du et al. 2005).
It has been previously reported by Lebbink (Lebbink et al. 2000) and Suzuki (Suzuki et al. 2001) that increased activity at low temperature is accompanied with lower activity at high temperature in the screen for cold-adapted hyperthermophilic enzymes. This can also
89 be referred to as the activity-stability trade off, because it is also accompanied by a decrease in thermostability (Zecchinon et al. 2001). Our study supports this theory, since the
R19G/K71E/S229T- and R19G/G39E/K71E/S229T-prolidase mutants demonstrated increased activity at lower temperatures but also a decrease in thermostability at 90ºC, in which enzyme activity fell by half in the first 3-4 hours of incubation at 90°C. However, thermoactivity of these two mutants at 100ºC did increase, but at a cost of stability at high temperatures. Although the exact mechanism behind the observed changes in thermostability is still unclear at this stage, it has been suggested that protein thermostability is not maintained by a single mechanism. Instead, it is fostered by a network of numerous factors, including increased van der Waal interactions (Berezovsky et al. 1997), higher core hydrophobicity (Schumann et al. 1993), additional networks of hydrogen bonds (Jaenicke and Bohm 1998), enhanced secondary structure propensity (Querol et al. 1996), ionic interactions (Vetriani et al. 1998), increased packing density (Hurley et al. 1992) and decreased length of surface loops (Thompson and Eisenberg 1999). P. furiosus prolidase is able to accommodate single- or triple-residue substitutions at either the C-terminal or N- terminal domain, without affecting its thermoactivity or temperature optimum for catalysis.
The observations that thermophilic enzymes have cold-adapted activities without loss of thermostability have also been reported from other studies (Lebbink et al. 2000; Suzuki et al.
2001). In addition, studies of mesophilic enzymes have shown that enzymes can be engineered to yield better stability without loss of activity, more recently by optimizing the charge-charge interactions on the protein surfaces (Giver et al. 1998; Gribenko et al. 2009;
90 Van den Burg et al. 1998). These results, support the idea that thermostability and activity can be controlled by separate molecular determinants (Vieille and Zeikus 2001).
In Table 2-5 a comparison of the hydrolysis of OP nerve agents, DFP, p-nitrophenyl soman, and prolidase specific substrate, Gly-Pro, between the prolidases from Alteromonas sp. strain JD6.5 and P. furiosus was shown (Vyas et al. 2010). This is the first study demonstrating that P. furiosus prolidases are able to hydrolyze OP nerve agents, DFP and p- nitrophenyl soman, with the mutants exhibiting higher activity at lower temperature relative to WT-Pfprol. The wild type and mutant P. furiosus prolidases all remain reactive at 12 h and even up to 48 h when incubated at 70ºC, which is promising given the DTRA guidelines.
The development of an enzyme based cocktail for response decontamination of CWA
(chemical warfare agents) is being considered by the U.S. Department of Defense and requires that enzyme catalysts retain reactivity in solutions over a range of temperatures and have a pot-life of at least 12 h. Other desirable qualities include enzymes that are active and stable over broad ranges of pH, and remain functional in the presence of salts and other surfactants. It would be beneficial to include OPAA/prolidase in a cocktail, along with other prolidases, such as the mutant P. furiosus prolidases that are stable and active over a broad temperature and pH range.
The ability of OPAA, organophosphate anhydrolase to hydrolyze OP nerve agents in addition to Xaa-Pro dipeptides has been observed for many years, while the reaction mechanism has taken longer to elucidate (Cheng et al. 1999; Cheng et al. 1998).
OPAA/prolidase has the same pita-bread fold in the C-terminal region as do prolidases, and also contains a binuclear Mn(II) active site with metal ligand residues Aspartate-244,
91 Aspartate-255, Histidine-336, Glutamate-381, and Glutamate-420 with bound glycolate, a surrogate of glycine (Vyas et al. 2010). These residues are homologous in most pita-bread enzyme C-terminal catalytic domains, including enzymes MetAP and AMPP (Lowther and
Matthews 2002). P. furiosus prolidase is almost identical to OPAA, although it contains a
Co(II) dinuclear active site consisting of metal ligand residues Aspartate-209, Aspartate-220,
Histidine-284, Glutamate-313, and Glutamate-327, with a bridging water molecule at W176
(Maher et al. 2004). Detailed comparisons of AMPP and OPAA indicated that the substrate specificity is similar due to the hydrophobic proline binding pocket provided by residues
Histidine-350 and Arginine-404 in AMPP, that interact with the prolidyl ring of substrate P1'
Pro. These interactions and residues are conserved in OPAA/prolidase at Histidine-332 and
Arginine-418 (Graham et al. 2006). The reaction mechanism of these two enzymes is similar, where in Pfprol, the bridging hydroxide nucleophile attacks the carbonyl oxygen of the scissile peptide bond of the dipeptide substrate, and it also can attack the phosphorus center of OP nerve agents, like DFP, which explains the cross over in substrate specificity
(Lowther and Matthews 2002; Vyas et al. 2010). However, there could be subtle differences introduced when the four subunits form a tetramer of AMPP, whereas only one subunit forms the monomer of OPAA/prolidase (Figure 2-1C).
This study provides experimental evidence that supports the idea that through the use of directed evolution methods, thermophilic enzymes can be engineered to yield cold-adapted variants. Our efforts focused on the improvement of P. furiosus prolidase activity at low temperatures (10°C to 70°C) and resulted in identification of amino acid residues critical in supporting low temperature activity of the enzyme.
92
Acknowledgments
The authors thank Rushyannah Killens for helping to construct the
R19G/G39E/K71E/S229T-prolidase mutant. We also, thank Saumil Shah from the U.S.
Army, Edgewood Chemical Biological Center at Aberdeen Proving Ground for his help with the DFP and p-nitrophenyl soman assays, especially conducting the G39E-Pfprol assays with p-nitrophenyl soman. Support for these studies was provided by the Army Research Office
(contract number 44258LSSR).
93 References Cited
Adams MW, Perler FB, Kelly RM (1995) Extremozymes: expanding the limits of biocatalysis. Biotechnology (N Y) 13: 662-668
Berezovsky IN, Tumanyan VG, Esipova NG (1997) Representation of amino acid sequences in terms of interaction energy in protein globules. FEBS Lett 418: 43-46
Booth M, Jennings PV, Ni Fhaolain I, O'Cuinn G (1990) Endopeptidase activities of Streptococcus cremoris. Biochem Soc Trans 18: 339-340
Browne P, O'Cuinn G (1983) The purification and characterization of a proline dipeptidase from guinea pig brain. J Biol Chem 258: 6147-6154
Cheng TC, DeFrank JJ, Rastogi VK (1999) Alteromonas prolidase for organophosphorus G- agent decontamination. Chem Biol Interact 119-120: 455-462
Cheng TC, Rastogi VK, DeFrank JJ, Sawiris GP (1998) G-type nerve agent decontamination by Alteromonas prolidase. Ann N Y Acad Sci 864: 253-258
Cupo P, El-Deiry W, Whitney PL, Awad WM, Jr. (1980) Stabilization of proteins by guanidination. J Biol Chem 255: 10828-10833
Datsenko KA, Wanner BL (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97: 6640-6645
Defense Threat Reduction Agency (2008) Joint Science and Technology Office for Chemical and Biological Defense FY10/11- New initiatives. 1-53
DeFrank JJ, Cheng TC (1991) Purification and properties of an organophosphorus acid anhydrase from a halophilic bacterial isolate. J Bacteriol 173: 1938-1943
Du X, Tove S, Kast-Hutcheson K, Grunden AM (2005) Characterization of the dinuclear metal center of Pyrococcus furiosus prolidase by analysis of targeted mutants. FEBS Lett 579: 6140-6146
94 Endo F, Hata A, Indo Y, Motohara K, Matsuda I (1987) Immunochemical analysis of prolidase deficiency and molecular cloning of cDNA for prolidase of human liver. J Inherit Metab Dis 10: 305-307
Fernandez-Espla MD, Martin-Hernandez MC, Fox PF (1997) Purification and characterization of a prolidase from Lactobacillus casei subsp. casei IFPL 731. Appl Environ Microbiol 63: 314-316
Fujii M, Nagaoka Y, Imamura S, Shimizu T (1996) Purification and characterization of a prolidase from Aureobacterium esteraromaticum. Biosci Biotechnol Biochem 60: 1118-1122
Fukasawa KM, Fukasawa K, Higaki K, Shiina N, Ohno M, Ito S, Otogoto J, Ota N (2001) Cloning and functional expression of rat kidney dipeptidyl peptidase II. Biochem J 353: 283-290
Ghosh M, Grunden AM, Dunn DM, Weiss R, Adams MW (1998) Characterization of native and recombinant forms of an unusual cobalt-dependent proline dipeptidase (prolidase) from the hyperthermophilic archaeon Pyrococcus furiosus. J Bacteriol 180: 4781-4789
Giver L, Gershenson A, Freskgard PO, Arnold FH (1998) Directed evolution of a thermostable esterase. Proc Natl Acad Sci U S A 95: 12809-12813
Graham SC, Lilley PE, Lee M, Schaeffer PM, Kralicek AV, Dixon NE, Guss JM (2006) Kinetic and crystallographic analysis of mutant Escherichia coli aminopeptidase P: insights into substrate recognition and the mechanism of catalysis. Biochemistry 45: 964-975
Gribenko AV, Patel MM, Liu J, McCallum SA, Wang C, Makhatadze GI (2009) Rational stabilization of enzymes by computational redesign of surface charge-charge interactions. Proc Natl Acad Sci U S A 106: 2601-2606
Grunden AM, Ray RM, Rosentel JK, Healy FG, Shanmugam KT (1996) Repression of the Escherichia coli modABCD (molybdate transport) operon by ModE. J Bacteriol 178: 735-744
95 Hill CM, Li WS, Cheng TC, DeFrank JJ, Raushel FM (2001) Stereochemical specificity of organophosphorus acid anhydrolase toward p-nitrophenyl analogs of soman and sarin. Bioorg Chem 29: 27-35
Hurley JH, Baase WA, Matthews BW (1992) Design and structural analysis of alternative hydrophobic core packing arrangements in bacteriophage T4 lysozyme. J Mol Biol 224: 1143-1159
Jaenicke R (1991) Protein stability and molecular adaptation to extreme conditions. Eur J Biochem 202: 715-728
Jaenicke R, Bohm G (1998) The stability of proteins in extreme environments. Curr Opin Struct Biol 8: 738-748
Jalving R, Bron P, Kester HC, Visser J, Schaap PJ (2002) Cloning of a prolidase gene from Aspergillus nidulans and characterisation of its product. Mol Genet Genomics 267: 218-222
Kohen A, Cannio R, Bartolucci S, Klinman JP (1999) Enzyme dynamics and hydrogen tunnelling in a thermophilic alcohol dehydrogenase. Nature 399: 496-499
Lakatos S, Halasz G, Zavodszky P (1978) Conformational stability of lactate dehydrogenase from Bacillus thermus-aquaticus [proceedings]. Biochem Soc Trans 6: 1195-1197
Lebbink JH, Kaper T, Bron P, van der Oost J, de Vos WM (2000) Improving low- temperature catalysis in the hyperthermostable Pyrococcus furiosus beta-glucosidase CelB by directed evolution. Biochemistry 39: 3656-3665
