The Protective Effects of Conjugated Linoleic Acid Against Carcinogenesis
Item Type text; Electronic Dissertation
Authors Kemp, Michael Quentin
Publisher The University of Arizona.
Rights Copyright © is held by the author. Digital access to this material is made possible by the University Libraries, University of Arizona. Further transmission, reproduction or presentation (such as public display or performance) of protected items is prohibited except with permission of the author.
Download date 24/09/2021 15:13:15
Link to Item http://hdl.handle.net/10150/193637 THE PROTECTIVE EFFECTS OF CONJUGATED LINOLEIC ACID AGAINST
CARCINOGENESIS
by
Michael Quentin Kemp
A Dissertation Submitted to the Faculty of the
GRADUATE PROGRAM IN NUTRITIONAL SCIENCES
In Partial Fulfillment of the Requirements for the Degree of
DOC TORAL OF PHILOSOPHY
In the Graduate College
THE UNIVERSITY OF ARIZONA
2005 2
THE UNIVERSITY OF ARIZONA GRADUATE COLLEGE
As members of the Dissertation Committee, we certify that we have read the dissertation prepared by Michael Q. Kemp entitled The Protective Effec ts of Conjugated Linoleic Acid Against Carcinogenesis and recommend that it be accepted as fulfilling the dissertation requirement for the
Deg ree of Doctor of Philosophy
______Date : 11/18/05 . Donato Romagnolo
______Date: 11/18/05 . Wanda Howell
______Date: 11/18/05 . Linda Houtkooper
______Date: 11/18/05 . Scott Going
______Date: 11/18/05 . Joy Winzerling
Final approval and acceptance of this dissertation is contingent upon the candidate’s submission of the final copies of the dissertation to the Graduate College.
I hereby certify that I have read this dissertation prepar ed under my direction and recommend that it be accepted as fulfilling the dissertation requirement.
______Date : 11/18/05 . Dissertation Director: Donato Romagnolo 3
STATEMENT BY AUTHOR
This diss ertation has been submitted in partial fulfillment of requirements for an advanced degree at The University of Arizona and is deposited in the University Library to be made available to borrowers under rules of the Library.
Brief quotations from this diss ertation are allowable without special permission, provided
that accurate acknowledgment of source is made. Requests for permission for extended
quotation from a reproduction of this manuscript in whole or in part may be granted by
the head of the major department of the Dean of the Graduate College when in his or her
judgment the proposed use of the material is in the interests of scholarship. In all other
instances, however, permission must be obtained from the author.
SIGNED: Michael Q Kemp . 4
ACKNOWLEDGMENTS
I would first like to thank my mentor and graduate advisor, Dr. Donato Romagnolo, for providing me the opportunity to work in his laboratory. His guidance has proven invaluable in helping me think critically to become a better scientist. I would also like to thank my committee members, Dr. Wanda Howell, Dr. Linda Houtk ooper, Dr. Scott
Going, and Dr. Joy Winzerling for their beneficial comments and advice. I would also like to thank the past and present members of the R omagnolo laboratory. 5
TABLE OF CONTENTS
LIST OF FIGURES…………………………………………………………………….8
LIST OF TABLES...... 10
ABSTRACT …………………………………………………………………………..11
CENTRAL HYPOTHESIS ..……………………………………………………….....12
RELEVANCE ……………………………………………………………………...... 13
SPECIFIC AIMS ...... ………………………………………………………….14
CHAPTER 1: INTRODUCTION ……...…………………………….……………….15
Conjugated Linoleic Acid ……………………………………………………...17
Conjugated Linoleic Acid as Breast Anticarcinogen ………………………..…22
Cell Cycle ……………………………………………………………………...24
Polycyclic Aromatic Hydrocarbons as Risk Factors in Breast Carcinogenesis ..27
Susceptibility of DNA Damage from PAHS: AhR Pathway...... 29
Cyclooxygenase and Breast Cancer ...... 30
PAHs as Substrates and Inducers of COX -2...... 33
CLA Attenuates COX -2 Expression...... 37
CHAPTER 2: MATERIALS AND METHODS ...... 38
Cell Culture ...... 38
Trypan Blue Exclusion...... 38
Methylthiazolydiphenyl -tetrazolium Bromide...... 39
Flow Cytometry ...... 39
Western Blotting...... 39 6
TABLE OF CONTENTS -CONTINUED
Transient Transfections ...... 40
Mutagenesis ...... 41
DNA -Protein Binding...... 41
Data Collection and Statistical Analysis ...... 43
CHAPTER 3: CONJUGATED LINOLEIC ACID INHIBITS CELL PROLIFERATION
THROUGH A P53-DEPENDENT MECHANISM: EFFECTS ON THE EXPRESSION
OF THE G1 -RESTRICTION POINTS IN BREAST AND COLON CANCER...... 44
Abstract ...... 45
Introduction...... 46
Results ...... 49
Discussion...... 63
CHAPTER 4: CONJUGATED LINOLEIC ACID INHIBITS POLYCYCLIC
AROMATIC HYDROCARBON -INDUCED CYCLOOXYGENASE -2 PROMOTER
ACTIVITY THROUGH AND AROMATIC HYDROCARBON RECEPTOR -
DEPENDENT MECHANISM...... 68
Abstract ...... 69
Introduction...... 70
Results ...... 73
Dis cussion...... 89
CHAPTER 5: SUMMARY AND CONCLUSIONS ...... 95
Conclusions...... 95 7
TABLE OF CONTENTS -CONTINUED
Future Directions...... 99
APPENDIX A. ABBREVIATIONS ..…………………....…………………...….……100
APPENDIX B. PERMISSION TO REPRINT COPYRIG HTED MATERIALS..…….102
APPENDIX C. PUBLISHED MATERIALS ...... 103
REFERENCES ...... 104 8
LIST OF FIGURES
Figure 1. Proposed Model ...... 16
Figure 2. Structures of cis9trans11-CLA, tr ans10cis12-CLA and linoleic acid...... 18
Figure 3. Metabolic interme diates of linoleic and linolenic acid produced by rumen bacteria ...... 21
Figure 4. Cell cycle and its arrest ...... 26
Figure 5. Structure of the PAH, Benzo[a]pyrene ...... 28
Figure 6. Cyclooxygenase synthesis of prostaglandins via arachidonic acid ...... 32
Figure 7. Activation of B[a]P by COX enzymes ...... 34
Figure 8. Identification of cis -acting elements in human COX -2 promoter ...... 36
Fi gure 9. Treatment with a CLA mix ture reduces the growth rate of breast cancer MCF -7 cells ...... 50
Figure 10. Treatment with CLA mixture induces G1 arrest and modulate s the expression of G1 checkpoints ...... 53
Figure 11. CLA delays exit of MCF -7 cells from G0/G1 arrest...... 56
Figure 12. Wild -type p53 is required for CLA -dependent down -regulation of cyclinE in breast cancer MCF -7 cells...... 57
Figure 13. CLA does not lead to accumulation of hypophosphorylated Rb in p53KO colon cancer cells...... 59
Figure 14. Effects of c9,t11-CLA and t10,c12-CLA isomers on cell proliferation and expression of p53 in breast cancer MCF -7 cells...... 61 9
LIST OF FIGURES -CONTINUED
Figure 15. Effects of various concentrations of c9,t11-CLA and t10,c12-CLA on
expression of p53 and Rb in breast cancer MCF -7 cells...... 62
Figure 16. Treatment of breast cancer MCF -7 cells with CLA mixture induces G1 arrest
...... 74
Figure 17. CLA mixture inhibits B[a]P and TCDD induction of COX -2 promoter activity
...... 76
Figure 18. TCDD induced COX -2 promoter activity abrogated by mutation and/or deletion of potential XREs ...... 78
Figure 19. CLA mixture inhibits B[a]P and TCDD induction of p1A1 -4x-Luc promo ter activity ...... 80
Figure 20. Linoleic acid does not inhibit TCDD induction of p1A1 -4x-Luc promoter activity ...... 82
Figure 21. t10,c12-CLA and CLAmix inhibit B[a]P and TCDD induction of pCOX -2-
3900 better than c9,t11-CLA ...... 86
Figur e 22. t10,c12-CLA and CLAmix inhibit B[a]P and TCDD induction of p1A1 -4x-
Luc better than c9,t11-CLA...... 87
Figure 23. CLAmix and Isomers inhibit TCDD induction of COX -2 at physiological concentrations...... 88
Figure 24. Potential mechanism of CLAs action...... 98 10
LIST OF TABLES
Table 1. Conjugated linoleic acid content of various foods...... 19
Table 2. Physiological properties of conjugated linoleic acid...... 23 11
ABSTRACT
The long-range goal of this project is to investigate the protective effects of
conjugated linoleic acid (CLA) against carcinogenesis . I n this dissertation, we demonstrat e the mechanisms of CLA action on cell cycle progression and repression of polycyclic aromatic hydrocarbon (PAH) -induced Cyclooxygenase -2 ( COX -2) in breast and colon cancer cells. CLA reduced the expression of factors required for G1 to S-phase transition including cyclins D1 and E, and hyperphoshorylated retinoblastoma Rb protein.
In contrast, the over -expression of mutant p53 (175Arg to His) in MCF -7 cells prevented the CLA -dependent accumulation of p21 and the reduction of cyclin E levels suggesting that the expression of wild- type p53 is required for CLA -mediated activation of the G1 restriction point. We also report , CLA reduced the expressi on of COX -2 promoter activity induced by the aromatic hydrocarbon receptor (AhR)-ligand benzo[a]pyrene
(B[a]P ). Mutagenesis or deletion of potential xenobiotic responsive elements (XREs ) with in the COX -2 promoter abrogated its ability to be induced by the high affinity AhR- ligand TCDD. In addition, promoter studies using a XRE- dependent CYP1A1 plasmid revealed CLA can inhibit PAH -induced AhR/XRE -driven genes. In both studies, the t10,c12-CLA isomer was more effective than c9,t11-CLA in inhibiting cell proliferation and AhR/XRE -dependent genes. Taken together, these data suggest that the anti - cancerous properties of CLA appear to be a function, at least in part, of the relative content of specif ic isomers and their 1) ability to elicit a p53 response that leads to the accumulation of pRb and cell growth arrest, and 2) ability to inhibit PAH -induced cycl ooxygenase -2 promoter activity through an AhR-dependent mechanism . 12
CENTRAL HYPOTHESIS
The centr al hypothesis of this proposal is that PAHs abrogate the G0/G1 cell
cycle checkpoint and allow progression of cells containing DNA dama ge caused by
metabolites of PAHs . Conversely, CLA induces p53 expression, which in turn activates
the G0/G1 checkpoint. CLA also represses the expression of COX -2 enzymes that catalyze the biotransformation of PAHs to carcinogenic metabolites . 13
RELE VANCE
This proposal is relevant because to date numerous studies with CLA describe anti - proliferative/cancerous effects against proliferative chemical carcinogens. The mechanism of CLAs cytostatic properties has been revealed recently, but no mechanistic studies on those properties have been reported. We hypothesize that CLA abrogates proliferative effects of PAHs by activating th e G0/ G1 checkpoint through accumulation of p53. Additionally, CLA may abrogate mutagenic effects of PAH by acting as an antagonist for the AhR. COX -2 is responsible for biotransformation of PAHs to active
DNA damaging metabolites and its gene may be regula ted in an AhR dependent fashion.
Since (i) COX -2 over -expression occurs in 50% of huma n invasive breast cancers and
80% of ductal carcinomas in situ , and (Reviewed in Bundred and Barnes, 2005) (ii) biotransformation is required for PAHs to form mutagenic DNA adducts. Elucidation of the contribution of CLA to these molecular mechanisms are of extreme significance. This project will examine the protective effects of CLA on PAH -induced alterations in cell cycle kinetics, PAH -induced over -expression of the COX -2 gene, and the relative roles of the AhR and p53 pathways. Elucidation of these molecular mechanisms may have potential therapeutic implications for cancers with varying resulting from exposure to
PAHs. 14
SPECIFIC AIMS
1. Specific Aim #1 will characterize in breast and colon cancer epithelial cells the
requirement for p53 in CLA -dependent activation of G1 arrest.
2. Specific Aim #2 will examine in breast cancer epithelial cells how CLA prevents
AhR-dependent transcriptional activation of the COX -2 gene by PAHs 15
CHAPTER 1: INTRODUCTION
The Diagram presented in Fig. 1 depicts how activation of the AhR by B[a]P leads to increased expression of COX2 , which contributes to metabolism of B[a]P to reactive end products (BPDE). These metabolites cause DNA damage and induce cancer .
Conversely, CLA induces p53 expression, which in turn activates the G1 checkpoint and represses the expression of COX -2 enzymes. 16
CLA (2) (1) AhR p53
B[a]P COX -2 BPDE Cancer
Figure 1. Proposed model. The exposure to B[a]P induces COX -2 transcription via ac tivation of the AhR. COX -2, then catalyzes the biotransformation of B[a]P to the DNA damaging and carcinogen BPDE. Specific Aim #1: Treatment of cells with CLA can abrogate breast carcinogenisis by inducing p53-dependent G0/G1 arrest. Specific Aim #2: Furthermore, CLA blocks B[a]P induced COX -2 transcription by acting as an AhR antagonist . 17
Conjugated Linoleic A cid
The term conjugated linoleic acid and its acronym CLA refers generally to a
mixture of positional and geometric conjugated dieonic isomers of linoleic acid (LA) in
which the double bonds are conjugated, instead of being in the typical methylene
interrupted configuration (Belury et al. , 2002)( Fig 2). The double bonds of CLA may be in the positions of 7,9; 8,10; 9,11; 10,12; or 11,13 and the 3-dim ensional geometric combinations of cis and/or trans (c and/or t) configurations. CLA is found in a variety of foods including oils and seafood (0.2-0.8mg CLA/g), meats (1.0-4.0mg CLA/g fat) and dairy products (5.0-7.0 mg CLA/g fat) (Chin et al. , 1992) (Tab le1 ). 18
Figure 2. Structures of cis9trans11-CLA, tr ans10cis12-CLA and linoleic acid (18:2cis9cis12). These isomers are also refered to as c9 -t11-CLA and t10-c12-CLA. 19
Table 1. Conjugated linoleic acid content of various foods* 20
The major isomers present in foods are found in the following order : c9t11
>t7c9 >11,13 (c/t) > 8,10 (c/t) >t10c12 >11,13 (c/t) (Ma et al. , 1999; Fritscheet al. , 1999;
Kramer et al. , 1998). The CLA found in ruminant meat and dairy products originates
from incomplete biohydrogenation of LA by rumen bacteria or desaturation of t-11-
octadecenoic acid by delta -9 desaturase (Griinari et al. , 2000). CLA and monounsaturated
fatty acids (MUFAs) are produced as intermediates of polyunsaturated fatty acids
(PUFAs), specifically linoleic (18:2n–6) and linolenic acids (18:3n–3), by ru men bacteria
(Kepler et al. , 1966; Hughes et al., 1982). Two major groups of rumen bacteria have been identified that isomerize either the c12 bond to t11, eg, Butyrivibrio fibris olvens (Kepler
et al. , 1966; Hughes et al. , 1982; Kim et al. , 2000), or the c9 bond to t10, eg,
Megasphaera elsdenii (Kim et al. , 2002). The cascade of possible FAs from 18:2n–6 and
18:3n–3 by these two groups of rumen bacteria is shown in Fig. 3. There are several
dietary factors that influence rumen bacterial population to produce either t11 or t10
containing FAs. The feeding of high -concentrate diets (Piperova et al. , 2000&2002) or
the addition of vegetable oils, crushed oilseeds, or fish oil to the diet of ruminants is
generally associated with reduced milk fat (Griinari et al. , 1998; Franklin et al. , 1999; Ip
et al. , 1999; Bear et al., 2002; Abu-Ghazaleh et al. , 2002; Loor et al. , 2002; Precht et al. ,
2002) and increased t10-18:1 and t10,c12-CLA (Piperova et al. , 200&2002; Precht et al. ,
2002). However, dairy products from ruminants that are exclusively pasture -fed have
been found to contain very high levels of t11-containing FAs, specifically c9,t11-CLA,
t11,c13-CLA, and t11-18:1. 21
Figure 3. Metabolic intermediates of linoleic and linolenic acid produced by rumen bacteria. 22
Conjugated L inoleic Acid as a Breast Anticarcinogen
Several studies reported that fats and fatty acids stimulate mammary
tumorigenesis in animals (Table 2). Increased intake of specific fatty acids have been
linked to increased development of mammary tumors in rats (Carrol et al. , 1979). For example, the incidence of mammary tumors increased linearly in proportion to an increasing intake of linoleic acid (LA) from 0.5% to 4% by weight (Ip et al. , 2001).
Conversely, several investigations indicated that CLA inhibited the cell growth of rat mammary organoids (Ip et al. , 1999a), human breast cancer cells in vitro (Schultz et al. ,
1992; Park et al. , 2000) and chemically -induced breast carcinogenesis in animal models
(Ha et al. , 1990). Prior administration of CLA reduced the incidence of B[a]P -induced mammary cancer in rodents. These diet ary studies found a dose -depende nt protection at levels of 1% CLA and below, but no additional benefit was seen at levels above 1% (Ip et al. , 1991). In studie s with dietary CLA at 0.05, 0.1, 0.25 and 0.5%, as little as 0.1% CLA was sufficient to cause a significant reduction in mammary tumors. This is in contrast to n-3 of fish oil, whose tumor suppression properties are seen when fed in excess of 10% in the diet (Ip et al. , 1994). The mechanism anti -carcinogenic effects of CLA have been attributed, at least in part, to its geometric isomerism because treatment with LA does not inhibit the growth of any cell line and in some cases stimulated tumor growth and met astasis (Schonberg et al. , 1995; Ip, 1985). 23
Table 2. Physiological properties of conjugated linoleic acid. 24
Cell Cycle .
