Chk2 Phosphorylation of the BLM Helicase Promotes Its Interactions with Topoisomerase Iiα and the Resolution of Chromosome Breakage

Home , Bloom syndrome protein, FANCD2, FANCI, Helicase, MSH2, Protein kinase

Chk2 phosphorylation of the BLM helicase promotes its interactions with topoisomerase IIα and the resolution of chromosome breakage.

Dissertation

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

Julia Louise Harris Behnfeldt, B.A.

Graduate Program in Biomedical Sciences

The Ohio State University

2015

Committee:

Joanna Groden Ph.D., Advisor

Jeffrey Parvin M.D., Ph.D.

Kay Huebner Ph.D.

Dawn Chandler Ph.D.

Julia Louise Harris Behnfeldt

2015

Abstract

Genomic instability, including chromosome breakage, can arise from dysfunctional cell cycle control, environmental agents that damage DNA or ineffective

DNA repair; it is a hallmark of most cancers. The induction or regulation of genomic instability also represents an opportunity in cancer therapeutics. The BLM helicase is a

RecQ-like helicase with DNA repair functions in homologous recombination and DNA replication. Cells lacking BLM exhibit a hyper-recombination phenotype, increased chromosome breakage and the inability to repair some types of DNA damaged. Previous work has shown that the interaction of topoisomerase IIα and BLM is required to stimulate BLM helicase activity and resolve chromosome breaks. This works shows that phosphatase-treatment of BLM inhibits topoisomerase IIα stimulation of BLM helicase activity, although the specific activity of BLM is increased. Computational analysis identified two putative serine clusters S517, S518 (C1) and S577, S579, S580 (C2) within the topoisomerase IIα interaction domain of BLM. Mutagenesis of these clustered serines to alanine (BLMC1A, BLMC2A) or aspartate (BLMC1D, BLMC2D) permitted testing of their ability to regulate the BLM/topoisomerase IIα interaction and function in chromosome breakage. BLMC2A was unable to lower high micronuclei numbers in cells lacking endogenous BLM, while BLMC1A, BLMC1D, BLMC2D and wild-type BLM lowered the high micronuclei numbers. All six single amino acid mutants

ii behaved similar to wild-type BLM. In localization studies, BLMC2A displayed a 2.5-fold decrease in colocalization with topoisomerase IIα during G2/M-phase, while also exhibiting an increased number of anaphase ultra-fine bridges (UFBs). In vitro phosphorylation of BLM by Chk2 restored the topoisomerase IIα-stimulation of phosphatased-BLM in contrast to treatment with Chk1. Lastly, transfection of BLMC2D into BLM-/- cells exhibited lower amounts of DNA double-strand breaks (DSBs) compared to BLM and BLMC2A following inhibition of Chk2 in vivo. These findings demonstrate that post-translational modification of BLM by Ch2k2 at amino acids S577,

S579 and S580 controls its interaction with topoisomerase IIα, most likely at the G2-M boundary, and its functions in regulating chromosome breakage. They also suggest that disruption of BLM phosphorylation via Chk2 inhibitors to control BLM/topoisomerase

IIα localization and/or interaction may be a novel mechanism to manipulate DNA damage.

iii

Acknowledgments

First, I must thank my mentor Joanna Groden for her guidance and support over the years. I would not be in my current position if not for her. I am extremely grateful for

Samir Acharya and Michael McIlhatton. To Samir, thank you for your scientific guidance. All of my biochemical knowledge has come from you. To Michael, thank you for mentorship and friendship. You always have the best advice. Thank you to former

Groden lab members: Patrick, Jeremy and April. You were invaluable to my success and wonderful friends to have in lab. To Patrick and Jeremy, I appreciate the time you took to explain and demonstrate the numerous assays to me, even after you had left the lab. To

April, thank you for showing me the ropes of graduate school and making lunchtime the best part of the day. Thank you to all the current Groden lab members for your friendship and advice. It is comforting to know that each of you is always willing to help out in any way possible.

Thank you to my parents, Kent and Sherrie Harris, and siblings, Libby and Kal, who have always supported my pursuit in higher education. Finally to my husband Matt, thank you for believing in me even when I doubted myself. You are my biggest supporter and a constant source of inspiration.

Vita

May 2006 ...... Patrick Henry High School

August 2010 ...... B.A. Biology, Capital University

2010 to present ...... Ph.D., The Ohio State University

Publications

Burns JN, Orwig SD, Harris JL, Watkins JD, Vollrath D, and Lieberman RL. Rescue of glaucoma-causing mutant myocilin thermal stability by chemical chaperones. ACS Chem

Biol 2010; 5(5):477-87.

Gocha ARS, Harris J, and Groden J. Alternative lengthening of telomeres: Permissive mutations, DNA repair proteins, and tumorigenic progression in mammalian cells. Mut

Res 2013; 743:142-50.

Acharya S, Kaul Z, Gocha ARS, Martinez A, Harris J, Parvin JS, Groden J.

Collaboration between BLM andBRCA1 in modulating telomere metabolism in ALT cells. PLoS One. 2014 Aug 1;9(8):e103819.

Harris Behnfeldt J, Acharya S, Tangeman L, Gocha ARS, Keirsey J, German J, Groden

J. BLM helicase/TOP2A interaction is regulated by Chk2 to resolve chromosome breakage. Submitted. 2015.

Fields of Study

Major Field: Biomedical Sciences

Emphasis: Cancer Biology

Table of Contents

Abstract ...... ii Acknowledgments ...... iv Vita ...... v List of Figures…………………………………………………………………………….x

Chapter 1: Literature Review. …………………………..………………………..……1 Clinical features and genetics of Bloom’s syndrome…………………..………....1

BLM gene identification and BLM protein structure………………………...... 4

BLM enzymatic activity...……………………..………………………………….7

BLM and DSB repair…………………………………..……………………...... 11

BLM and DNA replication…………………………………….……….…….….15

BLM and telomere maintenance……………………………………….….……..16

BLM and chromosome segregation…………………………………………...... 17

Cell cycle regulation and BLM localization.…………………………….…..…..20

BLM super-complexes……………………………………………….…………..22

Post-translation modifications of BLM……………………………………....….23

BLM and topoisomerase IIα……………………………………………………..26

BLM and checkpoint kinase 2 (Chk2)…………………………………………...28

Chapter 2: Thesis Rationale and Research Objectives………..………………….….30

Chapter 3: The phosphorylation status of BLM regulates its helicase activity and topoisomerase IIα stimulation………………………………………………….…...... 32 vii

I. Introduction……………………………………………………………………32

II. Materials and methods………………………………………………………..36

Protein purification………………………………………………………36

Phosphatase treatment……………………………………………………36

Mass spectrometry in-gel digestion……………………………………...37

Mass spectrometry LC-MS/MS analysis………………………………...37

Mass spectrometry data analysis………………………………………...38

Helicase assays…………………………………………………………..38

Phosphorylation by Chk2/Chk1 in vitro…………………………………39

III. Results………………………………………………………………………..39

BLM purified from S. cerevisiae is highly phosphorylated…………...... 39

Phosphatase treatment increases BLM helicase activity in vitro………...41

BLM phosphorylation is required for topoisomerase IIα stimulation of

helicase activity.……………………………………………………….....44

Chk2 phosphorylation of phosphatased BLM recovers topoisomerase IIα

stimulation.…………………………………………………………...... 46

IV. Discussion……………………………………………………………………52

Chapter 4: Phosphosite 577/579/580 of BLM regulates its functional interactions with topoisomerase IIα and chromosome breakage………………………………….54

I. Introduction……………………………………………………………………54

viii

II. Materials and methods………………………………………………………..57

In silico phosphorylation prediction……………………………………..57

Cell lines and tissue culture…………………………………………...... 57

Cloning………………………………………………………….....……..57

Co-localization studies…………………………………………………..60

Protein purification………………………………………………………60

Cell cycle analysis……………………………………………………….61

Micronuclei analysis……………………………………………………..61

Ultra-fine bridges………………………………………………………...62

In vitro immunoprecipitation…………………………………………….63

Helicase assays…………………………………………………………...63

Phosphorylation by Chk2 in vitro………………………………………..64

Chk2 inhibition…………………………………………………………..64

Comet assays……………………………………………………………..64

III. Results………………………………………………………………………..65

In silico phosphorylation programs predict 15 putative sites within the

topoisomerase IIα interaction region of BLM………………………...... 65

Phosphorylation of BLM C2 (S577/S579/S580) is required for correction

of elevated chromosome breakage……………………………………....68

Phosphorylation of BLM C2 (S577/S579/S580) is required for co-

localization with topoisomerase IIα……………………………………74

Phosphorylation of BLM C2 (S577/S579/S580) is required for resolution

of ultra-fine bridges (UFBs)…………………………………………...... 76

Topoisomerase IIα localizes to anaphase bridges………………………..79

Phosphorylation of BLM C2 (S577/S579/S580) does not alter in vitro

interactions with topoisomerase IIα…………………………………...... 83

S577, S579 and S580 of BLM are required for topoisomerase IIα

stimulation of BLM helicase activity. ………………………………...... 85

Chk2 phosphorylation of phosphatased BLM recovers topoisomerase IIα

stimulation and requires S577, S579 and S580 of BLM………………...88

DNA damage following Chk2 inhibition in vivo is corrected by the

phosphomimetic BLMC2D……………………………………………....90

IV. Discussion…………………………………………………………………....93

Chapter 5: BLM stimulates topoisomerase IIα relaxation of supercoiled DNA…...98

I. Introduction…………………………………………………………………....98

II. Materials and methods………………………………………………………..99

Protein purification……………………………………………………....99

DNA relaxation assay…………………………………………………..100

III. Results………………………………………………………………………100

BLM stimulates topoisomerase IIα DNA relaxation of supercoiled

DNA……...... 100

Modification of BLM C2 (S577/S579/S580) does not alter topoisomerase

IIα relaxation of supercoiled DNA……………………………………..102

IV. Discussion………………………………………………………………….105

Chapter 6: Thesis Summary…………………………………………………………107

Bibliography…………………………………………………………………………..120

List of Figures

Figure 1: Bloom’s syndrome characteristics……………………………………………....4

Figure 2: The domains of the BLM helicase protein……………………………………...6

Figure 3: DNA and RNA substrates unwound by BLM……………………………...... 10

Figure 4: Roles of BLM in Homologous Recombination mediated DNA repair………..14

Figure 5: Post-translational modifications of BLM……………………………………...26

Figure 6: BLM purified from S. cerevisiae is highly phosphorylated………………..….41

Figure 7: Phosphatase-treatment of BLM increases BLM helicase activity…………….43

Figure 8: Phosphatase-treatment of BLM eliminates topoisomerase IIα-mediated stimulation of BLM helicase activity…………………………………………………….45

Figure 9: Chk2 phosphorylation of phosphatased BLM (PP-BLM) rescues topoisomerase

IIα-mediated stimulation of helicase activity…………………………………………….49

Figure 10: Chk1 phosphorylation of phosphatased BLM (PP-BLM) does not rescue topoisomerase IIα-mediated stimulation of helicase activity…………………………...51