Lowther WT, Matthews BW (2002) Metalloaminopeptidases: common functional themes in disparate structural surroundings. Chem Rev 102: 4581-4608
Maher MJ, Ghosh M, Grunden AM, Menon AL, Adams MW, Freeman HC, Guss JM (2004) Structure of the prolidase from Pyrococcus furiosus. Biochemistry 43: 2771-2783
96 Maloy SR, Nunn WD (1981) Selection for loss of tetracycline resistance by Escherichia coli. J Bacteriol 145: 1110-1111
Morel F, Frot-Coutaz J, Aubel D, Portalier R, Atlan D (1999) Characterization of a prolidase from Lactobacillus delbrueckii subsp. bulgaricus CNRZ 397 with an unusual regulation of biosynthesis. Microbiology 145 ( Pt 2): 437-446
Myara I, Charpentier C, Lemonnier A (1984) Prolidase and prolidase deficiency. Life Sci 34: 1985-1998
Myara I, Cosson C, Moatti N, Lemonnier A (1994) Human kidney prolidase--purification, preincubation properties and immunological reactivity. Int J Biochem 26: 207-214
Querol E, Perez-Pons JA, Mozo-Villarias A (1996) Analysis of protein conformational characteristics related to thermostability. Protein Eng 9: 265-271
Saelensminde G, Halskau O, Jr., Helland R, Willassen NP, Jonassen I (2007) Structure- dependent relationships between growth temperature of prokaryotes and the amino acid frequency in their proteins. Extremophiles 11: 585-596
Saelensminde G, Halskau O, Jr., Jonassen I (2009) Amino acid contacts in proteins adapted to different temperatures: hydrophobic interactions and surface charges play a key role. Extremophiles 13: 11-20
Schumann J, Bohm G, Schumacher G, Rudolph R, Jaenicke R (1993) Stabilization of creatinase from Pseudomonas putida by random mutagenesis. Protein Sci 2: 1612- 1620
Siddiqui KS, Cavicchioli R (2006) Cold-adapted enzymes. Annu Rev Biochem 75: 403-433
Sjostrom H, Noren O, Josefsson L (1973) Purification and specificity of pig intestinal prolidase. Biochim Biophys Acta 327: 457-470
Studier FW (2005) Protein production by auto-induction in high density shaking cultures. Protein Expr Purif 41: 207-234
97 Suga K, Kabashima T, Ito K, Tsuru D, Okamura H, Kataoka J, Yoshimoto T (1995) Prolidase from Xanthomonas maltophilia: purification and characterization of the enzyme. Biosci Biotechnol Biochem 59: 2087-2090
Suzuki T, Yasugi M, Arisaka F, Yamagishi A, Oshima T (2001) Adaptation of a thermophilic enzyme, 3-isopropylmalate dehydrogenase, to low temperatures. Protein Engineering 14: 85-91
Theriot CM, Tove SR, Grunden AM (2009) Characterization of two proline dipeptidases (prolidases) from the hyperthermophilic archaeon Pyrococcus horikoshii. Appl Microbiol Biotechnol 86: 177-188
Thompson MJ, Eisenberg D (1999) Transproteomic evidence of a loop-deletion mechanism for enhancing protein thermostability. J Mol Biol 290: 595-604
Van den Burg B, Vriend G, Veltman OR, Venema G, Eijsink VG (1998) Engineering an enzyme to resist boiling. Proc Natl Acad Sci U S A 95: 2056-2060
Vetriani C, Maeder DL, Tolliday N, Yip KS, Stillman TJ, Britton KL, Rice DW, Klump HH, Robb FT (1998) Protein thermostability above 100 degrees C: a key role for ionic interactions. Proc Natl Acad Sci U S A 95: 12300-12305
Vieille C, Zeikus GJ (2001) Hyperthermophilic Enzymes: Sources, Uses, and Molecular Mechanisms for Thermostability. Microbiol. Mol. Biol. Rev. 65: 1-43
Vihinen M (1987) Relationship of protein flexibility to thermostability. Protein Eng 1: 477- 480
Vyas NK, Nickitenko A, Rastogi VK, Shah SS, Quiocho FA (2010) Structural insights into the dual activities of the nerve agent degrading organophosphate anhydrolase/prolidase. Biochemistry 49: 547-559
Wetherell J, Price M, Mumford H (2006) A novel approach for medical countermeasures to nerve agent poisoning in the guinea-pig. Neurotoxicology 27: 485-491
98 Wilcox DE (1996) Binuclear Metallohydrolases. Chem Rev 96: 2435-2458
Yaron A, Naider F (1993) Proline-dependent structural and biological properties of peptides and proteins. Crit Rev Biochem Mol Biol 28: 31-81
Zavodszky P, Kardos J, Svingor, Petsko GA (1998) Adjustment of conformational flexibility is a key event in the thermal adaptation of proteins. Proc Natl Acad Sci U S A 95: 7406-7411
Zecchinon L, Claverie P, Collins T, D'Amico S, Delille D, Feller G, Georlette D, Gratia E, Hoyoux A, Meuwis MA, Sonan G, Gerday C (2001) Did psychrophilic enzymes really win the challenge? Extremophiles 5: 313-321
99
Table 2-1 PCR primers used in this study
Name Sequence (5’-3’) Function of PCR product
Ec PepP F GTGAGATATCCCGGCAAGAGTTTCAGCGTCGCCGT For replacement of pepP with Cm CAGGCCCTGGTGGAGTGTAGGCTGGAGCTGCTTCG cassette
Ec PepP R GACGGATAGCGCGCACCGTGGCGGTTAAATTCGTG For replacement of pepP with Cm GTGAATTTCGCCTTCCATATGAATATCCTCCTTAG cassette
Ec PepQ F AAATCATATAGCTACCTTACAAGAACGGACTCGCG For replacement of pepQ with ATGCGCTGGCGCGCTTGTAGGCTGGAGCTGCTTCG Km cassette
Ec PepQ R TCAGCCACTTTCGCCGCCGGAAGCGCCACCCGCAG For replacement of pepQ with CAGAACGAATGCCTGCATATGAATATCCTCCTTAG Km cassette
PepP-Up GGTTGGGTCAATCACTTCCTG For PCR verification of pepP deletion
PepP-Dn AGCATGTGACTCTGGCGCAGT For PCR verification of pepP deletion
PepQ-Up GCCATCTTCCAGCCAGTCAA For PCR verification of pepQ deletion
PepQ-Dn TTGCGGTTCAGCCACCACAGC For PCR verification of pepQ deletion
Prol-1 ATAGGATCCGGTGAGGAGGTTGTATGAAAGAAAG Cloning of prolidase gene into ACTTGAA vector
Prol-2 ATAGCGGCCGCCTACATTAATCAGAAAGGCTGAA Cloning of prolidase gene into GTTGTTA vector
Prol-3 TGATGACGTGATAAAGGA For prolidase gene sequencing
Prol-4 TGATATGAAAGCAGCTCT For prolidase gene sequencing
Prol-5 GCCCCTCTCTATCCTCTTGT For prolidase gene sequencing
Prol G39E F TCTGGAACTTCTCCCCTGGGAGAGGGATACATAA For generation of R19G/G39E/ TAGTTGACGGT (The mutation site of Gly to Glu is K71E/S229T pET-prol plasmid underlined)
Prol G39E R ACCGTCAACTATTATGTATCCCTCTCCCAGGGGA For generation of R19G/G39E/ GAAGTTCCAGA (The mutation site of Gly to Glu is K71E/S229T pET-prol plasmid underlined)
100
Table 2-2 Kinetic parameters of wild type and mutated prolidases from Pyrococcus furiosus
Km Vmax kcat kcat / Km Temperature Prolidase (mM) ( mol/min/mg) (s-1) (mM-1 s-1)
WT-Pfprol 6.4 1.5 187 22 123 19 35 C G39E 13 1.3 254 15 167 13 R19G/K71E/S229T 11.3 1.7 261 20 171 15
R19G/G39E/ K71E/S229T 7.9 1.5 263 26 173 22
WT-Pfprol 5.7 1.4 1,168 140 767 135 70 C G39E 6.8 1.2 1,549 118 1,017 150
R19G/K71E/S229T 9.2 1.7 1,853 162 1,217 132
R19G/G39E/ K71E/S229T 7.5 1.4 3,679 344 2,416 322
WT-Pfprol 7.95 1.3 3,194 247 2,104 266 100 C G39E 14.5 4.7 6,995 1,416 4,594 317
R19G/K71E/S229T 13.7 3.4 9,740 1,490 6,396 467
R19G/G39E/ K71E/S229T 11.1 2.4 11,594 1,427 7,481 674 Enzyme assays were done using a range of Met-Pro (1-16 mM) with at least 5 points and in duplicate. Enzyme kinetic parameters were plotted using nonlinear regression (r2 values > 0.9) and analyzed using the Michaelis- Menton equation utilizing software from Prism 5 (GraphPad, La Jolla, CA). All enzyme assays contained 1.2 mM of CoCl2.
101
Table 2-3 Pot-life reactivity of recombinant wild type and mutant P. furiosus prolidases at 70°C
Specific Activity (U/mg) Incubation Time WT-Pfprol G39E R19G/ K71E/ R19G/G39E/K71 S229T E/ S229T
12 hr 1563 ± 51 1768 ± 135 843 ± 68 1366 ± 137
24 hr 1278 ± 66 1202 ± 208 853 ± 57 1037 ± 166
48 hr 1083 ± 58 599 ± 94 722 ± 49 496 ± 102
Prolidase assays were performed at 100°C and contained 1.2 mM CoCl2 and 4 mM of Met-Pro. P. furiosus prolidases were incubated anaerobically at 70°C over a 48 h period. Enzyme samples were taken after 12, 24 and 48 h to assess reactivity.
102
Table 2-4 Substrate specificity of recombinant wild type and mutant P. furiosus prolidase with different proline dipeptides
Relative Activity (%) of WT-Pfprol specific activity Substrate WT-Pfprol G39E R19G/ K71E/ R19G/G39E/K71E/ S229T S229T Met-Pro 100 103 137 143 (2154) Leu-Pro 100 85 169 79 (1582) Phe-Pro 100 60 97 122 (395) Ala-Pro 100 35 95 38 (392) Gly-Pro 100 37 47 10 (347) Arg-Pro 100 132 101 112 (164) Pro-Ala 100 125 117 13 (24)
Prolidase assays were performed at 100°C and contained 1.2 mM CoCl2 and 4 mM of each substrate. One hundred percent specific activity is reported for WT-Pfprol and correlates to U/mg in parentheses below the 100% relative activity.
103
Table 2-5 Specific activity of OP nerve agents and Gly-Pro with Alteromonas sp. strain JD6. 5 OPAA/prolidase and Pyrococcus furiosus prolidases Specific Activity (U/mg) DFP Gly-Pro p-nitrophenyl Prolidases soman Alteromonas OPAA/prolidasea 439a 13.5a 4.8a WT-Pfprol 0.73 347 0.50 G39E Pfprol 1.63 130 0.86 R19G/K71E/S229T Pfprol 0.89 163 1.02 R19G/G39E/K71E/S229T Pfprol 5.45 36 1.70 Pyrococcus prolidases were assayed at 50 C for DFP, 100 C for Gly-Pro and 70 C for p-nitrophenyl soman. All assays contained 50 mM MOPS 200 mM NaCl pH 7.0, 0.2 mM CoCl2, 4 mM Gly-Pro and 3 mM for DFP and soman. Units for OP nerve agents are defined as µmoles of product formed/min/mg and for Gly-Pro, units represent µmoles of proline released/min/mg. aResults are taken from Vyas et al., 2010.
104
Fig. 2-1 Mapping of the mutations in the monomer structure of P. furiosus prolidase and
OPAA/prolidase from Alteromonas sp. strain JD6.5. Mutations made in the Pfprol are indicated by red circles and include R19G, G39E, K71E and S229T. (A) Stereoview of the backbone trace of the domain structure (B) Ribbon drawing of the domain structure in the same orientation as (A). N-terminal domain is in blue and the C-terminal domain is yellow.
The metal atoms are depicted as gray spheres (modified from Maher et al., 2004). (C)
Ribbon drawing of the Alteromonas sp. strain JD6.5 OPAA/prolidase monomer (modified from Vyas et al., 2010).
105
Fig. 2-2 Relative activity of WT-Pfprol and the prolidase mutants with Met-Pro (4 mM) and
CoCl2 (1.2 mM) at temperatures ranging from 10 C-100 C. 100% relative activity corresponds to WT-Pfprol specific activities of 5.5 U/mg at 10 C, 25 U/mg at 20 C, 61 U/mg at 35 C, 138 U/mg at 50 C, 806 U/mg at 70 C, and 2154 U/mg at 100 C.
106
Fig. 2-3 Specific activity of WT-Pfprol and prolidase mutants over a pH range of 4.0-10.0.
Prolidase assays were done at 100 C and contained Met-Pro (4 mM), CoCl2 (1.2 mM) and a final concentration of 200 mM NaCl and 50 mM of the following buffers: pH 4.0-5.0,
Sodium Acetate; pH 6.0-8.0, MOPS; pH 9.0, CHES; pH 10.0, CAPS.
107
Fig. 2-4 Relative activity with WT-Pfprol and prolidase mutants with OP nerve agent DFP.
All prolidase assays contained 50 mM MOPS 200 mM NaCl pH 7.0, 0.2 mM CoCl2, and 3 mM DFP. 100% relative activity corresponds to WT-Pfprol specific activity for DFP of 0.42
µmoles product formed/min/mg at 35 C and 0.73 µmoles product formed/min/mg at 50 C.
108
Fig. 2-5 Relative activity with WT-Pfprol and prolidase mutants with the OP nerve agent analog, p-nitrophenyl soman. All prolidase assays contained 50 mM MOPS 200 mM NaCl pH 7.0, 0.2 mM CoCl2, and 3 mM p-nitrophenyl soman. 100% relative activity corresponds to WT-Pfprol specific activity of p-nitrophenyl soman of 0.23 µmoles product formed/min/mg at 35 C, 0.3 µmoles product formed/min/mg at 50 C and 0.5 µmoles product formed/min/mg at 70 C.
