sign in sign up
<<
Home , Bartonella alsatica, Bartonella doshiae, Bartonella grahamii, Bartonella talpae, Bordetella ansorpii, Helicobacter bilis

US 20150376685A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2015/0376685 A1 LiPuma et al. (43) Pub. Date: Dec. 31, 2015

(54) METHOD FOR BACTERAL Publication Classification IDENTIFICATION AND STRAIN TYPNG (51) Int. Cl. (71) Applicant: The Regents of the University of CI2O I/68 (2006.01) Michigan, Ann Arbor, MI (US) G06F 9/14 (2006.01) (52) U.S. Cl. (72) Inventors: John LiPuma, Ann Arbor, MI (US); CPC ...... CI2O I/689 (2013.01); G06F 19/14 Theodore Spilker, Ann Arbor, MI (US) (2013.01) (57) ABSTRACT (21) Appl. No.: 14/752,391 The present disclosure describes a method for identifying a strain or species of using a single locus sequence (22) Filed: Jun. 26, 2015 typing technique. The single locus useful in the method is the promoter region of the 16S rRNA operon. The method is Related U.S. Application Data useful to identify infectious bacteria in a subject, to identify (60) Provisional application No. 62/018,211, filed on Jun. ing contaminants in a food source, as well as strain typing and 27, 2014. genetic fingerprinting of bacterial families. Patent Application Publication Dec. 31, 2015 Sheet 1 of 4 US 2015/0376685 A1

Input 204

208

Predictability Database Measurement TOO 206

214

Medical ProtoCO Analysis Routine Database 210

216

Conclusion Medical ProtoCO ROutine

212 COmmuniCation Protocol

Communication

Human Subject ( > Medical practitioner 2OO or Worker 2O2

FIG. I. Patent Application Publication Dec. 31, 2015 Sheet 2 of 4 US 2015/0376685 A1

Figure 2 Reference Strain Ribosomal Predicted copy number copy Achronobacter A. xylosoxidans-C54 3 1B Acidovorax A. avenae spp. Citrulli-AAC00-1 3 3A Acinetobacter A. baunani-AYE 6 5A.B. D A. pleuropneumoniae-JL03 6 6A, B, C, D Aeromonas A. hydrophila-ATCC 7966 10 3C Aggregatibacter A. aphrophilus-NJ8700 6 3C Agrobacterium A. tunifaciens-C58 4 3B, C (C2) Anaplasma A. marginale-str. Florida 1. 1B Amycolatopsis A. mediterranei-S699 4 4A, B, D Alcanivorax A. borkumensis-SK2 3 1A Alicyclobacillus A. acidocaidarius-DSM 446 6 1A, C Arcobacter A. nitrofigilis-DSM 7299 4 3A, B, D Azospirillum A. lipoferum-4B 9 2A, B, D Bacteroides B. fragilis-NCTC 9343 6 3A, C B. Ceres-ATCC 10987 12 3A, B, D B. henselae-Houston-l 2 1A Bifidobacterium B. dentium-Bal 4 3A, B B. bronchiseptica-RB50 3 1B Borrelia B. burgdorferi-B31 1. 1A, D Brachyspira B. pilosicoli-B2904 1 1B Bradyrhizobium B. japonicum-USDA 110 1 1B, D Brucella B. Suis-1330 3 2B Buchnera B. aphidicola-APS 1. 1A, D Burkholderia B. cenocepacia-AU 1054 6 2A, B, D Campylobacter C. jejuni-NCTC 11168 3 2A, B, D Ca. Phytoplasma asteris C. asteris-AYWB 2 1A, D C. trachomitis-434/Bu 2S A, B, D Chlamydophila C. -AR 39 1 1A, B, D Chlorobaculum C. tepidum-TLS 2 2A, D Chlorobium C. lumicola-DSM 245 2 1A, D Citrobacter C. rodentium-ICC 168 7 4A, B, C, D C. prefingens-ATCC 13124 8 8A, B C. diphtheriae-241 5 3B, C, D Coxiella C. burnetii-RSA 493 1A Cupriavidus C. taiwanensis-LMG 19424 5 3A, B DeinoCOCCus D. radiodurans-R1 3 1A, D Desulfovibrio D. desulfitricans-ATCC 27774 3. 1B, D Erlichia E. canis-Jakc 1A, D Enterobacter E. cloacae- ATCC 13047 8 1A, B, C, D Ensifer (Sinorhizobium) E. meliloti-1021 3 1B EnterOCOccus E. faecalis-V583 4 2B, C, D Patent Application Publication Dec. 31, 2015 Sheet 3 of 4 US 2015/0376685 A1

Figure 2 (cont'd) Genus Reference Strain Ribosomal Predicted copy number Copy Erwinia E. amylovora-ATCC 49946 7 5A, B, D Escherichea E. Coli-UTI89 7 1A, B, C, D Eubacterium E. rectale-ATCC 33.656 5 2A Flavobacterium F. branchiophilum-FL-15 3 A. B. D Geobacillus G. kaustophilus-HTA426 9 2. Gluconacetobacter G. diazotrophicus-PAI 5 4 4C Gordonia G. bronchialis-DSM 43247 2 2D H. influenza-pittEE 6 4D H. pylori-J99 2 2A Herihaspirillum H. seropedicae-SmR1 3 2B, C Herminimonas H. arsenicoxydans-NC 009 138 2 1B Janthinobacterium Janthinobacterium sp.-MarScille 2 1B Klebsiella K. pneumonia-MGH 78578 8 5A, B, C, D Lactobacillus L. acidophilus-NCFM 4 2A, B LactococcuS L. lactis-KF147 6 6B, C L. pneumophilia-Str. Paris 3 1A, B. D Leptospira L. biflexia-Patoc i Paris 2 2A, B, D LeutCOno Stoc L. gasicomitatum-LMG 18811 4 A, B Listeria L. monocytogenes-4b F23.65 6 3A, B, C Marinobacter M. adhaerens-HP15 3 1A.D Mesorhizobium M. lot-MAFF303099 2 1B, C Methylibium M. petroleiphilum-PMI l B(rubrivivax) Methylobacterium M. extorquens-PA1 5 43, D Mycobacterium M. leprae-TN 1 1B, D M. hyopneumoniae-J 1 1B Neisseria N. gonorrhoeae-FA 1090 4 B N. Risticii-Illinois 1B Nocardia N. farcinica-IFM 10152 3 2A, B, D Nocardiopsis N. alba ATCC BAA-2 165 5 3A, B. D Ochrobactrum O. anthropi-ATCC 49188 4 1B Paenibacillus P. polymyxia-E681 1 1B Pantoea P. dnancitis-LMG 20103 6 6A, B, D Pasturella P. multocida-Pnm70 6 6A, C PrevOtella P. denticolat-F0289 4 3A, B, D Prochlorococcus P. nitrinus-MIT 93 13 2 2A Propionibacterium P. acidipropionici-ATCC 4875 4 2D Pseudomonas P. aeruginosa-PA7 4 1A, B, D Psychrobacter P. articus-273-4 4 1A, B Ralstonia R. Solanacearum-GMI1000 3 1A. B. D Rhizobium R. elfi-CFN 42 3 23 Rhodococcus R. jostii-RHA1 4 4B, D R. rickettsii-Iowa l 1B Patent Application Publication Dec. 31, 2015 Sheet 4 of 4 US 2015/0376685 A1

Figure 2 (cont'd) Genus Reference Strain Ribosomal Predicted copy number copy Rubrivivax R. gelatinosus-IL144 3B Salmonella S. enterica Subsp. typhi-CT18 5A, B, C, D Serratia S. marces Cens-WW4 1A, B, D Shewanella S. putrefaciens-CN 32 6A, B, C, D Shigella S. dysenteriae-Sd197 4A, B, C, D Sphingobium S. chlorophenolicum-L-1 1A, B, D Sphingomonas S. wittichii-RW1 1B Spirochaeta S. COCCOides- DSM 17374 A, B, D Spiroplasma S. taiwanense-CT-1 1. Staphylcoccus S. aureuS-USA300 3 B, C, D Stenotrophomonas S. maltophilia-K279a 1B, C, D S. pneumoniae-D39 4A Strepomyces S. griseus-NBRC 13350 6A, B, D Synechococcus S. elongatus-PCC6301 1. B (thermo) Thermoanerobacter T. italicus-Ab9 Thermotoga T. maritine-MSB8 Treponema T. pallidum-SS14 Tistrella T mobilis-KA081020-065 Ureaplasma U. parvum-ATCC 700970 Vibrio V. -O395 Xanthomonas X axonopodis pv.citri-306 Xylella X. fastidiosa-GB514 Yersinia Y. pestis-Antiqua

Organization of 30S, 50S ribosomal proteins Alignment of operons C Organization of ribosomal intergenic regions 'Analysis of flanking genes of ribosomal operons US 2015/0376685 A1 Dec. 31, 2015

METHOD FOR BACTERAL SPECIES 1998). The DNA sequences useful in MLST are generally IDENTIFICATION AND STRAN TYPNG conserved, slow to evolve, and, ideally, distributed through out the genome. MLST is able to characterize the sequence CROSS-REFERENCE TO RELATED type of each isolate and the genetic relatedness of isolates can APPLICATIONS be presented as a dendrogram constructed by using the matrix of pairwise differences between the allelic profiles of the 0001. The present application claims the priority benefit of genes analyzed. MLST has gained increasing popularity dur U.S. Provisional Patent Application No. 62/018,211, filed ing the last 15 years with >80 MLST schemes being devel Jun. 27, 2014, hereby incorporated by reference in its entirety. oped for bacterial species important in human . However, this method is limited by the cost and labor FIELD OF THE INVENTION involved in amplifying, sequencing, editing and concatenat 0002 The present disclosure relates to a method for deter ing multiple housekeeping genes. In certain instances, PFGE mining the species and/or strain of a bacteria using a single has been found to be more reliable a strain predictor than locus sequence typing technique. The single locus useful in MLST, while in other strains, MLST is more reliable (Nemoy the method is the promoter region of the 16S rRNA operon. et al., J. Clin Microbiol. 43(4): 1776-1781, 2005). The method is useful to identify infectious bacteria in a sub 0007 Ribotyping has also recently been developed in an ject, to identifying contaminants in a food source, as well as effort to better categorize bacteria species and strains. A ribo strain typing and genetic fingerprinting of bacterial families. Somal operon generally consists of the three genes encoding the structural rRNA molecules, 16S, 23S, and 5S, cotrans BACKGROUND OF THE INVENTION cribed as a polycistronic operon. The copy numbers, overall 0003) To delineate specific strains at the subspecies level, ribosomal operon sizes, nucleotide sequences, and secondary a variety of bacterial genotyping methods have been devel structures of the three rRNA genes are highly conserved oped, including pulsed-field gel electrophoresis (PFGE), ran within a bacterial species, with the 16S rRNA being the most dom amplified polymorphic DNA (RAPD) sequencing, conserved. Therefore, 16S rRNA gene sequencing has BOX-A1 R-based repetitive extragenic palindromic-PCR recently become popular for identification and taxonomic (BOX-PCR), multilocus sequence typing (MLST) and classification of bacterial species (Bouchet et al., Clin Micro ribotyping. Each of these has certain advantages and disad biol Rev. 21(2): 262-273, 2008; Kolbert, et al., Curr. Opin. Vantages with respect to assessing bacterial clonality. Microbiol. 2:299-305, 1999). 0004 PFGE is a technique that relies on digestion of the 0008 Ribotyping is based on restriction endonuclease entire bacterial genome by rare-cutting restriction endonu cleavage of total genomic DNA followed by electrophoretic cleases followed by separation of the resulting large DNA separation, Southern blot transfer, and hybridization of trans fragments in an agarose gel Subjected to pulsed-field electro ferred DNA fragments with a radiolabeled ribosomal operon phoresis. This method can separate large DNA fragments (of probe. Only those bands containingaportion of the ribosomal 5 to 10 Mbp) in a size-dependent manner, with relatively few operon are visualized. The number of fragments generated by bands to compare (Unemo et al., Clin Microbiol Rev. 24: ribotyping is a reflection of the multiplicity of rRNA operons 447-458, 2011). One advantage of PFGE lies in its high present in a bacterial species. Copy numbers of rRNA oper discriminatory power (Hansen et al., Clin Microbiol Infect 8, ons have been found to range from 1 (e.g., for Chlamydia 397-404, 2002), but PFGE is technically difficult and can trachomatis) to 15 (e.g., for Photobacterium profundum) result in intralab variability in the absence of careful coordi (Bouchet et al. Supra). The Ribosomal RNA Operon Copy nation and planning. PFGE can detect chromosomal rear Number Database (rrindb) is an Internet-accessible database rangements, caused, for example, by mobile elements in the containing annotated information on rRNA operon copy genome and rapid evolutionary rates. In contrast, MLST is number among prokaryotes. Gene redundancy is uncommon more appropriate for strain phylogeny and large-scale epide in prokaryotic genomes, yet the rRNA genes can vary from miology (Vimont et al., J Med Microbiol 57: 1308-1310, one to as many as 15 copies. See rrindb.: the Ribosomal RNA 2008). Operon Copy Number Database, Klappenbach et al., Nucl. 0005 PCR-based DNA fingerprinting relies on the prin Acids Res. 29:181-184, 2001. ciple that the primers bind to specific regions of the DNA, and when this binding occurs in the proper orientation and within 0009 While the 16S ribosomal subunit gene (16S rRNA) an optimum distance, species- or strain-specific amplification has been widely used to identify bacteria to the species level, products may be generated. Primers such as REP1R-Dt and this locus is not universally capable of distinguishing all REP2-Dt, which are derived from the repetitive extragenic species in a given genus. Multilocus sequencing analyses, palindromic (REP) sequences found primarily in gram-nega often including a portion of the 16S rRNA gene, can enable tive bacteria have been used. BOX-PCR is a fingerprinting species assignment when a single gene does not possess Suf technique based on the BOX dispersed-repeat motif (e.g., ficient discriminatory power. using BOXA1R and BOXA2R primers) that are interspersed (0010 WO 2000/008138 describes an rRNA operon alter throughout the bacterial genome. BOX repeats were first able bacterium useful for the selection of antibiotics against identified in Streptococcus pneumoniae, but are present in a pathogenic microorganisms. European Patent EP0424473 number of bacterial species. (see e.g., Brusetti et al., BMC describes a method of interrupting the expression of a mac Microbiology 8:220-, 2008). romolecular synthesis operon in bacteria comprising the step 0006. In MLST analysis, multiple genes (loci), typically of binding an antisense oligonucleotide to a single stranded internal fragments of chromosomal housekeeping genes, are DNA or to a mRNA transcribed from the macromolecular sequenced to measure genetic relatedness and analyze synthesis operon. Klappenbach et al., (Appl Environ Micro sequence variation between alleles from many strains biol. 66(4): 1328-1333, 2000) discuss that no phenotype has (Maiden, et al. Proc. Natl. Acad. Sci. USA 95:3140-3145, been consistently associated with rRNA gene copy number US 2015/0376685 A1 Dec. 31, 2015