Figure 11: Putative BLM phosphorylation sites in the topoisomerase IIα interaction region…………………………………………………………………………………….67

Figure 12: Phosphorylation of BLM C2 (S577/S579/S580) is required for correction of chromosome breakage in BLM-/- cells……………………………………………………70

xii

Figure 13: All three serines within BLM cluster 2 (S577/S579/S580) are required for correction of chromosome breakage in BLM-/- cells……………………………………..71

Figure 14: Phosphorylation of BLM C2 (S577/S579/S580) is required for correction of

DNA DSBs in BLM-/- cells…………………………………………………………….…73

Figure 15: Phosphorylation of BLM C2 (S577/S579/S580) is required for co-localization with topoisomerase IIα in BLM-/- cells…………………………………………………...76

Figure 16: Phosphorylation of BLM C2 (S577/S579/S580) is required for resolution of ultra-fine bridges (UFBs)………………………………………………………………...78

Figure 17: Phosphorylation of BLM C2 (S577/S579/S580) is not required for resolution of anaphase bridges………………………………………………...... …………………80

Figure 18: Topoisomerase IIα localizes to anaphase bridges……...... 82

Figure 19: BLM phospho-mutants exhibit similar cellular localization to BLM………..84

Figure 20: Purified BLM phospho-mutants are phosphorylated………………………...86

Figure 21: BLM phospho-mutants exhibit in vitro interactions with topoisomerase IIα..87

Figure 22: BLM C2 (S577/S579/S580) is necessary for topoisomerase IIα-mediated stimulation of BLM helicase activity…………………………………………………….89

Figure 23: Chk2 phosphorylation of phosphatased BLM recovers topoisomerase IIα- mediated stimulation of helicase activity and is dependent on its ability to modify BLM

C2 (S577/S579/S580)……………………………………………………………………91

Figure 24: Phosphomimetic mutation of BLMC2 (S577/S579/S580) prevents DNA damage following Chk2 inhibition………………………………………………………94

xiii

Figure 25: BLM stimulates topoisomerase IIα-mediated relaxation of DNA supercoiling……………………………………………………………………………..103

Figure 26: Modification of BLM C2 (S577/S579/S580) does not alter topoisomerase IIα relaxation of supercoiled DNA…………………………………………………………105

Figure 27: Model for the role of Chk2 phosphorylation in the BLM/topoisomerase IIα interaction required to resolve chromosome breaks…………………………………....118

xiv

Chapter 1: Literature Review

Clinical features and genetics of Bloom’s syndrome

Bloom’s syndrome (BS) is a chromosomal breakage disorder, inherited in an autosomal recessive manner. Persons with BS are invariably characterized by their proportional dwarfism; additionally they can be affected by immunodeficiency, sun- sensitivity or cancer predisposition. BS was first identified in 1954 by Dr. David Bloom as “clinical syndrome characterized by low weight, stunted growth, and a sun-sensitive telangiectatic skin.” Growth defects in BS are evident in utero and remain throughout

(Figure 1). The majority of BS persons have reduced levels of serum immunoglobulin classes (IgM, IgA, and/or less commonly IgG).

Cancers arise in BS persons at a much higher rate and multiplicity than that of the general population. Accordingly, the first 100 cancers documented in The Bloom’s

Syndrome Registry were identified in 71 BS patients (German 1997). The distribution and sites of cancers found in BS patients mimic those arising in the general public, i.e. acute leukemia affect younger persons while colon and stomach carcinomas affect older individuals. Rare tumors, including medulloblastomas and osteogenic sarcomas, have been identified in BS persons as young as 3 and 4 years, respectively. Nearly every class and type of cancer has been identified in BS with the exceptions of ovarian and prostate

1 cancer; the average age of cancer onset in BS is 24.7 years. As expected, cancer is the leading cause of death in BS, with an average age of death of 23.6 years.

In 2009, there were 265 individuals with BS, from 222 families, registered in The

Bloom’s Syndrome Registry, a surveillance program maintained at Cornell-Weill College of Medicine. While BS is rare in the general population, individuals of Ashkenazi Jewish linage have a higher incidence of BS. Of the first 19 identified cases of BS, 9 patients were of Ashkenazi Jewish heritage (German et al., 1968). The BS carrier rate for the

Ashkenazi Jewish population is 1/107. BS carriers show no clinical manifestation of BS symptoms, although some studies have reported modestly elevated sister chromatid exchanges or chromosome breakage (Gross et al., 2008).

Cells from those with BS have unique cytological features, including high rates of sister chromatid exchanges (SCE), telomere associations between homologous chromosome arms and quadiradial structures of homologous chromosomes. SCE refers to the exchange of DNA between two sister chromatids. SCEs can be observed in normal healthy cells at very low levels. BS lymphocytes can exhibit anywhere from 10-100 increase in SCE numbers, diagnostic for the disorder (German et al., 1977).

Interestingly, a minor population of BS persons are mosaic for lymphocytes with high levels of SCE and lymphocytes with low levels of SCE. Low SCE lymphocytes are found exclusively in BS-affected offspring of nonconsanguineous partners or those offspring of non-Ashkenazi Jewish ancestry. These compound heterozygotes carry two different and unique mutated alleles, one from each parent. Due to the hyper recombination phenotype observed in the high SCE cells, it was hypothesized that a newly functional BLM gene

2 could be “regenerated” by intragenic somatic recombination between the two different inherited mutant alleles. This observation eventually permitted mapping of the causative

BS gene, to be discussed later (Ellis et al., 1995). Telomere associations occur when two telomeric regions from homologous chromosomes associate and occur at a higher rater

(approximately 6-fold) in BS cells compared to wild-type cells (Lillard-Wetherell et al.,

2004). Additionally, higher amounts of symmetric quadriradials, formed by unresolved somatic recombination events between homologous chromosomes, are observed in BS cells compared to wild-type cells (Chaganti et al., 1974). These unique cytological features point to an increased rate of homologous recombination (HR) in BS cells.

Figure 1: Bloom’s syndrome. A full-grown, young man with Bloom's syndrome with Dr. David Bloom (seated, left) and Dr. James German (standing, rear). The person exhibits the proportional dwarfism characteristic of Bloom’s syndrome (personal photo, Joanna Groden).

BLM gene identification and BLM protein structure

Nearly 41 years after the first description of BS, the gene responsible for BS was identified. Using a method known as somatic crossover point mapping, which compared regions of heterozygosity in high SCE lymphocytes that were reduced to homozygosity in low SCE lymphocytes from the same person, the position of the BS causative gene was located between a recombinant and non-recombinant region on chromosome 15 (Ellis et 4 al., 1995). The gene was also mapped to 15q26.1 by a more conventional mapping method using linkage disequilibrium and designated as BLM (Ellis et al., 1995). The BLM gene product, BLM, was predicted to encode a DNA helicase as it contained amino acid motifs homologous to motifs found in Escherichia coli RecQ helicase. Biochemical investigations revealed that BLM is a DNA-stimulated ATPase and an ATP- and Mg2+- dependent DNA helicase that unwinds DNA in a 3’ to 5’ direction, also defining it as a member of the RecQ-like helicase family (Karow et al., 1997). The human RecQ-like helicase family consists of 5 members including BLM, WRN, RECQL1, RECQL4 and

RECQL5. In addition to BLM, mutations in WRN and RECQL4 are also associated with heritable human diseases, Werner’s syndrome and Rothmund-Thomson syndrome respectively. Similar to BS, Werner’s syndrome and Rothmund-Thomson syndrome are characterized by genomic instability and a predisposition to cancer (Hickson, 2003). A highly conserved helicase domain made up of an ATPase domain and less conversed

RQC (RecQ conserved) domain is present in each of the family members (Bohr, 2008).

The BLM RQC domain functions as the main DNA binding element that recognizes a wide array of DNA structures (Huber et al., 2006). Additionally, BLM contains an RNase D C-terminal (HRDC) domain. The HRDC domain regulates helicase activity of BLM by through protein and DNA substrate interactions (Kim and Choi

2010). The HRDC domain is required for the resolution of double Holliday junctions, discussed later (Kim and Choi, 2010). A C-terminal (1334-1349) bipartite nuclear localization signal (NLS) is responsible for BLM translocation into the nucleus (Figure 2)

(Kaneko et al., 1997). A poorly characterized N-terminal domain (1-431) is required for

BLM oligomerization as well as protein–protein interactions. The N-terminal domain of

BLM exists as hexamers and dodecamers in solution (Bernsten et al., 1999). Size- exclusion purification demonstrated that BLM existed is a 700-900 kDa multimer and is mostly likely hexameric (Karow et al., 1999).

More than 60 pathogenic mutations have been reported within BLM

(http://bioinf.uta.fi/BLMbase/)(German et al., 2007). Most mutations are found upstream of the helicase domain and are nonsense mutations, thereby generating truncated transcripts degraded by nonsense-mediated mRNA decay. One mutation is frequently among the Ashkenazi Jewish population, the BlmAsh allele, consisting of a 6 basepair deletion and 7 basepair insertion, creating a nonsense codon downstream of the alternation (Straughen et al., 1998).

A small number of missense mutations affect the localization of BLM to the nucleus, despite the protein remaining enzymatically active, while others abolish enzymatic activity (helicase-dead mutants) (Guo et al., 2007). Therefore, enzymatic activity of BLM is required to maintain genomic integrity.

BLM$

Helicase( RQC( HRDC( NLS(

Figure 2: The domains of BLM. BLM contains four functional domains. The helicase (orange) domain is responsible for BLM unwinding activity. The helicase and RQC RecQ C-terminal; blue) domains are conserved in all RecQ family members. The HRDC (helicase and Rnase D C-terminal; green) domain is required for DNA/RNA substrate recognition. The NLS (nuclear localization sequence; red) mediates BLM localization to the nucleus.

BLM enzymatic activity

As a DNA helicase, BLM uses the energy derived from ATP hydrolysis to unwind duplex DNA in a variety of cellular settings. BLM has a wide variety of known

DNA substrates, suggesting multiple functions of BLM in DNA metabolism (Popuri et al., 2008). These includes forked DNA duplexes, X (four-way) junctions that mimic the

Holliday junction recombination intermediate, overhang DNA duplexes, displacements loops and blunt-ended duplexes with an internal ‘bubble’ of non-complementary sequence (Figure 3). A 3’ overhang of at least 11 nucleotides is required for BLM to bind and translocate until it reaches duplexed DNA, which it then unwinds (Popuri et al.,

2008). Additionally, BLM has a high affinity for unwinding G-quadruplex DNA. G- quadruplexes (G4) are stable DNA structures that can form in guanine-rich DNA sequences (Sun et al., 1998). Recent work has shown that G4 motifs are enriched at transcription start sites of differentially expressed mRNAs in BS cells compared with 7 healthy control cells, suggesting that G-quadruplex structures are targets for BLM binding in transcription of protein-coding genes (Nguyen et al., 2014). Although not considered a RNase, BLM can also unwind RNA:DNA hybrids when the 3’ overhang is

DNA, but not RNA (Grierson et al., 2012). RNA:DNA hybrids are thought to form between a rRNA transcript and a template rDNA, suggesting that their unwinding by

BLM allows transcription and replication to proceed. BLM is unable to unwind

RNA:RNA substrates (Grierson et al., 2012).