109
CHAPTER 3
Characterization of Two Proline Dipeptidases (Prolidases) from the Hyperthermophilic Archaeon Pyrococcus horikoshii
Casey M. Theriot, Sherry R. Tove, Amy M. Grunden
Department of Microbiology, North Carolina State University, Raleigh, NC 27695
Citation: Theriot, C.M., S.R. Tove, A.M. Grunden (2010) Characterization of Two
Proline Dipeptidases (Prolidases) from the Hyperthermophilic Archaeon Pyrococcus
horikoshii. Applied Microbiology and Biotechnology. 86: 177-188.
110 Abstract
Prolidases hydrolyze the unique bond between X-Pro dipeptides and can also cleave the P-F and P-O bonds found in organophosphorus (OP) compounds, including the nerve agents, soman and sarin. The advantages of using hyperthermophilic enzymes in biodetoxification strategies are based on their enzyme stability and efficiency. Therefore, it is advantageous to examine new thermostable prolidases for potential use in biotechnological applications.
Two thermostable prolidase homologs, PH1149 and PH0974, were identified in the genome of Pyrococcus horikoshii based on their sequences having conserved metal binding and catalytic amino acid residues that are present in other known prolidases, such as the previously characterized Pyrococcus furiosus prolidase. These P. horikoshii prolidases were expressed recombinantly in the Escherichia coli strain BL21 (λDE3) and both were shown to function as proline dipeptidases. Biochemical characterization of these prolidases shows they have higher catalytic activities over a broader pH range, higher affinity for metal and are more stable compared to P. furiosus prolidase. This study has important implications for the potential use of these enzymes in biotechnological applications and provides further information on the functional traits of hyperthermophilic proteins, specifically metalloenzymes.
Keywords: Prolidase; Pyrococcus horikoshii; Hyperthermophile; Metalloenzyme; Cobalt enzyme
111
3.1 Introduction
Pyrococcus horikoshii is a hyperthermophilic, anaerobic organism that was isolated from a deep (1400 m depth) hydrothermal vent in the Okinawa Trough in the northeastern Pacific
Ocean (Gonzalez et al. 1998). Closely related Pyrococcus furiosus was isolated from a shallow marine solfatara at Vulcano Island off the coast of Italy (Fiala and Stetter 1986). P. furiosus is one of the most studied hyperthermophiles to date (Adams 1993). Both
Pyrococcus species grow optimally at extreme temperatures of 98-100ºC and at pH 7.0
(Gonzalez et al. 1998). They are both obligately heterotrophic anaerobes that are able to use select peptides and proteins to produce organic acids, CO2 and H2 (Fiala and Stetter 1986;
Gonzalez et al. 1998). P. furiosus grows on maltose, starch and pyruvate, whereas P. horikoshii cannot and is only able to utilize proteinaceous media substrates such as yeast extract, tryptone, or a 21-amino-acid mixture supplemented with vitamins (Gonzalez et al.
1998; Schut et al. 2003). P. horikoshii, unlike other closely related species such as P. furiosus and Pyrococcus abyssi, requires tryptophan and histidine for growth and cannot grow on a non-peptide carbon source (Gonzalez et al. 1998; Lecompte et al. 2001). The growth profile for these three organisms is similar (Gonzalez et al. 1998), with the main differences being the substrates they are able to use for energy, which could lead to subtle differences in the regulation of metabolism.
The genomes of P. furiosus and P. horikoshii have been compared. The genomes consist of 1.908 mbp and 1.738 mbp for P. furiosus and P. horikoshii, respectively (Maeder et al. 1999). The missing 170-kbp gap between the two organisms contains sequences that
112 code for amino acid biosynthetic pathways, specifically trp, his, aro, leu-ile-val, arg, pro, cys, thr and mal operons (Maeder et al. 1999). However, P. horikoshii has many genes for chemotaxis that P. furiosus lacks (Lecompte et al. 2001; Maeder et al. 1999). The reliance of
P. horikoshii on proteinaceous substrates for energy production and metabolism suggests that
P. horikoshii may require more proteases that function to provide the organism with amino acids that it is unable to make on its own. This could explain why P. horikoshii possesses more than one functional proline dipeptidase.
Enzymes that are able to catalyze the hydrolysis of proteins into smaller peptide fractions and amino acids are defined as proteases. There are few proteases that are able to cleave a peptide bond adjacent to a proline residue. This is due to the conformational constraint that the cyclic structure of proline puts on a peptide bond (Cunningham and
O'Connor 1997). Prolidase is one of these proteases that is able to hydrolyze dipeptides with proline in the C-terminus, X-Pro, and a non-polar amino acid in the N-terminus (Lowther and
Matthews 2002). Prolidases are ubiquitous in nature and can be found in Archaea, Bacteria and Mammals (Endo et al. 1989; Fernandez-Espla et al. 1997; Ghosh et al. 1998; Suga et al.
1995). It is unclear what role prolidase plays in archaea and bacteria, but it has been suggested to aid in protein degradation and could be responsible for the recycling of proline.
Due to its reaction mechanism it could also play a role in regulating biological processes
(Cunningham and O'Connor 1997). In humans, however, prolidase has been shown to be involved in the final stage of the degradation of endogenous and dietary protein and is important in the breakdown of collagen. PD, or prolidase deficiency in humans, is a recessive disorder marked by mutations and or deletions in the human prolidase gene
113 (Ledoux et al. 1996). PD is characterized by skin ulcerations, mental retardation and recurrent infections of the respiratory tract (Endo et al. 1989; Forlino et al. 2002).
The specificity of prolidase reactions and the substrates it is able to cleave may be dependent on the metal center it possesses. Prolidase belongs to a small class of metalloenzymes known as the “pita bread enzymes” because they contain the same pita bread fold encompassing a similar metal center and substrate binding pocket (Lowther and
Matthews 2002). Other enzymes within this class include methionine aminopeptidase, aminopeptidase P and creatinase, each having slightly different substrate specificity, but the same conserved metal binding pocket suggesting they might have a conserved catalytic mechanism (Lowther and Matthews 2002). Most enzymes in this class require one or two divalent ions such as Co2+, Mn2+, or Zn2+ to be present in their active sites to catalyze a reaction, with one of the metal atoms being more tightly bound than the other (Lowther and
Matthews 2002). The first prolidase structurally and biochemically characterized was from the hyperthermophilic archaeon P. furiosus (Ghosh et al. 1998; Grunden et al. 2001; Maher et al. 2004). P. furiosus prolidase showed maximum activity at 100 C and pH 7.0 (Ghosh et al. 1998; Grunden et al. 2001) and a narrow substrate specificity, only hydrolyzing dipeptides with a proline in the C-terminus and non-polar amino acid (Leu, Met, Val, Phe or Ala) in the
N-terminus (Ghosh et al. 1998). This dipeptidase is maximally active with the addition of divalent cations Co2+ and Mn2+ but cannot be substituted with other divalent cations (Mg2+,
Ca2+, Ni2+, Cu2+ or Zn2+) (Ghosh et al. 1998). It requires two cobalt atoms occupying the metal binding sites, one tight binding at residues E313 and H284 and one loose binding at
114 D209, with a Kd of 0.24 mM (Du et al. 2005). P. furiosus prolidase has also been shown to be maximally active with Fe2+ (1434 U/mg), and somewhat less active with Co2+ (573.6
U/mg) under anaerobic conditions, suggesting that the metal preference in vivo may be for
Fe2+ rather than Co2+ (Du et al. 2005).
Recombinant prolidase has use in several biotechnological applications (Theriot et al.
2009). It is used by the food and dairy industry in the fermentation process, specifically in cheese taste and texture development (Bockelmann 1995). Recombinant prolidase is also being examined for enzyme replacement therapy for patients that have PD. However, it has also been shown to degrade organophosphorus (OP) nerve agents. OP nerve agents act by inhibiting acetylcholinesterase (AChE), which leads to a buildup of acetylcholine in the body and can lead to hypersecretion, convulsions, respiratory problems, coma and finally death.
OPAAs or organophosphorus acid anhydrolases from Alteromonas have shown the ability to hydrolyze OPs because they are able to cleave the P-F, P-O, P-CN and P-S bonds of the nerve agents, sarin and soman (Cheng et al. 1998). OPAA can also hydrolyze specific proline dipeptides characterized by [Xaa-Pro], specifically Leu-Pro and Ala-Pro, therefore it is now considered a prolidase. OPAA‟s target substrates (soman and sarin) mimic that of the prolidase specific substrates [Xaa-Pro] in shape, size and surface charges (Cheng and
DeFrank 2000). Prolidase could be a potential biodecontaminant for detoxification of OP nerve agents in the field. An activity of 30 U mg-1 was seen when purified P. furiosus prolidase was tested at 55 C against G-series OP nerve agent diisopropylfluorophosphate
(DFP) (Theriot et al. 2009). Currently, Alteromonas OPAA-1 and OPAA-2 prolidases are
115 used in a foam formulation DS2 for biodecontamination, although metal is still required for enzyme activity (Cheng et al. 1999). It is necessary to study other candidate prolidases in the hopes of identifying an enzyme that will be more efficient in detoxifying OP nerve agents under harsh conditions that exist with field applications. To further evaluate new enzymes that could potentially be used for decontamination of OP nerve agents, two putative prolidases from P. horikoshii have been expressed and biochemically characterized.
3.2 Materials and Methods
Identification and cloning of the P. horikoshii prolidase-encoding genes
The Pfprol accession number (AAL81467) was entered into the Basic Local Alignment
Search Tool (BLAST) or blastp to look for similar structures based on Pfprol. The results included homologous protein structures Phprol (BAA30249) and Ph1prol (BAA30071).
P. horikoshii genomic DNA was obtained from ATCC, strain 700860D-5. P. horikoshii prolidase (PH1149), prolidase homolog 1 (PH0974) and prolidase homolog 2
(PH1902) genes were amplified by PCR for subsequent cloning of these genes into the T7- polymerase-driven expression vector pET-21b (Novagen). For the PCR amplification of P. horikoshii prolidase, prolidase homolog 1 and prolidase homolog 2 genes, two primers were designed for each: Phprol Primer 1 (5‟-AAGATCAAGGAGGTCATATGGACATAA-3‟)
(forward, containing an NdeI restriction site shown in bold) and Primer 2 (5‟-
CCTACTAAAGCTTGCTAGATGAGTTCTC-3‟) (reverse, containing an HindIII restriction
116 site shown in bold); Ph1prol Primer 1 (5‟AACCATATGA-
GGCTTGAAAAGTTCATTCAC-3‟) (forward, containing an NdeI restriction site shown in bold) and Primer 2 (5‟-TGAGTCGACAGTAGT-AGAATAATAACA-3‟) (reverse, containing a SalI restriction site shown in bold); Ph2prol Primer 1 (5‟-
GAACTCATATGGTTATGAGAGGGAACA-3‟) (forward, containing an NdeI restriction site shown in bold) and Primer 2 (5‟-CACTGGTCGACATAGACATTCTAATAA-3‟)
(reverse, containing a SalI restriction site shown in bold). All primers were designed using
MacVector (Accelrys, San Diego, CA) computer software.
PCR amplification was performed using native P. furiosus DNA polymerase (0.2 µl) in a 50 µl reaction solution containing 5.0 µl 10X Taq buffer, 0.4 µl dNTP (25 mM), 0.5 µl
Forward primer (40 µM), 0.5 µl Reverse primer (40 µM), 0.5 µl Taq Polymerase, and 1.0 µl
P. horikoshii genomic DNA (100 ng/µl). The following PCR protocol was run on the thermocycler (Biorad, Hercules, CA): Two initial cycles for 4 min at 94°C for denaturation, 1 min at 55°C for annealing, 1 min at 72°C for extension; followed by 39 cycles of 94°C for 1 min, 55°C for 1 min, 72°C for 1 min; and one final cycle at 72°C for 7 min. The prolidase
PCR product sizes were 1.08-kb, 1.07-kb, and 1.09-kb for Phprol, Ph1prol and Ph2prol, respectively. PCR products were electrophoresed through a 1% agarose gel for visual inspection.
The amplified prolidase genes were subsequently cloned into the EcoRV site of plasmid pCR-Script (Stratagene) to yield plasmids phprol-script, ph1prol-script and ph2prol- script. Plasmids were transformed into E. coli strain XL1-Blue (Novagen), and the transformed cells were plated on Luria Bertani (LB) plates supplemented with ampicillin
117 (100 µg/ml) and X-gal (40 mg/ml) and incubated at 37°C overnight. Blue-white screening was used to select colonies for plasmid isolation.
Plasmids with insert were isolated from white colonies and digested with NdeI and
HindIII for the phprol gene and NdeI and SalI to excise prolidase homolog 1 and 2 genes, respectively. The excised prolidase and homolog genes were subsequently cloned into the
NdeI and HindIII or NdeI and SalI (NEB) sites in expression vector pET-21b (Novagen), resulting in plasmids pET-Phprol, pET-Ph1prol and pET-Ph2prol. All plasmids were sent to
MWG Biotech (High Point, NC) for sequencing to ensure that no sequence changes occurred in the cloning process.