Cellular reproduction is a cyclic process in which daughter cells are produced through nuclear division or mitosis. Mitosis is part of the growth -division cycle called the cell cycle. Mitosis, which is divided into four stages (Prophase, metaphase, anaphase, and telophase), is a relatively small part of the total cell cycle; the majority of the time, a cell is in a growth stage called interphase . Interphase is divided into three parts: G1, S, and
G2. The first gap phase, G1, follows mitosis and is a period of growth and metabolic activity. The S phase follows G1 and is a period of DNA synthesis, in which DNA is replicated. Anothe r gap phase, G2, follows DNA synthesis and precedes the next mitotic division (Reviewed in Lodish et al., 2000).
The cell cycle checkpoints are controlled by cyclin dependent kinases (CDK) which are composed of two proteins - a cyclin (structural protein) and a kinase (enzyme).
In mammals, a succession of kinases (CDK4, CDK2, and CDC2) are expressed along with a succession of cyclins (D, E, A, and B) as cells go from G1 to S to G2 to M. A cyclin joins with a CDK to form a complex. The cyclin A-CDK complex is activated by phosphorylation and this leads to the activation of the transcription factor E2F by the removal of an inhibitor of the transcription factor. Rb is bound to the transcription factor
E2F during G1 but upon phosphorylation from cyclinA, E2F rel eases and activates the transcription of genes required for transition into S phase (Reviewed in Lodish et al.,
2000). 25
The controls associated with cell cycle involv e p53 and Rb . p53 acts prior to
DNA replication by detecting DNA damage in G1 and delay en try into S until the
damage has been repaired. p53 functions as a transactivator of p21, a gene controlling
cellular kinetics. One apparent target for p21 modulation of cell cycle is the R b protein. p21 disrupts phosphorylation of Rb and hence prevents re lease of the S phase
transcription factor E2F. Any mutation that removes or otherwise modifies a checkpoint inhibitor (such as p53) or removes or modifies a transcription inhibitor (such as Rb ) will
lead to a loss of cell cycle regulation and lead to cance r (Reviewed in Lodish et al.,
2000)(Fig. 4). 26
Cyclin B1 P Cdk2 Rb E2F Rb E2F + Cdc2 Cyclin A Cdk2 P Cyclin E Cdk2 Cyclin D1 Cdk4/6 G0 G1 S phase G2 M Restriction Point p21 p27
p53 B[a]P
Figure 4. Cell cycle and its arrest . 27
Polycyclic Aromatic Hydrocarbons as Risk Factors in Breast
Carcinogenesis. Cigarette smoke, diet, and environmental pollution vehicle a
complex mixture of compounds including polycy clic aromatic hydrocarbons, aromatic
amines, and nitrosamines, all of which after metabolic activation induce DNA damage
(Dip ple et al. , 1999; Szeliga et al. , 1997; Gorleska-Roberts et al. , 2002). Of the many
substances present in tobacco smoke, B[a]P is considered a prototype PAH, and classic
DNA damaging ag ent and carcinogen (Russo et al. , 2002; Hecht et al. , 2002) (Fig 5).
B[a]P is a ubiquitous pollutant found in amounts of 10ng per cigarette contributing about
200ng/d for a pack -a-day smoker (Scherer et al. , 2000). Food ingestion is a significant source of exposure to B[a]P. The daily dietary intake of B[a]P has been estimated to range from 120 to 2800 ng/d (Hattemer -Frey et al. , 1991) with average values approximating 600 ng/d (Scher er et al. , 2000). Catabolism of B[a]P can generate reactive diol-epoxides, which have been shown to form stable DNA adducts at mutational hotspots in the p53 (Denissenko et al. , 1996). 28
Figure 5. Structure of the PAH, benzo[a]p yrene. 29
Susceptibility of DNA Damage from PAHs: AhR Pathway.
The extent to which a given exposure to carcinogens produces adducts between
cellular components and reactive metabolites in vivo depends on the balance between
rates of oxidation of the parent compound and rates of detoxification of reactive
compounds via conjugation (Hu and Wells, 1992). Thus, induction of mono-oxygenas e
enzymes, CYP1A1, (Burke, 1977) or inhibition of conjugation enzymes (Hu and Wells,
1992; Bock et al. , 1981) enhances the covalent binding of B[a ]P to DNA. In particular, in mammalian models, responsiveness to PAHs is mediated, among other factors, by the
AHR pathway. The AhR is a steroid/nuclear type receptor which acts as a ligand- activated transcription factor by binding to xenobiotic responsive elements (XRE=5 ′-
GCGTG -3′) in the promoter regions of responsive genes including cytochrome p4501A1
(CYP1A1) (Krishnan et al. , 1995). A prototypical ligand for the AhR is B[a]P. B[a]P
enters the cell and binds with high affinity to the aromatic hydrocarbon receptor. Via this
mechanism, B[a]P/AhR can upregulate expression of CYP1A1, which in turn will lead to
the biotransformation of B[a]P to the highly mutagenic diol-epoxide 7r,8t-dihydroxy -
9t,10-epoxy -7,8,9,10-tetrahydrobenzo[a]pyrene (BPDE) (Ruddon, 1995). BPDE has been
shown to preferentially form DNA covalent (+) trans adducts at the N2 position in
guanine which may cause the DNA polymerase to insert an adenine across from it during
replication (Denissenko et al. , 1996). In the subsequent round of replication, a thymine is
inserted across from the A with the end result being a G T transversion mutation
becoming fixed. Defective repair of B[a]P:DNA adducts has been related to occurrence
of transvers ion mutations (Denissenko et al. , 1996). One gene that may contribute to the 30
susceptibility for DNA damage from PAHs is COX -2. In breast tissue, COX -2 play s a critical role in the bioactivation of PAHs to their carcinogenic end products.
Cyclooxygenase and Breast Cancer .
Cyclooxygenases (COX) are prostaglandin synthases with intrinsic cyclooxygenase and peroxidase activities which catalyze the conversion of ara chidonic acid to prostaglandin G2 (PGG2), and subsequent prostaglandin s (Fig 6). There are two distinct isoforms of this enzyme, a constitutively expres sed isoform (COX -1) and an inducible isoform (COX -2). COX -1 is expressed in virtually all extrahepatic tissues, though not in all cell types within a tissue (Herschman et al. , 1996; Smith et al. , 1991;
Marnett et al. , 1991). Conversely, COX -2 is present co nstitutively in few tissues (brain, testis, kidney), but its expression can be induced by a variety of mediators, including cytokines, growth factors, tumor promoters (Harrison et al. , 1994; Rimarachin et al. ,
1994; Kujuda et al. , 1991), bile acids (Zhang et al., 1998), xenobiotic response element inducers (Kelly et al. , 1997; Liu et al. , 1997) and UVB irradiation (Buckman et al. , 1998).
Over -expression of COX -2 is seen in several neoplastic tissues, e.g. colon (Kargman et al. , 1995; Sano et al. , 1995), bre ast (Parrett et al. , 1987) and lung (Hida et al. , 1998; Wolff et al. , 1998). COX -derived prostanoids contribute to many physiological processes. In particular, COX -2 is required for several female reproductive processes including ovulation, fertilization, implantation and decidualization (Keire et al. , 1990; Cameron et al. , 1992; Smith et al. , 1992). Though COX -2 is required in several female reproductive processes its over -expression may also contribute to breast cancer. 31
COX -2 has been implicated in mamma ry carcinogenesis in several ways. COX -2
expression has been detected in human breast tumors, with no detectable expression in
normal breast tissue (Parrett et al. , 1997). In addition, COX -2 over -expression occurs in
43% of human invasive breast cancers an d 63% of ductal carcinomas in situ. COX -2 over -expression may result from exposure to the PAHs (Kelly, 1997). In addition to its over -expression by PAHs, COX -2 results in bioactivation of PAHs by oxidation during prostanoid synthesis (Marnett et al. , 1990; Marnett et al. , 1978; Guthrie et al. , 1982; Dix
and Marnett, 1983; Eling et al. , 1990; Eling and Curtis, 1992). Hence, B[a]P functions
not only as substrates, but also as inducers for COX -2. 32
Figure 6.Cyclooxygenase synthesis of prostaglandins via arachidonic acid. 33
PAHs as Substrate and Inducer of COX -2
In hepatic tissues, the cytochrome P-450 family of enzymes is widely recognized
for catalyzing oxidative reactions and activating xenobiotics to reactive electrophiles that
are carcinogenic. In contrast, the COX enzyme system is especially important in
bioactivating chemicals in ‘extrahepatic tissues’, such as breast and co lon, where the
cytochrome P-450 mono-oxygenase system has low activity. The metabolism of B[a]P to
B[a]P -7,8-diol and to its DNA reactive BPDE by COX has been thoroughly investigated,
and proceeds through the formation of peroxyl radicals by the cyclooxygenase enzyme
activity during prostanoid synthesis (Fig 7). These cyclooxygenase -formed peroxyl radicals are capable of adding an oxygen molecule across the isolated C9 -C10 double bond of B[a]P -7,8-diol forming BPDE, which is a highly reactive and strongly mutagenic
carcinogen (Marnett et al. , 1990; Marnett, 1978; Guthrie et al. , 1982; Dix and Marnett,
1983; Eling et al. , 1990; Eling and Curtis, 1992). 34
Figure 7. Activation of B[a]P by COX enzymes. 35
Though COX -2 metabolism of carcinogens proceeds through the formation of peroxyl radicals, expression can be induced to enhance bioactivation of carcinogens resulting in increased covalent binding to DNA. Of special interest concerning the activation of B[a]P -7,8-diol is the fact that B[a]P has been shown to be a ligand for the
AhR, a ligand-activated transcription factor, by binding to xenobiotic responsive elements (XRE=5 ′-GCGTG -3′) in the promoter regions of responsive genes (Krishnan et al. , 1995). The human COX -2 promoter contains motifs consistent with xenobiotic responsive elements (Kraemer et al. , 1996; Sherratt et al. , 2003) (Fig 8). The presence of
XREs is compatible with the idea that B[a]P induces COX -2 via an AhR-dependent mechanism, as is the case for other xenobiotic metabolizing enzymes such as CYP1A1
(Whitlock et al. , 1986). In fact, previous studies demonstrate B[a]P induced COX -2 expression (Kelly et al. , 1997; Liu et al. , 1997). 36
Figure 8. Identification of cis -acting elements in the human COX -2 promoter. Three potential XRE (5’-GCGT G-3’) sequences were identified between nucleotide -3444 and - 3440, -958 and -955, and -507 and -504. 37
CLA Attenuates COX -2 Expression
In spite of structural similarities LA and CLA exert opposite effects on COX -2 expression. It is well established that CL A decreases PGE2 production (Li and Watkins,
1998; Sugano, 1998). In contrast, LA enhances PGE2 production, because it is a precursor for AA and, therefore the substrate for COX -mediated PGE2 production
(Moonen et al. , 2004). This is in line with the fact that LA enhances growth and development of tumors while CLA inhibits tumor growth (Schonberg et al. , 1995; Ip et al. , 1985). Attempts to explain how CLA reduces arachidonate -derived eicosanoids such as PGE2 have given support to the theory that CLA inhibit s the constitutive enzyme,
COX -1 and/or the inducible form COX -2, at the mRNA or protein level (Belury, 2002).
Background Summary
CLA is a potent breast anti -carcinogen. It has been shown to inhibit B[a]P induced breast tumor formation. B[a]P can cause t he overexpression of COX -2 . COX -2 overexpression has been linked to breast cancer. CLA attenuates COX -2 expression. 38
CHAPTER 2: MATERIALS AND METHODS
Cell Culture .
Breast (MCF -7) and colon (HCT -116) cancer cells containing wild -type p53
(p53+/+ ) were obta ined from the American Type Culture Collection (Manassas, VA). p53-
deficient (p53-/-) HCT116 cells (HCT KO) (obtained from Dr. Bert Vogelstein, The Johns
Hopkins University School of Medicine, Baltimore, MD) were maintained in DMEM from Sigma (St. Louis, MO ) supplemented with 10% fetal calf serum [(FCS) Hyclone
Laboratories, Logan, UT)]. A mixture of CLA isomers (CLAmix) (Lot #22K1142) and consisted of c9,t11 (50%), t10,c12 (40%), c10,c12 (10%) and B[a]P was obtained from
Sigma. . Purified c9,t11- and t10, c1 2-CLA isomers were obtained from Matreya (State
College, PA). TCDD was obtained from Midwest Research Institute (Kansas City, MO).
Trypan Blue Exclusion.
The effects of the CLA preparations on cell proliferation were investigated using trypan blue exclusio n. The trypan blue assay protocol was as previously described (Jeffy et al. , 2002), and is based on the exclusion of the trypan blue dye by viable cells and uptake by dead cells. Briefly, cells were seeded in quadruplicate at a density of 0.5 x 106
cells/6 -well tissue culture plates and maintained in DMEM plus 10% FCS. At the end of the incubation periods, cells were washed with PBS, trypsinized and counted using a hemocytometer. 39
Methylthiazolyldiphenyl -tetrazolium Bromide
The methylthiazolyldiphenyl -tetr azolium bromide (MTT ) proliferation assay kit
was obtained from Promega (Madison, WI). This assay is based on the conversion of the
yellow tretrazolium dye MTT to purple formazan crystals by metabolically active cells
(Dong, 2002). Briefly, cells were see ded in 96-well tissue culture plates and maintained overnight in DMEM plus 10% FCS. Four wells were assigned to each experimental treatment. Cells were treated with various concentrations of CLA or specific isomers for various periods of time. At 24, 48 or 72 h after treatment, 15 µL of MTT dye solution was
added to each well, and the plate was incubated for 4 h at 37°C. Solubilization/stop solution (100 µL) was added for 1 h at 37°C and the absorbance at 570 nm was recorded
using a Synergy HT plate reader (Bio -Tek Instruments, Winooski, VT).
Flow Cytometry
Flow cytometry was performed in triplicate as described previously (Jeffy, 2000).
Briefly, cells were harvested with trypsin and washed in PBS. Cells were then treated
with RNAse and stained with propidium iodide (70 µmol/L in PBS). Cell cycle
distribution profiles were recorded with a FACscan (Becton-Dickinson, San Diego, CA),
using a CELLQuest program.
Western Blotting
Western blotting was performed as described previously (Jeffy, 2002). Cell
extracts were normalized to protein content and separated by 4 to 12% gradient SDS - 40
PAGE. Immunoblotting was carried out with antibodies raised against p53, p21, p27
(Oncogene Research Products, Cambridge, MA), cyclin D1 and cyclin E (BD Pharmagen,
San Diego, CA). The effects of CLA on the phopshorylation status of Rb were investigated using antibody mAb245 (BD Pharmagen, San Diego, CA) that recognizes both hypo- and hyperphosphorylated Rb ( 110–116 kDa) and mAb549, which recognizes only the fast migrating 110 kDa underphosphorylated Rb protein (Biomol Research
Laboratories, Plymouth Meeting, PA). The normalizat ion of Western blots was confirmed by incubating immunoblots with ß-actin antibody -1 (Oncogene Research Products). The
immunocomplexes were detected by enhanced chemiluminescence (Amersham,
Arlington Heights, IL).
Transient Transfections
Transient transfec tions were performed using the Lipofectamine-Plus procedure
according to manufacturer’s instruction (Life Technologies, Gaithersburg, MD) and as described previously (Jeffy, 2002). Cells were transfected for 3 h with 3 µg of the expression vectors : pCMV (e mpty), pCMV53mut containing a cassette encoding for p53 mutated at position 175 (Arg to His) under the control of the cytomegalovirus promoter
(CVM) (plasmids were gifts from Dr. Bert Vogelstein). pGL3 -COX -2-3900 (a gift from
Dr. McIntyre, University of Utah, Salt Lake City, UT), which contains three potential
XREs at -507 to -504 (XRE1), -958 to -955 (XRE2) and -3444 to -3440 (XRE3). pGL3 -
COX -2-3900-XREmut1, which contains a mutant XRE1 . pGL3 -COX -2-3900-
XREmut1&2 , which contains two mutant XREs site 1 and 2. pGL3 -COX -2-1432- 41
XREmut1, which contains a mutant XRE at -507 to -504. pGL3 -COX -2-1432, pGL3 -
COX2 -327, pGL3 -COX -2-124 (Gifts from Dr . GT Bowden, University of Arizona,
Tucson, AZ), which contain only two potential XREs or none. p1A1- 4x-Luc (a gift from
Dr. Pasco, University of Mississippi, University, MS), which contains a CYP1A1
consensus sequence linked to an array of four GCGTG elements . The transfected cells
were cultured in the absence or presence of B[a]P, TCDD, and CLA for 24 h prior to the
harvesting of cell lysates.
Mutagenesis
Mutation of XRE core sequences (GCGTG to Gccaa) was carried out by site -
directed mutagenesis (Stragene, La Jolla, CA) using the following primers synthesized by
Sigma -Genosys (The Woodlands, TX):
XREmut1 -F, 5’-CCCCAGTCTGTCCCGA ccaa ACTTCCTCGACCC -3’;
XREmut1 -R, 5’-GGGTCGAGGAAGT ttggTCGGGACAGACTGGGG -3’;
XREmut2 -F,
5’GGGCTAGTAACCAAAATAAT ccaa CCATCAGGGAGAGAAATGCC -3’;
XREmut2 -R, 5’-GGCATTTCTCTCCCTGATGG ttggATTATTTTGGTTACTAGCCC -
3’. Insertion of mutations was confirmed by direct sequencing.