BLM is a poorly processive helicase, only able to unwind DNA duplexes of less than 100 basepairs. The eukaryotic single-stranded DNA-binding protein replication protein A (RPA) strongly stimulates BLM (Brosh et al., 2000). This stimulation allows for unwinding of longer DNA duplexes. As RPA coats recently resected DNA in homologous recombination, it is likely that the stimulation of BLM by RPA is vital for efficient HR processing. Numerous other protein interaction partners of BLM affect its helicase activity on a variety of DNA substrates. For example, BLM helicase activity is stimulated by the telomeric shelterin protein TRF2, but inhibited by the related telomeric shelterin protein TRF1 on telomeric DNA substrates (Lillard-Wetherell et al., 2004).

BRCA1, a vital tumor suppressor, has the ability to enhance BLM helicase activity by three-fold on forked substrates containing telomeric repeats (Acharya et al., 2014).

Additionally, topoisomerase IIα stimulates BLM on substrates mimicking early homologous recombination (HR) intermediates, including a 3’ overhang and bubble

DNA substrate, indicating a role for the BLM and topoisomerase in early, but not late,

HR (Russell et al., 2011). Here, we show that topoisomerase IIα-mediated stimulation of

BLM helicase activity is dependent on the phosphorylation status of BLM.

BLM forms a large number of functionally important oligomeric complexes.

While the N-terminal domain of BLM forms hexamers and dodecamers in solution, recent work has suggested that the monomeric form of BLM is most often found on DNA structures encountered during early HR-based DNA repair. Additionally, DNA structures resembling HR intermediates are processed by BLM dimers in vitro (Gyimesi et al.,

2013). The status of BLM oligomers on more complex DNA structures, including G4

DNA, is currently unknown. Others have shown that mulitmeric BLM dissociates into monomer and dimers upon the addition of ATP and DNA, indicating that BLM may function as a monomer during unwinding (Xu et al., 2012).

A.$ B.$

5’( 3’( 5’( 3’( 3’( 5’( 3’( 5’(

C.$ D.$

5’( 5’( 3’( 3’( 5’( 5’( 3’( 3’( 3’( 5’( 3’( 5’(

3’(5’( E.$ F.$

5’( 5’( 3’( 3’( 3’( 5’( 5’( 3’( 5’(3’( G.$ H.$ 5’( 3’(

Figure 3: DNA and RNA substrates unwound by BLM. Shown are A: DNA duplex with 3’ overhang B: DNA/RNA (orange) duplex with 3’ overhang C: Displacement loop D: Displacement loop containing RNA (orange) single strand (R-loop) E: Replication fork F: X-junction G: G quartet (G4) DNA top view (Adapted from Giri et al. Nucl. Acids Res. 2011) H: G4 DNA side view.

BLM and DSBs repair

DNA double-strand breaks (DSBs) commonly occur in all cells and their repair is vital for genomic stability. DSBs can arise from external agents such as ionizing radiation, radiomimetic chemicals and topoisomerase inhibitors. They can also be caused when a DNA polymerase encounters a DNA single-strand break or by mechanical stress on chromosomes. Unrepaired DSBs can lead to the formation and loss of chromosome fragments via micronuclei, duplications and translocations and others events associated with oncogenesis.

There are two major types of DNA repair that fix DSBs: homologous recombination (HR) or non-homologous end joining (NHEJ). HR uses the information of a homologous sister chromatid or chromosome to repair the break in an error-free process. This method of repair requires the availability of a sister chromatid and therefore is mostly used during S/G2 cell cycle phases. When a homology donor in the form of a sister chromatid is not present, during G1 cell cycle phase, NHEJ can correct DSBs.

NHEJ ligates blunt-ended DSBs resulting in an error-prone method of DNA repair. BLM plays a role in both forms of DNA repair and will be discussed further.

A DNA DSB is recognized by the sensor MRN (MRE11–RAD50–NBS1) complex to initiate repair. In HR, the blunt ends of a DSB are initially resected by MRN in conjunction with CtIp to generate a 3’ DNA single-stranded tail. The single-stranded ends are then quickly coated by replication protein A (RPA). At this point, BLM performs its first function in HR. Along with exonuclease EXO1 and DNA2, BLM

11 extends the length of the single-strand resection then in a surprisingly pro-recombination function. BRCA1 and RAD52 promote the displacement of RPA and the creation of

RAD51-bound single-stranded DNA. Disruption of RAD51 from the single-stranded

DNA filament offers a potential mechanism for the early suppression of inappropriate

HR. RAD51 displacement also causes the inhibition of DNA strand exchange. BLM helicase can efficiently disrupt the nucleofilament by displacing RAD51 protein in an

ATPase-dependent manner in an anti-recombination function. However, if RAD51 remains bound to the single-stranded DNA, RAD51 then performs a homology search and eventually invades the homologous template to create a D-loop DNA structure. Here,

BLM performs another unique anti-recombination function by resolving the D-loop formation. If D-loop formation persists, DNA synthesis and ligation will occur and result in the formation of double Holliday junctions (dHJs). Holliday junctions are processed by either “resolution” or “dissolution” to create crossover or non-crossover products respectively. In the presence of BLM, a dHJ processed by a complex known as the BLM dissolvasome; it includes BLM, topoisomerase IIIα, RMI1 and RMI2, to dissolve the structure in a non-crossover method (Manthei and Keck 2013). In the absence of BLM, as seen in BS, a dHJ is resolved in a manner that leads to crossovers, such as SCE. The enzymatic activities and the cellular phenotypes of BLM-/- cells and BS persons point to a primarily anti-recombination role for BLM.

As there is no requirement for a homology donor, NHEJ may occur throughout the cell cycle. NHEJ is initiated by binding of Ku protein to blunt-ended DSBs. The

DNA-dependent protein kinase catalytic subunit-Artemis complex is recruited, post Ku

12 binding, allowing for blunt end processing. Finally, the DNA ligase IV (LIG4)-XRCC4 complex is recruited for ligation of the two DNA ends. An unconventional form of end- joining, known as alternative end-joining or A-EJ, generates large deletions (>200 base pairs) via CtIP/MRE11 followed by the use of microhomology (2-25 base pairs) to ligate the ends. BLM has a dual function in A-EJ that is dependent on cell cycle stage and interaction partners (Grabarz et al., 2013). In the presence of 53BP1 and RIF1, BLM represses A-EJ. In the absence of 53BP1 and RIF1 in later cell cycle phases, BLM promotes formation of large deletions by CtIP. Promotion of large deletions occurs during S and G2 cell cycle phases, suggesting that BLM may promote A-EJ resections in order to promote HR, which requires resection of DSBs prior to homology searches.

CtIP$ CtIP$

MRN$ MRN$

RPA$ RPA$

RPA$ BLM$ RPA$ EXO1$ DNA2$

Rad51$ BLM$ Rad51$

Rad51$

Branch$$ BLM$ Migra?on$

Crossover$ NonAcrossover$

Figure 4: Roles of BLM in homologous recombination mediated DNA repair. During HR, BLM participates in both pro- and anti-recombination functions. A DSB is detected by the MRN complex, allowing for the initial resection in conjunction with CtIP. The 3′ single stranded DNA (ssDNA) overhang are then bound by RPA. BLM, DNA2 and EXO1 perform further DNA resection. RPA is displaced by RAD51, a step that BLM can inhibit. The RAD51 filament facilitates a homology search and strand invasion of the homologous template (blue) forming a displacement (D)-loop. Here, BLM can resolve the D-loop structure. Double Holliday junctions (dHJ) form upon DNA synthesis. BLM promotes branch migration and dissolution of dHJs without crossover products in contrast to the formation of crossover products occurring by resolution.

BLM and DNA replication

The first evidence of a role for BLM in DNA replication was a decreased rate of

DNA chain growth in replicating BS dermal fibroblasts compared to normal control fibroblasts (Hand and German, 1975). BS cells are also hypersensitive to treatment with the DNA synthesis inhibitor hydroxyurea (HU), consistent with BLM functions in a protective manner against the toxicity associated with DNA replication arrest (Davies et al., 2004). In addition to a reduced replication fork velocity, BS cells commonly exhibit fork pausing (Rao et al., 2007). BLM localizes to stalled replication forks, suggesting

BLM functions in the repair and restart of stalled replication forks (Sengupta et al.,

2003). BLM promotes fork regression into a “chicken-foot” structure, on leading-strand stalled replication forks with a DNA gap ahead of the leading strand. This allows for replication to bypass the gap on the leading strand using the nascent lagging strand as a template to extend the leading strand. This is known as template switching and can lead to dJHs, a DNA structure BLM dissolves without creating crossover products. Recent work has shown that G4 motifs, another structure unwound preferentially by BLM, are enriched at the transcription start sites of differentially expressed mRNAs in BS cells compared with healthy control cells (Nguyen et al., 2014). This supports a new role for

BLM in gene regulation.

BLM and telomere maintenance

Telomeres are the repetitive DNA sequences found at the ends of chromosomes and are made up of TTAGGG repeats approximately 4 to 18 kilobases long. Due to the end-replication problem, telomeres prevent the loss of coding DNA in each cell division and prevent the recognition of blunt chromosome ends as DNA breaks. Telomeres form a cap-like structure, the t-loop, with a group of protective proteins, known as the shelterin complex, in order to hide the ends of chromosomes from recognition by the DNA break response machinery. Shelterin effectively “hides” the ends of every chromosome. The first evidence that BLM functions in telomere maintenance came from the observation of telomeric associations (TAs) between homologous chromosomes ends, yet normal telomere length, in BS patient cells (Lillard-Wetherell et al., 2004). This indicated that in the absence of BLM, normal telomere structure was compromised resulting in the association of telomeres. In cells lacking BLM, other telomere defects are observed, including telomere free ends and sister telomere loss. There is also an increase in telomere associations between homologous chromosome arms, most likely arising from entangled telomeres or unresolved replication intermediates (Lillard-Wetherell et al.,

2004, Barefield and Karlseder 2012).