Overexpression of P. horikoshii prolidases
P. horikoshii prolidase expression plasmids and the rare arginine, leucine and isoleucine tRNA encoding plasmid pRIL (Stratagene) were transformed into E. coli BL21(λDE3) cells
(Novagen), which has isopropyl-β-D-thiogalactopyranoside (IPTG) inducible expression of
T7-RNA polymerase encoded on the chromosome. Transformants were selected on LB-
Ampicillin-Chloramphenicol plates after incubation at 37 C overnight.
Large-scale protein expression was done for Phprol and Ph1prol by inoculating 1 L cultures of autoinduction media (Studier 2005) supplemented with 100 µg/ml of ampicillin and 34 µg/ml chloramphenicol for plasmid maintenance. Cells were grown with shaking
(200 RPM) at 37 C for 14 h. Cells were harvested by centrifugation and stored at –80 C
118 until broken. Recombinant protein expression was evaluated throughout this process using
SDS-PAGE analysis.
Purification of recombinant P. horikoshii prolidases
Cell pellets containing the Phprol and Ph1prol protein were suspended in 50 mM Tris-HCl, pH 8.0 containing 1 mM benzamidine-HCl and 1 mM DTT. The cell suspension was passed through a French pressure cell (20,000 lb/in2) two times. The lysed suspension was centrifuged at 38,720 g for 30 min to remove cell debris. The supernatant was made anaerobic and was heated at 80 C for 30 min. E. coli cell debris and denatured protein were removed by centrifugation of the heated supernatant at 38,720 g for 30 min. The clarified extract was applied to a 20 ml phenyl sepharose column. Before adding the extract to the column, ammonium sulfate, [NH4]2SO4, was added to the heat-treated extract gradually to a final concentration of 1.5 M. For phenyl sepharose chromatography, the binding buffer used was 50 mM Tris-HCl, 1.5 M [NH4]2SO4, pH 8.0 and the elution buffer was 50 mM Tris-HCl, pH 8.0. The fractions with active enzyme were applied to a 5 ml Q-column, which used a binding buffer of 50 mM Tris-HCl, pH 8.0 and an elution buffer of 50 mM Tris-HCl, 1 M
NaCl, pH 8.0. All fractions were visualized on 12.5% SDS-polyacrylamide gels and enzyme assays were performed as well to ensure activity after each purification step.
119 Prolidase enzyme assay
The enzyme reaction mixture and assay is based on a previously described method from
Ghosh et al., 1998 and Du et al., 2005. The (500 µl) reaction mixture contains 50 mM
MOPS (3-[N-morpholino]propanesulfonic acid) buffer (pH 7.0), 200 mM NaCl, 5% (vol/vol) glycerol, 0.1 mg/ml BSA protein and 1.2 mM CoCl2 (metal), and finally the enzyme. The reaction mixture was heated for 5 min at 100 C in order for the metal and enzyme to interact.
The reaction was initiated with the addition of the substrate, Met-Pro (final concentration of
4 mM). The reaction was heated for an additional 10 min at 100 C. To stop the reaction, glacial acidic acid (500 µl) was added, and then (3% [wt.vol]) ninhydrin reagent (500 µl) was added. The mixture was heated again for 10 min at 100 C and then cooled to 23 C. The absorbance was determined at 515 nm with an extinction coefficient of 4,570 M-1-cm-1 for the ninhydrin-proline complex. One unit of prolidase activity is defined as the amount of enzyme that liberates one µmole of proline per min (Ghosh et al. 1998). For assays conducted at different pH values, the following buffers were used at final concentrations of
100 mM: pH 5.0, Sodium Acetate; pH 6.0 – 8.0, MOPS; pH 9.0, CHES; pH 10.0, CAPS.
For assays that evaluate metal preference, the following metals were substituted for Co2+:
Mn2+, Fe2+, Ni2+, Zn2+, and Cu2+ at final concentrations of 1.2 mM. Also, when evaluating substrate specificity the following dipeptides: Leu-Pro, Gly-Pro, Ala-Pro, Arg-Pro, Phe-Pro and Pro-Ala, were substituted for Met-Pro at a final concentration of 4 mM. Enzyme kinetic assays were done with increasing concentrations of Met-Pro and a metal concentration of
120 Co2+ of 0.2 mM.
Anaerobic enzyme assay to determine metal preference
The active site metals were stripped from the purified prolidases by dialyzing 1 ml of 0.1 mg/ml of purified protein in 1 L of buffer (50 mM MOPS pH 7.0, 0.5 mM EDTA) for 1 h, followed by 2 more washes in 1 L of 50 mM MOPS pH 7.0 (repeated twice for 1 h each) to remove any EDTA. The metal centers were reconstituted by incubating the apo-proteins with 7.5 µM (this corresponds to 3-fold molar equivalents of metal/ prolidase monomer) of the following metals, CoCl2, FeSO4, ZnCl2, under anaerobic conditions for 15 min at 80 C.
A final concentration of 1 mM of DT or sodium dithionite was added to the FeSO4 in order to keep the iron reduced to Fe (II). The reconstituted enzyme preparations were assayed following the same protocol described above. All assays were done under anaerobiosis in a
Coy Anaerobic Chamber.
Metal content analysis of purified P. horikoshii prolidases
For preparation of protein samples for metal content determinations, 5 ml of 1 mg/ml purified prolidase protein was dialyzed in 2 L 50 mM MOPS, pH 7.0 overnight at 4 C. The dialyzed protein sample and a dialysis buffer sample were collected. Metal content of the
121 prolidases was determined by ICP emission spectrometry at the North Carolina State
University Analytical Service Laboratory.
Metal competition experiments
The active site metals were stripped from the purified prolidases by dialyzing 1 ml of 1 mg/ml of protein in 1 L of buffer (50 mM MOPS pH 7.0, 5 mM EDTA) for 1 h, followed by
2 more washes in 1 L of 50 mM MOPS pH 7.0 (repeated twice for 1 h each) to remove any residual EDTA. The metal centers were reconstituted by incubating the apo-proteins with
125 µM (this corresponds to 5-fold molar equivalents of metal/ prolidase monomer) of the following metals, CoCl2, MnCl2, and ZnCl2, and 62.5 µM (this corresponds to 2.5-fold molar equivalents of metal/ prolidase monomer) of the following metal mixtures: CoCl2 and MnCl2 and CoCl2 and ZnCl2 under anaerobic conditions for 15 min at 80 C. Metal reconstituted enzyme samples were dialyzed in 50 mM MOPS pH 7.0 at 4 C overnight. Enzyme assays were done following metal removal and after overnight dialysis.
Thermostability assay
Each enzyme (0.2 mg/ml in 100 mM MOPS, pH 7.0) was incubated anaerobically in a sealed vial in a 100 C water bath for 8 hours. Samples were taken every hour and an enzyme assay was done to monitor activity. To calculate the thermal half-life t50%, enzymes were prepared
122 as described above but were incubated in a 90 C oven for 48 hours. Samples were taken at specific time points to monitor activity. Enzyme assays contained 0.2 mM CoC12 and 4 mM
Met-Pro.
Amino acid sequence accession numbers
The prolidase amino acid sequences in the Clustal alignment (Fig. 3-1) can be accessed in the
GenBank database with accession numbers: P. furiosus prolidase (AAL81467), P. horikoshii prolidase (BAA30249), P. horikoshii prolidase homolog 1 (BAA30071), P. horikoshii prolidase homolog 2 (NP_143731), Alteromonas OPAA-2 (AAB05590), and prolidases from
Lactobacillus delbrueckii (CAB07978), Human (AAA60064), and E. coli (P15034).
3.3 Results
Identification of P. horikoshii prolidase homolog genes
P. horikoshii prolidase or Phprol (PH1149), P. horikoshii prolidase homolog 1 or Ph1prol
(PH0974) and P. horikoshii prolidase homolog 2 or Ph2prol (PH1902) each show 88%, 55% and 27% similarity to previously characterized P. furiosus prolidase, respectively (Fig. 3-1).
Phprol and Ph1prol both contain all 5 conserved metal center-liganding amino acid residues that are required for catalysis (Asp-209, Asp-220, His-192, Glu-313, Glu-327) (Pfprol numbering) (Maher et al. 2004). Ph2prol only contains 2 out of the 5 conserved residues and
123 has different spacing between the residues signifying that it may be a different class of enzyme. National Center for Biotechnology Information (NCBI) lists the following annotations for each protein as follows: PH1149, X-Pro dipeptidase; PH0974, dipeptidase and PH1902, hypothetical protein.
Expression and purification of recombinant prolidases from P. horikoshii
Prolidases from P. horikoshii were expressed in BL21 (λDE3) E. coli cells using autoinduction media (Studier 2005). Maximum recombinant protein expression levels were obtained after incubation of 14 h with autoinduction cultures. Assays were done using crude cell extract and heat-treated cell extract (heated at 80 C for 20 min) to determine whether the recombinant prolidases had activity.
Although there was an overexpressed protein (41.78 kDa) that could be seen by SDS- gel analysis for the PH1902 expressed cell extract, there was no enzymatic activity observed for Ph2prol (PH1902) using the non-heat treated or heat-treated crude extracts and the entire battery of metals and dipeptide substrates. Therefore, the recombinantly expressed PH1902 protein was determined not to be a prolidase and was not subjected to further purification and characterization.
Phprol (PH1149) and Ph1prol (PH0974) showed high activity in crude and heat- treated cell extract, and multi-column purification was performed to purify both enzymes.
The overexpressed prolidases were identified using SDS-PAGE analysis, and protein bands
124 of 39.27 kDa (Phprol) and 40.04 kDa (Ph1prol) were followed throughout the purification process, as was prolidase activity (Fig. 3-1S).
To evaluate the metal content of each enzyme after purification, ICP emission spectrometry was used. The metal present in the highest amounts for purified Phprol and
Ph1prol was zinc (0.268 g-atoms of Zn/mol of subunit and 1.136 g-atoms of Zn/mol of subunit, respectively) (Table 3-1S). Cobalt was detected at levels less than 0.001 g-atoms of
Co/mol of subunit for both enzymes.
Catalytic properties of recombinant prolidases Phprol (PH1149) and Ph1prol (PH0974)
The temperature profile showed maximal activity of 1938 U/mg for Phprol and 2355 U/mg for Ph1prol at 100 C (Fig. 3-2S). The optimum pH for both enzymes was at pH 7.0, although the second highest activity was recorded at pH 6.0 closely followed by pH 5.0 (Fig.
3-2). Previously characterized Pfprol was shown to have the highest activity with the substrate Met-Pro and the next highest activity with Leu-Pro (Ghosh et al. 1998). Phprol and
Ph1prol showed the same trends as Pfprol (1350 U/mg) with these dipeptides, having 100% relative activity with Met-Pro, correlating to specific activities of 1824 U/mg and 2751
U/mg, respectively (Table 3-1). All substrate specificity assays were done using 1.2 mM
CoCl2 and 4 mM of each substrate. There were slight differences in activities for the following dipeptide substrates: Gly-Pro, Ala-Pro, Arg-Pro and Phe-Pro. Both Phprol (10% relative activity) and Ph1prol (8% relative activity) showed slightly higher activity with Gly-
125 Pro as the substrate compared to Pfprol (1% relative activity) (Ghosh et al. 1998). While
Ph1prol appeared to have more then twice the relative activity with Ala-Pro, Arg-Pro and
Phe-Pro compared to Phprol, all the prolidases showed very little to no activity with the substrate Pro-Ala.
Phprol and Ph1prol are both very thermostable, showing no significant change in activity after 8 h at 100 C. The t50% value at 90 C for both Phprol and Ph1prol was 21.5 and
21 h, respectively.
Aerobic activity assay conditions
P. furiosus and P. horikoshii both require an anaerobic environment to grow optimally.
Therefore, prolidases from these anaerobic organisms should be assayed anaerobically to evaluate their enzymatic properties under physiologically relevant conditions. However, for prolidases to be useful in biotechnological applications they will need to be active under aerobic conditions. As such, it is important in this case to screen the P. horikoshii prolidases under both aerobic and anaerobic conditions.
For the aerobic assays, both prolidases were prepared with different divalent metal cations (1.2 mM), and the highest activity was seen with Co2+ followed by Mn2+, while Cu2+,
Fe2+, Zn2+ and Ni2+ could not restore activity (Fig. 3-3). When assayed with different concentrations of Co2+ and Mn2+, the enzymes performed optimally at 0.2 mM Co2+ for
Phprol with an activity of 2075 U/mg and for Ph1prol with 0.15 mM Co2+ and an activity of
126 4901 U/mg (Fig. 3-4). With Mn2+, the optimum activity was almost 724 U/mg for Phprol, and for Ph1prol the activity reached 2139 U/mg at a final concentration of 1.6 mM.
