DOCSLIB.ORG

Wo 2010/049454 A2

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date 6 May 2010 (06.05.2010) WO 2010/049454 A2 (51) International Patent Classification: (81) Designated States (unless otherwise indicated, for every A61K 35/56 (2006.01) A61P 31/04 (2006.01) kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, (21) Number: International Application CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, PCT/EP2009/06422S DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, (22) International Filing Date: HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, 28 October 2009 (28.10.2009) KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, (25) Filing Language: English NO, NZ, OM, PE, PG, PH, PL, PT, RO, RS, RU, SC, SD, (26) Publication Language: English SE, SG, SK, SL, SM, ST, SV, SY, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (30) Priority Data: 20084555 28 October 2008 (28.10.2008) NO (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (71) Applicant (for all designated States except US): NOFI- GM, KE, LS, MW, MZ, NA, SD, SL, SZ, TZ, UG, ZM, MA INGREDIENS [NO/NO]; Kjerreidviken 16, N-5141 ZW), Eurasian (AM, AZ, BY, KG, KZ, MD, RU, TJ, Fyllingsdalen (NO). TM), European (AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, (72) Inventors; and MC, MK, MT, NL, NO, PL, PT, RO, SE, SI, SK, SM, (75) Inventors/Applicants (for US only): NYGAARD, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, Halvor [NO/NO]; Bratet 25IB, N-5 152 Bønes (NO). ML, MR, NE, SN, TD, TG). LANGMYHR, Eyolf [NO/NO]; Harald Harfagres gate 5, N-5007 Bergen (NO). Published: (74) Agent: HOIBERG A/S; St. Kongensgade 59A, DK- 1264 — without international search report and to be republished Copenhagen K (DK). upon receipt of that report (Rule 48.2(g)) (54) Title: ANTIMICROBIAL COMPOSITION FROM COPEPODS (57) Abstract: The present invention relates to an antimicrobial composition, and to a process for the preparation of such a com position. The invention also relates to the use of such an antimicrobial composition. The present invention further relates to the use of the antimicrobial composition as a pharmaceutical. Antimicrobial composition from copepods All patent and non-patent references cited in the present application, are also hereby incorporated by reference in their entirety. The nowegian patent application 20084555 and the references cited herein are hereby incorporated in the patent application in its entirety. Field of invention The present invention relates to an antimicrobial composition obtained from the marine copepod Calanus finmarchicus, and to a process for the preparation of such a composition. The invention also relates to the use of such an antimicrobial composition. Background of invention Copepods are a group of small crustaceans found in the sea and nearly every freshwater habitat. According to the classification system of Martin and Davies (2001), the copepods form a subclass belonging to the subphylum Crustacea (crustaceans). Subphylum Crustacea is a large group of the phylum Arthropoda, comprising almost 52.000 described species. Six classes of the Crustaceans are usually recognized. Subclass Copepoda of the class Maxillopoda comprise ten orders, of which the order Calanoida include 43 families with about 2000 species. Many species are planktonic (drifting in sea waters), but more are benthic (living on the ocean floor), and some continental species may live in limno-terrestrial habitats and other wet terrestrial places, such as swamps, under leaf fall in wet forests, bogs, springs, ephemeral ponds and puddles, damp moss, or water-filled recesses (phytotelmata) of plants such as bromeliads and pitcher plants. Many live underground in marine and freshwater caves, sinkholes, or stream beds. Two of the most abundant northern calanoid species is C.finmarchicus which is commonly regarded as a northern boreal species inhabiting North Atlantic Ocean, while C.hyperboreus is an arctic species. The evolution of antibiotic-resistant pathogenic bacteria has stimulated the search for alternative antimicrobial agents from natural sources. Antimicrobial activity has previously been detected in several decapod crustaceans, including lobster, crabs, shrimps and freshwater crayfish. The search for novel compounds displaying antimicrobial activity has led to the identification of several antimicrobial peptides and proteins in decapod crustaceans (Haug et al., 2002). Summary of invention The present invention relates to an antimicrobial composition from a marine copepod, such as Calanus finmarchicus, and to a process for the preparation of such a composition. The invention also relates to the use of such an antimicrobial