DNA -Protein Binding
Binding of AhR to XRE –COX -2 and XRE -CYP1A1 promoter DNA complexes was assayed by a new technique re cently described (Zhu Y, 2004). Eighty percent to 90% 42
confluent MCF -7 were treated with an TCDD and isomer of CLA for 90min, 3h, 6h, 12h,
and 24h before nuclear extracts were prepared. The biotin -labeled , double -stranded
oligonucleotide probes were synthesized by IDT (Integrated DNA Technologies,
Coralville, IA) based on human COX -2 promoter sequence : -507and -504 (COX -XRE1-F ,
5’-/biotin/ CCCCAGTCTGTCCCGA CGTG ACTTCCTCGACCC -3’; COX -XRE1-R,
5’-/biotin/ GGGTCGAGGAAGT CACG TCGGGACAGACTGGGG -3’), -958 to -955 and
(COX -XRE2-F , 5’-
/biotin/GGGCTAGTAACCAAAATAAT CACG CCATCAGGGAGAGAAATGCC -3’;
COX -XRE2-R, 5’ -
/biotin/GGCATTTCTCTCCCTGATGG CGTG ATTATTTTGGTTACTAGCCC -3’ ); and the CYP1A1 promoter sequence: (CYP -XRE- F, 5’-
/biotin/CGGCTCTTGTCACGCAACTCCGAGCTCA -3’; CYP -XRE- R 5’-
/bio tin/TGAGCTCGGAGTTGCGTGAGAAGAGCCG- 3’); . A biotinylated nonrelevant sequence, 5' -/biotin/AGTCATCGAGTCACATGGG -3' that does not harbor known enhancer elements, was used as a binding control. The binding assay was performed by mixing 200 µg MCF7 nuclear extrac ts, 2 µg biotin -labeled DNA oligonucleotides, and 20
µL streptavidin agarose beads with 70% slurry. The mixture was incubated at room temperature for 1 hour with shaking. Beads were then pelleted down by centrifugation at
5000g in a microcentrifuge for 30 seconds and washed with cold PBS 3 times. The binding proteins were separated on 4% to 15% PAGE followed by Western blot analysis probed with antibodies against AhR. 43
Data Collection and Statistical Analysis
Cell viability, flow cytometry and transient tra nsfection data are presented as
means ± SEM . The comparison of means following a significant (P < 0.05) ANOVA were performed by the Fisher protected least significant difference test. Flow cytometry data were analyzed with the MODFIT.2 software at the Flow Cytometry Laboratory, Arizona
Cancer Center. 44
CHAPTER 4: CONJUGATED LINOLEIC ACID INHIBITS CELL PROLIFERATION
THROUGH A P53-DEPENDENT MECHANISM: EFFECTS ON THE EXPRESSION
OF THE G1 -RESTRICTION POINTS IN BREAST AND COLON CANCER. 45
Abstract
Previous reports have documented the anti -proliferative properties of a mixture of conjugated isomers (CLA) of linoleic acid [LA (18:2)]. In this study, we investigated the mechanisms of CLA action on cell cycle progression in breast and colon cancer cells.
Treatment wi th CLA inhibited cell proliferation in breast cancer MCF -7 cells containing wild -type p53 (p53+/+ ). At cytostatic concentrations, CLA elicited cell cycle arrest in G1 and induced the accumulation of the tumor suppressors p53, p27 and p21 protein.
Conversel y, CLA reduced the expression of factors required for G1 to S-phase transition including cyclins D1 and E, and hyperphoshorylated retinoblastoma Rb protein. In contrast, the over -expression of mutant p53 (175Arg to His) in MFC -7 cells prevented the
CLA -dep endent accumulation of p21 and the reduction of cyclin E levels suggesting that
the expression of wild -type p53 is required for CLA -mediated activation of the G1
restriction point. To futher elucidate the role of p53, the effects of CLA in colon cancer
HCT 116 cells (p53+/+ ) and p53-deficient (p53-/-) HCT116 cells (HCTKO) were examined.
The treatment of HCT116 cells with CLA increased the levels of p53, p21, p27 and
hypophosphorylated (pRb) protein and reduced the expression of cyclin E, whereas these
effect s were not seen in p53-deficient HCTKO cells. The t10,c12-CLA isomer was more
effective than c9,t11-CLA in inhibiting cell proliferation of MCF -7 breast cancer cells and enhancing the accumulation of p53 and pRb. We conclude that the antiproliferative properties of CLA appear to be a function, at least in part, of the relative content of specific isomers and their ability to elicit a p53 response that leads to the accumulation of pRb and cell growth arrest. 46
Introduction
Conjugated linoleic acid (CLA) is a collective term for a mixture of positional and geometric isomers of linoleic acid (LA) in which the double bonds are conjugated in either the cis or trans configuration at positions 7,9-, 8,10-, 9,11-, 10,12- or
11,13- of the carbon chain (Sehat et al. , 1998). CLA is found in a variety of foods including oils and seafood (0.2–0.8 mg CLA/g fat), meats (1.0–4.0 mg CLA /g fat) and dairy products (5.0–7.0 mg CLA/g fat) ( Herbel et al. , 1998). The CLA found in ruminant meat and dairy products originates from the incomplete biohydrogenation of LA by rumen bacteria or desaturation of trans-11-octadecenoic acid by -9 desaturase (Griinari
et al. , 2000). The cis -9, trans-11 (c9,t11-CLA) isomer is the primary dietary form of CLA
in human diets. However, the relative concentration of c9,t11-CLA and other isomers
including trans-10,cis -12 (t10,c12-CLA) in dairy and meat products is influenced by the
type and amount of vegetable fats fed to ruminants (Pariza et al. , 2001). CLA inhibits
chemically -induced stomach (Ha et al. , 1990), mammary ( Ip et al., 1991; Ip et al. , 2001),
colon (Liew et al. , 1995) and skin (Belury et al. , 1996) cancers. In vitro investigations
indicate that CLA inhibits the cell growth of rat mammary organoid s (Ip et al. , 1999b),
human breast cancer cells in vitro (Schultz et al. , 1992; Park et al. , 2000) and chemically -
induced carcinogenesis in animal models (Ha et al. , 1990).
The anti -proliferative effects of CLA have been attributed, at least in part, to its
geometric isomerism because treatment with LA stimulates rather than represses the
growth of breast (Rose, 1989), leukemia (Phoon et al. , 2001) and liver epithelial (Hayashi 47
et al. , 1997) cells. Studies comparing the effects of various CLA isomers sugge st that t10,c12-CLA may be the more biologically active isomer for the inhibition of tumor cell proliferation (Miller et al. , 2002), and elongation and desaturation of linoleic and linolenic acids (Ip et al. , 2002). This cumulative evidence suggests that CLA formulations
could be developed as a dietary adjuvant against neoplastic transformation (Thompson et
al. , 1997; Hubbard et al. , 2000). However, how CLA or specific isomers regulate the expression of cell cycle checkpoints is unknown (Belury et al. , 2002a).
The cell cycle progression from G0/G 1 to S-phase requires phosphorylation of the
retinoblastoma tumor suppressor protein, Rb, a member of the pocket protein family, by
the cyclin D1 -cdk4/6 and cyclin E-cdk2 complexes (Weinberg et al. , 1995).
Phosphory lation of Rb in early G1 by cyclin D1/cdk4/6 triggers a cascade of events that begins with the dissociation of E2F from Rb and the activation of transcription of cyclin E
by E2F, and culminates with the stimulation by E2F of its own transcription and assem bly
of cyclin E with its catalytic partner Cdk2. The cyclin E-cdk2 complexes promote further phosphorylation of Rb and the release of E2F, thus establishing a positive feedback loop
that accelerates the irreversible progression through late G1 (Sherr et al ., 1996).
The tumor suppressor p53 plays a key role in the regulation of the cell cycle in
response to DNA damage and is frequently mutated in human cancers (Kinzler et al. ,
1997). The loss of p53 functions may occur early in tumorigenesis (Ziegler et al. , 1994)
or be a late event (Baker et al. , 1990). The tumor suppressing properties of p53 stem from
its ability to regulate, through both transcription-dependent and -independent 48
mechanisms, the expression of a battery of genes whose products regulate cell cycle transition at the G1/S interval, or trigger apoptosis depending on the severity of DNA damage (Vogelstein et al. , 1992). In this study, we attempted to clarify the mechanisms of
CLA action on the expression of restriction points controlling cell cycl e transition in breast and colon cancer cells. 49
Results
Effects of CLA on proliferation of MCF -7 cells and expression of G1 checkpoints.
The effects of a mixture of CLA isomers on cell proliferation of asynchronous MCF -7
cells were investigated using the trypan blue exclusion assay. This assay provides a direct count of viable cells that exclude the trypan blue dye. The treatment with CLA for 72 h resulted in a 20% inhibition of cell proliferation starting at concentrations of 40 µmol/L
(Fig. 9A), whereas 160 µmol/L CLA reduced the growth rate by 45%. The anti - proliferative effects of CLA on MCF -7 cells were further examined using the MTT proliferation assay, which provides an indirect but quantitative determination of metabolically active cells (Dong et al. , 2002). Compared with cells cultured in control medium, the treatment with the CLA mixture for 72 h resulted in a 20 to 30% reduction in cell viability with a concentration range of 10–80 µmol/L, and a 50% reduction in the presence of 160 µmol/L CLA (Fi g. 9B). Therefore, compared with the trypan blue method, the MTT assay was more sensitive, indicating that at concentrations as low as 10
µmol/L the CLA treatment reduced the number of metabolically active cells. 50
Figure 9. Treatment with a conjugated linoleic acid (CLA) mixture reduces the growth rate of breast cancer MCF -7 cells. MCF -7 cells were cultured in DMEM, DMEM plus the vehicle ethanol (Vehicle) or DMEM plus various concentrations of a CLA mixture (CLA). At the end of the incubation period (72 h), the number of adherent cells was determined by direct counting using ( A) the trypan blue exclusion or (B) the methylthiazolyldiphenyl -tetrazolium bromide (MTT) proliferation assay protocol as described in Materials and Methods. Bars are means ± SEM from two independent experiments performed in quadruplicate ( n = 8). Means without a common letter differ. (P < 0.05). 51
To determine whether the CLA mixture inhibited growth by altering cell cycle
progression, its effects on cell cycle distribution were examined by flow cytometry. For this experiments, the concentration of 160 µmol/L CLA was used, which approximates that used in previous culture studies investigating the regulation of apoptotic gene expression in human breast cancer cells (Majumder et al. , 2002) and the activation of the
peroxisome proliferator-activated receptor (PPAR) by various CLA isomers (Yu, 2002).
The flow cytometry data indicated that when asynchronous MCF -7 cells were cultured in
control DMEM, a similar perc entage of cells occupied the G0/G1 ( 41.0%) and S-phase
( 43.0%) windows. Conversely, the treatmen t with CLA for 24 h delayed MCF -7 cells in
G0/G1 (53.4%) while reducing the accumulation in the S-phase (28.7%), but had no
effect on the fraction of cells occupying the G2/M window (17.8 versus 16.6%) (Fig.
10A). Western blot analysis of cell lysates obta ined from MCF -7 cells indicated that the
CLA -induced arrest in G0/G1 was paralleled by the accumulation of p53 and p21 proteins
(Fig. 10B). In addition, the CLA mixture increased the levels of hypophosphorylated Rb,
as evidenced by the appearance of a doublet comprising a faster migrating band ( 110 kDa). The Rb protein migrates on an SDS -PAGE as multiple closely spaced bands ( 110–
116 kDa). The different bands represent different Rb phosphorylation states, which are
cell cycle dependent and were detected in this study using antibody mAb245 that
recognizes both hypo- and hyperphosphorylated Rb. In MCF -7 cells cultured in control
medium (DMEM), we observed the accumulation of cyclin D1 (6 to 24 h) and cyclin E
(18 h). In contrast, in CLA -treated cells we observed a reduction of cyclin D1 (6 to 24 h)
and E (6 and 18 h) (Fig. 10C) protein levels. Both cycli n D1 and cyclin E are required for 52
progression to S-phase and their reduced expression in CLA -treated cells corroborated the flow cytometry data (Fig. 10A) documenting the arrest of MCF -7 cells in G1 phase of the cell cycle following treatment with the CLA mixture . 53
Figure 10. Treatment of breast cancer MCF -7 cells with a conjugated linoleic acid (CLA) mixture induces G1 arrest and modulates the expression of G1 checkpoints. MCF -7 cells were cultured in DMEM or DMEM plus 160 µM CLA mixture (CLA) . (A) Flow cytometry of asynchronous MCF -7 cells indicated that treatment with CLA for 24 h induced cell cycle arrest in G0/G1. The flow cytometry profiles are representative of three independent experiments (n = 9) with SD lower than 3%. ( B, C) Western blot analysis of cell lysates obtained from MCF -7 cells cultured for 24 h in DMEM or DMEM plus 160µM CLA. Bands represent immunocomplexes for (B) p53, p21, hyper- (ppRb) and hypo (pRb)-phosphorylated Rb and (C) cyclin D1 and cyclin E. The control bands are ß-actin immunocomplexes. Results are representative of three separate experiments. 54
Th e suppressive effects of CLA on cyclin E expression require wild- type p53. The
kinetics of cell cycle arrest induced by the CLA mixture were further investigated by first
synchronizing MCF -7 cells in G0/G1 (Fig. 11). At the end of the synchronization period,
94% of the cells were positioned in G0/G1. The cells were then released in control
DMEM or DMEM plus 160 µmol/L CLA and their position in the cell cycle was
examined by flow cytometry. The treatment with the CLA mixture for 12 h did not
influence cell cycle distribution (Fig. 11A–C) or the cellular contents of p53, p21 and Rb
status irrespecti ve of the presence or absence of CLA in the culture media (data not shown). However, the treatment with CLA for 24 h increased the percentage of cells delayed in G0/G1 (68 versus 53%), while reducing the fraction of cells positioned in S- phase (30 versus 45%) and G2/M (1.9 versus 6.5%). These data provide important evidence that the CLA mixture induced cell cycle arrest in G1. This effect was accompanied by the accumulation of p53, p21 and the faster migrating immunocomplex representing hypophosporylated Rb (Fig. 11D). Based on these results, we hypothesized that one mechanism by which CLA may induce G1 arrest is through stabilization of p53, which in turn initiates a cascade of events including the activation of p21 expression and reduction of cyclin E expression. To test this hypothesis, MCF -7 cells were transfected with an expression vector (p53mut) containing a cassette encoding for p53 mutated at position 175 (Arg to His) under the control of the cytomegalovirus (CMV) promoter.