The kinetic parameters of Phprol and Ph1prol were determined using lower metal concentrations (0.2 mM) than were used for Pfprol (1.2 mM) (Ghosh et al. 1998). The kinetic analysis was done with Met-Pro and 0.2 mM of CoCl2 because their inclusion in the assay reactions provided the highest activity. The affinity or Km of Phprol for the substrate
Met-Pro, reported here as 3.4 mM is in line with Pfprol, both the native (2.8 mM) and recombinant (3.3 mM) versions, whereas Ph1prol has a Km of around 1.9 mM. The Vmax of both enzymes was very high (3997 and 5714 µmol·min-1·mg-1 for Phprol and Ph1prol, respectively), which were over three-fold higher than that of recombinant Pfprol (Table 3-2).
-1 The kcat/Km for Phprol and Ph1prol were high as well (2617 and 3812 s for Phprol and
Ph1prol, respectively).
Anaerobic activity assay conditions
Although aerobic metal analysis demonstrated that Co2+ supported the highest activity, when the assays were conducted under anaerobic conditions, very different results were seen. The
Phprol and Ph1prol purified enzymes were stripped of metals using EDTA, followed by metal reconstitution under anaerobiosis with Fe2+, Co2+ and Zn2+ at 80 C for 20 min. The highest activity for the anaerobic assays was observed with Fe2+, not Co2+. With Fe2+, Phprol showed the highest activity of 2371 U/mg while the activity for Ph1prol was 1357 U/mg.
127
The specific activity with Co2+ remained around 30% of the activity seen with Fe2+ (Fig. 3-
3S and Table 3-2S). Zn2+ was shown to only provide 1% of the relative activity in Ph1prol and did not support any activity in Phprol.
Metal competition experiment
Other than Pfprol, which has a solved Co-Co binuclear metal center, prolidases and metalloenzymes from different organisms and under varying conditions have been found to incorporate alternate divalent metal ions in their active sites (Besio et al. 2009; Lupi et al.
2006; Maher et al. 2004). Since, as purified, the P. horikoshii prolidases were shown to have been bound with zinc rather than with metals that support catalysis such as Co2+, Mn2+ and
Fe2+, it became necessary to evaluate how different metals and or metal combinations affect catalysis of these enzymes. Phprol and Ph1prol were dialyzed in 50 mM MOPS buffer containing EDTA to strip the enzyme of metal. Metal reconstitution was done under the following metal conditions, no metal addition (apo-protein) and the addition of the following metal or metal combinations, Co2+, Mn2+, Zn2+, Co2+/Mn2+, Co2+/Zn2+. The activity of the
WT-Ph1prol and WT-Phprol, pre-EDTA treatment, showed the normal activity seen with the addition of Co2+ (0.2 mM), Mn2+ or Zn2+ (1.2 mM) to an enzyme assay conducted at 100 C
(Table 3-3). Prolidase activity with the addition of cobalt in the assay yielded the highest activity at 4778 U/mg and 2174 U/mg for WT-Ph1prol and WT-Phprol, respectively. Apo-
128 protein represents protein that had EDTA treatment but contained no metal in the metal reconstitution process. Without the addition of metals to the enzyme assay, the apo-protein had very little to non-detectable activity (data not shown). When Co2+ ions were added to the assay with apo-protein, only 55% of the enzyme activity was restored for Ph1prol, and the activity was almost two-fold higher for Phprol. When adding Mn2+ to the assay, both
Ph1prol and Phprol apo-protein activity were almost fully restored. The highest activities for
Ph1prol were observed when Co2+, Mn2+, Co2+/Mn2+, and Co2+/Zn2+ were used in the reconstitution of the metal center and Co2+ was added to the assay mix (Table 3-3). The same trend was seen with Phprol, except the difference was almost a two-fold increase in activity when reconstituting with Co2+, Mn2+, Co2+/Mn2+ and Co2+/Zn2+, when the assay contained Co2+ (Table 3-4). When adding Mn2+ to the assay conditions with Phprol and
Ph1prol reconstituted with different metals, the activity was restored but not to the high levels detected when Co2+ was added. The addition of Zn2+ to assay conditions resulted in minimal activity (less than 1% relative activity) for Ph1prol and little to no detected activity for Phprol (Table 3-3).
3.4 Discussion
Biochemical characterization of both Phprol (PH1149) and Ph1prol (PH0974) supports their classification as prolidases or X-Pro dipeptidases. Although, Ph2prol possesses similar motifs to Xaa-Pro aminopeptidases when using pBLAST for protein comparison, no activity was seen when assays were done with Ph2prol crude cell extract when prolidase specific
129 substrates and metals were supplied. Closer inspection of the P. furiosus genome shows that it also contains two annotated prolidase genes, one being PF1343, which is the prolidase designated Pfprol, and PF0747, which we have classified as Pf2prol. Pf2prol is similar to
Ph2prol in that it only contains 2 out of 5 conserved metal binding residues and shows low percent similarity to Pfprol. Pf2prol and Ph2prol cannot be confirmed as prolidases and their function is still unknown at this time.
The catalytic properties of P. horikoshii prolidases are fairly similar to those observed for P. furiosus prolidase; however, there are key differences that could make them more ideal candidates for use in biotechnological applications. The temperature optima results for
Phprol and Ph1prol were very similar to Pfprol in that the highest activity was seen at 100 C.
This is not surprising since optimal growth of Pyrococci is at 98-100 C (Gonzalez et al.
1998). This would suggest that proteins isolated from these organisms should be very stable at high temperatures. Previously, when testing the thermal half-life of Pfprol under similar pH (7.0) and temperature conditions, Ghosh et al. found the t50% of Pfprol ((0.3 mg/ml) was 3 h. P. horikoshii prolidases (0.2 mg/ml) are even more thermostable with t50% values of over
20 h at 90°C, which is significantly higher than recombinant Pfprol and other characterized prolidases. Even after 48 h at 90°C, Phprol and Ph1prol were still active with a relative activity of 28% and 20%, respectively.
The P. horikoshii prolidases are more active over a broader pH range than Pfprol, showing significantly higher activity at the lower pH range, specifically pH 5.0 –7.0, and they continue to be active at pH 8.0 to a greater extent than is Pfprol. The enhanced stability
130 of P. horikoshii prolidases and catalysis over a larger pH range are qualities that could help these enzymes withstand other potential denaturants in OP nerve agent decontamination formulations. The kinetic parameters for the recombinant P. horikoshii prolidases are more promising for biotechnological applications compared to those determined for Pfprol. The affinity for the substrate Met-Pro is highest in Ph1prol with a Km of 1.9 mM, and the reaction turnover rates are significantly higher than for Pfprol. The substrate profile is similar to other prolidases in that they show high specificity to dipeptides with proline in the C-terminus and a non-polar amino acid in the N-terminal region, and rarely are able to cleave dipeptides with proline in the N-terminus, Pro-X. The differences in relative activities between Phprol and
Ph1prol could suggest differences in their roles in vivo. P. horikoshii, unlike P. furiosus, lacks many genes and operons that are responsible for de novo synthesis of amino acids; therefore, it is important that this organism obtain them from their environment. P. horikoshii may have two functional prolidases to aid in their amino acid metabolism requirements.
When examining the metal content of purified prolidases from P. horikoshii, it is not surprising that the incorporation of zinc, not cobalt was found in significant amounts.
Previously in Ghosh, et al., both the native and recombinant Pfprol contained one Co atom per molecule. When further chemical analysis was done, Zn was found in variable to significant amounts, but was attributed to non-specific binding due to its inability to restore enzyme catalysis. In addition, during the crystallization process used to solve the structure of
Pfprol, Zn replaced Co, the metal needed for catalysis, in the active site of the crystallized prolidase enzyme (Ghosh et al. 1998; Maher et al. 2004). The Maher study (Maher et al.
131 2004) warned when purifying or crystallizing a metalloenzyme such as prolidase, other metals could be introduced based on the crystallization medium used, and, this metal may not necessarily be physiologically or catalytically relevant to the enzyme.
The highest activity of Phprol and Ph1prol when assayed aerobically was observed when lower concentrations of Co2+ were introduced into the assay reaction than was used for
Pfprol activity assays (0.2 mM Co2+ for Phprol and Ph1prol versus 1.2 mM for Pfprol). For both Phprol and Ph1prol, the association constant for Co2+ appears to be much lower, between 10-50 µM, while for Pfprol it was previously projected to be 0.5 mM (500 µM) for recombinant P. furiosus prolidase (Ghosh et al. 1998). For Mn2+, the association constant was determined to be around 0.6 mM for Ph1prol, which is also consistent with Pfprol, which was shown to be 0.66 mM (Ghosh et al. 1998). The addition of metal for enzyme catalysis is one of the limitations in using this enzyme in applications because adding metal to the environment can be harmful. The P. horikoshii prolidases appear to be more active, more specific for their substrate, and require less metal for full catalysis than Pfprol, making them good candidates in the future for biotechnological applications.
Metal competition experiments with Phprol and Ph1prol also show variations in the preferred metal or mixed metals needed for optimum activity. Interestingly, the highest activities were seen with the enzyme reconstituted with Co2+, Mn2+, or a combination of
Co2+/Mn2+, with the addition of Co2+ to the assay conditions. This may suggest optimum activities could be achieved by a mixed metal center using Co and Mn ions in the active sites, rather then solely Co ions. Recently, in Besio et al. 2009, for the first time structural ICP-
MS and XAS data was presented of the recombinant human prolidase, showing that an active
132 prolidase can use a heterogeneous dimeric metal site, employing both Zn and Mn ions (Besio et al. 2009). Recombinant human prolidase had previously been characterized and was shown to contain a fully loaded Mn active site for maximum catalysis. However, the Besio et al. study indicated that human prolidase is also enzymatically active when one of two active sites is occupied by two Zn ions and the other with one Mn and one Zn ion (Besio et al.
2009). It has been suggested that zinc could play a structural role, while other divalent cations play a role in catalysis. The incorporation of zinc, whether non-specific or structural, may be present due to the host system used in the expression process. By using the E. coli host system to express recombinant proteins, zinc is more prevalent in vivo then any other divalent cations, which support prolidase activity (Maher et al. 2004; Willingham et al.
2001).
Although, cobalt is the preferred metal for catalysis aerobically, Fe2+ shows the highest activity anaerobically with Phprol and Ph1prol. In Du et al. it was reported that
Pfprol also had the highest activity with Fe2+ followed by Co2+ under anaerobic conditions
(Du et al. 2005). These findings are not particularly surprising considering the questions arising in the reported literature about the metal center in the closely related enzyme methionine aminopeptidase (Chai et al. 2008; Copik et al. 2005; Cosper et al. 2001; D'Souza et al. 2000; D'Souza and Holz 1999; D'Souza et al. 2002; Walker and Bradshaw 1998).
Methionine aminopeptidases share very similar structures with prolidases, as they both contain the same unique pita-bread fold and the same five metal ligands in the C- terminal region of the enzyme (Lowther and Matthews 2002). Other enzymes that are members of this family include aminopeptidase P and creatinase, and they all require metal
133 for catalysis (Lowther and Matthews 2002). Purified MetAP-I apoenzyme from E. coli can be activated by divalent cations such as Co2+, Mn2+, Fe2+, Ni2+ and Zn2+, with cobalt supporting the highest activity, but it is considered unlikely that Co2+ is the native cofactor in vivo based on whole cell metal analysis and MetAP inhibitor studies (Chai et al. 2008;
D'Souza and Holz 1999; Ye et al. 2006). In 1998, Walker and Bradshaw first demonstrated that Zn2+ was the native metal required in yeast MetAP-I, not Co2+ (Walker and Bradshaw
1998). Under physiologically relevant conditions and with inhibitors, E. coli MetAP-I
(EcMetAP-I) was found to use Fe2+ or Mn2+ for maximal activity, while Fe2+ was also found to maximally activate P. furiosus MetAP-II or PfMetAP-II at its physiologically relevant temperature of 80 C (D'Souza et al. 2000; D'Souza and Holz 1999; D'Souza et al. 2002;
Meng et al. 2002). These two enzymes have also been suggested to function in vivo as mononuclear enzymes (Chai et al. 2008; Copik et al. 2005). More recently a study by Chai et al. reports that Fe2+ is the native metal for MetAPs in both E. coli and two other Bacillus strains (Chai et al. 2008). Studies of prolidases and other related metallopeptidases continue to provide much needed information on the relationship and interactions between proteins and metals.
Many different prolidases are being studied for use in biotechnological applications including nerve agent detoxification, the development of cheese ripening and flavor in fermented foods, and most recently in enzyme therapy and drug delivery studies for patients with prolidase deficiency (PD) and even cancer (Theriot et al. 2009). Currently, prolidases are being characterized from lactic acid bacteria (LAB) evaluating their role in the food
134 fermentation process (Yang and Tanaka 2008). Enzyme therapy and drug delivery studies are underway using both recombinant human and prokaryotic prolidases (Lupi et al. 2006;
Mittal et al. 2007; Mittal et al. 2005). By studying new prolidases from different organisms we are able to explore the structure-function relationship of these enzymes and their interactions with metal.