composition. The present invention further relates to a pharmacuetical composition obtained from Calanus finmarchicus and to the use of a composition obtained from Calanus finmarchicus in the treatment of microbial infections in an individual in need thereof. Definitions The term proteinaceous is defined as any molecule comprising amino acids connected by amide (peptide) bonds. Non-proteinaceuos is any molecule, which does not comprise amino acids connected by amide (peptide) bonds. A protein in the present context is an organic macromolecule made of amino acids. A protein is a biopolymer. Proteins consist of one or more polypeptide molecules. A peptide in the present context is defined as a molecule consisting of 2 or more amino acids. Peptides are smaller than proteins. The dividing line between a peptide and a protein/polypeptide is at about 50 amino acids. Depending on the number of amino acids, peptides are called dipeptides, tripeptides, tetrapeptides, and so on. A nucleotide is composed of a nucleobase (nitrogenous base), a five-carbon sugar (either ribose or 2'-deoxyribose), and one to three phosphate groups. Together, the nucleobase and sugar comprise a nucleoside. The phosphate groups form bonds with either the 2, 3, or 5-carbon of the sugar, with the 5-carbon site most common. Ribonucleotides are nucleotides where the sugar is ribose, and deoxyribonucleotides contain the sugar deoxyribose. Nucleotides can contain either a purine or pyrimidine base. Nucleic acids are polymeric macromolecules made from nucleotide monomers. In DNA, the purine bases are adenine and guanine, while the pyrimidines are thymine and cytosine. RNA uses uracil in place of thymine. A nucleic acid is a macromolecule or a biopolymer composed of chains of monomeric nucleotides. A non-nucleic acid is a molecule which does not contain nucletotides. An aerobic organism or aerobe is an organism that can survive and grow in an oxygenated environment. Obligate aerobes require oxygen for aerobic cellular respiration. Facultative anaerobes can use oxygen, but also have anaerobic methods of energy production. Microaerophiles are organisms that may use oxygen, but only at low concentrations. Aerotolerant organisms can survive in the presence of oxygen, but they are anaerobic because they do not use it as a terminal electron acceptor. An anaerobic organism or anaerobe is any organism that does not require oxygen for growth and may even die in its presence. There are three types: obligate anaerobes, which cannot use oxygen for growth and are even harmed by it; aerotolerant organisms, which cannot use oxygen for growth, but tolerate the presence of it; and facultative anaerobes, which can grow without oxygen, but if present can utilize it. A microorganism or microbe is an organism that is microscopic. Microorganisms are very diverse; they include bacteria, fungi, archaea, viruses and protists; microscopic plants (called green algae); and animals such as plankton and the planarian. Pathogenic microorganisms cause infection. Bacteria can be classified on the basis of cell structure, cellular metabolism or on differences in cell components such as DNA, fatty acids, pigments, antigens and quinones. By combining morphology and Gram-staining, most bacteria can be classified as belonging to one of four groups: Gram-positive cocci, Gram-positive bacilli, Gram-negative cocci and Gram-negative bacilli. Bacteria can be aerobic, anaerobic, or facultative anaerobic. An antimicrobial is a substance that kills or inhibits the growth of microorganisms such as bacteria, fungi, or protozoans, as well as destroying viruses. Antimicrobial drugs either kill microbes (microbicidal) or prevent the growth of microbes (microbistatic). The main classes of antimicrobial agents are antibiotics (antibacterials), antivirals and antifungals targeting bacteria, viruses and fungi respectively. The term broad-spectrum antibiotic refers to an antibiotic with activity against a wide range of disease-causing bacteria. It is also means that it acts against both Gram- positive and Gram-negative bacteria. This is in contrast to a narrow-spectrum antibiotic which is effective against only specific families of bacteria. Antiseptics are antimicrobial substances that are applied to living tissue/skin to reduce the possibility of infection, sepsis, or putrefaction. A preservative is a compound that is added to products such as foods, pharmaceuticals, paints, biological samples, wood, etc. to prevent decomposition by microbial growth or by undesirable chemical changes. Disinfectants
Recommended publications
  • Structural Characterization of Helicobacter Pylori Proteins Contributing to Stomach Colonization