BLM interacts with the telomere shelterin protein TRF2 exclusively in the telomerase-independent, alternative lengthening of telomere (ALT) mechanism of telomere elongation (Stavropoulos et al., 2002, Lillard-Wetherell et al., 2004). ALT uses a variety of telomeric substrates, instead of the enzyme telomerase, to elongate telomeres

16 via recombination; it is used in approximately 15% of all human tumors. Further studies from the Groden lab indicated that BLM also interacts with the telomere shelterin protein

TRF1 in ALT cells. Interestingly, TRF2 stimulates BLM helicase activity on a telomeric and non-telomeric substrate, while TRF1 inhibits BLM helicase activity only on telomeric substrates (Lillard-Wetherell et al., 2004). These data suggested that BLM is a member of an ALT-specific shelterin complex. The loss of BLM in immortalized cell lines that utilize ALT exhibit telomere shortening (Bhattacharyya et al., 2009). This suggested a model in which t-loops in cells using ALT undergo recombination in order to elongate their telomeres and that without BLM present, recombined telomeres are not resolved resulting in telomere shortening. TRF2 stimulates BLM on DNA telomeric substrates mimicking a t-loop (Lillard-Wetherell et al., 2004). Other DNA repair proteins, including BRCA1 and Rad50, are interaction partners of BLM in ALT cells and co-localize with BLM at ALT telomeres (Acharya et al., 2014). Barefield and Karlseder

(2012) subsequently showed that BLM contributes to normal telomere maintenance in all cells by resolving late-replicating intermediates (LRIs), which are visible as BLM- covered ultra-fine bridges (UFBs) arising from telomeric DNA.

BLM and chromosome segregation

Chromosome segregation occurs before cell division, as the replicated genome must be accurately segregated to ensure the continued growth of daughter cells. Sister chromatids, the products of DNA replication, are held together by cohesion, a multi-

17 protein complex. Errors occurring during chromosomal segregation can lead to the loss or gain of chromosomes or chromosome fragments in daughter cells. Micronuclei are present in high numbers in BS cells and in all cells lacking BLM expression (Rosin and

German 1985). Micronuclei contain centromeric fragments generated by DNA damage or errors in chromosome segregation. Faithful chromosome segregation is maintained in eukaryotes by a control mechanism, known as the cell cycle checkpoint or the mitotic or spindle assembly checkpoint (SAC). This checkpoint monitors the status of kinetochore- microtubule (K-MT) attachments and prevents anaphase until chromosomes are correctly aligned in metaphase. At anaphase onset, cohesion between sister chromatids is abruptly lost to initiate segregation. Even after the loss of cohesion, sister chromatids are held together by DNA catenates and hemicatenates. It has long been known that these complex DNA structures are decatenated by topoisomerase IIα (Holm et al., 1989). This role is vital for proper cell division and highlighted by the fact that in vivo genetic elimination of topoisomerase IIα results in mice not developing beyond the 4-8 cell stage

(Akimitsue et al., 2003).

Incompletely segregated chromosomal DNA that connects daughter nuclei can result in the formation of anaphase bridges. BLM suppresses the accumulation of anaphase bridges and binds to anaphase bridge DNA with topoisomerase IIIα and RMI1

(Chan et al., 2007). BS cells have high numbers of anaphase bridges and ultra-fine bridges (UFBs), a separate species of mitotic DNA bridges that are too fine to be identified by normal DNA staining methods and often connect centromeres (Baumann et al., 2007, Chan et al., 2007). UFBs appear as fine, thread-like structures and subsequently

18 are classified into three subtypes dependent on their chromosome “anchorage” origin

(telomere/T-UFB, centromere/C-UFB or fragile site/FS-UFB) (Liu et al., 2014). These subtypes also differ in the proteins that mark their ends. FANCD2/FANCI is found at ends of FS-UFBs, while HEC1, an outer kinetochore marker is found at C-UFBs (Naim and Rosselli 2009, Chan et al., 2007). The type of DNA structures found within UFBs is not well defined but may represent incompletely replicated DNA, hemicatenanes or catenanes. Four unique DNA structures have suggested to form anaphase bridges: (1) hemicatenanes arising during DNA replication, (2) catenanes, (3) unreplicated regions of the genome or replication termination zones and (4) single- and double-Holliday junctions arising from HR (Germann et al., 2014). In the G2/M cell cycle transition, sister chromatids are typically connected by hemicatenanes and are catenated at the centromere

(Lucas and Hyrien, 2000; Johnson et al., 2009). Topoisomerase IIα decatenates these structures, to resolve anaphase bridges or UFBs and prevent chromosome breakage and/or chromosome nondisjunction (Wang et al., 2010). PICH and BLM may collaborate to keep UFBs histone-negative, thus allowing topoisomerase IIα to bind and resolve these aberrant DNA structures (Ke et al., 2011). Simultaneously, BLM is capable of dissolving hemicatenates between sister chromatids to form non-crossover products (Chan et al.,

2009). Currently, little is known about the regulation of the BLM/topoisomerase IIα interactions at these structures or at other sites of damaged DNA. The BLM dissolvasome, also referred to as the BTR complex, includes BLM, topoisomerase IIIα,

RMI1 and RMI2, and is known to dissolve double-Holliday junctions arising from HR

(Yin et al., 2005).

In this thesis we show a decreased co-localization between topoisomerase IIα and a BLM phospho-mutant and an increased number of anaphase UFBs. We predict that the decreased interaction between BLM and topoisomerase IIα could contribute to the formation of anaphase UFBs. Our hypothesis is supported by the recent finding that BLM associates with topoisomerase IIα to drive chromosome separation by centromere disjunction and published work from our lab showing topoisomerase IIα directly interacts with BLM, stimulates its helicase activity and functions in a common pathway with BLM to prevent chromosome breakage (Rouzeau et al., 2012, Russell et al., 2011).

Cell cycle regulation and BLM localization

BLM localizes to the nucleus using a bipartite nuclear localization signal spanning amino acids 1334-1349 (Kaneko et al., 1997). Without DNA damage, BLM mainly localizes to punctuate nuclear bodies, known as promyelocytic leukemia protein

(PML) nuclear bodies, that contain man DNA repair proteins, such as topoisomerase IIIα, p53 and the Rad50 complex (RAD50/MRE11/NBS1), (Gharibyan and Youssoufian 1999,

Bischof et al., 2001). PML bodies are dynamic and thought to serve as a protein storage site. They also are responsible for the release of proteins following protein post- translational modifications and have been implicated in nearly every cellular process

(Bernardi and Pandolfi 2007). Following DNA damage, induced by DNA crosslinking agents, γ-irradiation or ultraviolet irradiation, BLM migrates from PML bodies to foci that are the sites of DNA damage and DNA repair. BLM can be found with other DNA

20 repair proteins including phosphorylated histone H2AX (γH2AX), the RAD50 complex,

RAD51, FANCD2 and BRCA1 (Davalos and Campisi 2003).

BLM localizes to specialized PML bodies known as ALT-associated PML bodies

(APBs) in cells using ALT as their telomere maintenance mechanism (Lillard-Wetherell et al., 2004). APBs contain normal PML body proteins in addition to telomeric DNA and may represent a site where recombination-associated telomere elongation occurs. There is a clear association between APBs and the utilization of ALT, instead of telomerase, to elongate telomeres. A precise role for BLM in APBs is currently unknown, but likely involves the resolution of t-loops to allow for recombination-mediated telomere elongation.

Nucleoli are non-membrane-bound organelles and serve as the site of RNA polymerase I-mediated ribosomal RNA (rRNA) transcription. Despite being non- membrane bound, not all nuclear proteins are found in nucleoli. BLM localizes to the nucleolus of the cell, where it unwinds complex rDNA structures to assist RNA polymerase I-mediated rRNA transcription (Grierson et al., 2011). Additionally, a 60- fold increase in the recombination rate of rDNA is observed in cytogenetic studies of BS cells, suggesting that BLM is required to maintain the stability of these genomic regions

(Therman et al., 1981).

BLM is highly expressed in S-phase of the cell cycle and its expression persists in

G2/M- phases but sharply declines in G1-phase (Dutertre et al., 2000). Recent data indicate that BLM is ubiquitinated by E3 ligase MIB1 and degraded in G1-phase but is

21 stabilized by a phosphorylation-dependent interaction with TopBP1 in S-phase (Wang et al., 2013).

BLM super-complexes

BLM is a member of a number of unique protein super-complexes: BASC,

BRAFT and the BLM dissolvasome. BASC (BRCA1-associated genome surveillance complex) includes BRCA1, a tumor suppressor vital for repair of double-stranded DNA breaks (Wang et al., 2000). In addition to BLM and BRCA1, BASC includes DNA damage repair proteins p53, MSH2, MSH6, MLH1, ATM and the RAD50-MRE11-NBS1 protein complex. DNA replication factor C (RFC), a protein complex that facilitates the loading of PCNA onto DNA, is also part of BASC. As all members of BASC have a role in the recognition and repair of damaged DNA, BASC is believed to serve as a DNA damage or abnormal DNA structure sensor.

BRAFT (BLM, RPA, FA, and Topoisomerase IIIα) is another super-complex containing BLM that also may participate in DNA repair (Meetei et al., 2003). Five of the

Fanconi anemia (FA) complementation group proteins are present in BRAFT. The loss of

FA produces a disease that is broadly similar to Bloom’s syndrome, with an increased risk of cancer and genomic instability. This suggests that a common DNA repair pathway may be perturbed in both disorders.

The BLM dissolvasome, also referred to as the BTR complex, includes BLM, topoisomerase IIIα, RMI1 and RMI2 (Yin et al., 2005). The BLM dissolvasome resolves

22 intertwined DNA intermediates without exchange of genetic material or “crossovers.”

This function is vital for somatic cells to prevent the “loss of heterozygosity” or “LOH” that is a major cancer mechanism. The BLM dissolvasome is recruited to double Holliday junctions (dHJs), a DNA structure found in normal double strand break DNA repair.

Here, the BLM dissolvasome can “dissolve” the structure, which prevents the creation of crossover products, in a process known as “dissolution” (Wu and Hickson, 2003).

Post-translation modifications of BLM

The regulation of BLM via post-translational modifications, including phosphorylation, SUMOylation and ubiquitination, is vital for specific BLM cellular functions and localization (Ouyang et al., 2013, Wang et al., 2013). SUMOylation refers to the small ubiquitin-related modifier. Unlike ubiquitination, SUMOylation does not promote the degradation of proteins but instead regulates a variety of protein properties include protein interactions, subcellular localization and transactivation functions of transcription factors. Mammalian cells express three SUMO paralogues, called SUMO-1,

SUMO-2 and SUMO-3. SUMO-2 and SUMO-3 are approximately 95% identical to each other. SUMOylation at a lysine of the substrate occurs through the sequential action of an

E1 activating enzyme, the E2 SUMO-conjugating enzyme Ubc9 and finally an E3 SUMO ligase. SUMOylation of BLM at K317 and K331 mediates the localization of BLM to

PML bodies (Eldad et al., 2005). Others have shown that BLM is preferentially modified by SUMO-2/3 both in vitro and in vivo (Zhu et al., 2008). Additionally, expression of a

23 non-SUMOylate-able BLM mutant in BLM-deficient cells causes HR-mediated repair defects including increases in γ-H2AX foci and HU-induced DSBs, decreased interaction with RAD51 and decreased recruitment of RAD52 and BRCA2 (Ouyang et al., 2013).

BLM SUMOylation controls the amount of BLM-RPA complex normally formed at stalled forks, despite not having an effect on BLM helicase activity.