Current biodecontamination formulations that incorporate Alteromonas prolidases have limited utility when used under harsh field conditions. The main limitations are in the long-term stability of the enzyme in a formulation mixture that includes other solvents and denaturing solutions and the need to add excess metal to reach full activity. An enzyme is needed with higher activity at a lower pH, over a broader temperature range, long-term stability under harsh conditions and low metal requirement (Cheng and DeFrank 2000). Both prolidases characterized from P. horikoshii show promising enzymatic properties that make these enzymes potential candidates for future optimization studies for OP degradation.
Compared to Pfprol, Phprol and Ph1prol show higher activity at a lower pH range, long-term stability, higher affinity for the substrate, and significantly lower metal requirement for catalysis. Future studies will focus on broadening the enzyme catalysis temperature range to include those suitable for application conditions. The differences in the structures of Pfprol compared to Phprol and Ph1prol could also provide insight into the properties needed for generating an enzyme with a higher affinity for metal. By utilizing genetic engineering strategies, we may be able to make a more catalytically active enzyme for detoxification of
OP nerve agents.
135 Acknowledgments
The authors thank Tatiana Quintero-Varca, Zeltina O‟Neal, Prashant Joshi and Eli Tiller for their help in analyzing Pyrococcus prolidase homologs. A special thanks to Dr. Jimmy
Gosse for helping with the operation of the Coy Anaerobic Chamber. Also Dr. Robarge and
Kim Hutchison for their assistance with analyzing metal samples via ICP. Support for these studies was provided by the Army Research Office (contract number 44258LSSR).
136 References Cited
Adams MW (1993) Enzymes and proteins from organisms that grow near and above 100
degrees C. Annu Rev Microbiol 47: 627-658
Besio R, Alleva S, Forlino A, Lupi A, Meneghini C, Minicozzi V, Profumo A, Stellato F,
Tenni R, Morante S (2009) Identifying the structure of the active sites of human
recombinant prolidase. Eur Biophys J
Bockelmann W (1995) The proteolytic system of starter and non-starter bacteria:
Components and their importance for cheese ripening. International Dairy Journal 5:
977-994
Chai SC, Wang WL, Ye QZ (2008) FE(II) is the native cofactor for Escherichia coli
methionine aminopeptidase. J Biol Chem 283: 26879-26885
Cheng TC, DeFrank JJ (eds) (2000) Hydrolysis of organophosphorus compounds by bacterial
prolidases. Kluwer Academic Publishers, Dordrecht
Cheng TC, DeFrank JJ, Rastogi VK (1999) Alteromonas prolidase for organophosphorus G-
agent decontamination. Chem Biol Interact 119-120: 455-462
Cheng TC, Rastogi VK, DeFrank JJ, Sawiris GP (1998) G-type nerve agent decontamination
by Alteromonas prolidase. Ann N Y Acad Sci 864: 253-258
Copik AJ, Waterson S, Swierczek SI, Bennett B, Holz RC (2005) Both nucleophile and
substrate bind to the catalytic Fe(II)-center in the type-II methionyl aminopeptidase
from Pyrococcus furiosus. Inorg Chem 44: 1160-1162
137 Cosper NJ, D'Souza V M, Scott RA, Holz RC (2001) Structural evidence that the methionyl
aminopeptidase from Escherichia coli is a mononuclear metalloprotease.
Biochemistry 40: 13302-13309
Cunningham DF, O'Connor B (1997) Proline specific peptidases. Biochim Biophys Acta
1343: 160-186
D'Souza VM, Bennett B, Copik AJ, Holz RC (2000) Divalent metal binding properties of the
methionyl aminopeptidase from Escherichia coli. Biochemistry 39: 3817-3826
D'Souza VM, Holz RC (1999) The methionyl aminopeptidase from Escherichia coli can
function as an iron(II) enzyme. Biochemistry 38: 11079-11085
D'Souza VM, Swierczek SI, Cosper NJ, Meng L, Ruebush S, Copik AJ, Scott RA, Holz RC
(2002) Kinetic and structural characterization of manganese(II)-loaded methionyl
aminopeptidases. Biochemistry 41: 13096-13105
Du X, Tove S, Kast-Hutcheson K, Grunden AM (2005) Characterization of the dinuclear
metal center of Pyrococcus furiosus prolidase by analysis of targeted mutants. FEBS
Lett 579: 6140-6146
Endo F, Tanoue A, Nakai H, Hata A, Indo Y, Titani K, Matsuda I (1989) Primary structure
and gene localization of human prolidase. J Biol Chem 264: 4476-4481
Fernandez-Espla MD, Martin-Hernandez MC, Fox PF (1997) Purification and
characterization of a prolidase from Lactobacillus casei subsp. casei IFPL 731. Appl
Environ Microbiol 63: 314-316
138 Fiala G, Stetter KO (1986) Pyrococcus furiosus sp. nov. represents a novel genus of marine
heterotrophic archaebacteria growing optimally at 100°C. Archives of Microbiology
145 56-61
Forlino A, Lupi A, Vaghi P, Icaro Cornaglia A, Calligaro A, Campari E, Cetta G (2002)
Mutation analysis of five new patients affected by prolidase deficiency: the lack of
enzyme activity causes necrosis-like cell death in cultured fibroblasts. Hum Genet
111: 314-322
Ghosh M, Grunden AM, Dunn DM, Weiss R, Adams MW (1998) Characterization of native
and recombinant forms of an unusual cobalt-dependent proline dipeptidase
(prolidase) from the hyperthermophilic archaeon Pyrococcus furiosus. J Bacteriol
180: 4781-4789
Gonzalez JM, Masuchi Y, Robb FT, Ammerman JW, Maeder DL, Yanagibayashi M,
Tamaoka J, Kato C (1998) Pyrococcus horikoshii sp. nov., a hyperthermophilic
archaeon isolated from a hydrothermal vent at the Okinawa Trough. Extremophiles 2:
123-130
Grunden AM, Ghosh M, Adams MW (2001) Proline dipeptidase from Pyrococcus furiosus.
Methods Enzymol 330: 433-445
Lecompte O, Ripp R, Puzos-Barbe V, Duprat S, Heilig R, Dietrich J, Thierry JC, Poch O
(2001) Genome evolution at the genus level: comparison of three complete genomes
of hyperthermophilic archaea. Genome Res 11: 981-993
Ledoux P, Scriver CR, Hechtman P (1996) Expression and molecular analysis of mutations
in prolidase deficiency. Am J Hum Genet 59: 1035-1039
139 Lowther WT, Matthews BW (2002) Metalloaminopeptidases: common functional themes in
disparate structural surroundings. Chem Rev 102: 4581-4608
Lupi A, Della Torre S, Campari E, Tenni R, Cetta G, Rossi A, Forlino A (2006) Human
recombinant prolidase from eukaryotic and prokaryotic sources. Expression,
purification, characterization and long-term stability studies. FEBS J 273: 5466-5478
Maeder DL, Weiss RB, Dunn DM, Cherry JL, Gonzalez JM, DiRuggiero J, Robb FT (1999)
Divergence of the hyperthermophilic archaea Pyrococcus furiosus and P. horikoshii
inferred from complete genomic sequences. Genetics 152: 1299-1305
Maher MJ, Ghosh M, Grunden AM, Menon AL, Adams MW, Freeman HC, Guss JM (2004)
Structure of the prolidase from Pyrococcus furiosus. Biochemistry 43: 2771-2783
Meng L, Ruebush S, D'Souza V M, Copik AJ, Tsunasawa S, Holz RC (2002) Overexpression
and divalent metal binding properties of the methionyl aminopeptidase from
Pyrococcus furiosus. Biochemistry 41: 7199-7208
Mittal S, Song X, Vig BS, Amidon GL (2007) Proline prodrug of melphalan targeted to
prolidase, a prodrug activating enzyme overexpressed in melanoma. Pharm Res 24:
1290-1298
Mittal S, Song X, Vig BS, Landowski CP, Kim I, Hilfinger JM, Amidon GL (2005)
Prolidase, a potential enzyme target for melanoma: design of proline-containing
dipeptide-like prodrugs. Mol Pharm 2: 37-46
Schut GJ, Brehm SD, Datta S, Adams MW (2003) Whole-genome DNA microarray analysis
of a hyperthermophile and an archaeon: Pyrococcus furiosus grown on carbohydrates
or peptides. J Bacteriol 185: 3935-3947
140 Studier FW (2005) Protein production by auto-induction in high density shaking cultures.
Protein Expr Purif 41: 207-234
Suga K, Kabashima T, Ito K, Tsuru D, Okamura H, Kataoka J, Yoshimoto T (1995)
Prolidase from Xanthomonas maltophilia: purification and characterization of the
enzyme. Biosci Biotechnol Biochem 59: 2087-2090
Theriot CM, Tove SR, Grunden AM (eds) (2009) Biotechnological Applications of
Recombinant Microbial Prolidases. Academic Press, New York
Walker KW, Bradshaw RA (1998) Yeast methionine aminopeptidase I can utilize either Zn2+
or Co2+ as a cofactor: a case of mistaken identity? Protein Sci 7: 2684-2687
Willingham K, Maher MJ, Grunden AM, Ghosh M, Adams MW, Freeman HC, Guss JM
(2001) Crystallization and characterization of the prolidase from Pyrococcus furiosus.
Acta Crystallogr D Biol Crystallogr 57: 428-430
Yang SI, Tanaka T (2008) Characterization of recombinant prolidase from Lactococcus
lactis- changes in substrate specificity by metal cations, and allosteric behavior of the
peptidase. FEBS J 275: 271-280
Ye QZ, Xie SX, Ma ZQ, Huang M, Hanzlik RP (2006) Structural basis of catalysis by
monometalated methionine aminopeptidase. Proc Natl Acad Sci U S A 103: 9470-
9475
141
Table 3-1 Substrate specificity of recombinant P. furiosus and P. horikoshii prolidases with different dipeptides Relative Activity (%) Substrate Pfprol* Phprol Ph1prol
Met-Pro 100 100 100 Leu-Pro 79 71 74 Gly-Pro 1 10 8 Ala-Pro 17 8 40 Arg-Pro 10 10 27 Phe-Pro 24 15 31 Pro-Ala 0 2 4
Prolidase assays contained prolidase (14.8 ng of Phprol and 6.2 ng Ph1prol), CoCl2 (1.2 mM) and 4 mM of each substrate. 100% activity can be seen with Met-Pro and correlates to an activity of 1350 U/mg for Pfprol, 1824 U/mg for Phprol and 2751 U/mg for Ph1prol. *Results are taken from previous paper: Ghosh et al. 1998.
142
Table 3-2 Kinetic parameters of prolidases from P. furiosus and P. horikoshii.
Prolidase Substrate Km Vmax kcat kcat / Km (mM) ( mol/min/mg) (s-1) (mM-1 s-1)
N-Pfprol* Met-Pro 2.8 645 271 97
R-Pfprol* Met-Pro 3.3 1250 525 159
Phprol Met-Pro 3.4 3997 2617 768
Ph1prol Met-Pro 1.9 5714 3812 2006
All assays were done at 100 C in 50 mM Mops pH 7.0 with CoCl2 (0.2 mM). N-Pfprol and R-Pfprol represent the native and recombinant P. furiosus prolidase. *Results are taken from Ghosh et al. 1998.
143
Table 3-3 Effect of metal ions on Ph1prol activity Metal ions added in the assay Specific Activity (U/mg)
Metal Reconstitution Conditions
WT-Ph1prol apo-Ph1prol Co-Ph1prol Mn-Ph1prol Zn-Ph1prol Co/Mn- Co/Zn Ph1prol Ph1prol
Co2+ 4778 2605 4688 5352 2652 4903 3407 646 1277 37 230 357 547 345
Mn2+ 1741 1737 2035 2320 1153 2527 1668 196 62 130 35 214 81 485
Zn2+ 63 25 33 28 24 33 39 52 1 0.1 1 5 1 5
Table 3-4 Effect of metal ions on Phprol activity Metals ions added in the assay Specific Activity (U/mg)
Metal Reconstitution Conditions
WT-Phprol apo-Phprol Co-Phprol Mn-Phprol Zn-Phprol Co/Mn- Co/Zn Phprol Phprol
Co2+ 2174 4112 3615 3756 2080 4064 4421 384 119 192 168 310 37 197
Mn2+ 818 513 725 901 705 670 831 129 140 93 75 89 23 31
Zn2+ 9.6 N.D. N.D. N.D. N.D. N.D. N.D. 6 N.D. not detected
All assays were done at 100 C in 50 mM Mops pH 7.0 with the addition of CoCl2 (0.2 mM), MnCl2 or ZnCl2 (1.2 mM). Prolidase was stripped of metal by dialysis in 50 mM Mops buffer (pH 7.0) containing 5 mM EDTA. Metal reconstitution was done using 2.5-5 molar equivalents of metal per subunit with the following metal or metal combinations: Co2+, Mn2+, Zn2+, Co2+/Mn2+, and Co2+/Zn2+. Apo-Phprol and apo-Ph1prol were subjected to the reconstitution incubation at 80°C as were the metal reconstituted enzymes; however with no metal added.