and discloses that the number of rRNA genes correlates with 0020. In various embodiments, the genetic fingerprint is the rate at which phylogenetically diverse bacteria respond to useful to track patient to patient transmission of an infection. resource availability. In various embodiments, the genetic fingerprint is useful to 0011 For each bacterial identification technique previ determine the source of an outbreak of bacterial infection or ously studied, there seem to be strain specific preferences for epidemic or source of food contamination. which method is more effective at differentiating isolates of a 0021. In various embodiments, the analyzing is carried out particular bacteria, and no one method emerges as the leading by DNA sequencing analysis of a copy of the 16S rRNA method for characterizing bacterial isolates. operon promoter. In certain embodiments, the DNA sequenc ing involves polymerase chain reaction (PCR) analysis. SUMMARY OF THE INVENTION 0022. In various embodiments, DNA is extracted from the bacterial sample and the DNA sequence analyzed. In various 0012. The present disclosure identifies the utility of embodiments, the bacterial sample is cultured under condi sequence analysis of the rRNA promoter for both bacterial tions for bacterial growth prior to analyzing the promoter species identification and strain-level discrimination, taking sequence. It is contemplated that the DNA can be extracted advantage of the sequence variation found between promot directly from the bacteria prior to any culture of the bacteria. ers of the multiple rRNA operons typically present in bacte 0023. In various embodiments, the promoter region com rial species to identify the promoter that best predicted bac prises a portion of the 16S rDNA and regions upstream of the terial phylogeny. It was observed that this promoter provided 16S rDNA. In various embodiments, the promoter region is excellent strain level discrimination thereby providing a approximately 250 to 450 nucleotides in length. In various rapid, cost effective, portable single locus method for bacte embodiments, the promoter region sequenced product is rial species identification and strain typing. approximately 600 to 1200 nucleotides in length. 0013. In various embodiments, the disclosure provides a 0024. In various embodiments, the identification of the single locus sequence typing method for identifying an infec species of bacteria is based on a copy of the promoter having tious bacteria in a subject having one or more infectious one or more characteristics selected from the group consist bacteria the method comprising, a) obtaining a sample con ing of i) distance of the operon from origin of replication; ii) taining the infectious bacteria from the Subject; b) analyzing G/C content of the promoter; iii) an operon consisting of a polynucleotide sequence of a promoter region of bacterial (a) 16S, (b) 16S and 23S or (c) all three ribosomal subunit 16S rRNA operon in the infectious bacteria; and c) identify genes (16S, 23S, and 5S) and is found upstream of a cluster of ing the species and/or strain of infectious bacteria based on core 30S and 50S ribosomal subunit genes; and, iv) distinct the sequence of the 16S rRNA promoter region. ness of the copy from the remaining ribosomal operons in the 0014. In various embodiments, the method further com genome when 16S. 23S, and 5S are aligned, including align prises (d) treating the Subject with an antibacterial agent ment of intergenic spacer regions. against the infectious bacteria identified. 0025. In various embodiments, the intergenic spacer 0015. In various embodiments, the subject is a patient in a regions between the 16S and 23S ribosomal subunit genes are hospital and the bacteria is a nosocomial infection. selected from the group consisting of (i) lack of tRNA, (ii) 0016. In one embodiment, the bacteria is a multidrug resis tRNAGlu, tRNAAla, or tRNAIle; (iii) tRNAIle+tRNAAla: tant strain of bacteria. In one embodiment, the bacteria is an and (iv) tRNAAla--tRNAIle. Variations in the intergenic animal . In various embodiments, the animal patho spacer region between 16S operon copies can provide infor gen has been passed to a human Subject. Exemplary Zoonotic mation for identification of the correct promoter copy. bacteria include, but are not limited to, , Bru 0026. Also contemplated is a single locus sequence typing cella sp., Chlamydophila psittaci, E. coli O157:H7. kit comprising polynucleotide primers specific for a 16S Cryptosporidium parvum, Campylobacter, and Salmonella. operon promoter region in one or more bacterial species or 0017. In various embodiments, the sample is selected from strains; and instructions for carrying out a single locus the group consisting of whole blood, serum, saliva, Sputum, sequencing type analysis on a bacterial sample, wherein bac urine, cerebrospinal fluid, stool, amniotic fluid, or tissue terial DNA from the sample is amplified using the primers sample from skin, muscle, buccal or conjunctival mucosa, and the sequence of the amplified promoter region is com placenta, or other organs. pared to a library of bacterial 16S operon promoter regions 0018. In various embodiments, the disclosure provides a and the bacteria is identified based on the sequence of the 16S method for identifying a bacteria in a contaminated food rRNA promoter. Source having one or more contaminating bacteria, the 0027. It is also contemplated that the kit described herein method comprising, a) obtaining a sample containing bacte comprises collection of data and the collection of data is on a ria from the contaminated food source; b) analyzing a poly computer-readable storage medium. nucleotide sequence of a promoter region of bacterial 16S 0028. In various embodiments, the identification of the rRNA operon in the contaminating bacteria; and c) identify bacteria comprises a comparison of the promotersequence of ing the species and/or strain of contaminating bacteria based the isolated species or strain to other 16S promoter sequences on the sequence of the 16S rRNA promoter region. using a computer readable storage media having computer 0019. In one embodiment, contemplated is a method for executable instructions. In certain embodiments, the disclo generating a genetic fingerprint map for bacteria comprising Sure provides a computer-readable storage medium having a) analyzing a polynucleotide sequence of a promoter region computer-executable instructions stored in a memory device of bacterial 16S rRNA operon of a known or unknown bac to be executed on a processor for implementing a method for terial strain; and b) classifying the bacteria into a family, identifying an infectious bacteria in a Subject having one or genus, species and/or strain of bacteria based on the poly more infectious bacteria or for identifying a contaminating nucleotide sequence of the promoter region of the 16S rRNA bacteria in a food stock, the method comprising analyzing a operon. polynucleotide sequence of a promoter region of bacterial US 2015/0376685 A1 Dec. 31, 2015