    Structural Characterization of Helicobacter Pylori Proteins Contributing to Stomach Colonization

    Università degli Studi di Padova Dipartimento di Biologia Scuola di Dottorato di Ricerca in Bioscienze e Biotecnologie Indirizzo: Biotecnologie Ciclo XXVIII STRUCTURAL CHARACTERIZATION OF HELICOBACTER PYLORI PROTEINS CONTRIBUTING TO STOMACH COLONIZATION Direttore della Scuola: Ch.mo Prof. Paolo Bernardi Coordinatore di Indirizzo: Ch.ma Prof.ssa Fiorella Lo Schiavo Supervisore: Ch.mo Prof. Giuseppe Zanotti Dottorando: Maria Elena Compostella 31 Gennaio 2016 Università degli Studi di Padova Department of Biology School of Biosciences and Biotechnology Curriculum: Biotechnology XXVIII Cycle STRUCTURAL CHARACTERIZATION OF HELICOBACTER PYLORI PROTEINS CONTRIBUTING TO STOMACH COLONIZATION Director of the Ph.D. School: Ch.mo Prof. Paolo Bernardi Coordinator of the Curriculum: Ch.ma Prof.ssa Fiorella Lo Schiavo Supervisor: Ch.mo Prof. Giuseppe Zanotti Ph.D. Candidate: Maria Elena Compostella 31 January 2016 Contents ABBREVIATIONS AND SYMBOLS IV SUMMARY 9 SOMMARIO 15 1. INTRODUCTION 21 1.1 HELICOBACTER PYLORI 23 1.2 GENETIC VARIABILITY 26 1.2.1 GENOME COMPARISON 26 1.2.1.1 HELICOBACTER PYLORI 26695 26 1.2.1.2 HELICOBACTER PYLORI J99 28 1.2.2 CORE GENOME 30 1.2.3 MECHANISMS GENERATING GENETIC VARIABILITY 31 1.2.3.1 MUTAGENESIS 32 1.2.3.2 RECOMBINATION 35 1.2.4 HELICOBACTER PYLORI AS A “QUASI SPECIES” 37 1.2.5 CLASSIFICATION OF HELICOBACTER PYLORI STRAINS 38 1.3 EPIDEMIOLOGY 40 1.3.1 INCIDENCE AND PREVALENCE OF HELICOBACTER PYLORI INFECTION 40 1.3.2 SOURCE AND TRANSMISSION 42 1.4 ADAPTATION AND GASTRIC COLONIZATION 47 1.4.1 ACID ADAPTATION 49 1.4.2 MOTILITY AND CHEMIOTAXIS 60 1.4.3 ADHESION 65 1.5 PATHOGENESIS AND VIRULENCE FACTORS 72 1.5.1 VACUOLATING CYTOTOXIN A 78 1.5.2 CAG PATHOGENICITY ISLAND AND CYTOTOXIN-ASSOCIATED GENE A 83 1.5.3 NEUTROPHIL-ACTIVATING PROTEIN 90 1.6 HELICOBACTER PYLORI AND GASTRODUODENAL DISEASES 92 1.7 ERADICATION AND POTENTIAL BENEFITS 97 2.
  • Comparative Phylogeny of the Genus Bordetella Using Sequence Analysis of 16S Rrna and Ompa Genes

    Comparative Phylogeny of the Genus Bordetella Using Sequence Analysis of 16S Rrna and Ompa Genes

    J Med Bacteriol. Vol. 6, No. 3, 4 (2017): pp.1-13 jmb.tums.ac.ir Comparative Phylogeny of the Genus Bordetella Using Sequence Analysis of 16S rRNA and ompA Genes Ali Badamchi 1, Moslem Papizadeh 2* 1 Children's Medical Center Hospital, Tehran University of Medical Sciences, Tehran, Iran. 2 Department of Microbiology, Pasteur Institute of Iran (IPI), Tehran, Iran. ARTICLE INFO ABSTRACT Article type: Background: The genus Bordetella harbors 16 species; three of them are well-known for their high Original Article medical importance. The phylogenetic diversity of the genus is currently not very well investigated. Methods: In this study, 16S rRNA gene sequence of 16 type strains of the Bordetella species were Article history: analyzed. Also, phylogenies conducted on the same gene of 247 isolates of Bordetella species, Received: 19 Jan 2017 comprising a wide physiological as well as ecological diversity and encompassing ex-type Revised: Jun Mar 2017 representatives of the 16 Bordetella species, were analyzed. Accepted: 11 Sep 2017 Results: It was found that the phylogenetic diversity of the genus may be very different from that is Published: 15 Oct 2017 currently assumed. Interestingly, the 16S rRNA gene signals could not resolve some species with Keywords: promising bootstrap and posterior probability values as our phylogenies, using maximum likelihood Alcaligenaceae, and Bayesian inference methods, showed. Biogeography, Bordetella Conclusion: Our results indicate a probable need for additional phylogenetic signals which can be species, Ecological provided by coding genes. Therefore, sequence data of ompA gene of Bordetella species, a critically distribution, Phylogenetic significant genomic region in pathogenesis, was here analyzed, phylogenetically.
  • Phylogenetic Analysis Reveals an Ancient Gene Duplication As The