As previously discussed, BLM is a cell cycle regulated protein low expression in

G1-phase and high expression in S-phase that persists in G2/M-phases (Dutertre et al.,

2000). A recent discovery identified a unique mechanism for BLM cell cycle-dependent expression, regulated by two opposing post-translational modifications: poly- ubiquitination and phosphorylation (Wang et al., 2013). Similar to SUMOylation, ubiquitination requires the action of three separate enzymes, including the ubiquitin- activating enzyme (E1), ubiquitin-conjugating enzyme (E2) and ubiquitin ligase (E3).

The poly-ubiquitination of BLM at K38, K39 and/or K40 by the ubiquitin E3 ligase MIBI signals for BLM degradation via the 26S proteasome in the G1-phase. However in S- phase BLM is stabilized through its interaction with TopBP1 via phosphorylation of

BLM at S338. The kinase responsible for this phosphorylation is currently unknown. In contrast to degradation of BLM signaled by poly-ubiquitination, mono-ubiquitination of

BLM relocalizes it from nucleoli to PML bodies (Tikoo et al., 2013).

Phosphorylation involves the addition of a phosphate group (PO4) to a protein serine, threonine or tyrosine and often acts as an on/off enzymatic switch. As indicated by slow-migrating forms of BLM on polyacrylamide gel analysis, it was discovered that

BLM is highly phosphorylated during mitosis (Dutertre et al., 2000). BLM threonine 99

24 and 122 are phosphorylated after replicative stress via the ATM/ATR pathway.

Phosphorylation of threonine 99 alters the interaction of BLM with topoisomerase III and

PML in vivo (Rao et al., 2005). Chk1 phosphorylation of BLM serine 646 decreases after

DNA damage to relocalize BLM to sites of DNA damage (Davies et al., 2004, Kaur et al., 2010). Additionally, phosphorylation of BLM at serine 144 by MPS1 plays a role during the spindle assembly checkpoint (SAC), vital for faithful chromosome segregation

(Leng et al., 2006). In the work presented here, we show that the global removal of phosphorylation via a phosphatase increases BLM helicase specific activity. We also have discovered a novel phosphosite cluster (S577/S579/S580) within the topoisomerase

IIα-interaction region of BLM. Mutation of this site and/or inhibition of Chk2 activity promotes DNA damage and the formation of micronuclei in vivo. In vitro phosphorylation of BLM by Chk2 rescues topoisomerase IIα stimulation of BLM helicase activity on a substrate mimicking a double-stranded DNA break.

P4122( ( P499( ( P4338( ( P4646( P4144( ( P4577/579/580( (

BLM$ SU4317( SU4331(

UB438/39/40( Helicase( RQC( HRDC( NLS(

Figure 5: Post-translational modifications of BLM. The four main domains of BLM and known identified post-translational modification sites. P: phosphorylation (black); SU: SUMOylation (red); UB:ubiquitination (blue).

BLM and topoisomerase IIα

The BLM and topoisomerase IIα orthologs in yeast, Sgs1 and Topo II respectively, were identified as interaction partners whose direct interaction is required for faithful chromosome segregation (Watt et al., 1995, Watt et al., 1996). The interaction between BLM and topoisomerase IIα within human cells is a relatively new discovery (Bhattacharyya et al., 2009).

Topoisomerase IIα is a type-2A topoisomerase that senses the catenation of sister chromatids following DNA replication (Kaufmann and Kies, 1998). The general

26 mechanism of action for type-2A topoisomerases includes the transportation of one DNA helix (transported-segment or T-segment) through a double-strand break in another (gate- segment or G-segment). In this model, topoisomerase IIα functions as a homodimer. The

G-segment DNA first binds to and is bent by topoisomerase IIα. Each strand of this DNA is then cleaved by one of a pair of tyrosines, at sites 4 nucleotides apart, forming two covalent, 5’ phosphotyrosine intermediates. Covalent bonding of topoisomerase IIα with the 5′ ends of the G-segment DNA occurs via phosphotyrosine linkages. This reaction intermediate, with topoisomerase IIα covalently linked to the cleaved G-segment DNA, is referred to as the cleavage complex. Dimerization of the N-terminal domains of topoisomerase IIα occurs by binding ATP to create a new protein-protein interface known as the N-gate. The N-gate encloses the T-segment DNA helix, then passed through the G-segment DNA. Topoisomerase IIα reverses the phosphotyrosine linkage with the 5’ of the G-segment DNA and rejoins the cleaved DNA. The T-product release resets topoisomerase IIα for additional reactions. (Reviewed in Bromberg et al., 2004).

Similar to BLM, topoisomerase IIα, but not the β isoform, is cell cycle-regulated with highest expression in G2/M cell cycle phases of proliferating cells (Prosperi et al.,

1994, Turley et al., 1997). The topoisomerase IIα interaction domain within BLM was mapped to amino acids 489-587 (Russell et al., 2011). This interaction is required for both physical interaction, which peaks in the G2/M cell cycle phases, and the stimulation of BLM helicase activity. BLM lacking the topoisomerase IIα interaction domain also fails to recover elevated chromosome breaks in cells without endogenous BLM, as measured by micronuclei. These data suggested that the physical interaction between

BLM and topoisomerase IIα was required for genomic stability in vivo. Recent work by

Rouzeau et al. (2012) has uncovered a relationship between BLM, PICH helicase and topoisomerase IIα in the centromeres decatenation process. In the absence of BLM, topoisomerase IIα fails to localize to the centromere resulting in a higher frequency of centromere nondisjunction due to the presence of anaphase UFBs. One hypothesis is that

BLM collaborates with the PICH helicase to resolve centromeric chromatin into UFBs and anaphase bridges and then the two proteins remain present on these thread-like structures, creating a nucleosome-free state of DNA (Ke et al., 2011). The presence of

BLM and PICH helicase allows the fragile DNA threads to travel extensive distances between segregating sister centromeres during anaphase without any breakage occurring.

This creates a spatiotemporal window for topoisomerase IIα to access and resolve DNA catenations on the UFBs or anaphase bridges.

BLM and checkpoint kinase 2 (Chk2)

The serine/threonine kinase Chk2 is a known regulator of DNA damage repair that activates the G2 checkpoint as well as other DNA repair proteins (Bartek et al.,

2003). Chk2 is expressed throughout the cell cycle but remains inactive in the absence of

DNA damage. It is activated mainly by ATM in response to DSBs and its activation requires dimerization and autophosphorylation (Lukas et al., 2001). Chk2 phosphorylates a number of downstream regulators, including p53 and the Cdc25 protein phosphatases

(Stracker et al., 2009). Cells lacking BLM display an activated DNA DSB checkpoint

28 response with high expression of phosphorylated histone H2AX, Chk2 and ATM (Rao et al., 2007). Chk2 phosphorylates the N-terminal 660 amino acids of BLM, using fragments of BLM and an in vitro kinase assay (Kaur et al., 2010). However, specific phosphorylation sites were never identified from this study (Kaur et al., 2010). The work presented in this thesis shows that Chk2 can rescue topoisomerase IIα-mediated stimulation of dephosphorylated-BLM. When serines 577, 579 and 580 of BLM are mutated to inhibit potential Chk2 phosphorylation, the rescue of topoisomerase IIα- mediated stimulation of dephosphorylated-BLM is abolished. This novel phospho-site cluster also reduces levels of DSBs upon Chk2 inhibition in transfected cells treated with

Chk2 inhibitor. These data suggest Chk2 is the key regulator of the interaction between

BLM and topoisomerase IIα and their function in maintaining low levels of chromosomal breakage.

Chapter 2: Thesis Rationale and Research Objectives

This thesis test the hypothesis that BLM phosphorylation controls its inherent helicase activity, functional interactions with topoisomerase IIα and regulation of chromosome breakage. Cells lacking BLM are characterized by high levels of genomic instability, including high numbers of sister chromatid exchanges, telomere associations and anaphase bridges. In humans, the loss of both BLM alleles causes the autosomal recessive disorder Bloom’s syndrome (BS). Patients with BS are predisposed to cancer at a rate much higher than the normal population, highlighting the importance of BLM in the regulation of genomic stability to prevent neoplastic transformation. The effects of

BLM on genome stability is dependent on its interactions with other DNA damage repair proteins, including topoisomerase IIα. BLM without the topoisomerase IIα interaction region fails to correct chromosome breakage as measured by micronuclei (Russell et al.,

2011). Understanding BLM regulation, by post-translation modifications, has uncovered a new mechanism by which BLM interacts with topoisomerase IIα and promotes genomic stability. Furthermore, inhibition of critical regulators, such as the Chk2 kinase, in the BLM/topoisomerase IIα pathway may be a novel approach to induce DNA damage in cancers to promote cell death.

BLM is expressed and phosphorylated in a cell cycle dependent manner, with highest levels of expression and phosphorylation in the G2/M phases of the cell cycle

(Dutertre et al., 2000, Wang et al., 2013). The ability of BLM to regulate genomic

30 stability via dissolution of aberrant DNA structures is dependent on its helicase activity.

Therefore, I used a biochemical approach to explore the role of phosphorylation on BLM helicase activity and used a DNA substrate that mimics a DNA double-strand break

(DSB). Published work from other laboratories has shown that BLM phosphorylation alters its ability to interact with its protein partners and respond to DNA damage (Wang et al., 2013, Davies et al., 2004, Kaur et al., 2010). Work from the Groden lab has shown that BLM interacts with topoisomerase IIα to increase its helicase activity and prevent chromosome breakage (Russell et al., 2011). My work tested the hypothesis that BLM phosphorylation regulates its functional interaction with topoisomerase IIα. My experiments tested changes in phosphorylation on the ability of topoisomerase IIα to stimulate BLM helicase activity in an in vitro protein-purified biochemical system. In silico phosphorylation prediction programs identified potential phosphorylation sites within the previously defined topoisomerase IIα interaction domain of BLM (amino acids

489-587) (Russell et al., 2011). Cellular and biochemical phenotypes of mutant BLM lacking phosphorylation at the identified sites were evaluated. The checkpoint kinase two

(Chk2) phosphorylates unidentified sites within the N-terminal 660 amino acids of BLM

(Kaur et al., 2010). My experiments evaluated how in vitro Chk2 phosphorylation of dephosphorylated BLM affected its helicase activity and its stimulation by topoisomerase

IIα. Biochemical and cytological approaches were used to test effects of Chk2 on wild- type and mutant BLM helicase activity and ability to alter levels of chromosome breakage.

Chapter 3: BLM phosphorylation status regulates its helicase activity and the ability

of topoisomerase IIα to mediate stimulation of helicase activity.

I. Introduction

Regulation of enzymatic activity and protein interactions by phosphorylation is a long-standing, yet on-going, field of study (Krebs and Fisher 1955, Fisher and Krebs

1955). Phosphorylation refers to the enzymatic post-translational transfer of a phosphate

3− (PO4 ) from a nucleotide triphosphate (usually ATP) to the hydroxyl groups of certain serines, threonines and tyrosines within a target protein. These reactions are catalyzed by proteins known as kinases, encoded by the fourth largest gene family in the human, with

518 genes (~1.75 of the human genome) (Manning et al., 2002). Phosphate groups add negative charges to target proteins and often change protein activity. For example, checkpoint kinase 1 (Chk1) phosphorylation of BLM serine 646 decreases after DNA damage to relocalize BLM to sites of DNA damage (Kaur et al., 2010). Phosphorylation of BLM threonine 99 alters its interaction with topoisomerase III and PML in vivo (Rao et al.,

2005). No studies have yet identified phosphorylation as a mechanism for the regulation of BLM helicase activity.