16S rRNA operon in the bacteria; and identifying the species 0035. As used in the present disclosure and the appended and/or strain of infectious or contaminating bacteria based on claims, the terms “a”, “an and “the include plural reference the sequence of the 16S rRNA promoter region. It is under as well as singular reference unless the context clearly dic stood that the disclosure comprisises a tangible computer tates otherwise. readable medium including non-transitory computer read 0036. As used herein, the following terms have the mean able instructions that, when executed at one or more proces ings ascribed to them unless specified otherwise. sors of a system, execute a method as disclosed herein for 0037. The term “about” or “approximately” means an identifying an infectious or contaminating bacteria. acceptable error for aparticular value as determined by one of 0029. The invention also provides computer-implemented ordinary skill in the art, which depends in part on how the applications. In one Such application, the invention relates to value is measured or determined. In certain embodiments, the an apparatus for determining the sequence of a bacteria in a term “about' or “approximately” means within 1, 2, 3 or 4 sample, comprising a processor and a computer readable standard deviations. In certain embodiments, the term storage medium having computer executable instructions “about” or “approximately” means within 30%, 25%, 20%, adapted to be executed on the processor to analyze informa 15%, 10%, 9%, 8%, 7%, 6%. 5%, 4%, 3%, 2%, 1%, 0.5% or tion for at least one bacteria with respect to at least one 0.1% of a given value or range. Whenever the term “about” or promoter in the 16S operon, that is predictive the species “approximately” precedes the first numerical value in a series and/or strain of bacteria, and generate an output based on the of two or more numerical values, it is understood that the term promoter sequence information, wherein the output com “about' or “approximately' applies to each one of the prises at least one parameter to identify the bacteria as dis numerical values in that series. closed herein. 0038 A “sample” as described herein, refers to a sample 0030. It should be understood that all combinations of obtained from an individual that contains bacterial nucleic features described herein are contemplated, even if the com acid (DNA or RNA). Such a sample can be obtained from any bination of feature is not specifically found in the same sen source that contains bacterial DNA, including whole blood, tence or paragraph herein. This includes in particular the use serum, saliva, sputum, urine, cerebrospinal fluid, stool, amni of all markers disclosed herein, alone or in combination, for otic fluid, or tissue sample from skin, muscle, buccal or con analysis individually or in haplotypes, in all aspects of the junctival mucosa, placenta, gastrointestinal tract or other invention as described herein. Organs. 0039. A “subject of diagnosis or treatment is a human or BRIEF DESCRIPTION OF THE DRAWINGS non-human animal, including a mammal or a primate. Examples of mammals include, but are not limited to, any 0031 FIG. 1 is a schematic showing an exemplary system member of the mammalian class: humans, non-human pri for identifying bacteria in a sample as described herein. mates Such as chimpanzees, and otherapes and monkey spe 0032 FIG. 2 is a table showing bacteria analyzed for ribo cies; farm animals such as cattle, horses, sheep, goats, Swine; Somal promoter typing and parameters disclosed to be rel domestic animals such as rabbits, dogs, and cats; laboratory evant for identifying the promoter for species identification. animals including rodents, such as rats, mice and guinea pigs, and the like. Examples of non-mammals include, but are not limited to, birds, fish, and the like. The term does not denote DETAILED DESCRIPTION a particular age or gender. 0033. The present disclosure is directed to a rapid, cost 0040. A “food source' or “food stock' as used herein effective and portable single locus sequence typing (SLST) refers to any Substance containing nutrients, such as carbo method to identify and genotype bacteria. This method, hydrates, proteins, and fats, that can be ingested by a living which targets a specific ribosomal promoter, can be applied organism and metabolized for nourishment. Exemplary food broadly to all bacterial species and predicts phylogenetic Sources that can have bacterial contamination include, meat relationships that are comparable to those provided by full Sources (beef, chicken, pork), fish, vegetables and fruits. 16S rRNA gene sequence analysis or multilocus sequence 0041. A “contaminating bacteria' or an “infectious bacte analysis schemes. This approach also provides discrimina ria' refers to a bacterial strain or species in a sample which tory power that is equivalent to multilocus sequence typing results in detrimental effects to the host comprising the bac schemes in distinguishing clonal and unique strains from teria, or if in a food source, to the Subject consuming the food epidemiologically related and unrelated Strain sets. Using a Source. A contaminating or infectious bacteria confers unde general set of criteria, the disclosure provides a process to sirable, and potentially harmful, effects in a host. Contami identify which of the multiple ribosomal promoters in a bac nating or infectious bacteria can be the result of growth of terial chromosome should be targeted for this application. pathogenic or opportunistic bacteria in a Subject or food 0034. Unless otherwise defined, all technical and scien SOUC. tific terms used herein have the same meaning as commonly 0042 Conventional notation is used herein to describe understood by one of ordinary skill in the art to which the polynucleotide sequences: the left-hand end of a single present disclosure belongs. The following references provide stranded polynucleotide sequence is the 5'-end; the left-hand one of skill with a general definition of many of the terms used direction of a double-stranded polynucleotide sequence is in this disclosure: Singleton et al., DICTIONARY OF referred to as the 5'-direction. The direction of 5' to 3' addition MICROBIOLOGY AND MOLECULAR BIOLOGY (2d of nucleotides to nascent RNA transcripts is referred to as the Ed. 1994): THE CAMBRIDGE DICTIONARY OF SCI transcription direction. The DNA strand having the same ENCE AND TECHNOLOGY (Walker Ed., 1988): THE sequence as an mRNA is referred to as the “coding strand’’: GLOSSARY OF GENETICS, 5th Ed., R. Riegeretal. (Eds.), sequences on the DNA strand having the same sequence as an Springer Verlag (1991); and Hale & Marham, THE HARPER mRNA transcribed from that DNA and which are located 5' to COLLINS DICTIONARY OF BIOLOGY (1991). the 5'-end of the RNA transcript are referred to as “upstream US 2015/0376685 A1 Dec. 31, 2015 sequences'; sequences on the DNA strand having the same gent conditions, e.g., highly stringent conditions, when that sequence as the RNA and which are 3' to the 3'-end of the sequence is present in a mixture of (e.g., total cellular) DNA coding RNA transcript are referred to as “downstream or RNA. sequences.” 0047. The term “stringent conditions' refers to conditions 0043 “Complementary” refers to the topological compat under which a probe will hybridize preferentially to its target ibility or matching together of interacting Surfaces of two Subsequence, and to a lesser extent to, or not at all to, other polynucleotides. Thus, the two molecules can be described as sequences. “Stringent hybridization' and “stringent hybrid complementary, and furthermore, the contact surface charac ization wash conditions” in the context of nucleic acid hybrid teristics are complementary to each other. A first polynucle ization experiments such as Southern and Northern hybrid otide is complementary to a second polynucleotide if the izations are sequence-dependent, and are different under nucleotide sequence of the first polynucleotide is identical to different environmental parameters. An extensive guide to the the nucleotide sequence of the polynucleotide binding partner hybridization of nucleic acids is found in Tijssen, Laboratory of the second polynucleotide. Thus, the polynucleotide Techniques in Biochemistry and Molecular Biology—Hy whose sequence is 5'-TATAC-3' is complementary to a poly bridization with Nucleic Acid Probes, Part I, Chapter 2 in nucleotide whose sequence is 5'-GTATA-3'. A nucleotide “Overview of principles of hybridization and the strategy of sequence is “substantially complementary to a reference nucleic acid probe assays, Elsevier (New York, 1993). In nucleotide sequence if the sequence complementary to the certain embodiments, highly stringent hybridization and Subject nucleotide sequence is Substantially identical to the wash conditions are about 5° C. lower than the thermal melt reference nucleotide sequence. ing point (T) for the specific sequence at a defined ionic 0044) “Polynucleotide' refers to a polymer composed of strength and pH. The T is the temperature (under defined nucleotide units. Polynucleotides include naturally occurring ionic strength and pH) at which 50% of the target sequence nucleic acids, such as deoxyribonucleic acid (“DNA) and hybridizes to a perfectly matched probe. In certain embodi ribonucleic acid (“RNA), as well as nucleic acid analogs. ments, very stringent conditions are equal to the T for a Nucleic acid analogs include those which contain non-natu particular probe. rally occurring bases, nucleotides that engage in linkages 0048. An example of stringent hybridization conditions with other nucleotides other than the naturally occurring for hybridization of complementary nucleic acids that have phosphodiester bond, and/or bases attached through linkages more than 100 complementary residues on a filter in a South other than phosphodiester bonds. Non-limiting examples of ern or Northern blot is 50% formalin with 1 mg of heparin at nucleotide analogs include phosphorothioates, phospho 42°C., with the hybridization being carried out overnight. An rodithioates, phosphorotriesters, phosphoramidates, borano example of highly stringent wash conditions is 0.15 MNaCl phosphates, methylphosphonates, chiral-methyl phospho at 72°C. for about 15 minutes. An example of stringent wash nates, 2-O-methyl ribonucleotides, peptide-nucleic acids conditions is a 0.2xSSC wash at 65° C. for 15 minutes (see (PNAS), and the like. Such polynucleotides can be synthe Sambrook et al. for a description of SSC buffer). A high sized, e.g., using an automated DNA synthesizer. The term stringency wash can be preceded by a low stringency wash to “nucleic acid' typically refers to larger polynucleotides. The remove background probe signal. An example of medium term "oligonucleotide' typically refers to shorter polynucle stringency wash for a duplex of e.g., more than 100 nucle otides. In certain embodiments, an oligonucleotide contains otides, is 1xSSC at 45° C. for 15 minutes. An example of low no more than about 50 nucleotides. It will be understood that stringency wash for a duplex of e.g., more than 100 nucle when a nucleotide sequence is represented by a DNA otides, is 4-6xSSC at 40° C. for 15 minutes. In general, a sequence (i.e., A, T, G, C), this also includes an RNA signal to noise ratio of 2x (or higher) than that observed for an sequence (i.e., A, U, G, C) in which “U” replaces “T”. unrelated probe in the particular hybridization assay indicates 0045 “Primer' refers to a polynucleotide that is capable of detection of a specific hybridization. specifically hybridizing to a designated polynucleotide tem 0049. For sequence comparison, typically one sequence plate and providing a point of initiation for synthesis of a acts as a reference sequence, to which test sequences are complementary polynucleotide. Such synthesis occurs when compared. When using a sequence comparison algorithm, the polynucleotide primer is placed under conditions in which test and reference sequences are input into a computer, Sub synthesis is induced, i.e., in the presence of nucleotides, a sequence coordinates are designated, if necessary, and complementary polynucleotide template, and an agent for sequence algorithm program parameters are designated. The polymerization Such as DNA polymerase. A primer is typi sequence comparison algorithm then calculates the percent cally single-stranded, but may be double-stranded. Primers sequence identity for the test sequence(s) relative to the ref are typically deoxyribonucleic acids, but a wide variety of erence sequence, based on the designated program param synthetic and naturally occurring primers are useful for many eters. applications. A primer is complementary to the template to 0050. Optimal alignment of sequences for comparison can which it is designed to hybridize to serve as a site for the be conducted, e.g., by the local homology algorithm of Smith initiation of synthesis, but need not reflect the exact sequence and Waterman, Adv. Appl. Math. 2:482 (1981); by the of the template. In such a case, specific hybridization of the homology alignment algorithm of Needleman and Wunsch, J. primer to the template depends on the stringency of the Mol. Biol. 48:443 (1970); by the search for similarity method hybridization conditions. Primers can be labeled with, e.g., of Pearson and Lipman, Proc. Natl. Acad. Sci. USA, 85:2444 chromogenic, radioactive, or fluorescent moieties and used as (1988); by computerized implementations of these algo detectable moieties. rithms (e.g., GAP, BESTFIT. FASTA, and TFASTA in the 0046. The term “hybridizing specifically to”, “specific Wisconsin Genetics Software Package, Genetics Computer hybridization' or “selectively hybridize to refers to the bind Group, Madison, Wis.); or by visual inspection. ing, duplexing, or hybridizing of a nucleic acid molecule 0051. One example of a useful algorithm is PILEUP. preferentially to a particular nucleotide sequence understrin PILEUP creates a multiple sequence alignment from a group US 2015/0376685 A1 Dec. 31, 2015 of related sequences using progressive, pairwise alignments the similarity between two sequences (see, e.g., Karlin and to show relationship and percent sequence identity. It also Altschul, Proc. Natl. Acad. Sci. USA,90:5873-5787 (1993)). plots a tree or dendrogram showing the clustering relation One measure of similarity provided by the BLAST algorithm ships used to create the alignment. PILEUP uses a simplifi is the smallest sum probability (P(N)), which provides an cation of the progressive alignment method of Feng and indication of the probability by which a match between two Doolittle, J. Mol. Evol., 35:351-360 (1987). The method used nucleotide or amino acid sequences would occur by chance. is similar to the method described by Higgins and Sharp, In certain embodiments, a nucleic acid is considered similar CABIOS, 5:151-153 (1989). The program canalignup to 300 to a reference sequence if the Smallest Sum probability in a sequences, each of a maximum length of 5,000 nucleotides or comparison of the test nucleic acid to the reference nucleic amino acids. The multiple alignment procedure begins with acid is less than about 0.1, or less than about 0.01, or less than the pairwise alignment of the two most similar sequences, about 0.001. producing a cluster of two aligned sequences. This cluster is 0054) The terms “treat”, “treating” and “treatment” then aligned to the next most related sequence or cluster of encompass alleviating or abrogating a condition, disorder or aligned sequences. Two clusters of sequences are aligned by disease, or one or more of the symptoms associated with the a simple extension of the pairwise alignment of two indi condition, disorder or disease, and encompass alleviating or vidual sequences. The final alignment is achieved by a series eradicating the cause(s) of the condition, disorder or disease of progressive, pairwise alignments. The program is run by itself. In certain embodiments, the terms “treat”, “treating, designating specific sequences and their amino acid or nucle and “treatment” refer to administration of a compound, a otide coordinates for regions of sequence comparison and by pharmaceutical composition or a pharmaceutical dosage designating the program parameters. For example, a refer form to a Subject for the purpose of alleviating, abrogating or ence sequence can be compared to other test sequences to preventing a condition, disorder or disease, or symptom(s) determine the percent sequence identity relationship using associated therewith, or cause(s) thereof. In further embodi the following parameters: default gap weight (3.00), default ments, the term “treatment” refers to prophylactic (preventa gap length weight (0.10), and weighted end gaps. Another tive) treatment or therapeutic treatment or diagnostic treat algorithm that is useful for generating multiple alignments of ment. sequences is Clustal W (see, e.g., Thompson et al., Nucleic 0055. The term “effective amount” of a therapeutic means Acids Research, 22:4673-4680 (1994)). a dosage Sufficient to produce a desired result on a health 0052 Another example of an algorithm that is suitable for condition, pathology, or disease of a Subject or for a diagnos determining percent sequence identity and sequence similar tic purpose. The desired result may comprise a subjective or ity is the BLAST algorithm, which is described in Altschulet objective improvement in the recipient of the dosage. “Thera al., J. Mol. Biol., 215:403-410 (1990). Software for perform peutically effective amount” refers to that amount of an agent ing BLAST analyses is publicly available through the effective to produce the intended beneficial effect on health. National Center for Biotechnology Information. This algo 0056. A “computer-readable medium' is an information rithm involves first identifying high scoring sequence pairs storage medium that can be accessed by a computer using a (HSPs) by identifying short words of length W in the query commercially available or custom-made interface. Exem sequence, which either match or satisfy some positive-valued plary computer-readable media include memory (e.g., RAM, threshold score T when aligned with a word of the same ROM, flash memory, etc.), optical storage media (e.g., CD length in a database sequence. T is referred to as the neigh ROM), magnetic storage media (e.g., computer hard drives, borhood word score threshold (Altschul et al., J. Mol. Biol. floppy disks, etc.), punch cards, or other commercially avail 215:403-410 (1990)). These initial neighborhood word hits able media. Information may be transferred between a system act as seeds for initiating searches to find longer HSPs con of interest and a medium, between computers, or between taining them. The word hits are then extended in both direc computers and the computer-readable medium for storage or tions along each sequence for as far as the cumulative align access of stored information. Such transmission can be elec ment score can be increased. Cumulative scores are trical, or by other available methods, such as IR links, wire calculated using, for nucleotide sequences, the parameters M less connections, etc. (reward score for a pair of matching residues; always >0) and 0057 Bacteria N (penalty score for mismatching residues; always <0). For 0058. It is contemplated that the methods described herein amino acid sequences, a scoring matrix is used to calculate are useful to study the natural diversity of bacterial species, the cumulative score. Extension of the word hits in each resolve unclassified isolates into novel species or strains, direction is halted when: the cumulative alignment score falls define regional and global epidemiology of bacterial species, off by the quantity X from its maximum achieved value; the i.e., naturally occurring endemic strains, disease-causing epi cumulative score goes to Zero or below, due to the accumu demic strains, and strains with the potential to be agents for lation of one or more negative-scoring residue alignments; or bioterrorism, study the epidemiology of infectious diseases, the end of either sequence is reached. The BLAST algorithm differentiate pathogenic organisms, identify bacterial con parameters W.T. and X determine the sensitivity and speed of tamination Sources (e.g., hospital-acquired/nosocomial, the alignment. The BLASTN program (for nucleotide foodborne, animal/, environmental), link patient sequences) uses as defaults a wordlength (W) of 11, an expec acquisition of a bacterial infection, and track patient-to-pa tation (E) of 10, M-5, N=-4, and a comparison of both tient transmission during infectious disease outbreaks, Strands. For amino acid sequences, the BLASTP program inform decisions regarding infection prevention and control uses as defaults a wordlength (W) of 3, an expectation (E) of measures in health care facilities, inform decisions regarding 10, and the BLOSUM62 scoring matrix (see Henikoff and public health response to outbreaks. Henikoff, Proc. Natl. Acad. Sci. USA, 89:10915 (1989)). 0059 Bacteria can be classified on the basis of cell struc 0053. In addition to calculating percent sequence identity, ture, cellular metabolism or on differences in cell components the BLAST algorithm also performs a statistical analysis of Such as DNA, fatty acids, pigments, antigens and quinones. US 2015/0376685 A1 Dec. 31, 2015

By combining morphology and Gram-staining, most bacteria Bacteroides putredinis, Bacteroides pyogenes, Bacteroides can be classified as belonging to one of four groups: Gram Stercoris, Bacteroides suis, Bacteroides tectus, Bacteroides positive cocci, Gram-positive bacilli, Gram-negative cocci thetaiotaomicron, Bacteroides vulgatus, Bartonella species: and Gram-negative bacilli. Bacteria can be aerobic, anaero , , Bartonella bic, or facultative anaerobic. birtlesii, Bartonella bovis, Bartonella capreoli, Bartonella 0060 Exemplary bacteria that can be identified using the clarridgeiae, , , present methods, include Acetobacter aurantius, Acineto , Bartonella hemselae (cat scratch fever), bacter species: , Acinetobacter cal , Bartonella muris, Bartonella perony coaceticus, Acinetobacter johnsonii, Acinetobacter junii, sci, , Bartonella rochalinae, Bartonella Acinetobacter l'offii, Acinetobacter radioresistens, Acineto Schoenbuchii, , Bartonella taylorii, Bar bacter septicus, Acinetobacterschindleri, Acinetobacter urs tonella tribocorum, Bartonella vinsonii spp. Arupensis, Bar ingii, Actinomyces species: Actinomyces bovis, Actinomyces tonella vinsonii spp. Berkhofii, Bartonella vinsonii spp. Vin bowdenii, Actinomyces canis, Actinomyces cardiffensis, Acti sonii, Bartonella washoensis; BCG (Bacille Calmette nomyces Catuli, Actinomyces Coleocanis, Actinomyces denta Guerin), Bergeyella zoo helcum (Weeksella zoohelicum), lis, Actinomyces denticolens, Actinomyces europaeus, Acti Bifidobacterium bifidum, Blastobacter species, Blochmannia nomyces funkei, Actinomyces georgiae, Actinomyces species, Bordetella species: , Bordetella gerencseriae, Actinomyces graevenitzii, Actinomyces avium, Bordetella bronchiseptica, , Borde hongkongensis, Actinomyces hordeovulneris, Actinomyces tella holmesii, , howellii, Actinomyces humiferus, Actinomyces hyovaginalis, (), Bordetella petri, Bordetella trematum, Actinomyces israelii, Actinomyces marinammalium, Actino Borrelia species: Borrelia burgdorferi, Borrelia afzelii, Bor myces meyeri, Actinomyces naeslundii, Actinomyces nasi relia anserina, Borrelia garinii, Borrelia valaisiana, Borrelia cola, Actinomyces neuii, Actinomyces Odontolyticus, Actino hermsii, Borrelia Parkeri, Borrelia recurrentis, Bosea spe myces Oricola, Actinomyces radicidentis, Actinomyces cies, Bradyrhizobium species, Brenneria species, Brucella radingae, Actinomyces slackii, Actinomyces Streptomycini, species: , Brucella Canis, Brucella meliten Actinomyces suinastitidis, Actinomyces suis, Actinomyces sis, Brucella neotomae, Brucella ovis, Brucella suis, Brucella turicensis, Actinomyces urogenitalis, Actinomyces vaccinax pinnipediae, Buchnera species, Budvicia species, Burkhold illae, Actinomyces viscosus, Actinobacillus species: Actino eria species: Burkholderia cepacia (Pseudomonas cepacia), bacillus actinomycetemcomitans, Actinobacillus arthritidis, (Pseudomonas mallei/Actinobacillus Actinobacillus capsulatus, Actinobacillus delphinicola, Acti mallei), Burkholderia pseudomalilei (Pseudomonas nobacillus equuli, Actinobacillus hominis, Actinobacillus pseudomalilei); Buttiauxella species, Calymmatobacterium indolicus, Actinobacillus lignieresii, Actinobacillus minor; granulomatis, Campylobacter species: Campylobacter coli, Actinobacillus muris, Actinobacillus pleuropneumoniae, Campylobacter concisus, Campylobacter curvus, Campylo Actinobacillus porcinus, Actinobacillus rossii, Actinobacil bacter fetus, Campylobacter gracilis, Campylobacter hel lus Scotiae, Actinobacillus seminis, Actinobacillus succino veticus, Campylobacter hominis, Campylobacter hyointesti genes, Actinobacillus suis, Actinobacillus ureae, Aeromonas nalis, Campylobacter insulaenigrae, , species: Aeromonas allosaccharophila, Aeromonas bes Campylobacter lanienae, Campylobacter lari, Campylo tiarum, Aeromonas bivalvium, Aeromonas encheleia, Aero bacter mucosalis, Campylobacter rectus, Campylobacter monas enteropelogenes, Aeromonas euchrenophila, Aeromo Showae, Campylobactersputorum, Campylobacter upsalien nas hydrophila, Aeromonas ichthiosmia, Aeromonas jandaei, sis, Capnocytophaga canimorsus (Dysgonic fermenter type Aeromonas media, Aeromonas molluscorum, Aeromonas 2), Corynebacterium species, , popofii, Aeromonas punctata, Aeromonas Salmonicida, Cedecea species, Chlamydia species: Chlamydia trachoma Aeromonas Schuberti, Aeromonas Sharmana, Aeromonas tis (), Chlamydia muridarum, simiae, Aeromonas sobria, , Afipia fells, Chlamydia suis, Chlamydophila species: Chlamydophila Agrobacterium species: Agrobacterium radiobacter; Agro pneumoniae, Chlamydophila psittaci (Psittacosis), Chlamy bacterium rhizogenes, Agrobacterium rubi, Agrobacterium dophila pecorum, Chlamydophila abortus, Chlamydophila tumefaciens, Agromonas species, Alcaligenes species: felis, Chlamydophila caviae, Citrobacter species: Citro Alcaligenes aquatilis, Alcaligenes eutrophus, Alcaligenes bacter amalonaticus, Citrobacter braakii, Citrobacter farm faecalis, Alcaligenes latus, Alcaligenes xylosoxidans, Alish eri, , Citrobacter gillenii, Citrobacter ewanella species. Alterococcus species, Anaplasma phago intermedius, aka Citrobacter diversus, cytophilum, Anaplasma marginale, Aquamonas species, Citrobacter murliniae, Citrobacter rodentium, Citrobacter Arcanobacterium haemolyticum, Aranicola species, Arseno Sedlaki, Citrobacter werkmanii, Citrobacter youngae, phonus species, Azotivirga species, Azotobacter vinelandii, Clostridium species: Clostridium botulinum, Clostridium dif Azotobacter chroococcum, Bacillary (), ficile, Clostridium novyi, Clostridium septicum, Clostridium Bacillus species: Bacillus abortus (Brucella melitensis biovar tetani (Tetanus), Clostridium welchii (Clostridium perfirin abortus), Bacillus anthracis (Anthrax), Bacillus brevis, gens); Corynebacterium species: Corynebacterium diphthe Bacillus cereus, Bacillus coagulans, Bacillus fusiformis, riae (Diphtheria), Corynebacterium amycolatum, Coryne Bacillus globigii, Bacillus licheniformis, Bacillus megate bacterium aquaticum, Corynebacterium bovis, rium, Bacillus mycoides, Bacillus natto, Bacillus Stearother Corynebacterium equi, Corynebacterium flavescens, mophilus, Bacillus subtilis, Bacillus sphaericus, Bacillus thu Corynebacterium glutamicum, Corynebacterium haemolyti ringiensis, Bacteroides species: Bacteroides forsythus cum, Corynebacterium jeikeiun (corynebacteria of group (Tannerella forsythensis), Bacteroides acidifaciens, JK), Corynebacterium minutissimum (), Coryne Bacteroides distasonis (reclassified as Parabacteroides dis bacterium parvum (also called Propionibacterium acnes), tasonis), Bacteroides gingivalis, Bacteroides gracilis, Corynebacterium pseudodiptheriticum (also called Coryne Bacteroides fragilis, Bacteroides Oris, Bacteroides ovatus, bacterium hofinannii), Corynebacterium pseudotuberculosis US 2015/0376685 A1 Dec. 31, 2015