After transfection, cells were cultured for 48 h in the presence (160 µmol/L) or absence of
CLA and cell lysates were analyzed by Western blotting. The data ( Fig. 12) indicate that in MCF -7 cells transfected with the empty vector (pCMV) the treatment with the CLA 55
mixture led to the accumulation of p53 and p21 proteins, while reducing the levels of immunocomplexes representing cyclin E. As a result of constitutive activity from the
CMV promoter, transfection with the p53mut vector increased the intensity of immunocomplexes for p53 ir respective of the absence or presence of CLA in the culture media. More importantly, the overexpression of mutant p53 (p53mut) prevented the accumulation of p21 and the reduction of cyclin E observed in MCF -7 cells transfected with pCMV. These observations confirm that the suppressive effects of CLA on cyclin E levels were mediated by p53. 56
Figure 11. Conjugated linoleic acid (CLA) delays exit of MCF -7 cells from G0/G1 arrest. MCF -7 cells were synchronized in G0/G1 by serum starvation for 24 h. Cells were released into DMEM containing 10% fetal calf serum plus vehicle (DMEM) or DMEM plus 160µM CLA mixture (CLA) for 12 and 24 h. (A–C) Cell- cycle distribution was examined by flow cytometry. The profiles are representative of three independent exper iments. Means without a common letter differ (P < 0.05). (D ) Cell lysates were obtained from MCF -7 cells cultured for 24 h in DMEM or DMEM plus CLA mixture (160µM) following release from G0/G1 arrest. Bands represent immunocomplexes for p53, p21, hyper - (p pRb) and hypo (pRb)-phosphorylated Rb. The control bands are ß- actin immunocomplexes. Western blots are representative of two independent experiments. 57
Figure 12. Wild -type p53 is required for conjugated linoleic acid (CLA) -dependent down regulation of cyclin E in breast cancer MCF -7 cells. Data represent Western blot analysis of MCF -7 cells transiently transfected with the expression vector p53mut encoding mutated p53 (175Arg to His) under the control of the cytomegalovirus (CMV) promoter, or the empty vector pCMV. After transfection, MCF -7 cells were cultured for 24 in DMEM containing 10% fetal calf serum plus vehicle (DMEM) or DMEM plus 160 µmol/L CLA mixture (CLA). Bands represent immunocomplexes for p53, p21, and cyclin E. The control bands are ß-actin immunocomplexes. Results are representative of two separate experiments. 58
CLA does not lead to accumulation of hypophosphorylated Rb in HCTKO, p53-/-
colon cancer cells. To further investigate the role of p53 in the CLA -induced arrest in G1,
the effects of CLA on G1 checkpoints in colon cancer HCT116 cells containing wild -type
p53+/+ and p53-deficient HCT116 cells (HCTp53KO) were examined. Western blot
analysis indicated that the treatment of HCT116 cells with CLA (160 µmol/L) exerted
effects similar to those seen in MCF -7 cells including the accumulation of p53, p21, p27
and hypophosphorylated Rb (pRb) (Fig. 13A). Immunoblotting of cell lysates obtained from MCF -7 and HCT116 cells with the antibody, mAb549, which recognizes only
hypophosphorylated Rb, provided direct evidence that the treatment with the CLA
mixture caused accumulation of pRb and that this effect was p53-dependent. In fact, CLA failed to change the levels of p27 and Rb phosphorylation status in p53-deficient
HCTp53KO cel ls. However, in keeping with earlier reports documenting the induction of p21 through p53-independent mechanisms (el -Deiry et al. , 1993), a slight accumulation of p21 in HCTp53KO cells treated with CLA was observed. Time -course experiments with HCT116 cell s (p53+/+ ) confirmed that CLA induced the stabilization of p53, p27 and
p21 while reducing from 6 to 18 h the expression of cyclin E (Fig. 13B). Conversely, no
time -dependent changes in the cellular content of p27 and Rb in HCTp53KO cells treated
with CLA were observed (data not shown). These results provide direct evidence that the
reduction of hyperphosphorylated retinoblastoma (ppRb) protein levels observed in cells
treated with a mixture of CLA isomers results from the activation of p53-dependent mechan isms. 59
Figure 13. Conjugated linoleic acid (CLA) does not lead to accumulation of hypophosphorylated Rb in p53(-/-) colon cancer cells. (A) Breast MCF -7 (p53 +/+ ), and colon HCT116 (p53+/+ ) and HCTp53KO (p53-/-) cancer cells were cultured in DMEM plus vehicle (DMEM) or DMEM plus 160 µmol/L CLA (CLA) for 24 h. ( B) HCT116 cells were cultured in DMEM or DMEM plus CLA for various periods of time. Bands are immunocomplex for p53, p21, p27, cyclin E, hyper - (ppRb) and hypo (pRb)- phosphorylated Rb. Antibodies used to detect Rb proteins were mAb245 that recognizes both ppRb and pRb, and mAb549 that recognizes only pRb. The control bands are ß-actin immunocomplexes. Western blots are representative of three separate experiments. 60
Effec ts of c9,t11- and t10,c12-CLA on cell proliferation and Rb phosphorylation
status. To determine the physiological importance of the CLA levels used in these studies
and which CLA isomer was responsible for altering p53 protein and Rb phosphorylation
status, the effects of various concentrations of the CLA mixture with the c9, t11-CLA and
t10,c12-CLA isomers were compared. The MTT proliferation data from 24 to 72 h (Fig.
14) indicated that the c9,t11-CLA isomer induced a modest 5% decrease in cell number at concentrations ranging from 10 to 40 µmol/L (Fig. 14B). At 24 h, the treatment with 80 and 160 µmol/L c9,t11-CLA reduced cell number by 20%. Conversely, the treatment with t10,c12-CLA at concentrations ranging from 10 to 40 µmol/L CLA as early as 24 h produced a larger reduction ( 25%) in cell viability that was further reduced to 35 and
55%, respecti vely, after treatment with 80 and 160 µmol/L CLA for 72 h (Fig. 14C). The
CLA mixture and the t10,c12-CLA isomer produced similar growth inhibition. At the
concentration of 40 µmol/L, the CLA mixture and t10,c12-CLA, but not c9,t11-CLA,
were equally effect ive in inducing the accumulation of p53 protein (Fig. 14D). Titration
experiments confirmed that at concentrations as low as 10 µmol/L, the t10,c12-CLA isomer was more effective than c9,t11-CLA in increasing p53 (Fig. 15A) and pRb (Fig.
15B) levels. These data support the conclusion that the t10,c12-CLA isomer is more effective than c9,t11-CLA in enhancing an anti -proliferative response by lowering the expression of factors (ppRb) required for transition through G1. 61
Figure 14. Effects of c9,t11-conjugated linoleic acid (CLA) and t10,c12-CLA isomers on cell proliferation and expression of p53 in breast cancer MCF -7 cells. Cells were plated in 96-well tissue culture plates and cultured in DMEM plus vehicle (DMEM) or DMEM plus various amounts (10, 20, 40, 80 or 160 µmol/L) of (A) CLA mixture (CLA), ( B) c9,t11-CLA or (C) t10,c12 -CLA for 24, 48 and 72 h. At the end of the incubation periods, cells were counted using the methylthiazolyldiphenyl -tetrazolium bromide (MTT) viability ass ay as described in Materials and Methods. Data points represent means ± SEM from two independent experiments performed in quadruplicate (n = 8). (D ) MCF -7 cells were cultured in DMEM or DMEM plus 40 µM CLA, c9,t11-CLA or t10,c12-CLA for 24 h. Bands represe nt Western blot immunocomplexes for p53 and the control ß-actin. Western blots are representative of three separate experiments and suggest that at the concentration of 40 µmol/L the CLA mixture and t10,c12 -CLA isomer, but not c9,t11-CLA, were effective in inducing the accumulation of p53 protein. 62
Figure 15. Effects of various concentrations of c9,t1 1-conjugated linoleic acid and t10,c12-CLA on expression on p53 and Rb in breast cancer MCF -7 cells. MCF -7 cells were cultured in DMEM plus vehicle (DMEM) or DMEM plus various amounts (10, 20, 40, 80 and 160µM) of c9,t11-CLA or t10,c12-CLA for 24 h. At the end of the incubation period, cell lysates were analyzed by Western blotting. Bands represent immunocomplexes for (A) p53 and (B) hyperphosphorylated (ppRb) and hypophosphorylated (pRb). Antibodies used to detect Rb proteins were mAb245 that recognizes both ppRb and pRb, and mAb549 that recognizes only pRb. The control bands are ß-actin immunocomplexes. Western blots are represe ntative of three separate experiments and suggest that the t10,c12-CLA isomer is more effective than c9,t11-CLA in inducing the accumulation of p53 protein and pRb. 63
Discussion
The objective of this study was to elucidate the mechanisms by which CLA exerts its
anti -proliferative effects in breast and colon cancer cells. The cumulative observations
indicate that the growth arrest properties of CLA are the consequence of its ability to
activate a p53 response, which in turn leads to the gain of checkpoint proteins (p21, p27)
and the loss of cyclins (D1, E) and other factors (ppRb) required for G1/S transition. The
data also suggest that the t10,c12-CLA isomer is more effective than c9,t11 -CLA in
inhibiting the growth of breast cancer cells. The effects of CLA on the cell cycle
machinery were characterized using a CLA mixture consisting primarily of t10,c12 (40%)
and t9,c11 and c9,t11 (50%). Acute exposure of breast cancer MCF -7 cells to the CLA
mixture inhibited cell growth because of G1 arrest. This anti -prolif erative effect of CLA
has been attributed to the geometric isomerism of the fatty acid chain, and contrasts with
the growth promoting properties of LA. In fact, earlier studies have clearly demonstrated
that LA induces growth of human breast cancer (Schult z et al. , 1992; Rose et al. , 1989;
Rose et al. , 1990;Cunningham et al. , 1997), leukemia (Phoon et al. , 2001) and liver epithelial (Hayashi et al. , 1997) cells. The growth stimulation by LA has been attributed to the down -regulation of p53 protein expressi on (Tillotson et al. , 1993). Conversely, in
the current study the CLA mixture induced the arrest of breast cancer MCF -7 cells in G1 and the accumulation of p53. The p53 protein activates the transcription of genes encoding for factors involved in G1 to S-phase transition. Moreover, in MCF -7 breast 64
cancer and HCT116 cells the CLA treatment increased the expression of p21 and p27, whereas it repressed the expression of cyclin E and ppRb.
To examine the contribution of p53 to CLA -induced growth arrest, a muta nt p53
(175Arg to His) was over -expressed in MCF -7 cells, which prevented the accumulation of p21 and the reduction in cyclin E seen in non-transfected MCF -7 cells treated with
CLA. These data provide important mechanistic evidence that the activation of p53- regulated pathways may be central to the anti -proliferative effects of CLA. The p53 mutant 175Arg to His, which is comprised in the DNA -binding domain of the p53 protein, was used for the transfection experiments because it is the most frequently mutate d p53 codon in breast and colon tumors. The notion that p53 plays a key role in the
CLA -induced cell cycle arrest was further corroborated by the observation that the treatment of colon cancer HCTKO cells with CLA failed to elicit any changes in the expres sion of p27 or the relative ratio of ppRb/pRb.
These results suggest that the health effects of CLA may be mediated by the expression of wild -type p53. The p53 gene product is known to be a key player in the genotoxic -stress response in mammalian cells by inducing the transcription of p21, which in turn inhibits cyclin E/cdk2-dependent phosphorylation of Rb, thus leading to the accumulation of pRb (Weinberg et al. , 1995). The transition from G1 to S-phase requires phosphorylation of the retinoblastoma tumo r suppressor protein Rb by the cyclin D1 - cdk4/6 (G0 to mid -G1) and cyclin E-cdk2 (late G1) complexes. The phosphorylation of
Rb in early G1 leads to the dissociation of E2F transcription factors and the 65
transcriptional activation of genes, the protein products of which are required for the
transition through late G1 including cyclin E and E2F1 (Sherr et al. , 1996). In contrast,
the cdk inhibitors p21 and p27 stechiometrically regulate the activities of cyclin D1 -
Cdk4/6 and cyclin E-Cdk2 complexes during the G1 phase of the cell cycle (Harper et al. ,
1993). In proliferating cells, the p21 protein facilitates the assembly of the cyclin D1 -
Cdk4 complexes, whereas a reduction in the levels of cyclin D1 increases the pool of
available p21, which then associates with cyclin E -cdk2 complexes, thus reducing cyclin
E-cdk2-dependent kinase activity (Hall et al. , 1993 ). Similarly, p27 outtiters cyclin D1
thus inhibiting cyclin D1 -dependent activation of Cdk4/6 (Carrol, 2000). These overall
findings suggest that by triggering the p53-dependent accumulation of p21 and p27, CLA causes a reduction in the cellular levels of cyclin E and ppRb leading to G1 arrest.
Previous studies have suggested that the biological effects of CLA mixtures are, at least in part, due to the dis tinct actions of the c9,t11- and t10,c12-isomers ( Pariza et al. ,
2001). Therefore, we examined the effects of various concentrations of these CLA isomers on cell proliferation and expression of p53 and Rb proteins. Our results indicate that there are marke d differences in the anti -proliferative activity of c9, t11-CLA and t10,c12-CLA. At concentrations as low as 10 µmol/L, which approximate CLA plasma levels measured in humans (Herbel et al. , 1998; Huang et al. , 1994), the t10,c12-CLA isomer was more potent than c9,t11-CLA in repressing cell growth and inducing the
accumulation of p53 and pRb in breast cancer MCF -7 cells. Thus, the relative concentration of the t10,c12-CLA isomer may influence the health effects of CLA mixtures found in enriched preparations, and meat and dairy products. 66
The increase in the steady -state levels of p53 observed in MCF -7 cells treated
with t10,c12-CLA suggests that its growth inhibitory properties may involve the
induction of a DNA damage response. Previous studies showed that CLA induces lipid
peroxidation in breast MCF -7 and colon SW480 cancer cells (Miller, 2001), and
modulates both non-enzymatic arachidonic acid oxidation and cyclooxygenase -catalyzed
prostaglandin profile (Basu et al. , 2000). These effects of CLA on lipid me tabolism may
be exerted through the modulation of PPAR as evidenced by the fact that CLA is a ligand
of both PPAR (Moya -Camarena et al. , 1999) and PPAR - (Belury et al. , 2002b), and
PPAR are involved in the transcriptional regulation of the cyclooxygenase -2 gene (Meade et al. , 1999). Therefore, it is plausible that the ability of specific CLA isomers or metabolic derivatives to elicit changes in oxidative damage may contribute to the activation of p53-dependent pathways leading to cell cycle arrest or apoptosis depending
on the intensity and duration of exposure. Although the regulation of apoptosis by CLA
was not the primary focus of this study, an increase in the mRNA levels for Bax- and a
reduction in Bcl -2 expression in MCF -7 cells treated with the CLA mixture was observ ed
(Kemp, M. Q., Jeffy, B. D. & Romagnolo, D. F., unpublished data). These observations
corroborate earlier reports documenting the induction of apoptosis by CLA in MNU -
initiated rat mammary gland (Ip, 2000). Similar growth inhibitory properties have been
described for docosahexaenoic acid [22:6(n -3)], which decreases Rb phosphorylation in
melanoma SK -Mel -110 cells (Albino, 2000) and increased cytotoxicity induced by
doxorubicin (Germain et al. , 1998). The implication of p53 in the regulation of the 67
express ion of proapoptotic and anti -apoptotic genes suggests that the loss of functional p53 may confer resistance to CLA treatment.
In summary, this report documents that in breast and colon cancer cells, CLA compromises the expression of cyclins required for G1/S progression including cyclin D1 and E, and the phosphorylation status of Rb. This cell cycle regulatory aspect of CLA may have clinical importance in the development of preventive and/or therapeutic strategies based on the fact that nearly 45% of breas t cancers over -express cyclin D1 (Hui et al. , 2002), and over -expression of either cyclin D1 or cyclin E contributes to neoplastic progression of the breast ( Borter et al. , 1997) and colon (Wang et al. , 2002). Although further studies are required to clari fy whether CLA -induced p53 and related withdrawal from the cell cycle may be due to altered lipid peroxidation and/or generation or reactive metabolites, our findings document for the first time that the effects of CLA on the expression of G1 checkpoints may depend on the expression of functional p53. However, the fact that p53 is the most commonly mutated gene in human cancers may limit the usefulness of therapeutic strategies based on CLA. Finally, whereas our data do not preclude the possibility that the t10,c12- and c9,t11-CLA or other isomers may act synergistically to inhibit cell proliferation, this study attributes a major suppressive effect on the cell cycle apparatus to the t10,c12-CLA isomer. The molecular mechanisms through which this and other CLA isomers may alter the components of the cell cycle await further investigation. 68
CHAPTER 4: CONJUGATED LINOLEIC ACID INHIBITS POLYCYCLIC
AROMATIC HYDROCARBON -INDUCED CYCLOOXYGENASE -2 PROMOTER
ACTIVITY THROUGH AN AROMATIC HYDROCARBON RECEPTOR -
DEPENDENT MECHANISM. 69
Abstract
COX -2 expression has been detected in human breast tumors but not in normal breast tissue. Interestingly, of these breast cancer cases only 5-10% are hereditary while the majority is sporadic. This suggests that non-mutational events ma y increase breast cancer incidence by altering the expression of COX -2. The over -expression of COX -2 has been shown to result from exposure to the PAHs . In this study, we investigate the mechanisms of CLA action on repression of PAH -induced COX -2 promoter activity in
MC F-7 breast cancer cells. We report, CLA reduced the expression of COX -2 promoter activity induced by the AhR-ligand B[a]P and the high affinity AhR-ligand TCDD .
Mutagenesis of potential XREs within the COX -2 promoter abrogated its induction by
TCDD. In addition, promoter studies using a XRE -dependent CYP1A1 plasmid revealed
CLA can inhibit PAH -induced AhR-driven genes. In contrast, linoleic acid was unable to inhibit induction of CYP1A1 by TCDD. In both promoters, the t10,c12-CLA isomer was mo re effective than c9,t11 -CLA in inhibiting AhR/XRE -dependent genes. Taken together, these data suggest that the inhibitory properties of CLA on PAH -induced COX -
2 promoter activity appear to be a function, at least in part, of the relative content of specif ic isomers and their ability to inhibit an AhR-dependent mechanism . 70
Introduction
The environmental pollutants, PAHs , are present as a complex mixture in
cigarette smoke and grilled foods (Scherer et al. , 2000; Lijinsky et al., 1991). Most
notable of these substances is, B[a]P , a classic DNA damaging agent and carcinogen
(Russo et al., 2002; Hecht, 2002). Food ingestion is a major source of exposure to B[a]P.
Estimates of the daily dietary intake of B[a]P vary from 120 to 2800 ng/d (Hattemer -Frey et al., 1991) while averaging 600 ng/d (Scherer et al., 2000). B[a]P also is a common pollutant found in cigaret tes in amounts of 10ng per and 200ng/d for a pack -a-day smoker
(Scherer et al., 2000). Metabolism of B[a]P can generate the reactive diol-epoxide, 7r,8t-
dihydroxy -9t,10-epoxy -7,8,9,10-tetrahydrobenzo[a]pyrene (BPDE), which have been shown to form stable DNA adducts at mutational hotspots (Denissenko et al., 1996).
Metabolism of PAHs to reactive end products is mediated by the AhR pathway.