Phosphorylation is highly involved in various cellular processes including metabolism, protein synthesis, DNA repair, RNA/DNA synthesis, apoptosis, cellular division and cellular movement. Aberrant phosphorylation due to unregulated kinase activity is associated with a variety of human diseases including metabolic disorders, developmental disorders and certain cancers. A classic example is the BCR-ABL protein encoded by the translocation of the two genes on the Philadelphia chromosome, found in

90% of chronic myelogenous leukemia (CML) cases. Due to the unique fusion products in these CML cases, the ABL tyrosine kinase is constitutively active, allowing for unregulated cell growth leading to cancer. This discovery led to the design of the chemotherapeutic imatinib (Gleevec), a tyrosine-kinase inhibitor that targets BCR-ABL to stop cellular growth. Prior to Gleevec, CML five-year survival rate was about 30%.

Those numbers drastically improved with the addition of Gleevac as a treatment, with

89% of patients now surviving five years (Druker et al., 2001). As of 2009, there were 11

FDA-approved clinical kinase inhibitors, with many others in development (Zhang et al.,

2009).

Phosphorylation is a reversible reaction with protein phosphatases catalyzing the reverse reaction to remove phosphates. Human genome studies predict about 120 putative phosphatases, with 40% showing dual specificity for tyrosines and serine/threonine. In the cell, these processes are highly regulated and target specific amino acids within a target protein for phosphorylation or dephosphorylation. This specificity allows for fine- tuned control of pathways and cellular processes in response to the cellular environment or temporal changes.

Experimentally, global dephosphorylation via phosphatase treatment of purified proteins to remove all phosphates is a good tool to examine the effects of phosphorylation on protein activity. For example, the helicase and exonuclease activities of Werner

(WRN), a member of the RecQ gene family to which BLM belongs, are enhanced following global serine and threonine dephosphorylation (Karmaker et al., 2002). Global dephosphorylation has also been tested to examine phosphorylation effects on BLM protein interactions. Lambda-protein phosphatase treatment of GST-immunoprecipitated protein extracts from human cells expressing GST-tagged BLM abolishes the interaction of BLM and topoisomerase II beta-binding protein 1 (TopBP1) (Wang et al., 2013).

Such studies of global dephosphorylation provide evidence of BLM regulation by phosphorylation and suggested further studies to identify specific regulatory phosphorylation sites. Our research group therefore examined BLM phosphorylation status and its effects BLM helicase activity. These studies used BLM purification from a

Saccharomyces cerevisiae protein-expression system.

No reports, prior to this have examined the effect of BLM phosphorylation on its helicase activity, although some have determined the abilities of other proteins to stimulate or decrease BLM helicase activity. RPA stimulates BLM helicase activity and increases its processivity on long tracts of DNA (> 250bp) (Walpita et al. 1999).

Telomeric structural proteins TRF1 and TRF2 decrease and stimulate respectively BLM unwinding of telomeric substrates in vitro (Lillard-Wetherell et al., 2004).

Topoisomerase IIα stimulates BLM helicase activity using DNA substrates mimicking early homologous recombination (HR) intermediates, including a 3’ overhang and bubble

34 substrate but was unable to stimulate BLM on a X-junction DNA substrate mimicking a late HR structure (Russell et al., 2011). DNA topoisomerase I stimulates BLM helicase activity 1.3-fold on an rDNA-like RNA/DNA duplex substrate modeling co- transcriptionally formed rRNA:rDNA hybrids (Grierson et al., 2012). Recent work from our laboratory shows that BRCA1 increases the helicase activity of BLM three-fold on a

DNA substrate modeling a forked structure composed of telomeric repeats (Acharya et al., 2014).

Here, my work demonstrates that BLM expressed and purified from

Saccharomyces cerevisiae is highly phosphorylated. Global dephosphorylation of BLM via phosphatase treatment in vitro, and confirmed by mobility shift, results in a two-fold enhancement of helicase activity compared to wild-type BLM using a DNA substrate that mimics a double-strand break. Topoisomerase IIα stimulates BLM helicase activity using

3’ overhang duplex DNA substrates (Russell et al., 2011). The physical interaction of

BLM and topoisomerase IIα is also required to repair chromosome breaks (Russell et al.,

2011). These findings led to the hypothesis that BLM phosphorylation regulates its functional interaction with topoisomerase IIα. My work shows that phosphatased-BLM is not stimulated in vitro by topoisomerase IIα nor are mutated alleles of BLM encoding altered serines within the topoisomerase IIα-interaction domain able to correct the high chromosome breakage of BLM-/- cells. My work also identifies one kinase that regulates modification of these serines by testing the hypothesis that kinases activated by double- strand DNA damage and elevated when chromosome breakage occurs, would rescue the topoisomerase IIα-mediated stimulation of phosphatased-BLM in in vitro

35 phosphorylation assays. Subsequently, we demonstrate that the checkpoint kinase 2

(Chk2) but not the checkpoint kinase 1 (Chk1) can rescue topoisomerase IIα-mediated stimulation of phosphatased-BLM helicase activity. ATM activates Chk2 when double- strand DNA breaks occur. We propose that Chk2 phosphorylates specific serines within the topoisomerase IIα interaction domain of BLM (489-587) and that these sites are vital for the functional interaction of topoisomerase IIα and BLM.

II. Materials and methods

Protein purification. The pYES-BLM expression vector (pJK1) was kindly provided by

Ian Hickson (University of Oxford, Oxford, UK). BLM was purified as previously described (Lillard-Wetherell et al., 2004; Grierson et al., 2013). Hexa-histidine (6X-His)- tagged BLM was overexpressed in Jel1 protease-deficient Saccharomyces cerevisiae.

Yeast were lysed at 20k psi using a French Press Cell Disrupter (Thermo); lysates were separated by ultracentrifugation at 65,000g for 1hr at 4°C. Cleared lysates were purified by FPLC using Ni-NTA Superflow (Qiagen), followed by Q-Sepharose (Sigma) and finally Heparin-Sepharose (GE Life Sciences). BLM purity was determined by 10%

SDS-PAGE and gels stained with SYPRO Ruby Protein Gel Stain (Sigma). Gels were analyzed using ImageQuant software as previously described.

Phosphatase treatment. Ten units of lambda phosphatase (NEB) and 200 ng wild-type

BLM were used in 20 µl reactions with supplied 1X NEB Buffer PMP and 10mM MgCl2.

Reactions were performed at 30°C for 30 minutes. Products were separated by 8% SDS-

PAGE and protein mobility shifts examined with Coomassie stain and immunoblot with anti-BLM (Bethyl A300-110A). Subsequent reactions performed were stopped with 5 mM sodium vanadate (NEB) and immediately used in helicase assays or Chk2/Chk1 kinase reactions.

Mass spectrometry in-gel digestion. Samples (3 untreated, 3 phosphatase-treated) were diluted 1:1 in loading buffer (19 parts 2x Laemmli buffer to 1 part beta-mercaptoethanol), boiled 5 min and separated using 15% SDS-PAGE. Gels were stained with Bio-Safe

Coomassie Brilliant Blue G-250 for 1 h. Bands were excised from de-stained gels; gel bands replicates were combined and minced. Samples were digested overnight in 100 mM ammonium bicarbonate solution plus 400 ng trypsin with shaking at 37 °C.

Digestions were quenched, peptides extracted from gel matrixes and dried by vacuum centrifugation.

Mass spectrometry LC-MS/MS analysis. Samples were injected into an UltiMate 3000

HPLC system and separated on a reverse phase C18 column at a flow rate of 2 µL/min.

Mobile phases A and B were solubilized in 0.1% v/v formic acid in HPLC-grade water and 0.1% formic acid in HPLC-grade acetonitrile, respectively. Mobile phase gradients were as follows: 2% B for 3 min, 2% to 40% in 37 min, 40% to 90% in 3 min, 90% B for

6 min, 90% to 2% in 1 min and 2% B for 10 min to equilibrate the column prior to the subsequent injection. An LTQ Orbitrap XL was used for mass analysis. The top five

37 abundance peptide ions in each scan were selected for collision-induced dissociation fragmentation. A tertiary MS scan was triggered by identification of neutral fragment loss corresponding to phosphate group loss.

Mass spectrometry data analysis. RAW files were converted to the mzXML format and searched with the MassMatrix search engine against the canonical human proteome.

Variable modifications included phosphorylation of S/T, phosphorylation of Y and oxidation of M. Enzyme specificity was set for trypsin with up to three missed cleavages.

Peptide mass tolerance was set at 25 ppm and fragment ion tolerance at 0.8 Da. Modified and unmodified peptide lists were manually curated from MassMatrix results files.

Helicase assays. Oligonucleotides were purchased from Invitrogen. Oligonucleotide sequences (5’– 3’ orientation) to compose 3’ overhang duplexes were:

DNA38: ATGAGAAGCAGCCGTATCAGGAAGAGGGAAAGGAAGAA

DNA68:TTCTTCCTTTCCCTCTTCCTGATACGGCTGCTTCTCATCTACAACGTGA

TCCGTCATGGTTCGGAGTG

32 DNA38 was P-end-labeled using polynucleotide kinase (PNK; NEB) according to manufacturer's instructions. 3’ overhang substrates were generated by heating to 95°C for

5 min and slow cooling to room temperature. Helicase assays were performed as previously described (Lillard-Wetherell et al., 2004). Topoisomerase IIα (Topogen) was used at equimolar concentrations. Helicase products were separated on 10% non- denaturing polyacrylamide gels, dried and analyzed using ImageQuant (GE LifeSciences)

38 software. Percentages of % DNA unwound were fitted to Michaelis-Menton kinetics using KaleidaGraph (Synergy) software.

Phosphorylation by Chk2/Chk1 in vitro. 100 ng of phosphatased BLM was used in 20 ul reactions with 1X kinase buffer (40 mM MOPS pH 7.5, 0.5 mM EDTA), 100 µM ATP or 5 µCi [γ-32P] ATP and 100 ng Chk2 or Chk1 (Active Motif) at 30°C for 30 minutes.

Proteins were separated using 8% SDS-PAGE and gel staining with Coomassie or dried, exposed to a phosphoscreen and analyzed using ImageQuant software to confirm incorporation of γP32-ATP on BLM. Cold reactions were subsequently used in helicase assays.

III. Results

BLM purified from S. cerevisiae is highly phosphorylated.

BLM is phosphorylated on multiple residues by different kinases following replication stress and during mitosis (Kaur et al., 2010, Davies et al., 2004). His-tagged human BLM was isolated using S. cerevisiae as a protein expression system and purified by fast-protein liquid chromatography (FPLC) over nickel, Heparin-sepharose and finally

Q-sepharose resins. Purified BLM was then treated with lambda protein phosphatase.