    Phylogenetic Analysis Reveals an Ancient Gene Duplication As The

    1 Phylogenetic analysis reveals an ancient gene duplication as 2 the origin of the MdtABC efflux pump. 3 4 Kamil Górecki1, Megan M. McEvoy1,2,3 5 1Institute for Society & Genetics, 2Department of MicroBiology, Immunology & Molecular 6 Genetics, and 3Molecular Biology Institute, University of California, Los Angeles, CA 90095, 7 United States of America 8 Corresponding author: [email protected] (M.M.M.) 9 1 10 Abstract 11 The efflux pumps from the Resistance-Nodulation-Division family, RND, are main 12 contributors to intrinsic antibiotic resistance in Gram-negative bacteria. Among this family, the 13 MdtABC pump is unusual by having two inner membrane components. The two components, 14 MdtB and MdtC are homologs, therefore it is evident that the two components arose by gene 15 duplication. In this paper, we describe the results obtained from a phylogenetic analysis of the 16 MdtBC pumps in the context of other RNDs. We show that the individual inner membrane 17 components (MdtB and MdtC) are conserved throughout the Proteobacterial species and that their 18 existence is a result of a single gene duplication. We argue that this gene duplication was an ancient 19 event which occurred before the split of Proteobacteria into Alpha-, Beta- and Gamma- classes. 20 Moreover, we find that the MdtABC pumps and the MexMN pump from Pseudomonas aeruginosa 21 share a close common ancestor, suggesting the MexMN pump arose by another gene duplication 22 event of the original Mdt ancestor. Taken together, these results shed light on the evolution of the 23 RND efflux pumps and demonstrate the ancient origin of the Mdt pumps and suggest that the core 24 bacterial efflux pump repertoires have been generally stable throughout the course of evolution.
  • Biofilm Formation and Cellulose Expression by Bordetella Avium 197N, the Causative Agent of Bordetellosis in Birds and an Opportunistic Respiratory Pathogen in Humans

    Biofilm Formation and Cellulose Expression by Bordetella Avium 197N, the Causative Agent of Bordetellosis in Birds and an Opportunistic Respiratory Pathogen in Humans

    Accepted Manuscript Biofilm formation and cellulose expression by Bordetella avium 197N, the causative agent of bordetellosis in birds and an opportunistic respiratory pathogen in humans Kimberley McLaughlin, Ayorinde O. Folorunso, Yusuf Y. Deeni, Dona Foster, Oksana Gorbatiuk, Simona M. Hapca, Corinna Immoor, Anna Koza, Ibrahim U. Mohammed, Olena Moshynets, Sergii Rogalsky, Kamil Zawadzki, Andrew J. Spiers PII: S0923-2508(17)30017-7 DOI: 10.1016/j.resmic.2017.01.002 Reference: RESMIC 3563 To appear in: Research in Microbiology Received Date: 17 November 2016 Revised Date: 16 January 2017 Accepted Date: 16 January 2017 Please cite this article as: K. McLaughlin, A.O. Folorunso, Y.Y. Deeni, D. Foster, O. Gorbatiuk, S.M. Hapca, C. Immoor, A. Koza, I.U. Mohammed, O. Moshynets, S. Rogalsky, K. Zawadzki, A.J. Spiers, Biofilm formation and cellulose expression by Bordetella avium 197N, the causative agent of bordetellosis in birds and an opportunistic respiratory pathogen in humans, Research in Microbiologoy (2017), doi: 10.1016/j.resmic.2017.01.002. This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. Page 1 of 25 ACCEPTED MANUSCRIPT 1 For Publication 2 Biofilm formation and cellulose expression by Bordetella avium 197N, 3 the causative agent of bordetellosis in birds and an opportunistic 4 respiratory pathogen in humans 5 a* a*** a b 6 Kimberley McLaughlin , Ayorinde O.
  • Table of Contents