The AhR is a ste roid/nuclear type receptor which acts as a ligand-activated transcription factor by binding to xenobiotic responsive elements (XRE=5 ′-GCGTG -3′) in the promoter regions of responsive genes including CYP1A1 (Krishnan et al. , 1995). A prototypical ligand for the AhR is B[a]P. Via this mechanism, the B[a]P/AhR heterocomplex upregulates the expression of CYP1A1, which in turn leads to the biotransformation of B[a]P to the highly mutagenic B[a]P diol epoxide ( BPDE ) (Ruddon,
1995). Another gene that may function t hrough this same mechanism and contribute to the susceptibility of DNA damage from PAHs is COX -2. In breast tissue, COX -2 plays a critical role in the bioactivation of B[a]P to their carcinogenic end-products. 71
Cyclooxygenases are prostaglandin synthases w ith intrinsic cyclooxygenase and
peroxidase activities which catalyze the conversion of arachidonic acid to subsequent
prostaglandins (PGs). There are two distinct isoforms of this enzyme, a constitutively
expressed isoform (COX -1) and an inducible isoform (COX -2). COX -2 expression has been detected in human breast tumors, but not in normal breast tissue (Parrett et al.,
1997). However, only 5 -10% of breast cancer cases are hereditary while the majorities
are sporadic (Peto et al. , 1999; Shih et al. , 2000). This suggests that non-mutational
events may increase breast cancer incidence by altering the expression of COX -2. One
such event may be exposure to PAHs. Interestingly, COX -2 over -expression has been
shown to result from exposure to B[a]P (Kelly et al., 1997).
The COX -2 promoter contains motifs consistent with xenobiotic responsive
elements (Kraemer et a l., 1996; Sherratt et al., 2003). The presence of XREs is
compatible with the idea that B[a]P induces COX -2 via an AhR-dependent mechanism .
Further, COX -2 over -expression results in bioactivation of PAHs to the highly mutagenic
BPDE by oxidation during prostanoid synthesis (Marnett et al. , 1990; Marnett et al.,
1978; Guthrie et al., 1982; Dix and Marnett, 1983; Eling et al., 1990; Eling and Curtis,
1992). Interestingly, a mixture of conjugated linoleic acid s have been shown to
independently inhibit both COX -2 expression and B[a]P -induced breast cancer.
CLA refers generally to mixtures of positional and geometric conjugated dieonic
isomers of linoleic acid in which the double bonds are conjugated, instead of being in the
typical methylene interrupted configuration (Belury, 2002). The double bonds of CLA 72
may be in the positions of 7,9; 8,10; 9,11; 10,12; or 11,13 and the 3 -dimensional
geometric combinations o f cis and/or trans (c and/or t) configurations. CLA is found in a
variety of foods including oils and seafood (0.2-0.8mg CLA/g, meats (1.0-4.0mg CLA/g fat) and dairy products (5.0-7.0 mg CLA/g fat) (Chin, 1992). The major isomers present in foods are found in the following order: c9t11 >t7c9 >11,13 (c/t) > 8,10 (c/t) >t10c12
>11,13 (c/t) (Ma et al. , 1999; Fritsche et al. , 1999; Kramer et al. , 1998). It has been well established that CLA has anti -carcinogenic (Ip et al. , 1985; Ip et al. , 1991, Ip et al. , 1994) and COX -2 suppressive properties ( Liu and Belury, 1998; Kavanaugh et al., 1999;
Urquhart et al., 2002; Ma et al., 2002; Nakaniski et al., 2003; Yu et al., 2002; and Cheng et al., 2004). Research attempting to explain how CLA achiev es these beneficial ef fects has given rise to mRNA and promoter studies .
In this study, we investigated the effe cts of CLA against the prototype PAH B[a]P mediated COX -2 promoter activity. Additionally, we studied the recruitment of the AhR to a potential XRE located within COX -2 promoter. Finally , we evaluated the
participation of the AhR in the modulation of the COX -2 promoter by B[a]P and CLA. 73
Results
CLA induced G1 -arre st prevents B[a]P stimulated S-phase. The effect of a
mixture of CLA isomers and B[a]P on cell prolifera tion of asynchronous MCF- 7 cells
were investigated using flow cytometry. For this experiment the concentration of 160
µmol/L of a mixture of CLA isomers (CLAmix) was used, which is the amount used in previous cell culture studies investigating the regulati on of p53 in eliciting cell cycle arrest (Kemp et al., 2003). Likewise, a 1 µmol/L non-cytotoxic concentration of B[a]P was also used. The breast cancer cell line MCF -7 was selected as a model system for these studies based on the observation that it posse sses a B[a]P -inducible AhR pathway,
CYP1A1 -metabolizing activities( Safe and Krishnan, 1995), and an inducible COX -2 expression (Teh et al., 2004). The flow cytometry data indicated that when asynchronous
MCF -7 cells were cultured with CLA for 24 hours, G0/G1 cell cycle arrest resulted (55% vs. 72%) paralleled by reduction of cells in S-phase (31% vs. 28%) (Fig. 16A). Also as observed previously, treatment of asynchronous MCF -7 cells treated with B[a]P induced within 24 hours a reduction of cells in G0/G1 (5 5% vs. 45%) and an accumulation of cells in the S-phase compartment (31% vs. 35%) (Jeffy et al., 2000) (Fig. 16 B).
Conversely, the co -treatment of CLA with B[a]P saw activation of the G0/G1 checkpoint
(55% vs. 63%) resulting in a loss of cells in S-phase (31% vs. 28%) ( Fig. 16 A). B[a]P also stimulated an accumulation of cells in G2/M (13% vs. 20%) that was disrupted by co -treatment with CLA (13% vs. 10.5%) (Fig 16C). These results indicate that CLA can disrupt the movement of cells into the S-phase by the known carcinogen B[a]P . 74
A
B
C
Figure 16. Treatment of breast cancer MCF -7 cells with CLAmix induces G1 arrest. MCF -7 cells were cultured in DMEM, DMEM plus 160µmol/L CLAmix DMEM plus 1µmol/L B[a]P, and DMEM plus 1µmol/L B[a ]P and 160mol/L M CLA. Flow cytometry of asynchronous MCF -7 cells indicated that treatment with CLA for 24 hours induced cell cycle arrest in G0/G1 and an tagonizes the accumulation in S-phase induced by B[a]P. 75
CLA inhibits AhR-agonist induction of COX -2. Paradoxically both CLA and
B[a]P induce an accumulation of p53 (Kemp et al., 2003; Jeffy et al. 2002), which may suggest another mechanism for CLAs anti -proliferative effects. Since the accumulation of cells in S-phase does not occurs if genes responsible for the metabolism of B[a]P are inhibited (Kemp MQ and Romagnolo DF, unpublished data ), we investigated if CLA is abrogating expression of genes responsible for the metabolism of PAHs . In breast tissue,
COX -2 is induced by B[a]P and then simult aneously me tabolizes them as a substrate
(Marnett et al. , 1990; Marnett et al. , 1978; Guthrie et al. , 1982; Dix and Marnett, 1983;
Eling et al. , 1990; Eling and Curtis, 1992). To investigate the potential ability of CLA to inhibit this metabolism of B[a]P , we examined the effect of CLA on the COX -2 promoter. The pGL3 -COX -2-3900 was transfected into MCF -7 cells and treated with
B[a]P, which elicited a 1.6-fold induction (Fig. 17). However, co -treatment with CLAmix caused a 2.0-fold reduction in activity. Since B[a]P has been shown to activate COX -2 promoter activity through a variety of targets we sought to narrow likely targets by treating with the high -affinity AhR-ligand TCDD. The treatment with TCDD resulted in an increased promoter activity (1.7-fold) but co -treatm ent with CLA blocked this activity by 2.0-fold. The high -affinity of TCDD for activating the AhR suggests the presence of potentially active XREs in driving COX -2 promoter activity. Furthermore the ability of
CLA to inhibit TCDD induction of COX -2 suggests these events may occur through an
AhR/XRE -mechanism . 76
Figure 17. CLAmix inhibits B[a]P and TCDD induction of COX -2 promoter activity. MCF -7 cells were transiently transfected with pGL3 -COX2 -3900. Cells were cultured for 24h in DMEM/F12 plus 10% FCS (DMEM), DMEM plus 2.5 µmol/L B[a]P or 100nmol/L TCDD , and DMEM plus 160µmol/L CLAmix and 2.5µ mol/L B[a]P or 100nmol/L TCDD . Columns represent mean relative expression units for luciferase corrected for renilla +/ - SD (bars) from two independent experiments performed in quadruplicate . 77
Characterization of three Potential XREs within the COX -2 promoter. Previous
studies have identified potential XREs in the COX -2 promoter at -507 to -504 (XRE1), -
958 to -955 (XRE2), and -3444 to -3440 (XRE3) (Kraemer et al., 1996; Sherratt et al.,
2003), which may further suggest that TCDD is working through these XREs. To characterize whether these XREs are bonafide targets for TCDD and CLA we conducted site -directed mutagen esis and truncations of the COX -2 promoter ( Fig. 18). TCDD treat ment of MCF -7 cells transfect ed with a full length COX -2 plasmid containing a mutant XRE1 (pGL3 -COX -2-3900-XREmut1) resulted in a 19% drop in activity compared to wild -type. In addition, a full length COX -2 plasmid containing mutants at
XRE1&2 exhibited complete of loss of inducible activity. When the COX -2 promoter is truncated to 1432 bp (pGL3 -COX -2-1432) the XRE3 is lost. This plasmid was characterized by a 26% reduction in activity compared to pGL3 -COX2 -1432 .
Furthermore, mutation of XRE 1 in the pGL3 -COX -2-1432-XREmut1 plasmid resulted in an additional 36% loss of TCDD inducible activity. Finally the truncation of the COX promoter to eliminate all three XREs (pGL3 -COX -2-327 and pGL3 -COX -2-124) resulted in a complete absence of induction by TCD D. These data reveal that the absence of these potential XREs results in a loss of ability for AhR-agonists to induce COX -2 promoter activity, and supports that these XREs are functional sites . 78
Figure 18. TCDD -induced COX -2 promoter activity abrogated by mutation and/or deletion of potential XREs . Cells were transfected the ex pression vectorspGL3 -COX -2- 3900, which contains three potentia l XREs at -507 to -504 (XRE1), -958 to -955 (XRE2) and -3444 to -3440 (XRE3). pGL3 -COX -2-3900-XREmut1, which contains a mutant XRE at -507 to -504. pGL3 -COX -2-3900-XREmut1&2 , which contains two mutant XREs at -507 to -504 and -958 to -955. pGL3 -COX 2-1432-XREmut1, which contains a muta nt XRE at -507 to -504. pGL3 -COX2 -1432, pGL3 -COX2 -327, pGL3 -COX 2-124, which contain only two potential XREs or none. Cells were cultured for 24h in DMEM/F12 plus 10% FCS (DMEM), and DMEM plus 100 nmol/L TCDD . Columns represent mean relative expression units for luciferase corrected fo r renilla +/- SD (bars) from two independent experiments performed in quadruplicate 79
CLA inhibits AhR-agonist induction of AhR/XRE -driven genes. To test the hypothesis that
TCDD and CLA can work through an AhR/XRE mechanism, we transfected MCF -7 cells
with plasmid 1A1 -4x-Luc (CYPxre) , which contain a CYP1A1 conse nsus sequence
under the singular control of four XRE=GCGTG elements. Treatment with B[a]P resulted
in a 4.5-fold induction and co -treatment with 160 µmol/L CLAmix reduced that induction
with by 40% (Fig. 19). In addition, CYPxre activity was induced by tre ating with the
high -affinity AhR-ligand, TCDD, which resulted in a 4.0-fold induction. In contrast, co -
treatment with CLA abrogated that induction by 74%. These results sug gest that CLA can
disrupt XRE- driven promoters and the AhR-mechanism driving the COX -2 promoter is its likely targets for modulation. 80
Figure 19. CLAmix inhibits B[a]P and TCDD induction of CYP1A1 promoter activity. MCF -7 cells were transiently transfected with p1A1 -4x-Luc (CYPxre) . Cells were cultured for 24h in DMEM/F12 plus 10% FCS (DMEM), DMEM plus 2.5 µmol/L B[a]P, and DMEM plus 160 µmol/L CLA mix and 2.5 µmol/L B[a]P or 100nmol/L TCDD . Columns represent mean relative expression units for luciferase corrected for renilla +/ - SD (bars) from two independent experiments performed in quadruplicate. 81
CLA does but LA does not disrupt the AhR/XRE -mechanism. Previous studie s
have shown that LA inhibits the COX -2 promoter activity (Horia and Watkins, 2005). To determine if the inhibitory mechanism of action for L A is independent from that of CLA on the AhR/XRE -mechanism , we treated CYPxre transfected MCF -7 cells with TCDD and co -treated with either CLAmix or LA. The treatment with TCDD produced a 6.0-fold induction and the co -treatment with CLAmix abrogated that stimulation (Fig. 20).
Howev er, the co -treatment with LA did not produce any inhibitory effects on CYPxres
AhR pathway . These data show that CLAs ability to disrupt the XRE- mechanism is an effect of it own and is not shared with its progenitor fatty acid. 82
Figure 20. L A is unable to prevent TCDD induction of p1A1 -4x-Luc promoter activity. MCF -7 cells wer e transiently transfected with p1A1 -4x-Luc (CYPxre) . Cells were cultured for 24h in DMEM/F12 plus 10% FCS (DMEM), DMEM plus 100nmol/L TCDD, and DMEM plus 160 µmol/L CLA mix or 160 µmol/ LA and 100 nmol/L TCDD. Columns represent mean relative expression units for luciferase corrected for renilla +/ - SD (bars) from two independent experiments performed in quadruplicate. 83
Effects of c9,t11- and t10,c12-CLA on AhR-agonist induced XRE -driven genes and COX -2. To determine the physiological importance of the CLA levels used in these studies and which CLA isomer was responsible for altering COX -2 activity via the AhR- mechanism, the effects of vari ous concentrations of the a mixture of CLA isomers, c9,t11-CLA and t1 0,c12-CLA isomers were compared in both the CYP1A1 and COX -2 promoters. The pGL3 -COX -2-3900 was transfected into MCF -7 cells and treated with
TCDD, which elicited a 1.7-fold induction (Fig. 21). Co-treatment with the mixtu re of
CLA reduced promoter activity back to basal levels . The isomers of CLA exhibited differing activity in suppressing COX -2 promoter activity. Co -treatment with the c9,t11-
CLA isomer was able to significantly reduce COX -2 activity . However, the t10,c12-CLA isomer completely abrogated TCDD -induced COX -2 promoter activity similar to the mixture of CLA . The activity of the t10,c12- isomer over the c9,t11-isomer in inhibit ing the TCDD induction of COX -2 was significant (p <0.05).
Similar to COX -2, the isome rs of CLA exhibited differing activity in suppressing
CYPxre promoter (Fig. 22). Co -treatment with the c9,t11-CLA isomer was able to significantly reduce CYPxre activity. However , similar to the mixture of CLA the t10,c12-CLA isomer completely disrupted TC DD -induced CYPxre promoter activity . In addition, the ability of the t10,c12-isomer over the c9,t11-isomer to inhibit the TCDD induction of CYPxre was significant (p <0.05). These results suggest that both c9,t11- and t10,c12- isomers of CLA were able to inhibit COX -2 and CYPxre via an AhR pathway but the t10,c12 isomer was more effective in this regard. 84
The treatment with LA in these studies is in -line with previous studies , which has
shown that LA in hibits COX -2 transcription (Horia and Watkins, 2005). However, the co -treatment with LA did not produce any inhibitory effects on CYPxres . These data show that CLA and its isomers ability to disrupt the AhR/XRE -mechanism is an effect of it own and is not shared with its progenitor fatty aci d.
For the majority of this paper a concentration of 160 µmol/L CLA was used, which is the amount used in our previous cell culture studies investigating the regulation of p53 in eliciting cell cycle arrest (Kemp et al., 2003). However, previous studies have identified that t he physiological concentrations of CLA fall within 70 to 10 µmol/L
(Szebeni et al., 1986; Herbel et al., 1998; Huang et al. 1994; and Petridou et al., 2003).
To investigate if these results could be elicited using physiological concentrations of
CLA a titr ation study for CLAmix, c9,t11-CLA, t10,c12-CLA, and LA was performed
(Fig. 23). A mixture of CLA, the t10,c12-isomer , and the c9,t11-isomer , were able to inhibit TCDD -induced COX -2 activity to varying degrees . In specific, the c9,t11-isomer was able to in hibit TCDD induction of the COX- 2 promoter at the 40 (40%) and 80
(44%) µmol/L physiological concentrations, the 160 (42%) µmol/L supra -physiological concentration, but not at 20 µmol/L. In contrast, the mixture of CLA and the t10,c12– isomer at the 40, 80 and 160 µmol/L concentrations inhibited TCDD induction of COX -2 back to basal, which was significantly greater than the inhibition by the c9,t11-isomer.