Lambda phosphate modifies phosphorylated serine, threonine and tyrosine residues.

Treatment with lambda phosphate is a common and effective method to remove most or all phosphatases in proteins, including post-purified BLM. Three samples of 39 phosphatased-BLM and wild-type BLM were in-gel digested and examined via LC-mass spectrometry. Five phosphorylated sites were identified in wild-type BLM (T41, T171,

S175, S328, S601). Only one of these sites remained phosphorylated after phosphatase treatment (S328). Coomassie blue-stained gels and anti-BLM western blots showed a protein mobility shift indicating the lower molecular weight of phosphatased-BLM (PP-

BLM) in comparison to BLM purified directly from yeast (Figure 6). These observations indicate that recombinant BLM, when expressed in yeast, contains phosphorylated residues that can be removed by lambda phosphatase.

Figure 6: BLM purified from S. cerevisiae is highly phosphorylated. A: Purified BLM was treated with lambda phosphatase (NEB) (PP-BLM). Products were separated using 8% SDS-PAGE and examined with Coomassie staining (right) and immunoblotting (left) with anti-BLM (Bethyl). PP-BLM migrates faster than BLM, shown by a protein mobility gel shift in both images. B: Purified BLM and phosphatased-BLM were examined for phosphorylation sites via LC-MS/MS. Identified peptides were listed with start and end amino acids positions. Phosphorylated S328 remained following phosphatase treatment.

Phosphatase treatment increases BLM helicase activity in vitro.

We next asked whether BLM phosphorylation regulates its helicase activity using

DNA unwinding assays with purified BLM protein treated with lambda phosphatase to remove phosphates (Figure 6). Both phosphatased-BLM and native-BLM (treated identically but in the absence of phosphatase) were tested for helicase activity using a

DNA duplex substrate containing a 3’-overhang to mimic a DNA break or chromosomal

41 fragment. An autoradiograph of a representative helicase gel shows migration of the released radiolabeled single strand of DNA from the duplex 3’ overhang substrate. We observed that, with time, there was a greater accumulation of single strand substrate with phosphatased-BLM than with native-BLM (Figure 7). Quantitation of the released single strand shows that phosphate removal from BLM via lambda-phosphatase treatment steadily increases the percent DNA unwound: 5.7% for BLM and 9.5% for PP-BLM at 3 minutes; and 23.2% for BLM and 41.1% for PP-BLM at 15 minutes) (Figure 8). These data suggest that global phosphorylation of BLM inhibits helicase activity in vitro.

Figure 7: Phosphatase-treatment of BLM increases BLM helicase activity. A: A representative image from a helicase assay with native BLM and phosphatased-BLM (PP-BLM) unwinding a 3’ overhang 38-68mer DNA substrate. DNA products were resolved using 10% non-denaturing PAGE. Native (N), double stranded DNA or heat denatured (H), single stranded DNA showed migration of released radiolabeled strand (black star). An autoradiograph of a time-course (0.5-15 minutes) helicase assay with 1nM BLM or 1nM PP-BLM. B: Quantitation of percent DNA unwound on a 3’ overhang substrate. Black boxes represent BLM unwinding, while black circles represent PP-BLM unwinding. Helicase assays were repeated at least 3 times. Error bars represent standard deviation.

BLM phosphorylation is required for topoisomerase IIα stimulation of helicase activity.

In humans, BLM interacts with topoisomerase IIα via amino acids 489-587 of

BLM (Russell et al., 2011). The interaction region is required for topoisomerase IIα- mediated stimulation of BLM helicase activity using DNA substrates representing early homologous recombination intermediates, including 3’ overhang and bubble substrates.

We tested whether BLM phosphorylation is required for topoisomerase IIα-mediated stimulation. Helicase assays were performed using a DNA duplex substrate containing a

3’-overhang to mimic a DNA break or chromosomal fragment. Reaction kinetics were monitored over 15 minutes. Both PP-BLM and native BLM (treated identically but in the absence of phosphatase) were used in helicase assays with or without equimolar topoisomerase IIα. Equimolar topoisomerase IIα stimulated BLM as shown previously

(Russell et al., 2011) but failed to stimulate phosphatased-BLM (Figure 8). At 15 minutes, wild-type BLM (black square) alone unwinds 18.6% of the substrate verses

BLM plus topoisomerase IIα (BLM+TOP2A, empty square) at 45.8%. In comparison, phosphatased-BLM (PP-BLM, black circle) alone unwinds 35.9% of the substrate in comparison to phosphatased-BLM plus topoisomerase IIα (PP-BLM+TOP2A, empty circle) at 37.6%. Phosphatased-BLM and phosphatased-BLM plus topoisomerase IIα exhibit identical reaction kinetics in contrast to native BLM that shows a steady increase in reaction rate in the presence of topoisomerase IIα (Figure 8). These observations are consistent with the conclusion that global phosphorylation of BLM is required for

44 topoisomerase IIα-mediated stimulation of unwinding a 3’ overhang DNA substrate

(Figure 8).

Figure 8: Phosphatase-treatment of BLM eliminates topoisomerase IIα-mediated stimulation of BLM helicase activity. A: A representative image from a helicase assay using 1nM BLM plus/minus 1nM TOP2A and 1nM PP-BLM plus/minus 1nM TOP2A to unwind a 3’ overhang 38-68mer DNA substrate. DNA products were resolved by 10% non-denaturing PAGE. Native (N), double stranded DNA or heat denatured (H), single stranded DNA showed migration of released radiolabeled strand (black star). continued 45

Figure 8 continued... An autoradiograph of a time-course (0.5-15 minutes) indicates the elimination of TOP2A-mediated stimulation following BLM dephosphorylation by phosphatase treatment (PP-BLM). B: Quantitation of the percent DNA unwound uisng a 3’ overhang substrate. Black boxes represent BLM unwinding, while black circles represent PP-BLM unwinding using data from Figure 1C. White boxes represents BLM + TOP2A, while white circles represent PP-BLM + TOP2A. Helicase assays were repeated 3 times. Error bars equal standard deviation.

Chk2 phosphorylation of phosphatased BLM recovers topoisomerase IIα-mediated stimulation of unwinding activity.

BLM phosphorylation is required for topoisomerase IIα-mediated stimulation of unwinding a 3’ overhang DNA substrate (Figure 8). Checkpoint kinase 2 (Chk2) is ubiquitously expressed throughout the cell cycle and is known to phosphorylate BLM

(Kaur et al., 2010). Chk2 is activated by ATM phosphorylation during DNA double- strand break (DSB) repair (Lukas et al., 2001). BLM is also phosphorylated by ATM in response to ionizing radiation, which induces DNA DSBs (Ababou et al., 2000). Chk2 has many downstream targets and functions at various cell cycle checkpoints (Stracker et al., 2009). Previous data have shown that Chk2 phosphorylates unidentified amino acids within the first 660 amino acids of BLM (Kaur et al., 2010). As the DNA substrates used in our helicase assay mimic a double-strand DNA break and chromosome breakage is suppressed by BLM-topoisomerase IIα interaction (Russell et al., 2011), we hypothesized that Chk2 may be regulating their interaction via BLM phosphorylation. Therefore, we examined the effects of Chk2 treatment on altering BLM helicase activity in vitro and its stimulation by topoisomerase IIα. We tested whether Chk2 phosphorylation of

46 phosphatased-BLM recovers helicase stimulation by topoisomerase IIα (Figure 9).

Phosphatased-BLM was incubated with recombinant Chk2 and ATP and tested in helicase assays. In vitro kinase assays were first performed to determine whether Chk2 was capable of phosphorylating phosphatased-BLM. Kinase reactions were performed using [γ-P32] ATP, 100 nanograms phosphatased-BLM and 100 nanograms Chk2 (Figure

9). Reactions were separated using 8% SDS-PAGE, dried, exposed to phosphoscreens and analyzed using ImageQuant software to confirm [γ-P32] ATP incorporation.

Radioactive signals demonstrate that Chk2 can phosphorylate phosphatased-BLM

(pBLM) and, as a control, auto-phosphorylates itself (pChk2) (Figure 9). A Coomassie- stained gel indicates slight protein mobility shifts of BLM, phosphatased-BLM and phosphatased-BLM incubated with Chk2 and ATP, providing additional evidence that

BLM is phosphorylated by Chk2. We next examined the effect of in vitro Chk2 phosphorylation of phosphatased-BLM on helicase activity and topoisomerase IIα- mediated stimulation of BLM helicase activity. Chk2 phosphorylation of phosphatased-

BLM (PP-BLM+CHK2, black circles) does not increase helicase activity; addition of topoisomerase IIα to Chk2-phosphorylated phosphatased-BLM (PP-

BLM+CHK2+TOP2A) increases unwinding (Figure 9). At three minutes, Chk2- phosphorylated phosphatased-BLM plus topoisomerase IIα (PP-BLM+CHK2+TOP2A) exhibits a two-fold increase compared to Chk2 phosphorylation of phosphatased-BLM

(PP-BLM+CHK2) alone, phosphatased-BLM (PP-BLM) and phosphatased-BLM plus topoisomerase IIα (PP-BLM+TOP2A) (61.8% compared to 37.0%, 32.9% and 37.3% respectively).

Despite being structurally unrelated, Chk2 functions in DNA damage repair and cell cycle regulation overlap with Chk1functions. We next asked whether Chk1 could recover topoisomerase IIα-mediated stimulation of phosphatased-BLM, similarly to Chk2

(Figure 9). Chk1 phosphorylation of BLM was unable to recover topoisomerase IIα- mediated stimulation of phosphatased-BLM (PP-BLM+CHK1+TOP2A) (Figure 10).

Chk1 phosphorylation of phosphatased-BLM (PP-BLM+CHK1) does increase BLM basal helicase activity.

Figure 9: Chk2 phosphorylation of phosphatased BLM (PP-BLM) rescues topoisomerase IIα-mediated stimulation of helicase activity. A: Purified BLM was treated with lambda phosphatase (NEB) (PP) for 5, 15, or 30 minutes. The 30 minute PP- BLM was then incubated with equimolar Chk2 and ATP for 30 minutes. Products were separated using 8% SDS-PAGE and examined by Coomassie staining. PP-BLM migrates faster than BLM as shown by a gel shift. Continued 49

Figure 9 continued... PP-BLM incubated with Chk2 exhibits modestly slower migration than PP-BLM, confirming Chk2 phosphorylation. B: A representative phosphoscreen image shows the products of Chk2 kinase assays with 100 ng PP-BLM, 100ng Chk2, and [γ-32P] ATP. Control reactions included a reaction without Chk2 (no kinase). C: Unwinding curves of 1 nM phosphatased BLM (PP-BLM), PP-C2A, PP-C2D plus or minus 1nM TOP2A and Chk2 kinase treatment. Filled triangles represent PP- BLM alone, while empty triangles represent PP-BLM + TOP2A (from Figure 7). Filled circles represent Chk2 phosphorylation of PP-BLM, while empty circles represent Chk2 phosphorylation of PP-BLM + TOP2A (from Figure 7). PP-BLM, PP-BLM + TOP2A, and PP-BLM + Chk2 demonstrate identical rates of unwinding of 3’ DNA duplexes. TOP2A stimulation is observed following Chk2 phosphorylation of PP-BLM only. Helicase assays were repeated 3 times with the means plotted and error bars representing ± SD.