    Table of Contents

    MARCH 2013 • VOLUME 51 • NO. 3 TABLE OF CONTENTS PHOTO QUIZ Bacteremia in a Patient with Hepatic Encephalopathy Benjamin H. Hinrichs, Robert C. Jerris, 739 Eileen M. Burd Answer to Photo Quiz Benjamin H. Hinrichs, Robert C. Jerris, 1062–1063 Eileen M. Burd POINT-COUNTERPOINT Quantitative Cultures of Bronchoscopically Obtained Vickie Baselski, J. Stacey Klutts 740–744 Specimens Should Be Performed for Optimal Management of Ventilator-Associated Pneumonia BACTERIOLOGY Pan-PCR, a Computational Method for Designing Bacterium- Joy Y. Yang, Shelise Brooks, Jennifer A. 752–758 Typing Assays Based on Whole-Genome Sequence Data Meyer, Robert R. Blakesley, Adrian M. Zelazny, Julia A. Segre, Evan S. Snitkin Identification of Anaerobic Bacteria by Bruker Biotyper Matrix- Bryan H. Schmitt, Scott A. 782–786 Assisted Laser Desorption Ionization–Time of Flight Mass Cunningham, Aaron L. Dailey, Spectrometry with On-Plate Formic Acid Preparation Daniel R. Gustafson, Robin Patel Use of Universal 16S rRNA Gene PCR as a Diagnostic Tool for M. Guembe, M. Marín, P. Martín- 799–804 Venous Access Port-Related Bloodstream Infections Rabadán, A. Echenagusia, F. Camúñez, G. Rodríguez-Rosales, G. Simó, M. Echenagusia, E. Bouza, on behalf of the GEIDI Study Group Rapid Identification of Bacteria and Yeasts from Positive-Blood- Amy Fothergill, Vyjayanti Kasinathan, 805–809 Culture Bottles by Using a Lysis-Filtration Method and Matrix- Jay Hyman, John Walsh, Tim Drake, Assisted Laser Desorption Ionization–Time of Flight Mass Yun F. (Wayne) Wang Spectrum Analysis with the SARAMIS Database Pseudo-Outbreak of Vancomycin-Resistant-Enterococcus Rita M. Gander, Dominick Cavuoti, 810–813 (VRE) Colonization in a Neonatal Intensive Care Unit Using Adnan Alatoom, Paul Southern, Jr., Spectra VRE Surveillance Medium Debra Grant, Kathleen Salinas, Donna Gaffney, Jennifer MacKenzie, Linda Byrd Changes in Molecular Epidemiology of Streptococcus Bruno Pichon, Shamez N.
  • Table S1. Primers Used for PCR Amplification

    Table S1. Primers Used for PCR Amplification

    Table S1. Primers used for PCR amplification Name Primer Sequence (5’-3’) Gene target Taxon target Reference First PCR round DGGE analysis FGPH19 TACGGCAARGGTGGNATHG nifH Diazotrophic (Simonet et al. 1991) POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) 799F AACMGGATTAGATACCCKG 16S rRNA Bacteria (Chelius and Triplett 2001) 1492R TACGGYTACCTTGTTACGACTT 16S rRNA Bacteria (Chelius and Triplett 2001) F203α CCGCATACGCCCTACGGGGGAAAGATTTAT 16S rRNA Alphaproteobacteria (Gomes et al. 2001) F948β CGCACAAGCGGTGGATGA 16S rRNA Betaproteobacteria (Gomes et al. 2001) F243HCG GGATGAGCCCGCGGCCTA 16S rRNA Actinobacteria (Heuer et al. 1997) BACF GGGAAACCGGGGCTAATACCGGAT 16S rRNA Firmicutes (Garbeva et al. 2003) Second PCR round DGGE analysis POLF-GC CGCCCGCCGCGCCCCGCGCCCGGCCCGCCCCCG nifH Diazotrophic (Poly et al. 2001) CCCCTGCGAYCCSAARGCBGACTC AQER GACGATGTAGATITCCTG nifH Diazotrophic (Poly et al. 2001) F968-GC CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGC 16S rRNA Bacteria (Heuer et al. 1999) ACGGGGGGAACGAAGAACCTTAC R1401 CGGTGTGTACAAGACCC 16S rRNA Bacteria (Heuer et al. 1997) qPCR analysis POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) POLF TGCGAYCCSAARGCBGACTC nifH Diazotrophic (Poly et al. 2001) 6S-27F AGAGTTTGATCCTGGCTCAG 16S rRNA Bacteria Bulgari et al., 2014 338R GCTGCCTCCCGTAGGAGT 16S rRNA Bacteria Bulgari et al., 2014 Table 2. Primers used for Ion Torrent pyrosequencing analysis. Primer Primer sequence (5´-3´) Reference 967F-PP CNACGCGAAGAACCTTANC (Jünemann et al. 2012) 967F-UC1 CAACGCGAAAAACCTTACC (Jünemann et al. 2012) 967F-UC2 CAACGCGCAGAACCTTACC (Jünemann et al. 2012) 967F-UC3 ATACGCGARGAACCTTACC (Jünemann et al. 2012) 967F-AQ CTAACCGANGAACCTYACC (Jünemann et al. 2012) 1046R CGACAGCCATGCANCACCT (Jünemann et al. 2012) 1046R-PP CGACAACCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ1 CGACGGCCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ2 CGACGACCATGCANCACCT (Jünemann et al. 2012) Table S3. Alpha diversity indices. Statistical analysis of the total endophytic and diazotrophic endophytic bacterial community associated with sweet sorghum cv.
  • A Focus on Protein Glycosylation in Lactobacillus