(also called Corynebacterium Ovis), Corynebacterium pyo cola, , Klebsiella rhinoscleromatis, genes, Corynebacterium urealyticum (corynebacteria of Klebsiella Singaporensis, Klebsiella terrigena, Klebsiella group D2), Corynebacterium renale, Corynebacterium stria trevisani, Klebsiella varicola, , Kluyvera tum, Corynebacterium tenuis (Trichomycosis palmellina, Tri species, Lactobacillus species: Lactobacillus acetotolerans, chomycosis axillaris), Corynebacterium ulcerans, Coryne Lactobacillus acidifarinae, Lactobacillus acidipiscis, Lacto bacterium xerosis, (), Cronobacter bacillus acidophilus (Doderlein bacillus), Lactobacillus agi species: Cronobacter Sakazakii, Cronobacter malonaticus, lis, Lactobacillus algidus, Lactobacillus alimentarius, Lac Cronobacter turicensis, Cronobacter muytjensii, Crono tobacillus amylolyticus, Lactobacillus amylophilus, bacter dublimensis, Delftia acidovorans (Comamonas aci Lactobacillus amylotrophicus, Lactobacillus amylovorus, dovorans), Dickeya species, Edwardsiella species, Eikenella Lactobacillus animalis, Lactobacillus antri, Lactobacillus corrodens, Enterobacter species: Enterobacter aerogenes, apodemi, Lactobacillus aviarius, Lactobacillus bifermen , Enterobacter Sakazakii Enterococcus tans, Lactobacillus brevis, Lactobacillus buchneri, Lactoba species: Enterococcus avium, Enterococcus durans, Entero cillus camelliae, Lactobacillus casei, Lactobacillus cat coccus faecalis (Streptococcus faecalis/Streptococcus Group enaformis, Lactobacillus ceti, Lactobacillus coleohominis, D), Enterococcus faecium, Enterococcus solitarius, Entero Lactobacillus collinoides, Lactobacillus composti, Lactoba coccus gallinarum, Enterococcus maloratus, Ehrlichia cillus concavus, Lactobacillus coryniformis, Lactobacillus chafeensis, Erysipelothrix rhusiopathiae, Erwinia species, crispatus, Lactobacillus crustorum, Lactobacillus curvatus, Escherichia species: Escherichia adecarboxylata, Escheri Lactobacillus delbrueckii, Lactobacillus delbrueckii subsp. chia albertii, Escherichia blattae, , Escheri Bulgaricus, Lactobacillus delbrueckii Subsp. Lactis, Lacto chia fergusonii, Escherichia hermannii, Escherichia vuln bacillus diolivorans, Lactobacillus equi, Lactobacillus eris, Ewingella species, Flavobacterium species: equigenerosi, Lactobacillus farraginis, Lactobacillus far Flavobacterium aquatile, Flavobacterium branchiophilum, ciminis, Lactobacillus fermentum, Lactobacillus formicalis, Flavobacterium columnare, Flavobacterium flevense, Fla Lactobacillus fructivorans, Lactobacillus frumenti, Lactoba vobacterium gondwanense, Flavobacterium hydatis, Fla cillus fitchuensis, Lactobacillus gallinarum, Lactobacillus vobacterium johnsoniae, Flavobacterium pectinovorum, gasseri, Lactobacillus gastricus, Lactobacillus ghanensis, Flavobacterium psychrophilum, Flavobacterium saccharo Lactobacillus graminis, Lactobacillus hammesii, Lactobacil philum, Flavobacterium salegens, Flavobacterium scoph lus hamsteri, Lactobacillus harbinensis, Lactobacillus haya thalmum, Flavobacterium succinans, kitensis, Lactobacillus helveticus, Lactobacillus hilgardii, (Tularaemia), Francisella novicida, Francisella philomira Lactobacillus homohiochii, Lactobacillus iners, Lactobacil gia, Fusobacterium species: Fusobacterium necrophorum lus inglu viei, Lactobacillus intestinalis, Lactobacillus jens (Lemierre Syndrome/Sphaerophorus necrophorus), Fuso enii, Lactobacillus johnsonii, Lactobacillus kalixensis, Lac bacterium nucleatum, Fusobacterium polymorphum, Fuso tobacillus kefiranofaciens, Lactobacillus Refiri, bacterium novum, Fusobacterium mortiferum, Fusobacte Lactobacillus kimchii, Lactobacillus kitasatonis, Lactobacil rium varium, Gardnerella vaginalis, Gemella haemolysans, lus kunkeei, Lactobacillus leichmannii, Lactobacillus lind Gemella morbillorum (Streptococcus morbillorum), Gri neri, Lactobacillus malefermentans, Lactobacillus mali, Lac montella species, Haemophilus species: Haemophilus aegyp tobacillus manihotivorans, Lactobacillus mindensis, tius (Koch-Weeks bacillus), Haemophilus aphrophilus, Hae Lactobacillus mucosae, Lactobacillus murinus, Lactobacil mophilus avium, (), lus nagelii, Lactobacillus namurensis, Lactobacillus manten Haemophilus felis, Haemophilus haemolyticus, Haemophi sis, Lactobacillus Oligofermentans, Lactobacillus Oris, Lac lus influenzae (Pfeiffer bacillus), Haemophilus paracunicu tobacillus panis, Lactobacillus pantheris, Lactobacillus lus, Haemophilus parahaemolyticus, Haemophilus parain parabrevis, Lactobacillus parabuchneri, Lactobacillus para fluenzae, Haemophilus paraphrophilus (Aggregatibacter collinoides, Lactobacillus parafarraginis, Lactobacillus par aphrophilus), Haemophilus pertussis, Haemophilus pittma akefiri, Lactobacillus parallimentarius, Lactobacillus para niae, Haemophilus Somnus, Haemophilus vaginalis, Hafinia plantarum, Lactobacillus pentosus, Lactobacillus perolens, species, Hafnia alvei, Helicobacter species: Helicobacter Lactobacillus plantarum, Lactobacillus pontis, Lactobacil acinonychis, Helicobacter anseris, Helicobacter aurati, lus psittaci, Lactobacillus rennini, Lactobacillus reuteri, , Helicobacter bizzozeronii, Helicobacter Lactobacillus rhamnosus, Lactobacillus rimae, Lactobacil brantae, , , Heli lus rogosae, Lactobacillus rossiae, Lactobacillus ruminis, cobacter cholecystus, , Helicobacter Lactobacillus Saerimneri, Lactobacillus sakei, Lactobacillus cynogastricus, , Helicobacter fennelliae, salivarius, Lactobacillus Sanfranciscensis, Lactobacillus Helicobacterganmani, Helicobacter heilmannii (Gastrospir satsumensis, Lactobacillus secaliphilus, Lactobacillus illum hominis), , Helicobacter sharpeae, Lactobacillus Siliginis, Lactobacillus spicheri, mesocricetorum, Helicobacter marmotae, Helicobacter Lactobacillus Suebicus, Lactobacillus thailandensis, Lacto muridarum, Helicobacter mustelae, Helicobacter pameten bacillus ultunensis, Lactobacillus vaccinostercus, Lactoba sis, , (stomach cillus vaginalis, Lactobacillus versmoldensis, Lactobacillus ulcer), Helicobacter rappini, , Heli vini, Lactobacillus vitulinus, Lactobacillus zeae, Lactobacil cobacter Salomonis, , Helicobacter lus zymae, Leclercia species, Legionella species: Legionella typhlonius, Helicobacter winghamensis; Human granulo adelaidensis, , , cytic (Anaplasma phagocytophilum/Ehrlichia Legionella birminghamensis, Legionella bOzemanii, phagocytophila), Human monocytotropic ehrlichiosis , , Legionella (Monocytic ehrlichiosis/Ehrlichia chafeensis), Klebsiella cherrii, Legionella cincinnatiensis, , species: (Calymmatobacterium Legionella drancourti, Legionella drozanski, Legionella granulomatis), Klebsiella mobilis, Klebsiella Ornithinolytica, erythra, Legionella fairfieldensis, , , Klebsiella ozaenae, Klebsiella planti Legionella feelei, , Legionella genomo US 2015/0376685 A1 Dec. 31, 2015 species, , , chitae, Mycobacterium chlorophenolicum, Mycobacterium , , Legionella chubuense, Mycobacterium conceptionense, Mycobacterium israelensis, Legionella jamestowniensis, 'Candidatus confluentis, Mycobacterium conspicuum, Mycobacterium Legionella jeonii, , Legionella lansin cookii, Mycobacterium cosmeticum, Mycobacterium diern gensis, , , hoferi, Mycobacterium doricum, Mycobacterium du valii, , , Legionella Mycobacterium elephantis, Mycobacterium fallax, Myco micdadei, , , bacterium farcinogenes, Mycobacterium flavescens, Myco , , Legionella bacterium florentinum, Mycobacterium fluoroanthenivorans, pneumophila, , Legionella quinliva Mycobacterium fortuitum, Mycobacterium fortuitum Subsp. nii, , , Acetamidolyticum, Mycobacterium federiksbergense, , , Legionella Mycobacterium gadium, Mycobacterium gastri, Mycobacte Shakespearei, , Legionella Steiger rium genavense, Mycobacterium gilvium, Mycobacterium waltii, , , goodi, Mycobacterium gordonae (Mycobacterium aquae), , , Legionella Mycobacterium haemophilum, Mycobacterium hassiacum, worsleiensis, , Leminorella species, Mycobacterium heckeshornense, Mycobacterium heidelber Leptospira species: Leptospira interrogans, Leptospira kir gense, Mycobacterium hiberniae, Mycobacterium hodleri, Schneri, Leptospira noguchii, Leptospira alexanderi, Lep Mycobacterium holsaticum, Mycobacterium houstonense, to spira weilii, Leptospira genomospecies 1, Leptospira borg Mycobacterium immunogenium, Mycobacterium interjectum, petersenii, Leptospira Santarosai, Leptospira inadai, Mycobacterium intermedium, Mycobacterium intracellulare, Leptospira fainei, Leptospira broomii, Leptospira licerasiae, Mycobacterium kansasii, Mycobacterium komossense, Leptospira biflexia, Leptospira meyeri, Leptospira wolbachii, Mycobacterium kubicae, Mycobacterium kumamotonense, Leptospira genomospecies 3, Leptospira genomospecies 4. Mycobacterium lacus, Mycobacterium lentiflavum, Myco Leptospira genomospecies 5; Lepromatous (Daniels bacterium leprae (causes leprosy or Hansen disease/Hans sen-Boeck disease), Leptospira canicola, Leptospira hebdo eniasis), Mycobacterium lepraemurium, Mycobacterium madis, (Weil disease/Leptospira icterohaemor madagascariense, Mycobacterium mageritense, Mycobacte rhagiae/Leptospira interrogans SeFOOF rium malmoense, Mycobacterium marinum (Fish tank granu icterohaemorrhagiae), Leptotrichia, Leuconostoc species: loma), Mycobacterium massiliense, Mycobacterium microti, Leuconostoc carnosum, Leuconostoc citreum, Leuconostoc Mycobacterium monacense, Mycobacterium montefiorense, durionis, Leuconostoc fallax, Leuconostocficulneum, Leu Mycobacterium moriokaense, Mycobacterium mucogeni conostoc fructosum, Leuconostoc garlicum, Leuconostoc cum, Mycobacterium murale, Mycobacterium nebraskense, gasicomitatum, Leuconostoc gelidum, Leuconostoc inhae, Mycobacterium neoaurum, Mycobacterium newOrleansense, Leuconostoc kimchii, Leuconostoc lactis, Leuconostoc Mycobacterium nonchromogenicum, Mycobacterium novo mesenteroides, Leuconostoc pseudoficulneum, Leuconostoc castrense, Mycobacterium obuense, Mycobacterium palus pseudomesenteroides, Listeria species: Listeria grayi, List tre, Mycobacterium parafortuitum, Mycobacterium paras eria innocua, Listeria ivanovii, Listeria monocytogenes crofulaceum, Mycobacterium parmense, Mycobacterium (), Listeria Seeligeri, Listeria wellshimeri; Metha peregrinum, Mycobacterium phlei, Mycobacterium phocai nobacterium extroquens, Microbacterium multiforme, cum, Mycobacterium pinnipedii, Mycobacterium porcinum, Micrococcus species: Micrococcus antarcticus, Micrococcus Mycobacterium poriferae, Mycobacterium pseudoshottsii, flavus, Micrococcus luteus, Micrococcus lylae, Micrococcus Mycobacterium pulveris, Mycobacterium psychrotolerans, mucilaginosis, Micrococcus roseus, Micrococcus seden Mycobacterium pyrenivorans, Mycobacterium rhodesiae, tarius, Mobiluncus, Moellerella species, Morganella species, Mycobacterium Saskatchewanense, Mycobacterium scrofit Moraxella species: Moraxella atlantae, Moraxella boevrei, laceum, Mycobacterium Senegalense, Mycobacterium Seou , Moraxella canis, Moraxella caprae, lense, Mycobacterium septicum, Mycobacterium Shimoidei, (Branhamella catarrhalis), Moraxella Mycobacterium shottsii, Mycobacterium simiae, Mycobacte caviae, Moraxella cuniculi, Moraxella equi, Moraxella lacu rium Smegmatis, Mycobacterium sphagni, Mycobacterium nata, Moraxella lincolnii, Moraxella nonliquefaciens, Szulgai, Mycobacterium terrae, Mycobacterium the rmore Moraxella Oblonga, Moraxella Osloensis, Moraxella saccha sistibile, Mycobacterium tokaiense, Mycobacterium triplex, rolytica, Morganella morganii, Mycobacterium species: Mycobacterium triviale, Mycobacterium tuberculosis (major Mycobacterium abscessus, Mycobacterium africanum, cause of human tuberculosis), Mycobacterium bovis, Myco Mycobacterium agri, Mycobacterium aichiense, Mycobacte bacterium africanum, Mycobacterium canetti, Mycobacte rium alvei, Mycobacterium arupense, Mycobacterium asiati rium caprae, Mycobacterium pinnipedii, Mycobacterium cum, Mycobacterium aubagnense, Mycobacterium aurum, tusciae, Mycobacterium ulcerans (causes Bairnsdale ulcer/ Mycobacterium austroafricanum, Mycobacterium avium ), Mycobacterium vaccae, Mycobacterium van (Battey disease/Lady Windermere syndrome), Mycobacte baalenii, Mycobacterium wolinskyi, Mycobacterium xenopi; rium avium paratuberculosis (implicated in Crohn's disease Mycoplasma species: Mycoplasma fermentans, Mycoplasma in humans and Johne's disease in sheep), Mycobacterium genitalium, Mycoplasma hominis, Mycoplasma penetrans, avium Silvaticum, Mycobacterium avium "hominissuis', Mycoplasma phocacerebrale, Mycoplasma pneumoniae, Mycobacterium colombiense, Mycobacterium boenickei, Nanukayami (Seven-day fever/Gikiyami), Neisseria species: Mycobacterium bohemicum, Mycobacterium boiletii, Myco Neisseria gonorrhoea (Gonococcus/), Neisseria bacterium botniense, Mycobacterium bovis (Bovine tubercu meningiditis (Meningococcus), Neisseria sicca, Neisseria losis), Mycobacterium branderi, Mycobacterium brisban cinerea, Neisseria elongata, Neisseria flavescens, Neisseria ense, Mycobacterium brumae, Mycobacterium canariasense, lactanica, Neisseria mucosa, Neisseria polysaccharea, Neis Mycobacterium caprae, Mycobacterium cellatum, Mycobac seria subflava, Nitrobacter species, Nocardia species: terium chelonae, Mycobacterium chimaera, Mycobacterium Nocardia asteroides, Nocardia brasiliensis, Nocardia US 2015/0376685 A1 Dec. 31, 2015