144
Fig. 3-1: Clustal alignment of P. horikoshii prolidase (PH1149) and prolidase homolog 1
(PH0974) and 2 (PH1902) along with previously characterized P. furiosus prolidase
(PF1343), and other characterized prolidases from Alteromonas OPAA-2 (AAB05590),
Lactobacillus delbrueckii (CAB07978), Human (AAA60064), and E. coli (P15034). Gray shading designates identical and similar residues. Asterisks indicate the 5-conserved residues in the prolidases identifying the dinuclear cobalt metal-binding sites.
145
Fig. 3-2: Activity of P. horikoshii prolidases over a pH range of 4.0 – 10.0. Prolidase assays contained 14.8 ng for Phprol and 6.2 ng Ph1prol, Met-Pro (4 mM) and CoCl2 (1.2 mM). The following buffers were used for each pH at a final concentration of 100 mM: pH 5.0,
Sodium Acetate; pH 6.0 – 8.0, MOPS; pH 9.0, CHES; pH 10.0, CAPS. 100% specific activity corresponds to 2321 U/mg for Phprol and 3357 U/mg for Ph1prol.
146
Fig. 3-3: Activity of P. horikoshii prolidases with different divalent cations: Co2+, Mn2+,
Cu2+, Fe2+, Zn2+, and Ni2+. Prolidase assays contained 14.8 ng for Phprol and 6.2 ng
Ph1prol, Met-Pro (4 mM) and metals (1.2 mM). 100% specific activity correlates to 2321
U/mg for Phprol and 2751 U/mg for Ph1prol.
147 A.
B.
Fig. 3-4: The effects of metal ion concentrations of Co2+ and Mn2+ on activities of purified
Phprol (A) or Ph1prol (B). The reactions contained Met-Pro (4 mM) and 7.4 ng of enzyme when assayed with Co2+ and 14.8 ng of enzyme with Mn2+.
148
Table 3-1S Metal content of purified prolidases from P. horikoshii Phprol Ph1prol Metal Metal Content (g-atom/subunit) Co < 0.001 < 0.001 Fe 0.055 0.152 Mn 0.009 < 0.001 Zn 0.268 1.14
149
Table 3-2S Metal Reconstitution Assay under Anaerobic conditions Relative Activity (%) Metal Phprol Ph1prol
Fe 100 100 Co 32 30 Zn 1 0
Purified prolidase was stripped of metal with EDTA. Metal reconstitution was done by adding 3 molar equivalents of metal per subunit of protein. Incubation was done at 80 C for 15 minutes followed by the enzyme assay under anaerobic conditions. Prolidase assays contained 5 ng of Phprol and Ph1prol, 1.2 mM of metal and 4 mM of Met-Pro. 100% activity correlates to a specific activity of 2371 U/mg for Phprol and 1357 U/mg for Ph1prol with the metal Iron.
150
A.
B.
151
Fig. 3-1S: (A) Representative Phprol and Ph1prol specific activities throughout the purification process. (B) SDS 12.5% polyacryalmide gel electrophoresis showing purified
P. horikoshii prolidases, Phprol and Ph1prol (1 g). Molecular marker includes (kDa): myosin (200), -galactosidase (116), phosphorylase b (97), serum albumin (66.2), ovalbumin
(45), carbonic anhydrase (31), and trypsin inhibitor (21.5).
152
Fig. 3-2S: Activity of P. horikoshii prolidases resulting from incubating the reaction assays at temperatures ranging from 40 – 100 C. Prolidase assays contained 14.8 ng for Phprol and
6.2 ng Ph1prol, Met-Pro (4 mM) and CoCl2 (1.2 mM). 100% specific activity corresponds to
1938 U/mg for Phprol and 2355 U/mg for Ph1prol.
153
Fig. 3-3S: Activity of P. horikoshii prolidases under anaerobic conditions with different divalent cations. Prolidase assays contained 5 ng of each enzyme when assayed with Co2+ and Fe2+ or 500 ng for the assay with Zn2+.
154
APPENDIX
155
Screening Pyrococcus horikoshii Prolidase (Ph1prol) Mutants for Increased Activity over a Broad Range of Temperature with OP Nerve Agents
Abstract
Prolidases hydrolyze the unique bond between X-Pro dipeptides and can also cleave the P-F and P-O bonds found in organophosphorus (OP) compounds, including the nerve agents, soman and sarin. Ph1prol (PH0974) has previously been isolated and characterized from Pyrococcus horikoshii. It is an active prolidase with properties that may be beneficial for applications involving detoxification of OP nerve agents such as having higher catalytic activity over a broader pH range, higher affinity for metal, and being more stable than P. furiosus prolidase, Pfprol (PF1343). To obtain a better enzyme for organophosphorus nerve agent decontamination and to investigate the structural factors that may influence protein thermostability and thermoactivity, randomly mutated P. horikoshii prolidases were prepared by using an error prone PCR strategy. An Escherichia coli strain JD1 ( DE3) (auxotrophic for proline [ proA] with deletions in pepQ and pepP dipeptidases with specificity for proline-containing dipeptides) was constructed for screening mutant P. horikoshii prolidase expression plasmids. JD1 ( DE3) cells were transformed with mutated prolidase expression plasmids and were plated on minimal media supplemented with 5 M Leu-Pro as the only source of proline and grown at 20°C. Four cold-adapted variants, P. horikoshii
A195T/G306S-, Y301C/K342N-, E127G/E252D- and E36V-prolidase, were isolated. These mutants exhibited 2-3 times higher activity at 30°C than the WT-Ph1prol in heat-treated cell
156 extract. Large-scale expression of each mutant was accomplished using recombinant BL21
( DE3) E. coli cells grown in autoinduction media. The mutant Ph1prol enzymes will be purified using multi-column chromatography, and their activities against the OP nerve agent diisopropylfluorophosphate (DFP) will be determined. Those mutants that show increased activity against DFP compared to wild type Ph1prol or Pfprol will be fully biochemically characterized.
A.1 Introduction
Prolidases are being studied for their use in applications for chemical warfare agent
(CWA) detoxification and response decontamination. An enzyme that has previously been well studied for detoxification of nerve agents is OPAA or Organophosphorus Acid
Anhydrolase (Cheng et al. 1999; Cheng et al. 1998). Recently, the crystal structure of OPAA from Alteromonas sp. JD6.5 strain has been solved, and it has been determined to be a prolidase (Vyas et al. 2010).
Pyrococcus prolidases from P. furiosus (PF1343 or Pfprol) and P. horikoshii
(PH1149 or Phprol and PH0974 or Ph1prol) have been well characterized both structurally and enzymatically (Jeyakanthan et al. 2009; Maher et al. 2004; Theriot et al. 2009). The
Pyrococcus prolidases are very similar, with Pfprol showing 88% amino acid similarity to
Phprol and 55% similarity to Ph1prol. Although they show high similarity to each other, the kinetic properties of Ph1prol look to be more favorable for application purposes than are
Pfprol and Phprol. Ph1prol has demonstrated higher activity at lower temperatures and over
157 a broader pH range. It has long term stability and has higher affinity to substrates and lower metal requirement for catalysis (Theriot et al. 2009). Therefore, it would be advantageous to use Ph1prol in future mutagenesis studies in order to create a better enzyme for OP nerve agent detoxification and to further investigate factors that influence the catalysis of thermophilic metalloenzymes.
A.2 Methods and Materials
Bacterial strains, media and materials
The E. coli K-12 derivative NK5525 (proA::Tn10) was used to construct the selective strain
JD1( DE3) for screening of cold-adapted P. horikoshii prolidase variants. The P. horikoshii prolidase expression plasmid pET-Ph1prol was previously constructed as described in
Theriot et al, 2009 (Ch. 3). Bacteria were cultured either in Luria-Bertani (LB) broth or M9 selective minimal medium supplemented with 0.2% glucose, 1 mM MgSO4, 0.05% VitB1,
20 M IPTG, 20 M Leu-Pro. Ampicillin (100 g/ml), kanamycin (50 g/ml), chloramphenicol (34 g/ml) and tetracycline (6 g/ml) were added into the medium when required. Construction of selective strain JD1 ( DE3) was previously described in Theriot et al. 2010 (Ch. 2).
158
Construction of a pool of pET-Ph1prol plasmids encoding randomly mutated P. horikoshii prolidase genes
Error-prone PCR mutagenesis using the Genemorph II Random mutagenesis kit (Stratagene,
La Jolla, CA) was used to amplify and insert mutations into the P. horikoshii prolidase gene
(PH0974). PCR amplification was carried out for 30 cycles: (60s at 95°C, 60s at 55°C, 120s at 72°C), with a 10-minute final extension at 72°C. Reactions contained Mutazyme II reaction buffer, 125 ng/µl of each primer, 40 mM dNTP mix, and 2.5 U of Mutazyme II
DNA polymerase. Initial DNA template amounts used were 250 ng and 750 ng in order to select for medium to low mutation rates, respectively. The Genemorph II EZClone
(Stratagene, La Jolla, CA) reaction was employed to clone the mutated prolidase gene into the expression vector pET-21b.
The EZClone reaction included, EZClone enzyme mix, 50 ng of template plasmid
(pET-prol), 500 ng of megaprimer (mutated prolidase PCR product), and EZClone solution.
The reaction was run for 25 cycles: (50s at 95°C, 50s at 60°C, 14min at 68°C). Reactions were digested with Dpn I for 2 hours at 37°C to remove template plasmid. XL1-Gold supercompetent E. coli cells were transformed with the mutant plasmid mixture.
Screening for increased activity at low temperature
pET-Ph1prol plasmids from the mutant P. horikoshii library were transformed into the selective strain JD1( DE3) and were plated on M9 selective agar plates. Colonies that grew
159 after being incubated for 3-7 d at 20 C were isolated on LB plates and then grown in 10 ml
LB medium at 37°C with shaking (200 rpm) until an optical density of 0.6-0.8 was reached.
IPTG was then added to the cell culture to a final concentration of 1 mM. The induced culture was shaken at 37 C for 3 h before harvesting the cells. These cell pellets were lysed using 300 l of B-per buffer (Thermo Scientific, Rockford, IL), and the resulting cell extracts were used for enzyme activity assays conducted at 30 C and at 100 C. Heat-treated soluble protein samples were heated at 80 C for 20 min. Mutant colonies that exhibited at least 2-3 fold higher activities compared to the cells expressing the wild type P. horikoshii prolidase were selected, and their plasmids were isolated. The prolidase genes present in the isolated plasmids were subsequently sequenced using the T7 promoter and T7 terminator primers
(Operon, Huntsville, AL).
Large-scale expression of recombinant P. horikoshii prolidase mutants
Production of P. horikoshii prolidase variants (A195T/G306S-, Y301C/K342N-,
E127G/E252D- and E36V-prolidase) was carried out in transformed E. coli BL21 ( DE3) with the appropriate pET-prol plasmid and pRIL vector. The transformants were grown in 1
L cultures of autoinduction media (Studier 2005) incubated at 37 °C with shaking (200 RPM) overnight.
160 Prolidase activity assay
The enzyme activity assay used was based on a previously described method in Theriot et al,
2010 (Ch. 2). Briefly, the assay mixture (500 µl) contained 50 mM MOPS buffer (3-[N- morpholino]propanesulfonic acid), 200 mM NaCl pH 7.0, 4 mM Xaa-Pro (substrate), 5%
(vol/vol) glycerol, 100 µg/ml BSA protein, and 1.2 mM CoCl2 and was incubated at the testing temperature for 5 min. The reaction was initiated by addition of the enzyme. The mixture was incubated at the same testing temperature for 10 min, and the reaction was stopped by the addition of glacial acetic acid (500 µl) followed by the ninhydrin reagent (500
µl). Color development was achieved by heating the reaction mixture at 100 °C for 10 min.
The solution was cooled to 23°C, and the absorbance was determined at 515 nm. Specific activities were calculated using the extinction coefficient of 4,570 M-1·cm-1 for the ninhydrin- proline complex.