    A Focus on Protein Glycosylation in Lactobacillus

    International Journal of Molecular Sciences Review How Sweet Are Our Gut Beneficial Bacteria? A Focus on Protein Glycosylation in Lactobacillus Dimitrios Latousakis and Nathalie Juge * Quadram Institute Bioscience, The Gut Health and Food Safety Institute Strategic Programme, Norwich Research Park, Norwich NR4 7UA, UK; [email protected] * Correspondence: [email protected]; Tel.: +44-(0)-160-325-5068; Fax: +44-(0)-160-350-7723 Received: 22 November 2017; Accepted: 27 December 2017; Published: 3 January 2018 Abstract: Protein glycosylation is emerging as an important feature in bacteria. Protein glycosylation systems have been reported and studied in many pathogenic bacteria, revealing an important diversity of glycan structures and pathways within and between bacterial species. These systems play key roles in virulence and pathogenicity. More recently, a large number of bacterial proteins have been found to be glycosylated in gut commensal bacteria. We present an overview of bacterial protein glycosylation systems (O- and N-glycosylation) in bacteria, with a focus on glycoproteins from gut commensal bacteria, particularly Lactobacilli. These emerging studies underscore the importance of bacterial protein glycosylation in the interaction of the gut microbiota with the host. Keywords: protein glycosylation; gut commensal bacteria; Lactobacillus; glycoproteins; adhesins; lectins; O-glycosylation; N-glycosylation; probiotics 1. Introduction Protein glycosylation, i.e., the covalent attachment of a carbohydrate moiety onto a protein, is a highly ubiquitous protein modification in nature, and considered to be one of the post-translational modifications (PTM) targeting the most diverse group of proteins [1]. Although it was originally believed to be restricted to eukaryotic systems and later to archaea, it has become apparent nowadays that protein glycosylation is a common feature in all three domains of life.
  • In Silico Evolutionary Analysis of Helicobacter Pylori Outer Membrane Phospholipase a (OMPLA) Hilde S Vollan1*, Tone Tannæs1, Yoshio Yamaoka2 and Geir Bukholm3,4

    In Silico Evolutionary Analysis of Helicobacter Pylori Outer Membrane Phospholipase a (OMPLA) Hilde S Vollan1*, Tone Tannæs1, Yoshio Yamaoka2 and Geir Bukholm3,4

    Vollan et al. BMC Microbiology 2012, 12:206 http://www.biomedcentral.com/1471-2180/12/206 RESEARCH ARTICLE Open Access In silico evolutionary analysis of Helicobacter pylori outer membrane phospholipase A (OMPLA) Hilde S Vollan1*, Tone Tannæs1, Yoshio Yamaoka2 and Geir Bukholm3,4 Abstract Background: In the past decade, researchers have proposed that the pldA gene for outer membrane phospholipase A (OMPLA) is important for bacterial colonization of the human gastric ventricle. Several conserved Helicobacter pylori genes have distinct genotypes in different parts of the world, biogeographic patterns that can be analyzed through phylogenetic trees. The current study will shed light on the importance of the pldA gene in H. pylori. In silico sequence analysis will be used to investigate whether the bacteria are in the process of preserving, optimizing, or rejecting the pldA gene. The pldA gene will be phylogenetically compared to other housekeeping (HK) genes, and a possible origin via horizontal gene transfer (HGT) will be evaluated through both intra- and inter- species evolutionary analyses. Results: In this study, pldA gene sequences were phylogenetically analyzed and compared with a large reference set of concatenated HK gene sequences. A total of 246 pldA nucleotide sequences were used; 207 were from Norwegian isolates, 20 were from Korean isolates, and 19 were from the NCBI database. Best-fit evolutionary models were determined with MEGA5 ModelTest for the pldA (K80 + I + G) and HK (GTR + I + G) sequences, and maximum likelihood trees were constructed. Both HK and pldA genes showed biogeographic clustering. Horizontal gene transfer was inferred based on significantly different GC contents, the codon adaptation index, and a phylogenetic conflict between a tree of OMPLA protein sequences representing 171 species and a tree of the AtpA HK protein for 169 species.
  • Upper and Lower Case Letters to Be Used