caviae; Noma (cancrum oriS/gangrenous stomatitis), Obe Pseudomonas viridiflava, Pseudomonas abietaniphila, sumbacterium, Oligotropha species, Pseudomonas acidophila, Pseudomonas agarici, Pseudomo (Scrub ), Oxalobacter formigenes, Pantoea species: nas alcaliphila, Pseudomonas alkanolytica, Pseudomonas Pantoea agglomerans, Pantoea ananatis, Pantoea citrea, amyloderamosa, Pseudomonas asplenii, Pseudomonas azo Pantoea dispersa, Pantoea punctata, Pantoea Stewartii, Pan tifigens, Pseudomonas cannabina, Pseudomonas coenobios, toea terrea, Pasteurella species: Pasteurella aerogenes, Pas Pseudomonas congelans, Pseudomonas costantinii, teurella anatis, Pasteurella avium, Pasteurella bettvae, Pas Pseudomonas cruciviae, Pseudomonas delhiensis, teurella caballi, , , Pseudomonas excibis, Pseudomonas extremorientalis, Pasteurella gallicida, Pasteurella gallinarum, Pasteurella Pseudomonas federiksbergensis, Pseudomonas fiscovagi granulomatis, Pasteurella langaaensis, Pasteurella lymphan nae, Pseudomonas gelidicola, Pseudomonas grimontii, gitidis, Pasteurella mairii, , Pasteurella Pseudomonas indica, Pseudomonas jessenii, Pseudomonas pneumotropica, Pasteurella Skyensis, , injuensis, Pseudomonas kilomensis, Pseudomonas knack Pasteurella testudinis, Pasteurella trehalosi, Pasteurella tulla mussii, Pseudomonas koreensis, Pseudomonas lini, rensis, Pasteurella ureae, Pasteurella volantium, Pediococ Pseudomonas lutea, Pseudomonas moraviensis, Pseudomo cus species: Pediococcus acidilactici, Pediococcus cellicola, nas Otitidis, Pseudomonas pachastrellae, Pseudomonas pal Pediococcus claussenii, Pediococcus damnosus, Pediococ leroniana, Pseudomonas papaveris, Pseudomonas peli, cus dextrinicus, Pediococcus ethanolidurans, Pediococcus Pseudomonas perolens, Pseudomonas poae, Pseudomonas inopiniatus, Pediococcus parvulus, Pediococcuspentosaceus, pohangensis, Pseudomonas psychrophila, Pseudomonas Pediococcus stilesii Peptostreptococcus species: Peptostrep psychrotolerans, Pseudomonas rathonis, Pseudomonas rep tococcus anaerobius, Peptostreptococcus asaccharolyticus, tilivora, Pseudomonas resiniphila, Pseudomonas Peptostreptococcus harei, Peptostreptococcus hydrogenalis, rhizosphaerae, Pseudomonas rubescens, Pseudomonas Peptostreptococcus indoliticus, Peptostreptococcus ivorii, Salomonii, Pseudomonas segitis, Pseudomonas septica, Peptostreptococcus lacrimalis, Peptostreptococcus lactolyti Pseudomonas simiae, Pseudomonas suis, Pseudomonas ther cus, Peptostreptococcus magnus, Peptostreptococcus micros, motolerans, Pseudomonas tremae, Pseudomonas trivialis, Peptostreptococcus Octavius, Peptostreptococcus previotii, Pseudomonas turbinellae, Pseudomonas tuticorinensis, Peptostreptococcus tetradius, Peptostreptococcus vaginalis, Pseudomonas unsongensis, Pseudomonas vancouverensis, Photorhabdus species, Photorhizobium species, Plesiomo Pseudomonas Vranovensis, Pseudomonas xanthomarina, nas Shigelloides, Porphyromonas gingivalis, Pragia species, Rahnella species, Ralstonia species: Ralstonia basilensis, Prevotella, Propionibacterium species: Propionibacterium Ralstonia campinensis, Ralstonia eutropha, Ralstonia gilar acnes, Propionibacterium propionicus, Proteus species: Pro dii, Ralstonia insidiosa, Ralstonia mannitolilytica, Ralstonia teus mirabilis, Proteus morganii, Proteus penneri, Proteus metallidurans, Ralstonia paucula, Ralstonia pickettii, Ral rettgeri, , Providencia species: Providencia stonia respiraculi, Ralstonia Solanacearum, Ralstonia syzy friedericiana, , Pseudomonas species: gii, Ralstonia taiwanensis, Raoultella species, Rhodoblastus , Pseudomonas alcaligenes, species, Rhodopseudomonas species, , Rhizo Pseudomonas anguilliseptica, Pseudomonas argentinensis, bium radiobacter, Rhodococcus equi, Rickettsia species: Pseudomonas borbori, Pseudomonas citronellolis, , , , Rick Pseudomonas flavescens, Pseudomonas mendocina, ettsia Conorii, , , Rickettsia Pseudomonas nitroreducens, Pseudomonas Oleovorans, mooseri, (Typhus fever), Rickettsia Pseudomonas pseudoalcaligenes, Pseudomonas resino rickettsii, Rickettsia Siberica, , Rickettsia vorans, Pseudomonas Straminea, Pseudomonas aurantiaca, Conorii, Rickettsia africae, Rickettsia psittaci, Rickettsia Pseudomonas aureofaciens, Pseudomonas chlororaphis, quintana, , Rickettsia trachomae, Rothia Pseudomonas fragi, Pseudomonas lundensis, Pseudomonas dentocariosa, Salmonella species: Salmonella arizonae, Sal taetrolens, Pseudomonas Antarctica, Pseudomonas azotofor monella Bongori, , Salmonella enteridi mans, Pseudomonas brassicacearum, Pseudomonas bren tis, Salmonella paratyphi, Salmonella typhi (), neri, Pseudomonas Cedrina, Pseudomonas corrugate, Salmonella typhimurium, Salmonella Salamae, Salmonella Pseudomonas fluorescens, Pseudomonas gessardii, arizonae, Salmonella diarizonae, Salmonella houtenae, Sal Pseudomonas libanensis, Pseudomonas mandelii, monella indica, species, Serratia species: Serratia Pseudomonas marginalis, Pseudomonas mediterranea, entomophila, Serratia ficaria, Serratia fonticola, Serratia Pseudomonas meridiana, Pseudomonas migulae, grimesii, Serratia liquefaciens, , Serra Pseudomonas mucidolens, Pseudomonas Orientalis, tia Odoriferae, Serratia plvmuthica, Serratia proteamacu Pseudomonas panacis, Pseudomonas proteolytica, lans, Serratia quinivorans, Serratia rubidaea, Serratia ure Pseudomonas rhodesiae, Pseudomonas synxantha, ilytica, Shewanella putrefaciens, , Shigella Pseudomonas thivervalensis, Pseudomonas tolaasii, dysenteriae, , , Sodalis spe Pseudomonas veronii, Pseudomonas denitrificans, cies, Spirillum species: Spirillum minus ratbite fever, Staphy Pseudomonas pertucinogena, Pseudomonas Cremoricolo lococcus species: Staphylococcus aureus, Staphylococcus rata, Pseudomonas fulva, Pseudomonas monteilii, auricularis, Staphylococcus capitis, Staphylococcus Caprae, Pseudomonas mosselii, Pseudomonas Oryzihabitans, Staphylococcus cohnii, Staphylococcus epidermidis, Staphy Pseudomonas parafiulva, Pseudomonas plecoglossicida, lococcus felis, Staphylococcus haemolyticus, Staphylococcus Pseudomonas putida, Pseudomonas balearica, Pseudomo hominis, Staphylococcus intermedius, Staphylococcus lug nas luteola, Pseudomonas Stutzeri, Pseudomonas amygdale, dunensis, Staphylococcus pettenkoferi, Staphylococcus Pseudomonas avellanae, Pseudomonas Caricapapayae, Saprophyticus, Staphylococcus Schleiferi, Staphylococcus Pseudomonas cichorii, Pseudomonas coronafaciens, simulans, Staphylococcus vitulus, Staphylococcus warneri, Pseudomonas ficuserectae, Pseudomonas meliae, Staphylococcus xylosus, Stenotrophomonas species: Pseudomonas Savastanoi, Pseudomonas syringae, Stenotrophomonas acidaminiphila, Stenotrophomonas dok US 2015/0376685 A1 Dec. 31, 2015