The 80 µmol/L concentration of the mixture of CLA and its two isomer s was most effective in disrupting TCDD induced COX -2 activity, respectively. However, at this 85
concentration of the t10,c12-isomer (111%) was most effective at inhibiting TCDD
induction of the COX -2 promoter but their was no significant difference between that
inhibition and that seem with the 80 µmol/L CLA mixture (108%). These data show that
CLA and its c9,t11- and t10,c12-isomers are effective at physiological concentrations in
disrupting TCDD -induced COX -2 promoter activity. Moreover, the t10,c12-isomer confers the major TCDD inhibiting activity. 86
Figure 21. A mixture of CLA , c9,t10-CLA, and t10,c12-CLA inhibit TCDD induction of COX -2 promoter activity. MCF -7 cells were transiently transfected with pGL3 -COX2 - 3900. Cells were cultured for 24h in DMEM/F12 plus 10% FCS (DMEM), DMEM plus 100 nmol/L TCDD , and DMEM plus 160µmol/L CLA mix or isomers and 100nmol/L TCDD . Columns represent mean relative expression units for luciferase corrected for renilla +/ - SD (bars) from two independent experiments performed in quadruplicate . 87
Fig ure 22. A mixture of CLA , c9,t10-CLA, and t10,c12-CLA inhibit TCDD induction of CYP1A1 promoter activity. MCF -7 cells were transiently transfected with p1A1 -4x-Luc. Cells were cultured for 24h in DMEM/F12 plus 10% FCS (DMEM), DMEM plus 100 nmol/L TCDD , and DMEM plus 160µmol/L CLA mix or isomers and 100nmol/L TCDD . Columns represent mean relative expression units for luciferase corrected for renilla +/ - SD (bars) from two independent experiments performed in quadruplicate . 88
Figure 23. A titration of CLAmix, c9,t10-CLA, and t10,c12-CLA inhibit TCDD induction of COX2 -3900 promoter activity. MCF -7 cells were transiently transfected with p1A1 -4x-Luc. Cells were cultured for 24h in DMEM/F12 plus 10% FCS (DMEM), DMEM plus 100 nmol/L TCDD , and DMEM plus 160, 80, 40 and 20 µmol/L CLA mix or isomers and 100nmol/L TCDD . Columns represent mean relative expression units for luciferase corrected for renilla +/ - SD (bars) from two independent experiments performed in quadruplicate . 89
Discussion
At the onset of this study we identified that co -treatment of the chemical carcinogen B[a]P , whose exposure to is hallmarked by S-phase arrest , with CLA results in G1 -arrest. Paradoxically, both CLA and B[a]P are capable of inducing an accumulation of p53 and their respective cell cycle arrests are dependent on that accumulation (Kemp et al., 2003; Jeffy et al., 2000). Independent investigations by our lab oratory have found that inhibiting the CYP1A1 gene, which is responsible for metabolism of carcinogens, can disrupt B[a]P -in duced S-phase (Kemp MQ, and
Romagnolo DF, unpublished data ). These data indicate d that genes responsible for metabolism of PAHs may be a likely target for disruption of B[a]P -induced arrest. In this study , we hypothesized that CLA may disrupt the metabolis m of cell cycle altering carcinogens by abrogating COX -2.
In breast tissue COX -2 activity can be induced by B[a]P. This induction can result in the metabolism of B[a]P to carcinogenic end-products (Marnett et al. , 1990; Marnett et al. , 1978; Guthrie et al. , 1982; Dix and Marnett, 1983; Eling et al. , 1990; Eling and
Curtis, 1992). To investigate the relationship of CLA with regard to these mechanisms , we examined CLAs effect on the COX -2 promoter. These studies revealed that CLA inhibited the induction of CO X-2 by B[a]P suggesting that CLA can inhibit the biotran sformation of B[a]P. Since , PAHs commonly activate genes via an AhR pathway
(Krishnan et al., 1995) we investigated if the high -affinity AhR-ligand TCDD activates
COX -2 and if CLA disrupts that activity. These studies revealed that COX -2 was in -fact 90
inducible by TCDD and CLA could abrogate that induction, which suggest s that it may be under the control of an AhR pathway and that CLA may be an AhR-antagonist.
Previous studies have identified potential XREs in the COX- 2 promoter at -507 to
-504 (XRE1), -958 to -955 (XRE2), and -3444 to -3440 (XRE3) (Kraemer et al., 1996;
Sherratt et al., 2003). To investigate whether these XREs were functional we conducted site -directed mutagenesis and truncation studies. These data provided that TCDD induction of the COX -2 promoter is lost with mutation or deletion of these potential
XREs. This suggest s that COX -2 transcription is under direct control of the AhR
pathway. In addition, the TCDD inducible activity of the COX -2 promoter varied based
on which XREs were mutated or truncated. The mutation of XRE1 in COX -2-3900 and
truncation of XRE3 in COX -2-1432 res ult in a similar loss of activity . Furthermore , the
mutation of XRE1 and 2 in the COX -2-3900 promoter the mutation of XRE1 and
truncation of XRE3 in COX -2-1432 caused complete loss of TCDD induction. These
results imply that two XREs are but one XRE is not sufficient for AhR-driven activity of
the COX -2 promoter . Overall these data provide evidence that all three XREs of the
COX -2 promoter are likely authentic.
To further c haracterize the involvement of CLA in the AhR pathway we employed the use of a n AhR-dependent CYP1A1 plasmid . MCF -7 cells transfected with this p1A1 -4x-Luc plasmid and subsequent treatment with TCDD or B[a]P resulted in a
significant induction. However, co -treatment with CLA abrogated both TCDD and B[a]P
inductions. Since this CYP1A1 plasmid is only under the control of the AhR pathway , 91
these data strongly suggest CLA is an AhR-antagonist. In addition this effect was only seen with CLA and not its progenitor fatty acid LA. These finding reveal that the loss of the methylene interruption double bond of LA is necessary for the bioactivity of CLA on the AhR pathway .
Previous studies have suggested that the biological effects of CLA mixtures are, at least in part, due to the distinct actions of the c9,t11- and t10,c12-isomers (Pariza et al. ,
2001). Therefore, we examined the effects of various isomers on COX -2 and CYP1A1 promoter activities. Our results indicate that there are marked differences in AhR- antagonism by c9,t11- and t10,c12-CLA. Though both isomer significantly inhibit TCDD induction of COX -2 and AhR-dependent CYP1A1 promoter activities , the t10,c12- isomer inhibited both activities significantly more than the c9,t11-isomer. These studies also took into consideration the physiological concentration necessary for the inhibitory effects on CLA on COX -2. Titration studies using a mixture of CLA, c9,t11-isomer, t10,c12-isomer revealed that at physiologi cal concentrations (Szebeni et al., 1986; Herbel et al., 1998; Huang et al. 1994; and Petridou et al., 2003) a mixture of CLA and both the t10,c12- and c9,t11-isomer s, were able to inhibit TCDD -induced COX -2 activ ity. Thus, the relative concentration of the t10,c12-CLA isomer may influence the health effects of
CLA mixtures found in enriched preparations, and meat and dairy products.
Numerous studies have suggested COX -2 promoter activity is under the direct control of the AhR pathway. These reports have shown that COX -2 activity is B[a]P ,
TCDD, or cigarette smoke extract -inducible (Wiese et al., 2001; Kelly et al., 1997;Puga 92
et al., 1997; Liu et al., 1997;Vogel et al., 1998; Martey et al., 2005), the COX -2 promoter
region contains three potential XREs (Sh erratt et al., 2003; Kraemer et al., 1996), and the
murine COX -2 promoter is under the control of the AhR-mechanism (Yang and Bleich,
2004). To the best of our knowledge, this is the first study in human cells showing that the COX -2 is under the control of the AhR and that the XREs within its promoter region are functional . These findings provide a molecular basis for why COX -2 is induced by
AhR-ligands and possibly a target through which PAHs cause inflammation, immune responses and carcinogenesis (Rist imaki et al., 1994 ). Furthermore this knowledge provides an exact mechanism through which COX -2 expression can be antagonized.
The antagonism of COX -2 by CLA has been shown previously ( Liu and Belury,
1998; Kavanaugh et al., 1999; Urquhart et al., 2002; Ma et al., 2002; Nakaniski et al.,
2003; Yu et al., 2002; and Cheng et al., 2004). This study demonstrates that CLA can abrogate B[a]P and TCDD induced COX -2 promoter activity via an AhR-mechanism .
However, CLA anta gonism of COX -2 activity via an AhR-mechanism remains a curious event. Most antagonist s of the AhR achieve their disruptive properties by directly binding. These structures are typically based on the flavone ring system (Lu et al. , 1995;
Gasiewicz et al. , 1996; Lu et al. , 1996). H-bonding between flav one and AhR stabilizes the AhR-ligand complex in a conformation that prevents dissociation of hsp90 and sequesters the AhR in the cytoplasim disrupting its participation in transcription (Henry et al. , 1999). Flavones permit formation of an external H-bond with the AhR binding site by a high electron charge density external to the ring structure in a 4’-azido or 4’nitro compound (Henry et al. , 1999). Interestingly, CLA carries none of these characteristics 93
held by traditional AhR-antagonist but still retai ns potent disruptive activity . The defining characteristic of CLA is its double bonds are conjugated instead of in the typical methylene interrupted configuration. This presents the question, how is CLA act ing as an antagonist of the AhR? One possible explanation is by preventing phosphorylation of the
AhR required for it to activate transcription. Several studies have reported a synergistic effect between TCDD and a potent protein kinase C (PKC) activator, phorbol 12- myristate 13-acetate (TPA ) on activati on of AhR-driven genes (Chen and Tukey, 1996;
Long et al., 1998). These studies theorize that since DNA binding of the AhR requires phospohoylation at tyrosine residues (Park et al., 2000a) and steps in transcriptional activation requires phosphorylation at serine/threonine residues (Li and Dougherty,
1997), cellular signaling events carried out following activation of PKC may be essential in promoting gene responses initiated by the actions of the AhR. Therefore, it is possible that CLA disrupts activity of AhR pathway by altering PKC activity. CLA has been shown to modulate activity of TPA -inducible PKC family members ( Song et al., 2004).
In summary, this report documents that in breast cancer cells, (i) COX -2 promoter activity is under the control of th e AhR pathway and (ii) CLA compromises the expression of the COX -2 gene via an AhR-dependent mechanism. Although further studies are required to clarify wh ether CLA is disrupting the AhR-mechanism in COX -2 via altered phosporylation, our findings document for the first time that the effects of
CLA on the expression of COX -2 may depend on the AhR. In addition, this study attributes the major AhR-mediated COX -2 suppressive effects on the t10,c12-isomer.
Finally, this COX -2 regulatory aspect of CLA may have cl inical importance in the 94
development of preventive and/or therapeutic strategies based on the fact that (i) COX -2 over -expression occurs in 50% of human invasive breast cancers and 80% of ductal carcinomas in situ (Reviewed in Bundred and Barnes, 2005). 95
CHAPTER 5: SUMMARY AND CONCLUSIONS
Conclusions
Numerous studies have documented the anti -proliferative effects of CLA (Rose et al., 1989; Phoon et al., 2001; Hayashi et al., 1997) and its ability to inhibit chemical carcinogenesis (Ha et al., 1990; Ip et al ., 1991; Ip et al., 2001; Liew et al., 1995; Belury et al., 1996; Ip et al., 1999; Schultz et al., 1992; Park et al., 2000). Though revealing, these
studies lack investigation into the mechanism through which CLA works. In this
dissertation, we present two potential mechanisms through which CLA confers its
protective effects against cancer. In this dissertation we demonstrate the mechanisms of
CLA s action on cell cycle progression and repression of PAH -induced COX -2 in breast cancer cells.
The first specif ic aim of this dissertation characterized the mechanism of CLA s action on cell cycle progression in breast and colon cancer cells. Treatment with CLA inhibited cell proliferation in breast cancer MCF -7 cells containing wild -type p53
(p53+/+ ). At cytostatic concentrations, CLA elicited cell cycle arrest in G0/G1 and
induced the accumulation of the tumor suppressors p53, p27 and p21 protein. Conversely,
CLA reduced the expression of factors required for G1 to S-phase transition including cyclins D1 and E, and hyperphoshorylated retinoblastoma Rb protein. In contrast, the over -expression of mutant p53 (175Arg to His) in MFC -7 cells prevented the CLA - dependent accumulation of p21 and the reduction of cyclin E levels suggesting that the expression of wild -type p5 3 is required for CLA -mediated activation of the G1 restriction 96
point. To fu rther elucidate the role of p53, the effects of CLA in colon cancer HCT116
cells (p53+/+ ) and p53-deficient (p53-/-) HCT116 cells (HCTKO) were examined. The
treatment of HCT116 cel ls with CLA increased the levels of p53, p21, p27 and hypophosphorylated (pRb) protein and reduced the expression of cyclin E, whereas these effects were not seen in p53-deficient HCTKO cells. The t10,c12-CLA isomer was more
effective than c9,t11-CLA in in hibiting cell proliferation of MCF -7 breast cancer cells and enhancing the accumulation of p53 and pRb. We conclude that the anti -proliferative properties of CLA appear to be a function, at least in part, of the relative content of specific isomers and the ir ability to elicit a p53 response that leads to the accumulation of pRb and cell growth arrest.
The second specific aim we investigated the disruptive effects of CLA on genes responsible for metabolism of chemical carcinogens to mutagenic end-products. COX -2
expression has been detected in human breast tumors, with no detectable expression in
normal breast tissue. Interestingly, only 5-10% of breast cancer cases are hereditary while
the majority is sporadic. This suggests that non-mutational events may in crease breast
cancer incidence by altering the expression of COX -2. The over -expression of COX -2
has been shown to result from exposure to the PAHs . In this study, we investigate the
mechanisms of CLA action on repression of PAH -induced COX -2 promoter acti vity in
MCF -7 breast cancer cells. We report, CLA reduced the expression of COX -2 promoter
activity induced by the AhR-ligand B[a]P and the high affinity AhR-lgand TCDD.
Mutagenesis of potential XREs within the COX -2 promoter abrogated its induction by
TCD D. In addition, promoter studies using a XRE -dependent CYP1A1 plasmid revealed 97
CLA can inhibit PAH- induced AhR-driven genes. In contrast, linoleic acid was unable to inhibit induction of CYP1A1 by TCDD. In both promoters, the t10,c12-CLA isomer was
more ef fective than c9,t11 -CLA in inhibiting cell proliferation and AhR/XRE- dependent
genes. Taken together, these data suggest that the inhibitory properties of CLA on PAH -
induced COX -2 promoter activity appear to be a function, at least in part, of the relative
content of specific isomers and their ability to inhibit an AhR-dependent mechanism .
Taken together, these data suggest that the anti -cancerous properties of CLA appear to be a function, at least in part, of the relative content of specific isomers and th eir 1) ability to elicit a p53 response that leads to the accumulation of pRb and cell growth arrest, and 2) ability to inhibit PAH -induced cycl ooxygenase -2 promoter activity through an AhR-dependent mechanism (Fig. 24). This cell cycle regulatory aspect of
CLA may have clinical importance in the development of preventive and/or therapeutic strategies based on the fact that nearly 45% of breast cancers over -express cyclin D1 (Hui et al., 2002), and over -expression of either cyclin D1 or cyclin E contributes to neoplastic progression of the breast (Borter et al., 1997) and colon (Wang et al., 2002). Finally, the
COX -2 regulatory aspect of CLA may have clinical importance in the development of preventive and/or therapeutic strategies based on the fact that (i) COX -2 over -expression occurs in 50% of human invasive breast cancers and 80% of ductal carcinomas in situ
(Reviewed in Bundred and Barnes, 2005). 98
Cyclin B1 P Cdk2 Rb E2F Rb E2F + Cdc2 Cyclin A Cdk2 P Cyclin E Cdk2 Cyclin D1 Cdk4/6 G0 G1 S phase G2 M Restriction Point p21 p27
CLA p53
COX -2 B[a]P AhR BPDE CYP1A1
Figure 24. Potential mechanism of CLA s action 99
Future Directions
1. Determine if CLA abrogates binding of the AhR to XREs located within the
CYP1A1 and COX2 promoters.
2. Investigate the contribution of PKC in CLA disruption of AhR mediated
transcription. 100
APPENDIX A: ABBREVIATIONS
AhR….Aromatic hydrocarbon receptor
B[a]P….Benzo[a]pyrene
BPDE….7r,8t-Dihydroxy9t,10-epoxy -7,8,9,10-tetrahydrobenzo[a]pyrene c9, t10….cis9, trans11-conjugated linoleic acid
CLA….conjugated Linoleic Acid
CLAmix….conjugated linoleic acid mixture
CMV….cytomegalvirus
COX -1/-2….cyclooxygenase -1/-2
CYP1A1…. cytochrome P450 1A1
HCT KO…HCT116 cells knock -out p53
LA….linoleic acid
MUFA….monounsaturated fatty acid
MTT….methylthiazolyldiphenyl -tetrazolium bromide
P1A1 -4x-Luc….CYPxre p53WT….wild -type p53 p53KP….knock -out p53
PAH….polycyclic aromatic hydrocarbon
PGE2….prostaglandin E2
PGG2 ….prostaglandin G2 pRb….hypophosphorylated retinoblastoma ppRb….hyperphosphorylated retinoblasatoma 101
ABREVIATIONS -CONTINUED
PUFA….polyunsatured fatty acids
RT -PCR….reverse transcription polymerase chain reaction t10 ,c12….trans10, cis12-Conjugated Linoleic Acid
TCDD….2,3,7,8-tetrachlorodibenzo -p-dioxin
XRE….xenobiotic responsive element 102
APPENDIX B: PERMISSION TO REPRINT COPYRIGHTED METERIALS 103
APPENDIX C: PUBLISHED MATERIALS
Kemp MQ , Jeffy BD, Romagnolo DF. 2003. Conjugated linoleic acid Inhibits Cell
Proliferation through a p53-dependent Mechanism: Effects on the Expression of G1-
Restriction Points in Breast and Colon Cancer. J. Nutr. 133:3670-3677. 103
REFER ENCES
Abu-Ghazaleh AA, Schingoethe DJ, Hippen AR, Whitlock LA. 2002. Feeding fish meal and extruded soy beans enhances the conjugated linoleic acid (CLA) content of milk. J Dairy Sci 85: 624–631.
Albin o AP, Juan, G, Traganos F , Reinhart L, Connolly J, Rose DP, Darzynkiewicz Z. 2000. Cell cycle arrest and apoptosis of melanoma cells by docosahexaenoic acid: association with decreased pRb phosphorylation. Cancer Res. 60:4139-4145.