Organophosphorus nerve agent enzymatic assays
DFP (diisopropylfluorophosphate) Assay
The method used was previously described in DeFrank and Cheng, 1991 (DeFrank and
Cheng 1991). The hydrolysis of DFP by prolidases was measured by monitoring fluoride release with a fluoride specific electrode. Assays were performed at 35 C and 50 C, with continuous stirring in 2.5 ml of buffer (50 mM MOPS, 200 mM NaCl, pH 7.0), 0.2 mM
CoCl2 and 3 mM DFP. The enzyme and metal were incubated at the reaction temperature 5 min prior to the start of the reaction. The background of DFP hydrolysis was measured by
161 running a reaction without enzyme present at 35 C and 50 C. The background hydrolysis of
DFP was subtracted from enzymatic hydrolysis to determine specific activity of the enzyme.
p-Nitrophenyl Soman Assay (O-Pinacolyl p-Nitrophenyl Methylphosphonate Activity)
Prolidase hydrolysis of p-nitrophenyl soman was monitored by accumulation of p- nitrophenyl (Hill et al. 2001; Vyas et al. 2010). Two ml reaction assays contained buffer (50 mM MOPS, 200 mM NaCl, pH 7.0), 0.2 mM CoCl2, and 3 mM p-nitrophenyl soman. The reactions were conducted at three different temperatures (35 C, 50 C and 70 C). The enzyme and metal were incubated at the specified reaction temperature 5 min prior to the start of the reaction. Absorbance of the product p-nitrophenylolate was measured at 405 nm over a 5 min range. To calculate activity, the extinction coefficient for p-nitrophenolate of
10,101 M-1 cm-1 was used.
A.3 Results and Discussion
Pyrococcus prolidases specific activities with substrates Met-Pro and OP nerve agents DFP and soman analog
When comparing previously characterized Pfprol (PF1343) and Ph1prol (PH0974) against substrate Met-Pro from temperatures 10°C-100°C, Ph1prol showed improved activity at all temperatures (Fig. A-1). This was especially evident at the lower temperature range from
35°C-50°C where Ph1prol showed a two-fold increase in activity over Pfprol.
162 Figure A-2 shows the relative activity with another prolidase substrate, DFP, an OP nerve agent, which again exhibited the greatest hydrolysis with Ph1prol. Ph1prol had a relative activity that was 843% higher than Pfprol and 817% higher than Phprol at 35°C and
1870% higher than both Pfprol and Phprol at 50°C (Table A-1). The trends with the soman analog were very different as shown in Figure A-3. The relative activity of Ph1prol fell to
70%, 63% and 68% of Pfprol activity at 35°C, 50°C and 70°C, respectively (Table A-2).
Ph1prol prefered the substrate DFP and did not show high activity with the soman analog.
Differences in the protein structures could play a role in the substrate preference since Pfprol and Ph1prol share only 55% amino acid residue similarity. By altering the Ph1prol structure further by random mutagenesis we hope to select for Ph1prol variants that show increased hydrolysis of DFP and also improve the soman activity.
Screening and isolation of the Ph1prol mutant population using proline auxotrophic strain
JD1 (λDE3)
Since Ph1prol showed the most favorable properties including higher activity with DFP, it was selected for further mutagenesis using an error prone PCR strategy, which incorporates a mutated polymerase. Transformed JD1 (λDE3) cells were used to select for Ph1prol variants on minimal media plates that were supplemented with Leu-Pro and grown at 20°C. Colonies that were visible in 3-7 d were plated on minimal and rich media plates. Ph1prol variants were screened by small-scale expression in 10 ml cultures using IPTG. Four Ph1prol variants, 10, 19, 35 and 72, were isolated and both the soluble and heat-treated crude extract
163 were assayed with Leu-Pro (Fig. A-4). Mutants 10 and 19 showed 2-3 times the activity of
WT in the soluble fractions at 30°C (Fig. A-4A), whereas mutants 35 and 72 showed higher activity than WT, but not two-fold higher. For the soluble fractions at 100°C (Fig. A-4B), mutant 10 was almost two-fold higher than wild type, while mutants 19, 35 and 72 showed decreased activity at 100°C. The heat-treated soluble crude extract showed 2-fold higher activity for all of the mutants compared to wild type. The increased activity at the lower temperature of 30°C and variation at the higher temperature of 100°C is indicative of a mutation in a thermophilic protein, which can compromise activity or stability at higher temperatures, but could create more flexibility and increased catalysis at the lower temperatures.
Large-scale expression of Ph1prol variants
Large-scale expression was done using autoinduction media in BL21 (λDE3) cells. Small culture samples (1 ml) were taken after induction, and the cells were disrupted with B-per buffer. Both soluble and heat-treated fractions were analyzed by SDS-PAGE to validate expression of Ph1prol variants prior to purification (Fig. A-5).
Sequencing of Ph1prol mutants 10, 19, 35 and 72
Ph1prol mutants 10, 19, 35, and 72 were selected for sequencing after showing two-fold higher activity with Leu-Pro at 30°C as compared to wild type. Mutant 10 has two
164 mutations: one at position 195 in which there is a change from alanine to threonine (A195T) and the second at amino acid residue 306 in which glycine is changed to serine (G306S).
Both of these mutations reside in the C-terminal region of Ph1prol (Fig. A-6). Mutant 19 has two mutations: one at position 301 in which there is a change from tyrosine to cysteine
(Y301C) and the second at amino acid residue 342 which has a substitution of lysine with an asparagine (K342N). Both of these mutations are in the C-terminal region of the enzyme.
Mutant 35 contains two mutations one at position 127, which is in the α-helical linker region, in which there is a change from glutamate to glycine (E127G) and the second in the C- terminal region at position 252 with a substitution of glutamate for aspartate (E252D).
Mutant 72 is the only mutation in the N-terminal region at position 36 with a change from glutamate to valine (E36V) in Ph1prol.
Future directions
Ph1prol variants will be purified and evaluated with substrates DFP and soman analog to determine if there are any changes in substrate specificity. The hope of this study is to identify alternative amino acid residues that are important for low temperature adaptation.
We also hope to develop a better enzyme for OP nerve agent detoxification that could be used in future enzyme cocktail applications that are both highly active and stable over broad temperatures and under harsh conditions.
165 References Cited
Cheng TC, DeFrank JJ, Rastogi VK (1999) Alteromonas prolidase for organophosphorus G-
agent decontamination. Chem Biol Interact 119-120: 455-462
Cheng TC, Rastogi VK, DeFrank JJ, Sawiris GP (1998) G-type nerve agent decontamination
by Alteromonas prolidase. Ann N Y Acad Sci 864: 253-258
DeFrank JJ, Cheng TC (1991) Purification and properties of an organophosphorus acid
anhydrase from a halophilic bacterial isolate. J Bacteriol 173: 1938-1943
Hill CM, Li WS, Cheng TC, DeFrank JJ, Raushel FM (2001) Stereochemical specificity of
organophosphorus acid anhydrolase toward p-nitrophenyl analogs of soman and sarin.
Bioorg Chem 29: 27-35
Jeyakanthan J, Takada K, Sawano M, Ogasahara K, Mizutani H, Kunishima N, Yokoyama S,
Yutani K (2009) Crystal Structural and Functional Analysis of the Putative
Dipeptidase from Pyrococcus horikoshii OT3. J Biophys 2009: 434038
Maher MJ, Ghosh M, Grunden AM, Menon AL, Adams MW, Freeman HC, Guss JM (2004)
Structure of the prolidase from Pyrococcus furiosus. Biochemistry 43: 2771-2783
Studier FW (2005) Protein production by auto-induction in high density shaking cultures.
Protein Expr Purif 41: 207-234
Theriot CM, Tove SR, Grunden AM (2009) Characterization of two proline dipeptidases
(prolidases) from the hyperthermophilic archaeon Pyrococcus horikoshii. Appl
Microbiol Biotechnol 86: 177-188
166 Vyas NK, Nickitenko A, Rastogi VK, Shah SS, Quiocho FA (2010) Structural insights into
the dual activities of the nerve agent degrading organophosphate
anhydrolase/prolidase. Biochemistry 49: 547-559
167
Table A-1: Specific activity of recombinant Pyrococcus prolidases with OP nerve agent DFP
35 C Relative Activity 50 C Relative Activity (%) (%) Prolidases Ph1prol 3.96 943 14.4 1970 Phprol 0.53 126 0.76 104 Pfprol 0.42 100 0.73 100 Specific activity of DFP is in moles product formed/min/mg. Relative activity (%) is also represented compared to Pfprol. All assays contained 50 mM MOPS 200 mM NaCl pH 7.0, 0.2 mM CoCl2, and 3 mM for DFP. All assays were done in triplicate.
Table A-2: Specific activity of recombinant Pyrococcus prolidases with p-nitrophenyl somana
35 C Relative 50 C Relative 70 C Relative Activity Activity Activity Prolidases (%) (%) (%)
Ph1prol 0.16 70 0.19 63 0.34 68 Phprol 0.19 83 0.31 103 0.55 110 Pfprol 0.23 100 0.30 100 0.50 100 Specific activity of aO-pinacolyl p-nitrophenyl methylphosphonate is in moles product formed/min/mg. Relative activity (%) is also represented compared to Pfprol. All assays contained 50 mM MOPS 200 mM NaCl pH 7.0, 0.2 mM CoCl2, and 3 mM for p-nitrophenyl soman. All assays were done in duplicate.
168
4000 400 Pfprol (PF1343) 300 Ph1prol (PH0974) 3000 200
100
2000 0 10 20 35 50
1000 Specific Activity (U/mg) Activity Specific 0
10 20 35 50 70 100 Temperature (Celsius)
Figure A-1: Specific activity of WT-Pfprol and WT-Ph1prol with Met-Pro (4 mM) and
CoCl2 (1.2 mM) at temperatures ranging from 10 C-100 C.
169
2500 Pfprol (PF1343) 2000 Phprol (PH1149) Ph1prol (PH0974) 1500
1000
500 Relative Activity (%) Activity Relative 0
35 50 Temperature (Celsius)
Figure A-2: Relative activity with WT-Pfprol and P. horikoshii prolidases with OP nerve agent DFP. All prolidase assays contained 50 mM MOPS, 200 mM NaCl, pH 7.0, 0.2 mM
CoCl2, and 3 mM DFP. 100% relative activity corresponds to WT-Pfprol specific activity for DFP of 0.42 µmoles product formed/min/mg at 35 C and 0.73 µmoles product formed/min/mg at 50 C.
170
150 Pfprol (PF1343) Phprol (PH1149) Ph1prol (PH0974) 100
50 Relative Activity (%) Activity Relative 0
35 50 70 Temperature (Celsius)
Figure A-3: Relative activity with WT-Pfprol and P. horikoshii prolidases with the OP nerve agent analog, p-nitrophenyl soman. All prolidase assays contained 50 mM MOPS, 200 mM NaCl, pH 7.0, 0.2 mM CoCl2, and 3 mM p-nitrophenyl soman. 100% relative activity corresponds to WT-Pfprol specific activity of p-nitrophenyl soman of 0.23 µmoles product formed/min/mg at 35 C, 0.3 µmoles product formed/min/mg at 50 C and 0.5 µmoles product formed/min/mg at 70 C.
171
30 C Soluble 100 C Soluble 80 5000
4000 60 3000 40 2000 20
1000
Specific Activity (U/mg) Activity Specific Specific Activity (U/mg) Activity Specific 0 0
WT 10 19 35 72 WT 10 19 35 72 Ph1prol mutants Ph1prol mutants A. B.
Figure A-4: Screening of Ph1prol mutant prolidases after expression in
BL21 (λDE3). Prolidase activity assays 30 C Heat-treated were done with Leu-Pro (4 mM) and 15
CoCl2 (1.2 mM) 10 A. Specific activity of soluble fractions 5
of WT-Ph1prol and mutant prolidases at Specific Activity (U/mg) Activity Specific 30°C 0
WT 10 19 35 72 B. Specific activity of the soluble Ph1prol mutants C. fraction at 100°C
C. Specific activity of heat-treated fraction at 30°C
172
250 150 100
75
50
37
25
20 1 2 3 4 5 6 7 8 9
Figure A-5: SDS-PAGE showing over expression of mutant Ph1prol variants in E. coli
strain BL21 (λDE3) using autoinduction media. Lane 1: molecular marker (kDa); 2: Mutant
10 (A195T/G306S-Ph1prol) soluble fraction (S) from crude extract; 3: from heat-treated
(HT) fraction 4: Mutant 19 (Y301C/K342N-Ph1prol) S fraction; 5: from HT fraction; 6:
Mutant 35 (E127G/E252D-Ph1prol) S fraction; 7: from HT fraction; 8: Mutant 72 (E36V-
Ph1prol) S fraction; 9: from HT fraction. Approximate size of Ph1prol is 40 kDa.
173
N-domain
C-domain
Figure A-6: Mapping of the mutations in the monomer structure of P. horikoshii prolidase
(Ph1prol or PH0974). Mutations made in the Ph1prol are indicated by red circles and include E36V, E127G, A195T, E252D, Y301C, G306S and K342N. Ribbon drawing of the domain structure of Ph1prol where the N-terminal (residues 1-120) and C-terminal (131-356) domains are labeled with a α-helical linker at residues 121-130 (modified from Jeyakanthan et al. 2009).
174