donensis, Stenotrophomonas koreensis, Stenotrophomonas ing bacteria can be found in standard laboratory manuals, maltophilia, Stenotrophomonas nitritireducens, Stenotroph such as Molecular Cloning, M. Green, and J. Sambrook Omonas rhizophila, Streptobacillus species: Streptobacillus (Fourth Edition), 2012, Cold Spring Harbor Laboratory Press moniliformis (Streptobacillary rat bite fever); Streptococcus and Manual of Clinical Microbiology, 10" Edition, Ed. J. species: Streptococcus Group A, Streptococcus Group B, Versalovic, John Wiley & Sons, Inc. Streptococcus agalactiae, Streptococcus aginosus, Strepto 0063 Promoter Region coccus avium, Streptococcus bovis, Streptococcus canis, 0064. It is contemplated herein that analysis of a single Streptococcus Cricetus, Streptococcus faceium, Streptococ locus, the 16S operon promoter region can be predictive of the cus faecalis, Streptococcus ferus, Streptococcus gallinarum, species or strain of infectious or contaminating bacteria in a Streptococcus lactis, Streptococcus milleri, Streptococcus sample. In various embodiments, the promoter region com mition; Streptococcus mitis, Streptococcus mutans, Strepto prises a portion of the 16S rDNA and regions upstream of the coccus oralis, Streptococcus peroris, Streptococcus pneumo 16S rDNA. In one embodiment, the promoter region is niae, Streptococcus pyogenes, Streptococcus ratti, Strepto approximately 250 to 450 nucleotides in length. It is contem coccus salivarius, Streptococcus sanguinis, Streptococcus plated that the promoter region is approximately, 250, 275, sobrinus, Streptococcus parasanguinis, Streptococcus suis, 300, 325,350,375,400, 425 or 450 base pairs. It is contem Streptococcus thermophilus, Streptococcus vestibularis, plated that upstream nucleotides of from 200-500 base pairs, Streptococcus viridans, Streptococcus uberis, Streptococcus from 300-400 base pairs, or approximately 200, 250, 300, ZOOepidemicus, Tatumella species, Trabulsiella species, Tre 350, 400, 450, 500, 550 or 600 base pairs. It is contemplated ponema species: Treponema carateum (), Treponema that the sequenced product is approximately 400-1200 nucle denticola, Treponema endemicum (Beel), Treponema palli otides in length, or approximately 500-1000, 600-1200, 400 dum (), Treponema pertenue (); Tropheryma 700, 600-800 base pairs or approximately, 400, 450, 500, 550, whipplei (Whipple disease), , Urea 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050 or 1100 plasma urealyticum, Veillonella, Vibrio species: Vibrio aero base pairs, or any range in between. In various embodiments, genes, Vibrio aestuarianus, Vibrio agarivorans, Vibrio alben the sequenced product is approximately 600-1200 nucle sis, , Vibrio brasiliensis, Vibrio calviensis, otides in length. Vibrio Campbellii, Vibrio chagasii, (Cholera), Vibrio cincinnatiensis, Vibrio Comma, Vibrio coralliilyticus, 0065 Antibacterial Agent Vibrio crassostreae, Vibrio cyclitrophicus, Vibrio diabolicus, 0066. It is contemplated herein that if a sample from a Vibrio diazotrophicus, Vibrio ezurae, Vibrio fischeri, Vibrio Subject is identified as having an infectious bacteria, the Sub fluvialis, Vibriofortis, Vibrio furnissii, Vibrio gallicus, Vibrio ject can be treated with one or more antibacterial agents. gazogenes, Vibrio gigantis, Vibrio hallioticoli, Vibrio harveyi, Antibacterial agents include antibiotics, silver salts thereof, Vibrio hepatarius, Vibrio hispanicus, Vibrio ichthyoenteri, organic acids as antimicrobials in food products, e.g. lactic Vibrio kanaloae, Vibrio lentus, Vibrio litoralis, Vibrio logei, acid, citric acid, acetic acid, and their salts and essential oils. Vibrio mediterranei, Vibrio metschnikovii, Vibrio mimicus, Exemplary antibiotics, include, but are not limited to, Ami Vibrio mytili, Vibrio matriegens, Vibrio navarrensis, Vibrio kacin disulfate salt, Amikacin hydrate, Anisomycin from neonatus, Vibrio neptunius, Vibrio nereis, Vibrio nigripul Streptomyces griseolus, Apramycin Sulfate salt, Azithromy chritudo, Vibrio ordalii, Vibrio Orientalis, Vibrio pacinii, cin, Blasticidine S hydrochloride, Brefeldin A, Brefeldin A , Vibrio pectenicida, Vibrio penaei from Penicillium brefeldianum, Butirosin sulfate salt, cida, Vibrio pomeroyi, Vibrio ponticus, Vibrio proteolyticus, Butirosin A from Bacillus vitellinus, Chloramphenicol, Vibrio rotiferianus, Vibrio ruber, Vibrio rumoiensis, Vibrio Chloramphenicol base, Chloramphenicol Succinate sodium salmonicida, Vibrio scophthalmi, Vibrio splendidus, Vibrio salt, Chlortetracycline hydrochloride, Chlortetracycline superstes, Vibrio tapetis, Vibrio tasmaniensis, Vibrio tubi hydrochloride from Streptomyces aureofaciens, Clindamycin ashii, , Vibrio wodanis, Vibrioxuii, Vogesella 2-phosphate, Clindamycin hydrochloride, Clotrimazole, indigofera, Wigglesworthia species, Wolbachia species, Cycloheximide from microbial, Demeclocycline hydrochlo ride, Dibekacin Sulfate salt, Dihydrostreptomycin sesquisul Xenorhabdus species, , Yersinia pestis, fate, Dihydrostreptomycin Solution, Doxycycline hyclate, Yersinia pseudotuberculosis, and Yokenella species. In vari Duramycin from Streptoverticillium cinnamoneus, Emetine ous embodiments, the method is used to identify bacteria set dihydrochloride hydrate), Erythromycin, Erythromycin USP out in FIG. 2. Erythromycin powder, Erythromycin, Temephos, Erythro 0061 Common foodbourne bacteria include, but are not mycinestolate, Erythromycin ethyl Succinate, Erythromycin limited to Aeromonas hydrophilia, Bacillus cereus, Campy standard solution, Erythromycin Stearate, Fusidic acid lobacter jejuni, Clostridium botulinum, Clostridium perfirin sodium salt, G 418 disulfate salt, G 418 disulfate salt powder, gens, enteropathogenic Escherichinia coli such as O157:H7 G 418 disulfate salt solution liquid, Gentamicin solution liq (EColi), Listeria monocytogenes, Salmonella, Shigella, Sta uid, Gentamicin solution, Gentamicin Sulfate Micromono phylococcus aureus, Vibrio (e.g., parahaemolyticus) and spora purpurea, Gentamicin Sulfate salt, Gentamicin Sulfate Yersinia enterocolitica. salt powder USP, Gentamicin-Glutamine solution liquid, 0062 Bacteria may be analyzed and sequenced directly Helvolic acid from Cephalosporium caerulens, Hygromycin from the sample without culture or may be cultured under B Streptomyces hygroscopicus, Hygromycin B Streptomyces appropriate conditions to grow the bacteria for use in the hygroscopicus powder, Hygromycin B solution Streptomyces sequencing analysis. In one embodiment, a bacteria from a hygroscopicus, Josamycin, Josamycin solution, Kanamycin sample may be cultured in an appropriate media, Such as LB B sulfate salt, Kanamycin disulfate salt from Streptomyces media, or a plate containing agar and the appropriate media. kanamyceticus, Kanamycin monosulfate from Streptomyces The media may also contain additives for bacterial growth, kanamyceticus, Kanamycin monosulfate from Streptomyces Such as glucose or other Sugars. The bacteria can be grown in kanamyceticus powder USP, Kanamycin solution from Strep liquid or solid culture overnight at 37°C. Methods for grow tomyces kanamyceticus, Kirromycin from Streptomyces col US 2015/0376685 A1 Dec. 31, 2015 linus, Lincomycin hydrochloride, Lincomycin standard solu acid, 7-Aminodesacetoxycephalosporanic acid, , tion, Meclocycline sulfosalicylate salt, Mepartricin, Ampicillin, Ampicillin Sodium salt, Ampicillin trihydrate, Midecamycin from Streptomyces mycarofaciens, Minocy Ampicillin trihydrate USP, AZlocillin sodium salt, Bacitracin cline hydrochloride crystalline, Neomycin solution, Neomy Bacillus licheniformis, Bacitracin Zinc salt Bacillus licheni cin trisulfate salt hydrate, Neomycin trisulfate salt hydrate formis, Carbenicillin disodium salt, Cefaclor, Cefamandole powder, Neomycin trisulfate salt hydrate USP powder, lithium salt, Cefamandole nafate, Cefamandole Sodium salt, Netilmicin sulfate salt, Nitrofurantoin crystalline, Nourseo Cefazolin sodium salt, Cefinetazole sodium salt, Cefopera thricin Sulfate, Oleandomycin phosphate salt, Oleandomycin Zone sodium salt, Cefotaxime Sodium salt, Cefsulodin triacetate, Oxytetracycline dihydrate, Oxytetracycline hemi sodium salt, Cefsulodin sodium salt hydrate, Ceftriaxone calcium salt, Oxytetracycline hydrochloride, Paromomycin Sodium salt, Cephalexin hydrate, Cephalosporin C Zinc salt, sulfate salt, Puromycin dihydrochloride from Streptomyces Cephalothin Sodium salt, Cephapirin Sodium salt, Cephra alboniger, Rapamycin from Streptomyces hygroscopicus, dine, Cloxacillin sodium salt, Cloxacillin sodium salt mono Ribostamycin sulfate salt, Rifampicin, Rifamycin SV sodium hydrate, D-Penicillamine hydrochloride, D-Cycloserine salt, Rosamicin Micromonospora rosaria, Sisomicin Sulfate microbial, D-Cycloserine powder, Dicloxacillin sodium salt salt, Spectinomycin dihydrochloride hydrate, Spectinomycin monohydrate, D-Penicillamine, Econazole nitrate salt, dihydrochloride hydrate powder, Spectinomycin dihydro Ethambutol dihydrochloride, Lysostaphin from Staphylococ chloride pentahydrate, Spiramycin, Spiramycin from Strep cus staphylolyticus, Moxalactam Sodium salt, Nafcillin tomyces sp., Spiramycin solution, Streptomycin solution, sodium salt monohydrate, Nikkomycin, Nikkomycin ZStrep Streptomycin sulfate salt, Streptomycin sulfate salt powder, tomyces tendae, Nitrofurantoin crystalline, Oxacillin Sodium , Tetracycline hydrochloride, Tetracycline salt, Penicillic acid powder, Penicillin G potassium salt, Peni hydrochloride USP. Tetracycline hydrochloride powder, cillin G potassium salt powder, Penicillin G potassium salt, Thiamphenicol. Thiostrepton from Streptomyces azureus, Penicillin G sodium salt hydrate powder, Penicillin G sodium Tobramycin, Tobramycin Sulfate salt, Tunicamycin A salt powder, Penicillin G sodium salt, Phenethicillin potas homolog, Tunicamycin C homolog, Tunicamycin Strepto sium salt, Phenoxymethylpenicillinic acid potassium salt, myces sp., Tylosin Solution, Tylosin tartrate, Viomycin Sul Phosphomycin disodium salt, Pipemidic acid, Piperacillin fate salt, Virginiamycin M, (S)-(+)-Camptothecin, Sodium salt, Ristomycin monosulfate, Vancomycin hydro 10-Deacetylbaccatin III from Taxus baccata, 5-AZacytidine, chloride from Streptomyces orientalis, 2-Mercaptopyridine 7-Aminoactinomycin D, 8-Quinolinol crystalline, 8-Quino N-oxide sodium salt, 4-Bromocalcimycin A23 187 Bio linol hemisulfate salt crystalline, 9-Dihydro-13-acetylbacca Chemika, Alamethicin Trichoderma viride, Amphotericin B tin III from Taxus Canadensis, Aclarubicin, Aclarubicin Streptomyces sp., Amphotericin B preparation, Calcimycin hydrochloride, Actinomycin D from Streptomyces sp., Acti A23 187, Calcimycin A23 187 hemicalcium-magnesium) nomycin I from Streptomyces antibioticus, Actinomycin V salt, Calcimycin A23 187 hemicalcium salt, Calcimycin from Streptomyces antibioticus, Aphidicolin Nigrospora A23.187 hemimagnesium salt, Chlorhexidine diacetate salt sphaerica, Bafilomycin A1 from Streptomyces griseus, Bleo monohydrate, Chlorhexidine diacetate salt hydrate, Chlo mycin Sulfate from Streptomyces verticillus, Capreomycin rhexidine digluconate, Clotrimazole, Colistin Sodium meth Sulfate from Streptomyces capreolus, Chromomycin As anesulfonate, Colistin Sodium methanesulfonate from Bacil Streptomyces griseus, Cinoxacin, Bio lus colistinus, Colistin Sulfate salt, Econazole nitrate salt, Chemika, cis-Diammineplatinum(II) dichloride, Coumermy Hydrocortisone 21-acetate, Filipin complex Streptomyces fil cin A1, Cytochalasin B Helminthosporium dematioideum, ipinensis, Gliotoxin from Gliocladium fimbriatum, Gramici Cytochalasin D Zygosporium mansonii, Dacarbazine, din A from Bacillus brevis, Gramicidin C from Bacillus Daunorubicin hydrochloride, Daunorubicin hydrochloride brevis, Gramicidin from Bacillus aneurinolyticus (Bacillus USP Distamycin A hydrochloride from Streptomyces distal brevis), lonomycin calcium salt Streptomyces conglobatus, licus, Doxorubicin hydrochloride, Echinomycin, Echinomy Lasalocid A Sodium salt, Lonomycin A Sodium salt from cin BioChemika, Enrofloxacin BioChemika, Etoposide, Eto Streptomyces ribosidificus, Monensin sodium salt, N-(6- poside Solid, Flumequine, Formycin, Fumagillin from Aminohexyl)-5-chloro-1-naphthalenesulfonamide hydro Aspergillus fumigatus, Ganciclovir, Gliotoxin from Gliocla chloride, Narasin from Streptomyces auriofaciens, Nigericin dium fimbriatum, Lomefloxacin hydrochloride, Metronida Sodium salt from Streptomyces hygroscopicus, Nisin from Zole purum, Mithramycin A from Streptomyces plicatus, Streptococcus lactis, Nonactin from Streptomyces sp., Nys Mitomycin C Streptomyces caespitosus, Nalidixic acid, Nali tatin, Nystatin powder, Phenazine methosulfate, Pimaricin, dixic acid sodium salt, Nalidixic acid sodium salt powder, Pimaricin from Streptomyces chattanoogensis, Polymyxin B Netropsin dihydrochloride hydrate, Nitrofurantoin, Nogala solution, Polymyxin B sulfate salt, DL-Penicillamine acetone mycin from Streptomyces nogalater, Nonactin from Strepto adduct hydrochloride monohydrate, Polymyxin B sulfate salt myces tsusimaensis, Novobiocin Sodium salt, Ofloxacin, powder USP, Praziquantel, Salinomycin from Streptomyces Oxolinic acid, Paclitaxel from Taxus vannanensis, Paclitaxel albus, Salinomycin from Streptomyces albus, Surfactin from from Taxus brevifolia, Phenazine methosulfate, Phleomycin Bacillus subtilis, Valinomycin, (+)-USnic acid from Usnea Streptomyces verticillus, Pipemidic acid, Rebeccamycin dasypoga, (+-)-Miconazole nitrate salt, (S)-(+)-Camptoth from Saccharothrix aerocolonigenes, Sinefungin, Streptoni ecin, 1-Deoxymannojirimycin hydrochloride, 1-Deox grin from Streptomyces flocculus, Streptozocin, Succinylsul ynojirimycin hydrochloride, 2-Heptyl-4-hydroxyquinoline fathiazole, Sulfadiazine, Sulfadimethoxine, Sulfaguanidine N-oxide, Cordycepin, 1,10-Phenanthroline hydrochloride purum, Sulfamethazine, Sulfamonomethoxine, Sulfanil monohydrate puriss., 6-Diazo-5-oxo-L-norleucine, 8-Quino amide, Sulfaquinoxaline sodium salt, Sulfasalazine, Sul linol crystalline, 8-Quinolinol hemisulfate salt, Antimycin A fathiazole sodium salt, Trimethoprim, Trimethoprim lactate from Streptomyces sp., Antimycin A, Antimycin A, Anti salt, Tubercidin from Streptomyces tubercidicus, 5-AZacyti mycin A, Antipain, Ascomycin, AZaserine, Bafilomycin A1 dine, Cordycepin, Formycin A, (+)-6-Aminopenicillanic from Streptomyces griseus, Bafilomycin B1 from Streptomy US 2015/0376685 A1 Dec. 31, 2015 ces species, Cerulenin BioChemika, Chloroquine diphos in, for example, one or more memories or other computer phate salt, Cinoxacin, Ciprofloxacin, Mevastatin Bio readable medium and implemented on one or more proces Chemika, Concanamycin A, Concanamycin A Streptomyces sors. As is known, the processors may be associated with one sp, Concanamycin C from Streptomyces species, Coumermy or more controllers, calculation units and/or other units of a cin A1, Cyclosporin A from Tolypocladium inflatum, computer system, or implanted in firmware as desired. If Cyclosporin A, Econazole nitrate salt, Enrofloxacin, Etopo implemented in Software, the routines may be stored in any side, Flumequine, Formycin A, Furazolidone, Fusaric acid computer readable memory such as in RAM, ROM, flash from Gibberellafiujikuroi, Geldanamycin from Streptomyces memory, a magnetic disk, a laser disk, or other storage hygroscopicus, Gliotoxin from Gliocladium fimbriatum, medium, as is also known Likewise, this software may be Gramicidin Afrom Bacillus brevis, Gramicidin C from Bacil delivered to a computing device via any known delivery lus brevis, Gramicidin from Bacillus aneurinolyticus (Bacil method including, for example, over a communication chan lus brevis), Gramicidin from Bacillus brevis, Herbimycin A nel Such as a telephone line, the Internet, a wireless connec from Streptomyces hygroscopicus, Indomethacin, Irgasan, tion, etc., or via a transportable medium, Such as a computer Lomefloxacin hydrochloride, Mycophenolic acid powder, readable disk, flash drive, etc. Myxothiazol BioChemika, N-(6-Aminohexyl)-5-chloro-1- 0073 More generally, and as understood by those of ordi naphthalenesulfonamide hydrochloride, Nalidixic acid, nary skill in the art, the various steps described above may be Netropsin dihydrochloride hydrate, Niclosamide, Nikkomy implemented as various blocks, operations, tools, modules cin BioChemika, Nikkomycin Z Streptomyces tendae, and techniques which, in turn, may be implemented in hard N-Methyl-1-deoxynojirimycin, Nogalamycin from Strepto ware, firmware, Software, or any combination of hardware, myces nogalater, Nonactin.cquadrature.80% from Streptomy firmware, and/or software. When implemented in hardware, ces tsusimaensis, Nonactin from Streptomyces sp., Novobio Some or all of the blocks, operations, techniques, etc. may be cin Sodium salt, Ofloxacin, Oleandomycin triacetate, implemented in, for example, a custom integrated circuit Oligomycin Streptomyces diastatochromogenes, Oligomycin (IC), an application specific integrated circuit (ASIC), a field A, Oligomycin B. Oligomycin C, Oligomycin Streptomyces programmable logic array (FPGA), a programmable logic diastatochromogenes, OXolinic acid, Piericidin Afrom Strep array (PLA), etc. tomyces mobaraensis, Pipemidic acid, Radicicol from Dihet 0074. When implemented in software, the software may erospora chlamydosporia Solid, Rapamycin from Streptomy be stored in any known computer readable medium Such as on ces hygroscopicus, Rebeccamycin from Saccharothrix a magnetic disk, an optical disk, or other storage medium, in aerocolonigenes, Sinefitingin, Staurosporine Streptomyces a RAM or ROM or flash memory of a computer, processor, sp., Stigmatellin, Succinylsulfathiazole, Sulfadiazine, Sul hard disk drive, optical disk drive, tape drive, etc. Likewise, fadimethoxine, Sulfaguanidine purum, Sulfamethazine, Sul the Software may be delivered to a user or a computing system famonomethoxine, Sulfanilamide, Sulfaquinoxaline sodium via any known delivery method including, for example, on a salt, Sulfasalazine, Sulfathiazole sodium salt, Triacsin C from computer readable disk or other transportable computer Stor Streptomyces sp., Trimethoprim, Trimethoprim lactate salt, age mechanism. Vineomycin A, from Streptomyces albogriseolus Subsp., Tec 0075 An exemplary system of the invention, which may torigenin, and Paracelsin Trichoderma reesei. be used to implement one or more steps of methods of the 0067. Database invention, includes a computing device in the form of a com 0068 Determining the strain or species of bacteria in a puter. Components of computer may include, but are not sample can alternatively or additionally comprise comparing limited to, a processor, a system memory, a memory/graphics nucleic acid sequence data and/or protein sequence data interface, and an I/O interface. The system memory and a (genotype data) to a database containing correlation data graphics processor may be coupled to the memory/graphics between promoterseuqence characteristics described herein interface. A monitor or other graphic output device may be and identification of a bacterial strain and/or species. The coupled to the graphics processor. database can be part of a computer-readable medium 0076. The system memory includes computer storage described herein. media in the form of volatile and/or nonvolatile memory such 0069. In a specific aspect of the invention, the database as read only memory (ROM) and random access memory comprises at least one measure of identification of the bacte (RAM). The system ROM may contain permanent system ria in the sample. For example, the database may comprise data, such as identifying and manufacturing information. In assessment tools for analyzing G/C content, distance from the Some embodiments, a basic input/output system (BIOS) may origin of replication, etc., associated with particular bacterial also be stored in system ROM. RAM typically contains data strains and species. The database may also encompass use of and/or program modules that are immediately accessible to Such assessment tools with particular combinations for mul and/or presently being operated on by processor. tiple such parameters. 0077. The computer may also include removable/non-re 0070. In another specific aspect of the invention, the data movable, Volatile/nonvolatile computer storage media. By base comprises a look-up table containing at least one of the way of example only, the system contemplates a hard disk aforementioned parameters for bacterial identification based drive that reads from or writes to non-removable, nonvolatile on the 16S rDNA promoter sequence. magnetic media. The hard disk drive may be a conventional 0071 Computer-Implemented Aspects hard disk drive. 0072. As understood by those of ordinary skill in the art, 0078 Removable media, such as a universal serial bus the methods and information described herein may be imple (USB) memory, firewire (IEEE 1394), or CD/DVD drive may mented, in all or in part, as computer executable instructions be connected to the computer directly or through an interface. on known computer readable media. For example, the meth A storage media may be coupled through interface. Other ods described herein may be implemented inhardware. Alter removable/non-removable, volatile/nonvolatile computer natively, the method may be implemented in software stored storage media that can be used in the exemplary operating US 2015/0376685 A1 Dec. 31, 2015