Baker S, Preisinger A, Jessup J, Paraskev a C, Markowitz S, Wilson J , Hami lton S, Vogelstein B. 1990. p53 gene mutations occur in combination with 17p allelic deletions as late events in colorectal tumorigenesis. Cancer Res. 50:7717-7722.
Basu S, Smedman A, Vessby B. 2000. Conjugated linoleic acid induces lipid peroxidation in humans. FEBS Lett. 18:33-36.
Bear RJ, Ryali J, Schingoethe DJ, et al. 2001. Composition and properties of mi lk and butter from cows fed fish oil. J Dairy Sci 84: 345–353.
Belury MA, Nickel K, Bird CE, Wu Y. 1996. Dietary conjugated linoleic acid modulation of phorbol ester skin tumor promotion. Nutr. Cancer 26:149-157.
Belury MA. 2002. Dietary conjugated linoleic acid in health: physiological effects and mechanisms of action. Annu Rev Nutr. 22:505-31.
Belury MA. 2002a. Inhibition of carcinogenesis by conjugated linoleic acid: potential mechanisms of action. J. Nutr. 132:2995-2998.
Belury MA., Moya -Camarena SY , Lu M, Shi L, Leesnitzer LM. Blanchard SG. 2002b. Conjugated linoleic acid is an activator and ligand for peroxisome proliferator- activated receptor-gamma (PPARg). Nutr. Res. 22:817-824.
Bock KW, Bock Hennig KS, Lilienblum W, Volp RF. 1981. Relaease of mutagenic metabolites of benzo[a]pyrene from perfused rat liver after inhibition of glucuronidation and sulfation by salicylamide. Chem -Biol Interactions 36: 167- 177.
Bortner D, Rosenberg M. .1997. Induction of mammary gland hyperplasia and carcinomas in tr ansgenic mice expressing human cyclin E. Mol. Cell Biol. 17:453-459. 104
Buckman SY, Gresham A, Hale P, Hruza G, Anast J, Masferrer J, Pentland AP. 1998. COX -2 expression is induced by UVB exposure in human skin: implications for the development of skin cance r. Carcinogenesis 19: 723–729.
Bundred NJ, Barnes NLP. 2005. Potential use of COX -2-aromatase inhibitor combinations in breast cancer. Brit J. Cancer. 93(1):S10-S15.
Burke DM, Vadi H, Jernstorm B, Orrenius S. 1977. Metabolism of Benzo[a]pyrene with isolat ed hepatocytes and the formation and degradation of DNA -binding derivatives. J Biol Chem 252: 6424-6431.
Cameron IT. 1992. Prostaglandins and menstruation. In: J.O. Drife and A.A. Calder Editors, Prostaglandins and the uterus Springer -Verlag, London (1992) , pp. 17– 32.
Carroll JS, Prall OWJ, Musgrove EA, Sutherland RL. 2000. A pure estrogen antagonist inhibits cyclin E-cdk2 activity in MCF -7 breast cancer cells and induces accumulation of p130–E2F4 complexes characteristic of quiescence. J. Biol. Chem. 49:38221-38229.
Chen Y-H, Tukey RH. 1996. Protein kinase C modulates regulation of the CYP1A1 gene by the aryl hydrocarbon receptor. J. Biol. Chem. 271(42):26261-26266.
Cheng WL , Lii CK , Chen HW , Lin TH , Liu KL . 2004. Contribution of conjugated linoleic acid to the suppression of inflammatory responses through the regulation of the NF -kappaB pathway. J. Agric. Food Chem. 52(1):71-8.
Chin SF, Liu W, Storkson JM, Ha YL, Pariza MW. 1992. Dietary sources of conjugated dienoic isomers of linoleic acid, a newly recognized class of anticarcinogens. J Food Comp Anal 5: 185–197.
Cunningham DC , Harris on LY, Shultz TD. 1997. Proli ferative responses of normal human mammary and MCF -7 breast cancer cells to linoleic acid, conjugated linoleic acid and eicosanoid synthesis inhibitors in culture. Anticancer Res. 17:197-204.
Denissenko MF, Pao A, Tang M, Pfeifer GP. 1996. Preferential formation of benzo[a]pyrene adducts at lung cancer mutational hotspots in P53. Science 274: 430-432.
Dipple A, Khan QA, Page JE, Ponten I, Szeliga J. 1999. DNA reactions, mutagenic action and stealth properties of polycyclic aromatic hydrocarbon carcinogens (review). Int J Oncol 14: 103-111. 105
Dix TA, Marnett LJ. 1983. Metabolism of polycyclic aromatic hydrocarbon derivatives to ultimate carcinogens during lipid peroxidation. Science 221: 77-79.
Dong Y, Ganther HE. Stewart C, Ip C. 2002. Identification of molecular targets associated with selenium-induced growth inhibition in human breast cells using cDNA microarrays. Cancer Res. 62:708-714. el -Deiry WS, Tokino T, Velculescu VE , Levy DB, Parsons R, Tren t JM, Lin D, Mercer WE , Kinzle r KW, Vogelstein B. 1993. WAF -1, a potential mediator of p53 tumor suppression. Cell 75:817-825.
Eling TE, Curtis JF. 1992. Xenobiotic metabolism by prostaglandinH synthase. Pharmac Ther 3: 261-273.
Eling TE, Thompson DC, Foureman GL, Curtis JF, Hughes MF. 1990. Prostaglandin H synthase and xenobiotic oxidation. Annu Rev Pharmacol Toxicol 30: 1-45.
Franklin ST, Martin KR, Baer RJ, Schingoethe DJ, Hippen AR. 1999. Dietary marine algae (Schizochytrium sp.) increases concentrations of conjugated linoleic, docosahexaenoic and trans vaccenic acids in milk of dairy cows. J Nutr 129: 2048–2054.
Fritsche J, Rickert R, Steinhart H. 1999. Formation, contents, and estimation of daily intake of conjugated linoleic acid isomers and trans -fatty acids in foods. Yurawecz, M. P. Mossoba, M. M. Kramer, J.K.G. Pariza, M. W. Nelson, G. J. eds. Advances in Conjugated Linoleic Acid Research Vol. 1:378-396 AOCS Press Champaign, IL.
Gasiewicz TA, Kende As, Rucci G, Whitney B, Willey JJ. 1996. Analysis of the structural requirements for Ah receptor antag onist activity: ellipticines, flavones and related compounds. Biochem Pharmcol. 52:1787-1803.
Germa in E, Chajes V, Cognault S, Lhuillery C, Bougnoux P. 1998. Enhancement of doxorubicin cytotoxicity by polyunsaturated fatty acids in the human breast tumor cell line MDA -MB -231: relationship to lipid peroxidation. Int. J. Cancer 75:578- 583.
Gorlewska-Roberts K, Green B, Fares, Ambrosone CB, Kadlubar FF. 2002. Carcinogen - DNA adducts in human breast epithelial cells. Environ. Mol. Mut. 39:184-192.
Griinari JM, Dwyer DA, McGuire MA, Bauman DE, Palmquist DL, Nurmela KVV. 1998. trans-Octadecenoic acids and milk fat depression in lactating dairy cows. J Dairy Sci 81: 1251–1261. 106
Griinari JM, Corl BA, Lacy SH, Chouinard PY , Nurme la KV, Bauman DE. 2000. Conjugated lin oleic acid is synthesized endogenously in lactating dairy cows by delta (9)-desaturase. J. Nutr. 130:2285-2291.
Guthrie J, Robertson IGC, Zeiger E, Boyd JA, Eling T. 1982. Selective activation of some dihydrodiols of several polycyclic aromatic hydrocarb ons to mutagenic products by prostaglandin synthetase. Cancer REs 42: 1620-1623.
Ha YL , Storkson JM, Pariza MW. 1990. Inhibition of benzo[a]pyrene-induced mouse forestomach neoplasia by conjugated dienoic derivatives of linoleic acid. Cancer Res. 50:1097-1101.
Hall PA, McKee PH, Menage HP, Dover R, Lane D. 1993. High levels of p53 protein in UV -irradiated normal human skin. Oncogene 8:203 -207.
Harp er JW, Adami GR, Wei N, Keyomarsi K, Elledge SJ. 1993. The p21 Cdk-interacting protein Cip1 is a potent inhib itor of G1 cyclin -dependent kinases. Cell 19:805- 816.
Harrison JR, Lorenzo JA, Kawaguchi H, Raisz LG, Pilbeam C. 1994. Stimulation of prostaglandin E2 production by Il -1alpha and TGF -alpha in osteoblastic MC3T3 - E1 cells. J Bone Mineral Res 9: 817-823.
Hat temer -Frey HA, Travis CC. 1991. Benzo -a-pyrene. Environmental partionaing and human exposure. Toxicol. Ind. Health. 7:141-157.
Hayashi T, Matesi c DF, Nomata K, Kang K -S, Ch ang C-C, Trosko JE. 1997. Stimulation of cell proliferation and inhibition of gap ju nctional intercellular communication by linoleic acid. Cancer Lett. 112:103-111.
Hecht SS. 2002. Tobacco smoke carcinogens and breast cancer. Environ. Mol. Mut. 39:119-126.
Henry EC, Kende AS, Rucci G, Totleben MJ, Willey JJ, Dertinger SD, Pollenz RS, Jones JP, and Gasiewicz TA. 1999. Flavone antagonists bind competitively with 2,3,7,8- tetrachlorodibenzo -p-dioxi (TCDD) to Aryl hydrocarbon receptor but inhibit nuclear uptake and transformation. Mol. Pharmacol.55:716-725.
Herbel, B. K., McGuire, K. K., McGuire, M. A. & Shultz, T. D. 1998. Safflower oil consumption does not increase plasma conjugated linoleic acid concentrations in humans. Am. J. Clin. Nutr. 67:332-337.
Herschman HR. 1996. Prostaglandin synthase 2. Biochim Biophys Acta 1299: 125-140. 107
Hida T, Yatabe Y, Achiwa H, Muramatsu H, Kozaki K, Nakamura S, Ogawa M, Mitsdomi T, Sugiura T, Takahashi T. 1998. Increased expression of cyclooxygenase -2 occurs frequently in human lung cancers, specifically in adenocarcinomas. Cancer Res 58: 3761–3764.
Hla T, Neilson K. 1992. Human Cyclooxygenase -2 cDNA. Proc. Natl. Acad. Sci. 89:7384-7388.
Horia E, Watkins BA. 2005. Comparison of stearidonic acid and alpha-linoleic acid on PGE2 production and COX -2 protein levels in MDA -MB -231 breast cancer cell cultures. J. Nu tr. Biochem. 16:184-192.
Hu Z, and Wells PG. 1992. In vitro and in vivo biotransformation and covalent binding of Benzo[a]p yrene in Gunn and RHA rats with genetic deficiency in bilrubin urdine diphosphate UDO -glucuronosyltransferase. J Pharmacol Exp Ther 263: 334-342.
Huang Y-C, Luede cke LO, Shultz TD. 1994. Effect of cheddar cheese consumption on plasma conjugated linoleic acid concentrations in men. Nutr. Res. 14:373-386.
Hubbard NE, Lim D, Sum mers L, Erikson KL. .2000. Reduction of murine mammary tumor metastasis by conjugated linoleic acid. Cancer Lett. 150:93-100.
Hughes PE, Hunter WJ, Tove SB. 1982. Biohydrogenation of unsaturated fatty acids, purification and properties of cis -9,trans-11-octadecadienoate reductase. J Biol Chem 257: 3643–3649.
Hui, R., Finney, G. L., Carroll, J. S., Lee, C. S., Musgrove, E. A. & Sutherland, R. L. 2002. Constitutive overexpression of cyclin D1 but not cyclin E confers acute resistance to antiestrogens in T-47D breast cancer cells. Cancer Res. 62:6916- 6923.
Ip C, Carte r CA, Ip MM. 1985. Requirements of essential fatty acid for mammary tumorigenesis in the rat. Cancer Res 45: 1997–2001.
Ip C, Singh M, Thompson HJ, Scimeca JA. 1994. Conjugated lin oleic acid suppresses mammary carcinogenesis and proliferative activity of the mammary gland in the rat. Cancer Res . 54: 1212-1215.
Ip C, Chin SF , Scimeca JA, Pariza MW. 1991. Mammary cancer prevention by conjugated dienoic derivative of linoleic acid. Cancer Res. 51:6118-6124.
Ip C, Banni S, Angioni E, et al. 1999a. Conjugated linoleic acid -enriched butter fat alters mammary gland morphogenesis and reduces cancer risk in rats. J Nutr 129: 2135– 2142. 108
Ip MM , Ma sso -Welch PA, Shoemaker SF, Shea -Eaton W K, Ip C. 1999b. Conjugated linoleic acid inhibits proliferation and induces apopto sis of normal rat mammary epithelial cells in primary culture. Exp. Cell Res. 250:22-34.
Ip, C., Ip, M. M., Loftus, T., Shoemaker, S. & Shea -Eaton, W. 2000. Induction of apoptosis by conjugated linoleic acid in cultured mammary tumor cells and premalignan t lesions of the rat mammary gland. Cancer Epidemiol. Biomarkers Prev. 9:689-696.
Ip C, Dong Y, Thompson HJ , Bauman DE, Ip MM. 2001. Control of rat mammary epithelium proliferation by conjugated linoleic acid. Nutr. Cancer 39:233-238.
Ip, C., Dong Y, Ip MM, Banni S, Carta G, A ngioni E, Murru E, Spada S, Melis MP, Saebo A. 2002. Conjugated linoleic acid isomers and mammary cancer preventrion. Nutr. Cancer 43:52-58.
Jeffy, B. D., Chen, E. J., Gudas, J. M. & Romagnolo, D. F. 2000. Disruption of cell cycle kinetics by benzo[a]pyrene: inverse expression patterns of BRCA -1 and p53 in MCF -7 cells arrested in S and G2. Neoplasia 2:460-470.
Jeffy B D, Chirnomas RB, Chen EJ , Gudas JM, Romagnolo, DF. 2002. Activation of the aromatic hydrocarbon receptor pathway is not sufficient for transcriptional repression of BRCA -1: requirements for metabolism of benzo[a]pyrene to 7r, 8t- dihydroxy -9t, 10-epoxy -7, 8, 9, 10-tetrahydrobenzo[a]pyrene. Cancer Res. 62:113-121.
Kargman SL, O'Neill GP, Vickers PJ, Evans JF, Mancini JA, Jothy S. 1995. Expression of prostaglandin G/H synthase -1 and –2 protein in human colon cancer. Cancer Res 55: 2556–2559.
Kavanaugh CJ, Liu KL, Belury MA. 1999. Effects of dietary conjugated linoleic acid on phorbol ester -induced PGE2 production and hyperp lasia in mouse epidermis. Nutr. Cancer. 33:132-138.
Kelley DJ, MestreJR, Subbaramaiah K, Sacks PG, Schantz SP, Tanabe T, Inoue H, Ramonetti JT, Dannenberg AJ. 1997. Benzo[a]pyrene up-regulates cyclooxygenase -2 gene expression in oral epithelial cells. Car cinogenesis 18: 795–799.
Kemp MQ, Jeffy BD, Romagnolo DF. 2003. Conjugated lin oleic acid inhibits cell proliferation through a p53-dependant mechansism: Effects on the expression of G1 -restriction points in breast and colon cancer cells. J Nutr: 133(11):3670-7. 109
Kepler CR, Hirons KP, McNeill JJ, Tove SB. 1966. Intermediates and products of the biohydrogenation of linoleic acid by Butyrivibrio fibrisolvens. J Biol Chem 241: 1350–1354.
Keir e MJNC. 1990. Eicosanoids in human pregnancy and parturition. In: M.D. Mitchell Editor, Eicosanoids in reproduction CRC Press, Boca Raton, pp. 199–222.
Kim YJ, Liu RH, Bond DR, Russell JB. 2000. Effect of linoleic acid concentration on conjugated linoleic acid production by Butyrivibrio fibriosolvens A38. Appl Environm Micr obiol 66: 5226–5230.
Kim YJ, Liu RH, Rychlik JL, Russell JB. 2002. The enrichment of a ruminal bacterium (Megasphaera elsdenii YJ -4) that produces the trans-10, cis -12 isomer of conjugated linoleic acid J Appl Microbiol 92: 976–982.
Kinzle r, K. W. & Voge lstein, B. 1997. Cancer susceptibility genes: gatekeepers and caretakers. Nature 386:761-763.
Krishnan V, Porter W, Santostefano M, Wang X, Safe S. 1995. Molecular mechanism of inhibition of estrogen -induced cathepsin D gene expression by 2,3,7,8- tetrac hlorodibenzo -p-dioxin (TCDD) in MCF -7 cells. Mol Cell Biol 15: 6710- 6719.
Kraemer SA, Arthur KA, Denison MS, Smith WL, DeWitt DL. 1996. Regulation of prostaglandin endoperoxides H synthase -2 expression by 2,3,7,8- tetrachlorodibenzo -p-dioxin. Arch. Of Biochem. And Biophys. 330(2):319 -328.
Kramer JKG, Parodi PW, Jensen RG, Mossoba MM, Yurawecz MP, Adlof RO. 1998. Rumenic acid: a proposed common name for the major conjugated linoleic acid isomer found in natural products [letter]. Lipids 33: 835.
Kujuba DA, Fletcher BS, Varnum BC, Lim RW, Herschman HR. 1991. TIS10, a phorbol ester tumor promoter -inducible mRNA from Swiss 3T3 cells, encodes a novel prostaglandin synthase/cyclooxygenase homologue. J Biol Chem 266: 12866– 12872.