    Upper and Lower Case Letters to Be Used

    Isolation, characterization and genome sequencing of a soil-borne Citrobacter freundii strain capable of detoxifying trichothecene mycotoxins by Rafiqul Islam A Thesis Presented to The University of Guelph In Partial Fulfilment of Requirements for the Degree of Doctor of Philosophy in Plant Agriculture Guelph, Ontario, Canada © Rafiqul Islam, April, 2012 ABSTRACT ISOLATION, CHARACTERIZATION AND GENOME SEQUENCING OF A SOIL- BORNE CITROBACTER FREUNDII STRAIN CAPABLE OF DETOXIFIYING TRICHOTHECENE MYCOTOXINS Rafiqul Islam Advisors: University of Guelph, 2012 Dr. K. Peter Pauls Dr. Ting Zhou Cereals are frequently contaminated with tricthothecene mycotoxins, like deoxynivalenol (DON, vomitoxin), which are toxic to humans, animals and plants. The goals of the research were to discover and characterize microbes capable of detoxifying DON under aerobic conditions and moderate temperatures. To identify microbes capable of detoxifying DON, five soil samples collected from Southern Ontario crop fields were tested for the ability to convert DON to a de-epoxidized derivative. One soil sample showed DON de-epoxidation activity under aerobic conditions at 22-24°C. To isolate the microbes responsible for DON detoxification (de-epoxidation) activity, the mixed culture was grown with antibiotics at 50ºC for 1.5 h and high concentrations of DON. The treatments resulted in the isolation of a pure DON de-epoxidating bacterial strain, ADS47, and phenotypic and molecular analyses identified the bacterium as Citrobacter freundii. The bacterium was also able to de-epoxidize and/or de-acetylate 10 other food-contaminating trichothecene mycotoxins. A fosmid genomic DNA library of strain ADS47 was prepared in E. coli and screened for DON detoxification activity. However, no library clone was found with DON detoxification activity.
  • Ehrlichiosis and Anaplasmosis Are Tick-Borne Diseases Caused by Obligate Anaplasmosis: Intracellular Bacteria in the Genera Ehrlichia and Anaplasma

    Ehrlichiosis and Anaplasmosis Are Tick-Borne Diseases Caused by Obligate Anaplasmosis: Intracellular Bacteria in the Genera Ehrlichia and Anaplasma

    Ehrlichiosis and Importance Ehrlichiosis and anaplasmosis are tick-borne diseases caused by obligate Anaplasmosis: intracellular bacteria in the genera Ehrlichia and Anaplasma. These organisms are widespread in nature; the reservoir hosts include numerous wild animals, as well as Zoonotic Species some domesticated species. For many years, Ehrlichia and Anaplasma species have been known to cause illness in pets and livestock. The consequences of exposure vary Canine Monocytic Ehrlichiosis, from asymptomatic infections to severe, potentially fatal illness. Some organisms Canine Hemorrhagic Fever, have also been recognized as human pathogens since the 1980s and 1990s. Tropical Canine Pancytopenia, Etiology Tracker Dog Disease, Ehrlichiosis and anaplasmosis are caused by members of the genera Ehrlichia Canine Tick Typhus, and Anaplasma, respectively. Both genera contain small, pleomorphic, Gram negative, Nairobi Bleeding Disorder, obligate intracellular organisms, and belong to the family Anaplasmataceae, order Canine Granulocytic Ehrlichiosis, Rickettsiales. They are classified as α-proteobacteria. A number of Ehrlichia and Canine Granulocytic Anaplasmosis, Anaplasma species affect animals. A limited number of these organisms have also Equine Granulocytic Ehrlichiosis, been identified in people. Equine Granulocytic Anaplasmosis, Recent changes in taxonomy can make the nomenclature of the Anaplasmataceae Tick-borne Fever, and their diseases somewhat confusing. At one time, ehrlichiosis was a group of Pasture Fever, diseases caused by organisms that mostly replicated in membrane-bound cytoplasmic Human Monocytic Ehrlichiosis, vacuoles of leukocytes, and belonged to the genus Ehrlichia, tribe Ehrlichieae and Human Granulocytic Anaplasmosis, family Rickettsiaceae. The names of the diseases were often based on the host Human Granulocytic Ehrlichiosis, species, together with type of leukocyte most often infected.
  • Cystic Fibrosis Mice Develop Spontaneouschronic Bordetella