environment include, but are not limited to, magnetic tape stored on a computer-readable medium of the system and cassettes, flash memory cards, digital versatile disks, digital adapted to be executed on a processor of the system, to receive video tape, solid state RAM, solid state ROM, and the like. a data input about a sample and determine information about 007.9 The drives and their associated computer storage the promoter Seuqence. For example, the measurement tool media discussed, provide storage of computer readable 206 contains instructions, preferably executable on a proces sor of the system, for analyzing the unannotated input data instructions, data structures, program modules and other data and determining a characteristic of the promoter sequence for the computer. For example, a hard disk drive may store an sufficient to help in prediction of the bacterial species and/or operating system, application programs, other program mod strain. ules, and program data. A user may enter commands and I0087. In yet another variation, the input 204 from the information into the computer through input devices Such as sample comprises a biological sample, Such as a fluid (e.g., a mouse/keyboard or other input device combination. blood) or tissue sample that contains genetic material of the 0080. The computer may operate in a networked environ bacteria that can be analyzed to determine the promoter ment using logical connections to one or more remote com sequence. In this variation, an exemplary measurement tool puters, such as a remote computer via a network interface 206 includes laboratory equipment for processing and ana controller (NIC). The remote computer may be a personal lyzing the sample to determine the nuelcotide sequence or computer, a server, a router, a network PC, a peer device or other parameter of the promoter sequence. other common network node, and typically includes many or 0088. In some variations the measurement tool 206 all of the elements described above relative to the computer. includes: a nucleotide sequencer (e.g., an automated DNA The connection between the NIC 170 and the remote com sequencer) that is capable of determining nucleotide puter may include a local area network (LAN), a wide area sequence information from nucleic acid obtained from or network (WAN), or both, but may also include other net amplified from the biological sample; and an analysis tool works. Such networking environments are commonplace in stored on a computer-readable medium of the system and offices, enterprise-wide computer networks, intranets, and adapted to be executed on a processor of the system, to deter the Internet. The remote computer may also represent a web mine the presence or absence of the at least one marker allele server Supporting interactive sessions with the computer, or in based on the nucleotide sequence information. 0089. In some variations, the measurement tool 206 fur the specific case of location-based applications may be a ther includes additional equipment and/or chemical reagents location server or an application server. for processing the biological sample to purify and/or amplify 0081. In some embodiments, the network interface may nucleic acid of the bacteria for further analysis using a use a modem when abroadband connection is not available or Sequencer or other analytical equipment. is not used. It will be appreciated that the network connection 0090 The exemplary system further includes an analysis shown is exemplary and other means of establishing a com tool or routine 210 that: is operatively coupled to the predict munications link between the computers may be used. ability database 204 and operatively coupled to the measure 0082 In some variations, the system includes tools for ment tool 206, is stored on a computer-readable medium of performing at least one step, preferably two or more steps, the system, is adapted to be executed on a processor of the and in Some aspects all steps of a method of the invention, system to compare the information about the sample with the where the tools are operably linked to each other. Operable sequence information in the predictive database and generate linkage describes a linkage through which components can a conclusion with respect to species and/or strain of bacteria function with each other to perform their purpose. in a sample. In simple terms, the analysis tool looks at the 0083) Referring to FIG. 1, an exemplary system includes a promoter sequence characteristics as described herein by the predictability database 208 that is operatively coupled to a measurement tool, and compares this information to the pre dictive database, to determine a species and/or strain of the computer-readable medium of the system and that contains bacteria. The prediction can be based on a single parameter, or information correlating the 16S promoter sequence and pre multiple parameters, as described above, that is collected and dictability as to the species and/or strain of bacteria. included as part of the input 204 from the sample, and that 0084. In a simple variation, the predictability database 208 also is stored in the predictive database with respect to a contains data relating to the frequency that a particular char population of other bacteria. Generally speaking, each acteristic described herein has been observed in a population parameter of interest is weighted to provide a conclusion with of bacteria. Such data provides an prediction as to the species respect to determination of bacterial species and/or strain. and/or strain of bacteria. In another variation, the predictabil Such a conclusion is expressed in the conclusion in any sta ity database includes similar data with respect to two or more tistically useful form. characteristics, thereby providing a useful reference if the 0091. In some variations of the invention, the system as bacteria has any of the analyzed parameters. just described further includes a communication tool 212. For I0085. In addition to the predictability database 208, the example, the communication tool 212 is operatively con system further includes a measurement tool 206 programmed nected to the analysis routine 210 and comprises a routine to receive an input 204 from or about the sample and generate stored on a computer-readable medium of the system and an output that contains information about the promoter Seqe adapted to be executed on a processor of the system, to: unce. (The input 204 is not part of the system per se but is generate a communication containing the conclusion; and to illustrated in the schematic FIG. 1.) Thus, the input 204 will transmit the communication to a laboratory worker or medi contain a sample or contain data from which the sequence of cal practitioner, and/or enable the worker or medical practi the promoter can be directly read, or analytically determined. tioner to access the communication. In some variations, the I0086. In another variation, the input 204 from the sample communication is provided in a tangible form, Such as a contains data that is unannotated or insufficiently annotated printed report or report stored on a computer readable with respect parameters for predicting the bacterial Strain medium Such as a flash drive or optical disk. In some varia and/or species in the sample. In Such variations of the inven tions, the communication is provided electronically with an tion, the measurement tool 206 comprises a tool, preferably output that is visible on a video display or audio output (e.g., US 2015/0376685 A1 Dec. 31, 2015