Li S-Y, Dougherty JJ. 1997. Inhibit ors of serine/theonine-specific protein phosphatases stimulate transcription by the Ah receptor/Arnt dimmer by affecting a step subsequent to XRE binding. Arch. Biochem. Biophys. 340:73-82.
Li Y, Watkins BA. 1998. Conjugated linoleic acids alter bone fatty acid composition and
reduce ex vivo prostaglandin E2 biosynthesis in rats fed n-6 or n-3 fatty acids. Lipids 33: 417-25. 110
Liew C, Schut HAJ, Chin, SF , Pariza MW, Dashwood RH. 1995. Protection of conjugated linoleic acid against 2-amino-3-methylimidazol[4 , 5-f]quinoline - induced colon carcinogenesis in the F344 rat: a study of inhibitory mechanisms. Carcinogenesis 16:3037-3043.
Lijinsky W. 1991. The formation and occurrence of polynuclear aromatic hydrocarbons associated with food. Mutat Res. 259(3 -4):251-61.
Liu KL, Belury MA. 1998. Conjugated linoleic acid reduces arachidonic acid content and PGE2 synthesis in murine keratinocytes. Cancer Lett. 127:15-22
Liu Y, Levy GN, WeberWW. 1997. Induction of human prostaglandin endoperoxide H synthase mRNA by TCDD. Prostaglandins 53: 1–10.
Lodish H, Berk A, Zipursky SL, Matsudaira P, Baltimore D, Darnell J. Molecular Cell Biology (4 th Edition). 2000. W.H. Freeman and Company. New York, NY.
Long WP, Pray -Grant M, Tsai JC, Perdew GH. 1998. Protein Kinase C activity is required for aryl hydrocarbon receptor pathway -mediated signal transduction. 53:691-700.
Loor JJ, Herbein JH, Jenkins TC. 2002. Nutrient digestion, biohydrogenation, and fatty acid profiles in blood plasma and milk fat from lactating Holstein cows fed can ola oil or canolamide. Anim Feed Sci Technol 97: 65–82.
Lu Y-F, Santostefano M, Cunningham BDM, Treadgill MD, Saf e S. 1995. Iedntification of 3’-methoxy- 4’ -nitroflavone as a pure aryl hydrocarbon (Ah) receptor antagonist and evidence for more than one form of nuclear Ah receptor in MCF -7 human breast cancer cells. Arch. Biochem. Biophys. 316:470-477.
Lu Y-F, Santostefano M, Cunningham BDM, Treadgill MD, Safe S. 1996. Substituted flavones as aryl hydrocarbon (Ah) receptor agonist and antagonist. Biochem. Ph armacol. 51:1077-1087.
Ma D, Wierzbicki A, Field C, Clandinin MT. 1999. Conjugated linoleic acid in Canadian dairy and beef products. J Agric Food Chem 47: 1956-1960.
Ma DW, Field CJ, Clandinin MT. 2002. An enriched mixture of trans-10, cis -12-CLA inhibit s linoleic acid metabolism and PGE2 synthesis in MDA -MB -231 cells. Nutr. Cancer. 44:203-212.
Majumder, B., Wahle, K.W.J., Moir, S., Schofield, A., Choe, S-N., Farquharson, A. , Grant, I. & Heys, S. D. 2002. Conjugated linoleic acids (CLAs) regulate the 111
expression of key apoptotic genes in human breast cancer cells. FASEB J. (July 18, 2002) 10.1096/fj.01-0720fje.
Marnett LJ, Reed GA, Dennison DJ. 1978. Prostaglandin synthetase dependant activation of 7,8-dihydro -7,8dihydroy -benzo[a]pyrene to mutagenic deriva tives. Biochem Biophys Res Commun 82: 210-216.
Marnet t LJ. 1990. Prostaglandin synthase -mediated metabolism of carcinogens and a potential role for peroxyl radicals as reactive intermediates. Environ Health Perspect 88: 5-12.
Marnett LJ, Maddipatti KR. Pro staglandin H Synthase. 1991. In Everse J, Everse KE, Grisham MB. (eds) Peroxidases in Chemistry and Biology, Vol1. CRC Press, Boca Raton FL.
Martey CA, Baglole CJ, Gasiewicz TA, Sime PJ, Phipps RP. 2005. The aryl hydrogen receptor is a regulator of cigaret te smoke induction of the Cyclooxygenase and prostaglandin pathway in human lung fibroblasts. Am. J. Physiol. Lung Cell Mol. Physiol. 289(3):L391 -9.
Moonen HJ, Dommels YE, van Zwam M, van Herwijnen MH, Kleinjans JC, Alink GM, de Kok TM. 2004. Effects of polyunsaturated fatty acids on prostaglandin synthesis and cyclooxygenase -mediated DNA adduct formation by heterocyclic aromatic amines in human adenocarcinoma colon cells. Mol Carcinog 40(3): 180- 188.
Moore M, Narasimhan TR, Steinberg MA, Wang X, Safe S. 1993. Potentiation of CYP1A1 gene espression in MCF -7 human breast cancer cells cotrated with 2,3,7,8-tetrachlorodibenzo -p-dioxin and 12-o-tetradecanoylphorbol-13-acetate. Arch. Biochem. Biophys. 305(2):483-488.
Meade, E. A., McIntyre, T. M., Zimmerman, G. A. & Prescott, S. M. 1999. Peroxisome proliferators enhance cyclooxygenase -2 expression in epithelial cells. J. Biol. Chem. 274:8328-8334.
Miller, A., Stanton, C. & Devery, R. 2001. Modulation of arachidonic acid distribution by conjugated linoleic acid isomers and linoleic acid in MCF -7 and SW480 cancer cells. Lipids 36:1161-1168.
Miller, A., Stanton, C. & Devery, R. 2002. Cis 9, trans 11- and trans 10, cis 12- conjugated linoleic acid isomers induce apoptosis in cultured SW480 cells. Anticancer Res. 22:3879-3887. 112
Moya -Camarena, S. Y., Vanden Heuvel, J. P., Blanchard, S. G., Leesnitz er, L. A. & Belury, M. A. 1999. Conjugated linoleic acid is a potent naturally occurring ligand and activator of PPARa. J. Lipid. Res. 40:1426-1433.
Nakanishi T, Koutoko T, Kawahara S, Murai A, Furuse M. 2003. Dietary conjugated linoleic acid reduces cerebral prostaglandin E(2) in mice. Neurosci. Letter. 341:135-138.
Pariza, M. W., Park, Y. & Cook, M. E. 2001. The biologically active isomers of conjugated linoleic acid. Prog. Lipid Res. 40:283-298.
Park S, Henry EC, Gasiewicz TA. 2000. Regulation of DNA binding activity of the ligand-activated aryl hydrocarbon receptor by tyrosine phosphorylation. Arch. Biochem. Biophys. 381:302-312.
Park Y, Allen KGD, Shultz TD. 2000b. Modulation of MCF -7 breast cancer cell signal transduction by linoleic acid and conjugated linoleic acid in cell culture. Anticancer Res 20: 669-676.
Parrett ML, Harris RE, Joarder FS, Ross MS, Clausen KP, Robertson FM. 1987. Cyclooxygenase -2 gene expression in human breast cancer. Int. J. Oncology 10: 503–507.
Parrett ML, Harris RE, Joarder FS, et al. 1997. Cyclooxygenase -2 gene expression in human breast cancer. Int J Oncol 10: 503-507.
Petridou A, Mougios V, Sagredos A. 2003. Supplementation with CLA: isomer incorporation into serum lipids and effect on body fat of women. Lipids. 38:805- 811.
Peto J, Collins N, Barfoot R, Seal S, Warren W, Rahman N, Easton DF, Evans C, Deacon J, Stratton MR. 1999. Prevelance of BRCA -1 and BRCA1 gene mutations in patients with early onset breast cancer. J. Natl. Cancer Inst. 91:943-949.
Phoon MC, Desborders C , Howe J, Chow VT. 2001. Linoleic and linolelaidic acids differentially influence proliferation and apoptosis of MOLT -4 leukaemia cells. Cell Biol. Int. 25:777-784.
Piperova LS, Teter BB, Bruckental I, et al. 2000. Mammary lipogenic enzyme activity, trans fatty acids and conjugated linoleic acids are altered in lactating dairy cows fed a milk fat -depressing diet J Nutr 130: 2568–2574.
Piperova LS, Sampugna J, Teter BB, et al. 2002. Duodenal and milk trans octadecenoic acid and conjugated linoleic acid (CLA) isomers indicate that postabsorptive 113
synthesis is the predominant source of cis -9-containing CLA in lactating dairy cows. J Nutr 132: 1235–1241.
Precht D, Hagemeister H, Kanitz W, Voigt J. 2002. Milk fat depression and the role of trans and CLA fatty acid isomers by feeding a high fiber diet with calcium soap s of fatty acids in early lactating dairy cows. Milchwissenschaft 57: 518–22.
Puga A, Hoffer A, Zhou S, Bohm J, Leikauf, Shertzer H. 1997. Sustained increase in intracellular free calcium and activation of Cyclooxygenase -2 expression in mouse hepatoma cell s treated with dioxin. Biochem. Pharmacol. 54:1287-1297.
Rimarachin JA, Jacobson JA, Szabo P, Maclouf J, Creminon C, Weksler BB. 1994. Regulation of cyclooxygenase -2 in aortic smooth cells. Arterioscler Thromb 14: 1021-1031.
Ristimaki A, Garfinkel S, Wes se ndorf, Maciag T, Hla T. 1994. Induction of cyclooxygenase -2 by interleukin -1 alpha. Evidence for post- transcriptional regulation. J. Biol. Chem. 269(16):11769 -75.
Rose, D. P. & Connolly, J. 1989. Stimulation of growth of human breast cancer cell lines in culture by linoleic acid. Biochem. Biophys. Res. Commun. 164:277-283.
Rose , D. P. & Connolly, J. M. 1990. Effects of fatty acids and inhibitors of eicosanoid synthesis on the growth of a human breast cancer cell line in culture. Cancer Res. 50:7139-7144.
Ruddon R. Cancer Biology (3 rd Edition). 1995. Oxford University Press, New York, NY.
Russo J, Tahin Q, Lareef MH, Hu Y-F, Russo IH. 2002. Neoplastic transformation of human breast epithelial cells by estrogens and chemical carcinogens. Environ. Mol. Mut. 39:254-263.
Safe S, Krishnan V. 1995 Clorinated hydrocarbons: Extrogen and antiestrogens. Toxicol. Lett. 82-83:731-736
Sano H, Kawahito Y, Wilder RL, Hashiramoto A, Mukai S, Asai K, Kimura S, Kato H, Kondo M, Hla T. 1995. Expression of cyclooxygenase -1 a nd -2 in human colorectal cancer. Cancer Res 55: 3785–3789.
Schonberg S, Krokan HE. 1995. The inhibitory effects of conjugated dienoic derivatives (CLA) of linoleic acid on growth of human tumor cell lines is in part due to increased lipid peroxidation. An ticancer Res 15: 1241-1246. 114
Scherer G, Frank S, Riedel K, Meger -Kossien I, Renner T. 2000. Biomonitoring of exposure to polycyclic aromatic hydrocarbons of nonoccupationally exposed persons. Cancer Epidemiol. Biomarkers Prev. 9:373-380.
Schultz T, Chew B, Seaman W. 1992. Differential stimulatory and inhibitory responses of human MCF -7 breast cancer cells to linoleic acid and conjugated linoleic acid in culture. Anticancer Res 12: 21-43.
Sehat, N., Kramer, J. K., Mossoba, M. M., Yurawecz, M. P., Roach, J. A. , Eulitz, K., Morehouse, K. M. & Ku, Y. 1998. Identification of conjugated linoleic acid isomers in cheese by gas chromatography, silver ion high performance liquid chromatography and mass spectral reconstructed ion profiles. Comparison of chromatographic elution sequences. Lipids 33:963-971.
Sherr, C. J. 1996. Cancer cell cycles. Science 274:1672-1677.
Sherratt PJ, McLellan LI, Hayes JD. 2002. Positive and negative regulation of prostaglandin E2 biosynthesis in human colorectal carcinoma cells by cancer chemoprotective agents. Biochem. Pharmacol. 66:51-61.
Shih HA, Nathanson KL, Seal S, Collins N, Stratton MR, Rebbeck TR, Weber BL. 2000. BRCA1 and BRCA2 mutations in breast cancer families with multiple primary cancers. Clin. Cancer Res. 6:4259-4264.
Smith SK. 1992. Prostaglandins and implantation. In: J.O. Drife and A.A. Calder Editors, Prostaglandins and the uterus Springer -Verlag, London 1992, pp. 91–99.
Smith WL, Marnet LJ. 1991. Prostaglandin endoperoxide synthase: structure and catalysis. Biochim Biophys Acta 1083: 1-17.
Song HJ, Sneddon AA, Barker PA, Bestwick C, Choe SN, McClinton S, Grant I, Rotondo D, Heys SD, Wahle KW. 2004. Conjugated linoleic acid inhibits proliferation and modulates protein kinase C isoforms in human prostate cancer. Nutr. Cancer. 49(1):100-108.
Sugano M, Tsujita A, Yamasaki M, Noguchi M, Yamada K. 1998. Conjugated linoleic acid modulates tissue levels of chemical mediators and immunoglobulins in rats. Lipids 33: 521-27.
Szebeni J, Eskelson C, Sampliner R, Hartman B, Griffin J, Dormandy T, Watson RR. 1986. Plasma fatty acid pattern including diene-conjugated linoleic acid in ethanol user and patients with ethanol related liver disease. Metab. Clin. Exp. Res. 10:647-650. 115
Szeliga J, Hilton BD, Chmurny GN, Krzeminski J, Amin S, Dipple A. 1997. Characterization of DNA adducts formed by the four configurationally isomeric 5,6-dimethylchrysene 1,2-dihydrodiol 3,4-epoxides. Chem Res Toxicol 10: 378- 385.
The SH, Hill AK, Foley DA, McDermott EW, O’Higgins NJ, Young LS, 2004. COX inhibito rs modulate bFGF -induced cell survival in MCF -7 breast cancer cells. J. Cell Biochem. 91:796-807.
Thompson, H., Zhu, Z., Banni, S., Darcy , K., Loftus, T. & Ip, C. 1997. Morphological and biochemical status of the mammary gland as influenced by conjugated linoleic acid: implication for reduction in mammary cancer risk. Cancer Res. 57:5067-5072.
Tillotson, J. K., Darzynkiewicz, Z., Cohen, L. A. & Ronai, Z. 1993. Effects of linoleic acid on mammary tumor cell proliferation are associated with changes in p53 protein expression. Int. J. Oncol. 3:81-87.
Uru qhart P, Parkin SM, Rogers JS, Bosley JA, Nicolaou A. 2002. The effect of conjugated linoleic acid on arachidonic acid metabolism and eicosanoid production in human saphenous vein endothelial cells. Biochim. Biophys. Acta. 1580: 150-160.
Vogel C, Schuhmacher US, Degen GH, Bolt HM, Pineau T, Abel J. 1998. Modulation of prostaglandin H synthase -2 mRNA expression by 2,3,7,8-tetrachlorodibenzo -p- dioxin in mice. Arch Biochem Biophys. 351(2):265-71
Vogelstein, B. & Kinzler, K. W. 1992. p53 functions and dysfunction. Cell 70:523-526.
Wang, H. L., Wang, J., Xiao, S. Y., Haydon, R., Stoiber, D., He, T. C., Bissonnette, M. & Hart, J. (2002) Elevated protein expression of cyclin D1 and Fra -1 but decreased expression of c-Myc in human colorectal adenocarcinomas overexpressing beta - catenin. Int. J. Cancer 101:301-310.
Weinberg, R. A. 1995. The retinoblastoma protein and cell cycle control. Cell 81:323- 330.
Whitlock JP. 1986. The regulation of cytochrome P -450 gene expressio n. Annu Rev Pharmacol Toxicol. 26:333-69.
Wiese F, Thompson PA, F.Kadludar F. 2001. Carcingen substrate specificity of human COX -1 and COX -2. Carcinogenesis 21(1):5 -10. 116
Wolff H, Saukkonen K, Antilla S, Karjalainen A, Vainio H, Ristimaki A. 1998. Expression of cyclooxygenase -2 in human lung carcinoma. Cancer Res 58: 4997– 5001.
Yang F, Bleich D. 2004. Transcriptional regulation of Cyclooxygenase -2 gene in pancreatic β–cells. J. Biol. Chem.279(34):35403-35411.
Yu, Y., Correll , P. H. & Vanden Heuvel, J. P. 2002. Conjugated linoleic acid decreases production of pro -inflammatory products in macrophages: evidence for a PPARg - dependent mechanism. Biochim. Biophys. Acta 1581:89-99.
Zhang F, Subbaramaiah K, Altorki N, Dannenberg AJ. 1998. Dihydroxy bile acids activate the transcription of cyclooxygenase -2. J Biol Chem 273: 2424–2428.
Zhu Y, Saunders M, Yeh H, Deng W-G, Wu KK. 2002. Dynamic regulation of cyclooxygenase -2 promoter activity by isoforms of CCAAT/enhancer -binding proteins. J Biol Chem. 277: 6923-6928
Zieg ler, A., Jonason, A. S., Leffell, D. J., Simon, J. A., Sharma, H. W., Kimmelman, J., Remington, L., Jacks, T. & Brash, D. E. 1994. Sunburn and p53 in the onset of skin cancer. Nature 372:773-776.