    Cystic Fibrosis Mice Develop Spontaneouschronic Bordetella

    ISSN 2470-3176 SciO p Forschene n HUB for Sc i e n t i f i c R e s e a r c h Journal of Infectious Pulmonary Diseases Research Article Volume: 3.2 Open Access Received date: 11 Oct 2017; Accepted date: 28 Cystic Fibrosis Mice Develop Spontaneous Oct 2017; Published date: 02 Nov 2017. Chronic Bordetella Airway Infections Citation: Darrah R, Bonfield T, LiPuma JJ, Litman P, Hodges CA, et al. (2017) Cystic Fibrosis Mice Darrah R1*, Bonfield T2, LiPuma JJ3, Litman P1, Hodges CA4, Jacono F5 and Develop Spontaneous Chronic Bordetella Airway Drumm M6 Infections. J Infect Pulm Dis 3(2): doi http://dx.doi. org/10.16966/2470-3176.128 1Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA 2Department of Pediatrics, Case Western Reserve University, Cleveland Ohio, USA Copyright: © 2017 Darrah R, et al. This is an 3Department of Pediatrics and Communicable Diseases, University of Michigan Medical School, Ann open-access article distributed under the terms Arbor, Michigan, USA of the Creative Commons Attribution License, 4Departments of Radiology, Biomedical Engineering, and Pediatrics, Case Western Reserve University, which permits unrestricted use, distribution, and Cleveland Ohio, USA reproduction in any medium, provided the original 5Department of Medicine, Case Western Reserve University, and Louis Stokes VA Cleveland Medical author and source are credited. Center, USA 6Departments of Pediatrics and Genetics Genome Sciences, Case Western Reserve University, Cleveland Ohio, USA *Corresponding author: Rebecca Darrah, Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA, Tel: 216-368-4911; E-mail: [email protected] Abstract Chronic pulmonary disease and infection is the primary cause of morbidity and mortality in people with cystic fibrosis (CF).
  • Bordetella Petrii Clinical Isolate Isolates of This Species Have Been Previously Reported from 4

    Bordetella Petrii Clinical Isolate Isolates of This Species Have Been Previously Reported from 4

    routine laboratory protocols. Initial susceptibility testing Bordetella petrii using disk diffusion indicated apparent susceptibility of the isolate to erythromycin, gentamicin, ceftriaxone, and Clinical Isolate piperacillin/tazobactam. The isolate was resistant to amox- icillin, co-amoxiclav, tetracycline, clindamycin, ciproflo- Norman K. Fry,* John Duncan,* Henry Malnick,* xacin, and metronidazole. After initial sensitivity results, a Marina Warner,* Andrew J. Smith,† 6-week course of oral clarithromycin (500 mg, 8 hourly) Margaret S. Jackson,† and Ashraf Ayoub† was begun. We describe the first clinical isolate of Bordetella petrii At follow-up appointments 3 months and 6 months from a patient with mandibular osteomyelitis. The only pre- after antimicrobial drug therapy ceased, clinical and radi- viously documented isolation of B. petrii occurred after the ographic findings were not unusual, and the infected area initial culture of a single strain from an environmental healed successfully. Despite the successful clinical out- source. come, the isolate was subsequently shown to be resistant to clarithromycin in vitro (Table). Improvement of the 67-year-old man visited an emergency dental clinic, osteomyelitis may also have been facilitated by the biopsy Awhere he complained of toothache in the lower right procedure, during which a sequestrum of bone was mandibular quadrant. Examination showed a root-filled removed. lower right canine tooth that was mobile and tender to per- The gram-negative bacillus (designated strain cussion. The tooth was extracted uneventfully under local GDH030510) was submitted to the Health Protection anesthesia. The patient returned after several days with Agency, Centre for Infections, London, for identification. pain at the extraction site. A localized alveolar osteitis was Preliminary tests results were consistent with those diagnosed, and local debridement measures were institut- described for members of the genus Bordetella.