speaker). In some variations, the communication is transmit 0102) is stored on a computer-readable medium of the ted to the worker or the medical practitioner, e.g., electroni system, cally or through the mail. In some variations, the system is 0103) is adapted to be executed on a processor of the designed to permit the Subject or medical practitioner to system, to compare the information about the bacteria with access the communication, e.g., by telephone or computer. the promoter seeuqnce information in the predictive database For instance, the system may include software residing on a and generate a conclusion with respect to species and/or memory and executed by a processor of a computer used by strain of bacteria in a sample. the worker or the medical practitioner, with which the subject 0104 Exemplary processors (processing units) include all or practitioner can access the communication, preferably variety of microprocessors and other processing units used in securely, over the internet or other network connection. In computing devices. Exemplary computer-readable media are some variations of the system, this computer will be located described above. When two or more components of the sys remotely from other components of the system, e.g., at a tem involve a processor or a computer-readable medium, the location of the worker's or medical practitioner's choosing. system generally can be created where a single processor 0092. In some variations of the invention, the system as and/or computer readable medium is dedicated to a single described (including embodiments with or without the com component of the system; or where two or more functions munication tool) further includes components that add a treat share a single processor and/or share a single computer read ment or prophylaxis utility to the system. For instance, value able medium, Such that the system contains as few as one is added to a determination of bacterial species and/or strain processor and/or one computer readable medium. In some when a medical practitioner can prescribe or administer a variations, it is advantageous to use multiple processors or standard of care that can reduce bacterial infection, e.g., media, for example, where it is convenient to have compo administration of an antibiotic as described herein. nents of the system at different locations. For instance, some 0093. For example, in some variations, the system further components of a system may be located at a testing laboratory includes a medical protocol database 214 operatively con dedicated to laboratory or data analysis, whereas other com nected to a computer-readable medium of the system and ponents, including components (optional) for Supplying input containing information correlating the preditction of the information or obtaining an output communication, may be infectious or contaminating bacteria and a protocol for treat located at a medical treatment or counseling facility (e.g., ing the bacterial infection. Such medical protocols include doctor's office, health clinic, HMO, pharmacist, geneticist, any variety of medicines, or additional diagnostic tests, and hospital) and/or at the home or business of the human Subject the like that are designed to achieve one of the aforemen (patient) for whom the testing service is performed. tioned goals. 0094. The system of this embodiment further includes a EXAMPLES medical protocol tool or routine 216, operatively connected to the medical protocol database 214 and to the analysis tool or Example 1 routine 210. The medical protocol tool or routine 216 prefer 0105 Bacterial species often have multiple, non-identical ably is stored on a computer-readable medium of the system, ribosomal operons Scattered throughout their genomes. The and adapted to be executed on a processor of the system, to: (i) sequence variation in this operon includes variation in the 16S compare (or correlate) the conclusion that is obtained from rRNA gene, despite its widespread use in phylogenetic analy the analysis routine 210 and the medical protocol database ses. For example, three to six variants of the 16S rRNA gene 214, and (ii) generate a protocol report with respect to the can be found among the 5-6 copies of the ribosomal operon probability that one or more medical protocols in the medical found in Burkholderia species. Similarly, the promoters of protocol database will achieve one or more of the goals of the multiple ribosomal operons within the genome exhibit treating the bacterial infection. The probability can be based sequence variation. Consequently, the use of the ribosomal on empirical evidence collected from a samples of bacteria promoter for phylogenetic analysis will provide varying and expressed either in absolute terms (e.g., compared to results depending on which copy is selected. making no intervention), or expressed in relative terms, to 0106 Genomes. Annotated genome sequences of several highlight the comparative or additive benefits of two or more Burkholderia and Pseudomonas strains in the NCBI genome protocols. database (managed by the National Center for Biotechnology 0095. In some variations, a system of the disclosure is a Information, U.S. National Library of Medicine) were used. system for identifying a bacterial species or Strain, the system The Burkholderia strains included Burkholderia ambifaria comprising: AMMD, Burkholderia mallei ATCC 23344, Burkholderia 0096 at least one processor; pseudomallei K96243, Burkholderia multivorans ATCC 0097 at least one computer-readable medium; 17616, Burkholderia cenocepacia AU 1054, B. cenocepacia 0098 a predictive database operatively coupled to a com HI2424. B. cenocepacia J2315, B. cenocepacia MCO-3, puter-readable medium of the system and containing popula Burkholderia phymatum STM 815, Burkholderia phyto?ir mans PsM, Burkholderia contaminans str. 383, Burkhold tion information correlating the presence or absence of one or eria vietnamiensis G4, and Burkholderia xenovorans LB400. more properties of a 16S promoter operon in a bacteria; The Pseudomonas species included Pseudomonas aerugi 0099 a measurement tool that receives an input about the nosa PAO1, P aeruginosa PA7, P. aeruginosa LESB58, P bacteria and generates information from the input about the aeruginosa UCBPP-PA14, Pseudomonas putida F1, P sequence of the 16S rRNA promoter indicative of the species putida GB-1, P. putida KT2440, Pseudomonas fluorescens and/or strain of bacteria; and Pf-5, Pfluorescens Pf()1, Pseudomonas mendocinda ymp, 01.00 an analysis tool that: Pseudomonas Stutzeri A1501, Pseudomonas syringae pv. 0101 is operatively coupled to the predictive database and phaseolicola 1448A, Pseudomonas syringae pv. Syringae the the measurement tool, B728a and Pseudomonas syringae pv. tomato str. DC3000. US 2015/0376685 A1 Dec. 31, 2015

0107 Bacteria. Strains used in this study were obtained cycles were completed, each consisting of 30 seconds at 94° from referring laboratories by the Burkholderia cepacia C., 30 seconds at the appropriate annealing temperature Research Laboratory and Repository. (Table 1), and 60 seconds at 72° C. A final extension of 5 0108 Ribosomal promoter and 16S rDNA. Ribosomal minutes at 72°C. was applied with an infinite hold at 8°C. promoter elements were identified as the start of the UP 0112 Sequencing of ribosomal promoter DNA. Amplified element to the start of mature 16s rDNA (-450bp) (Condonet PCR products were purified using the Qiagen QIAquick PCR al., Microbiol Rev. 59(4):623-45, 1995). For primer design, purification kit (Qiagen Inc., Valencia, Calif.) following the 200bp of 16s rDNA and approximately 400bp upstream was manufacturers instructions. DNA sequencing was carried included to capture all possible promoter elements and the out with an Applied Biosystems ABI model 3730 sequencer upstream gene to design specific primer to a particular pro using the protocols provided by the manufacturer (PE moter. The total DNA sequence length used for Burkholderia Applied Biosystems, Foster City, Calif.) by using the BIG cepacia complex and Pseudomonas aeruginosa was 1,100 bp DYER) Terminator cycle sequencing ready reaction kit. per promoter. Complete 16S ribosomal sequences were used Sequence chromatograms were visualized and edited with and based on annotated data using EditSeq software (DNAS Chromas version 2.31 (Technelysium Pty. Ltd.). All TAR Inc., Madison, Wis.) sequences were aligned using MEGALIGNTM (DNAStar); 0109 DNA preparation. DNA was prepared from bacteria trimmed sequences were saved individually. as described previously (Coenye and Lipuma, J Infect Dis. 185(10): 1454-62, 2002). In brief, a single CFU was sus 0113 Results pended in 20 ul of lysis buffer containing 0.25% (vol/vol) 0114 Identification of Ribosomal Promoter of Interest. sodium dodecyl sulfate and 0.05 N NaOH. After heating for 0.115. In our analysis of several dozen species, it was noted 15 minutes at 95°C., 180 ul of high-performance liquid that selection of the most appropriate ribosomal operon pro chromatography-grade H2O (Fisher) was added. The Suspen moter for predicting phylogenetic relationships follows one sion was centrifuged at 13.300 rpm for 5 minutes, and the of several possible criteria. Supernatant was stored at 4°C. 0116 Ribosomal operon copy numbers are based on dis 0110 Primer design. The ribosomal promoter copy of tance from the origin of replication (of the primary chromo interest was aligned to the corresponding copy from other Some in species with multiple chromosomes). The exceptions genomes and were aligned using Clustal V with MegAlign are Chlamydia, which is based on the position of one of two software package (DNASTAR Inc., Madison, Wis.). Primers dnaA copies at positions 624,880 bp-626.247 bp, and Des were manually designed based on conserved regions of DNA. ulfovibrio, which is based on the position of one of two dnaA Primers were checked for loops, self-dimers and primer copies at positions 5.316 bp-7,721 bp. dimers using PrimerSelect software package (DNASTAR 0117 The present studies have shown that the ribosomal Inc., Madison, Wis.). Primers used in this study are listed in operon of interest is located closer to the origin of replication Table 1. than other ribosomal operons. This operon is commonly adja cent to rpmG (L33) and ribonuclease P, but transcribed and in TABLE 1. the opposite direction. Annealing 0118. The present analysis has shown that the operon of Species Temperature C. interest consists of all three ribosomal subunit genes (16S, Pseudomonas genus f 23S, and 5S) and is most often found upstream of a cluster of F- CGBGAYATCAARATCAAGYTGGC core 30S and 50S ribosomal subunit genes, beginning with (SEQ ID NO: 1) R-GCTCGACTTGCATGTGTTAGGC rplK (L11) and ending with rplO (L17). The number of addi (SEQ ID NO: 2) tional 30S and 50S genes in the genome and their proximity to each other decrease with increasing distance from the ribo Pseudomonas aeruginosa 58 Somal operon of interest. F- CTGCCRGAGATCGAGYTGTC (SEQ ID NO : 3) 0119) Additionally, the results indicate the operon of inter R-GCTCGACTTGCATGTGTTAGGC est is distinct from the remaining ribosomal operons in the (SEQ ID NO : 4) genome when these are aligned. This includes all intergenic Burkholderia cepacia complex f spacer regions. The intergenic spacer region between the 16S F-TCGGTGTGCGTCTCGGCCAT and 23S ribosomal subunit genes includes (i) no tRNA, (ii) (SEO ID NO. 5) tRNA, tRNA, or tRNA" or (iii) tRNA'+tRNA' or R- CCTGACTTACTTTAGTGTGAGACTC tRNA1-tRNA'. TT (SEO ID NO : 6) 0.120. Within a genus, there is greater inter-species consis tency in the genes flanking the ribosomal operon of interest 0111 PCR. Amplification of targeted DNA was carried than there are in genes flanking other ribosomal operons. out in 25-ul reaction Volumes, each containing 2 mM MgCl, 200 mM Tris-HCL, 500 mM KCl (pH 8.4: Invitrogen, Carls 0121 Numerous modifications and variations in the bad, Calif.), 250 uM (each) deoxynucleoside triphosphates invention as set forth in the above illustrative examples are (BioExpress, Kaysville, Utah), 0.4 uM (each) primer (IDT, expected to occur to those skilled in the art. Consequently Coralville, Iowa), 1 U of Taq polymerase (Invitrogen, Carls only Such limitations as appearin the appended claims should bad, Calif.), and 2 ul of whole-cell bacterial lysate, and be placed on the invention. adjusted to 25ul by the addition of high-performance liquid 0.122 All publications and patent documents cited in this chromatography-grade H2O. Amplification was carried out in application are incorporated by reference in their entirety to a PTC-100 thermocontroller (Bio-Rad, Hercules, Calif.). the same extent as if the contents of each individual publica After an initial denaturization for 2 minutes at 95° C., 30 tion or patent document were incorporated herein.

US 2015/0376685 A1 Dec. 31, 2015

What is claimed: 11. The method of claim 9 wherein the genetic fingerprint 1. A single locus sequence typing method for identifying an is useful to determine the source of an outbreak of bacterial infectious bacteria in a Subject having one or more infectious infection or epidemic. bacteria the method comprising, 12. The method of any one of the preceding claims, a) obtaining a sample containing the infectious bacteria wherein the analyzing is carried out by DNA sequencing from the subject; analysis of a copy of the 16S rRNA operon promoter. b) analyzing a polynucleotide sequence of a promoter 13. The method of any one of the preceding claims, wherein the bacterial sample is cultured under conditions for region of bacterial 16S rRNA operon in the infectious bacterial growth prior to analyzing the promoter sequence bacteria; and 14. The method of any one of the preceding claims, c) identifying the species and/or strain of infectious bacte wherein DNA is extracted from the bacterial sample and the ria based on the sequence of the 16S rRNA promoter DNA sequence analyzed. region. 15. The method of any one of the preceding claims, 2. The method of claim 1 further comprising, wherein the promoter region comprises a portion of the 16S (d) treating the Subject with an antibacterial agent against rDNA and regions upstream of the 16S rDNA. the infectious bacteria identified. 16. The method of claim 15 wherein the promoter region is 3. The method of claim 1 or 2, wherein the subject is a approximately 250 to 450 nucleotides in length. patientina hospital and the bacteria is a nosocomial infection. 17. The method of claim 16 wherein the promoter region sequenced product is approximately 600-1200 nucleotides in 4. The method of claim 1 or 2 wherein the bacteria is a length. multidrug resistant strain of bacteria. 18. The method of any one of the preceding claims wherein 5. The method of claim 1 or 2, wherein the bacteria is an identification of the species of bacteria is based on a copy of animal pathogen. the promoter having one or more characteristics selected from 6. The method of claim 5, wherein the animal pathogen has the group consisting of been passed to a human Subject. i) distance of the operon from origin of replication; 7. The method of claim 1 or 2, wherein the sample is ii) G/C content of the promoterseuqence selected from the group consisting of whole blood, serum, iii) an operon consisting of (a) 16S, (b) 16S and 23S or (c) saliva, sputum, urine, cerebrospinal fluid, stool, amniotic all three ribosomal subunit genes (16S. 23S, and 5S) and fluid, or tissue sample. is found upstream of a cluster of core 30S and 50S 8. A method for identifying a bacteria in a contaminated ribosomal Subunit genes; and food source having one or more contaminating bacteria, the iv) distinctness of the copy from the remaining ribosomal method comprising, operons in the genome when 16S. 23S, and 5S are a) obtaining a sample containing bacteria from the con aligned, including alignment of intergenic spacer taminated food source; regions. b) analyzing a polynucleotide sequence of a promoter 19. The method of claim 18, wherein the intergenic spacer region of bacterial 16S rRNA operon in the contaminat regions between the 16S and 23S ribosomal subunit genes are ing bacteria; and selected from the group consisting of c) identifying the species and/or strain of contaminating (i) lack of tRNA, bacteria based on the sequence of the 16S rRNA pro (ii) tRNAGlu, tRNAAla, or tRNAIle: moter region. (iii) tRNAIle+tRNAAla; and 9. A method for generating a genetic fingerprint map for (iv) tRNAAla+tRNAIle. bacteria comprising 20. The method of any one of the preceding claims, a) analyzing a polynucleotide sequence of a promoter wherein the identification of the bacteria comprises a com region of bacterial 16S rRNA operon of a known or parison of the promoter sequence on a computer readable unknown bacterial strain; and storage media. b) classifying the bacteria into a family, genus, species 21. A single locus sequence typing kit for identifying a and/or strain of bacteria based on the polynucleotide bacteria comprising, sequence of the promoter region of the 16S rRNA polynucleotide primers specific for a 16S operon promoter operon. region in one or more bacterial species or strains; and 10. The method of claim 9 wherein the genetic fingerprint instructions for carrying out a single locus sequencing type is useful to track patient to patient transmission of an infec analysis on a sample comprising a bacterial. tion. k k k k k