Figure 10: Chk1 phosphorylation of phosphatased BLM (PP-BLM) does not rescue TOP2A-mediated stimulation of helicase activity. Purified BLM was treated with lambda phosphatase (NEB) (PP) and incubated with equimolar Chk1 and ATP for 30 minutes. Unwinding curves of 1 nM phosphatased BLM (PP-BLM) plus or minus 1nM TOP2A in addition to CHK2 kinase treatment. Filled circles represent PP- BLM alone, while empty circles represent PP-BLM + TOP2A. Filled triangles represent Chk1 phosphorylation of PP-BLM, while empty triangles represent Chk1 phosphorylation of PP-BLM + TOP2A. PP-BLM, PP-BLM + TOP2A, PP-BLM + Chk1 + TOP2A unwinding of 3’ DNA duplexes are identical.

IV. Discussion

Phosphorylation is an effective mechanism to control enzymatic function. Here, we show that phosphate removal from BLM purifed in S. cerevisiae increases BLM helicase activity, demonstrating that the overall phosphorylation status of BLM governs its ability to unwind DNA. Other studies have reported similar inhibitory effects of phosphorylation altering DNA helicase activity. For example, the replication initiation protein MCM is phosphorylated by cdk2/cyclinA to suppress its helicase activity (Ishimi et al., 2000). In contrast to BLM and MCM, phosphorylation of SV40 T antigen is required for double hexamer formation by enhancing its ability to unwind the SV40 origin of replication (Barbora et al., 2000). Phosphorylation-mediated regulation of helicase activity is dichotomous in nature, with examples of both enhancement and suppression of helicase activity following phosphorylation. The mechanism of how global de-phosphorylation of BLM enhances its helicase activity is unclear and thus became the subject of further investigation in this thesis. De-phosphorylated BLM is not stimulated by topoisomerase IIα, in contrast to wild-type phosphorylated BLM with a two-fold increase in activity with topoisomerase IIα (Figure 8).

DNA damage in the form of double-strand breaks activates Chk2 by ATM phosphorylation of Chk2 threonine-68. Chk2 homodimerization by trans-phosphorylation of Chk2 threonine-383 and -387 allows for full activation of the kinase. Once activated,

Chk2 phosphorylates several key substrates, including serine 20 of p53, serines 123,178 and 292 of Cdc25A, serine 216 of Cdc25C and serine 988 of BRCA1. These phosphorylation events result in cell cycle delay in either G1 or G2, activation of DNA

52 repair mechanisms or, if needed, apoptosis (reviewed in Stolz et al., 2011). Chk2 recovery of, but not that of Chk1, topoisomerase IIα-mediated stimulation of phosphatased-BLM helicase activity indicates that BLM may also be an in vivo downstream substrate of Chk2 and that post-translation modification of BLM by Chk2 regulates its interaction with topoisomerase IIα to repair damaged DNA. BLM interactions with DNA topoisomerase IIα modify BLM helicase activity in vitro using unique nucleic acid substrates that mimic early recombination substrates. (Russell et al.,

2011). Chk2 regulation of these processes would allow for additional processes to promote topoisomerase IIα-mediated stimulation of BLM helicase activity following sensing of DNA damage.

Chapter 4: Phosphosite cluster 577/579/580 of BLM regulates its functional

interactions with topoisomerase IIα and repair of chromosome breakage.

I. Introduction

Loss of function of the BLM helicase is responsible for the autosomal recessive chromosome breakage disorder Bloom’s syndrome (BS) (Ellis et al., 1995). Clinical characteristics of BS invariably include short stature, male infertility and an increased risk of cancer (German, 1997). Cells without BLM are characterized by increased sister chromatid exchange and chromosome breakage, observed directly or measured by micronuclei formation. The BLM helicase is an ATP-dependent, 3’-5’ structure-specific

RecQ-like helicase vital for DNA repair (Karow et al., 1997). BLM is required for the maintenance of genomic stability most likely through its participation in homologous recombination and non-homologous end joining (Chu and Hickson 2009, Langland et al.,

2002). BLM interacts with a variety of DNA repair protein partners, including BRCA1, p53 and MLH1 (Pedrazzi et al., 2001, Wang et al., 2000, Langland et al., 2002, Wang et al., 2001, Acharya et al., 2014).

BLM interacts directly with members of both type 1 and type II topoisomerases, including topoisomerase I, topoisomerase IIα and topoisomerase III (Wu et al., 2000,

Grierson et al., 2012, 2013, Russell et al., 2011). Topoisomerases catalyze the passage of

DNA strands through transient breaks in other DNA strands, thus regulating DNA topology within the cell. The topoisomerase IIα-interaction region of BLM maps to

54 amino acids 489-587 (Russell et al., 2011); this interaction is required for the correction of chromosome breakage as measured by micronuclei in cell lines lacking BLM.

Additionally, topoisomerase IIα stimulates BLM helicase activity in vitro two-fold using

DNA substrates mimicking early homologous recombination structures (Russell et al.,

2011). Work by others has identified a role for BLM and the PICH helicase in resolving centromeric chromatin concatenation and the recruitment of active topoisomerase IIα to the centromere (Rouzeau et al., 2012). Excessive numbers of anaphase bridges and lagging chromosomes in cell lines without BLM suggest a reduced or dysfunctional localization of topoisomerase IIα at the centromere during mitosis (Payne and Hickson,

2009).

BLM regulation by post-translational modification is vital for specific BLM cellular functions and localization (Ouyang et al., 2013, Wang et al., 2013). BLM threonine 99 and 122 are phosphorylated following replicative stress, while Chk1 phosphorylation of BLM serine 646 decreases following DNA damage to relocalize BLM to sites of DNA damage (Davies et al., 2004, Kaur et al., 2010). Phosphorylation of threonine 99 alters the interaction of BLM with topoisomerase III and PML in vivo (Rao et al., 2005). In the previous chapter, we show that the global phosphorylation status of

BLM affects stimulation by topoisomerase IIα. When BLM is dephosphorylated by phosphatase treatment, topoisomerase IIα is unable to increase the ability of BLM to unwind DNA in comparison to wild-type, phosphorylated BLM (Figure 8). However, in vitro phosphorylation by Chk2, but not Chk1, rescues the ability of topoisomerase IIα to stimulate phosphatased-BLM. These data suggested that Chk2 may be phosphorylating

55 specific BLM resides that control the functional interaction between BLM and topoisomerase IIα. In experiments presented in Chapter 4, we test the hypothesis that specific phosphorylation sites regulate the interaction and/or localization of BLM and topoisomerase IIα, and its subsequent function in the regulation of chromosome breakage.

In silico prediction programs identified 15 putative phosphorylation sites within the topoisomerase IIα interaction region of BLM (489-587). Computational analysis identified high scoring sites grouped into two clusters: cluster 1 (C1) (S517/S518) and cluster 2 (C2) (S577/S579/S580). Mutagenesis of these clustered serines to alanine

(BLMC1A, BLMC2A) or the phospho-mimic, aspartate (BLMC1D, BLMC2D) permitted testing of their ability to regulate the interaction of BLM with topoisomerase

IIα and BLM functions in chromosome breakage. Our findings support a role for BLM phosphorylation of serines 577, 579 and 580 by Chk2 that control its interaction with topoisomerase IIα and its ability to repair chromosome breakage.

II. Materials and methods

In silico phosphorylation prediction. Phosphorylation sites, conservation of sites and relative solvent accessibility (RSA) values were predicted using the following six online prediction programs:

KinasePhos2.0: http://kinasephos2.mbc.nctu.edu.tw

PSPP: http://ppsp.biocuckoo.org/aboutPPSP.php

NetPhos2.0: http://www.cbs.dtu.dk/services/NetPhos/

Phosida: http://www.phosida.com

SABLE for RSA values: http://sable.cchmc.org/sable_doc.html

COBALT for conservation: http://www.ncbi.nlm.nih.gov/tools/cobalt/

Cell lines and tissue culture. GM08505 cells (BLM-/-) were obtained from Coriell Cell

Repository and cultured in Minimum Essential Medium (Invitrogen) containing 10% fetal bovine serum (Hyclone). All cells were cultured at 37°C and 5% CO2.

Cloning. Phospho-mutations were created by overlapping PCR in the pJK1 vector. 5’ mutant primers (BLMC2A through 577D) were used with 3’ 3884-3913 primer. 5’ 1838-

1859 and 3’ 2351-2377 were used in another reaction. Products from both reactions were gel-purified (Qiagen) and added to an overlapping PCR in a 10 to 1 ratio. Primers used in the overlapping PCR were Lower 3884-1859 and Upper 1838-1859. Primers (5’-3’) used were:

BLMC1A: AATGAAGACGATTATTTCCCAGGAAATGTTCTCAC

BLMC1D: AATGAAGCCGCTTATTTCCCAGGAAATGTTC

BLMC2A: GCCGCCAAAGCTGCCACAGCTGCCTATCAACCC

BLMC2D: TAGCAGCCGACAAAGATGACACAGCTGCCTATCAACCC

577A: TTTAGCAGCCGCCAAATCTTC

577D: TTTAGCAGCCGACAAATCTTC

579A: CTG TGG AAG CTT TGG CGG CTG

579D: CTG TGG AAT CTT TGT CGG CTG

581A: CAAATCTTCCGCAGCTGCCTATC

581D: CAAATCTTCCGACGCTGCCTATC

3884-3913: GCACTCTTAC TCCCCAAGAA AATGTCGACC

1838-1859: TGATTCACTTGATGGCCCTATGGAGG

2351-2377: GATGACACTG GAAGACAGTC TGTCTTGGC

Each insert and pJK1 were digested by EcoRI-HF and SalI-HF at 37°C for 2 hours. T4 ligase (NEB) was used to ligate vectors and inserts per manufacturers’ instructions.

Ligation reactions were transformed into DH5α-competent cells. Sequencing at The Ohio

State University Nucleic Acids Shared Resource confirmed mutations and accurate sequences in each plasmid. Inserts were cloned from pJK1 into eGFP-BLM by digestion with EcoRI and PvuI and ligated as described above. Additional phospho-mutations

(580A, 580D, 577A/579A, 577D/579D, 577A/580A, 577D/580D, 579A/580A, and

579D/580D) were created by overlapping PCR in the pEGFP-BLM vector with Phusion

High-Fidelity DNA Polymerase (NEB). 3’ internal primers were used with the 5’ external

58 primer, and 5’ internal primers were used with the 3’ external primer. Products from both reactions were gel-purified (Qiagen) and added to an overlapping PCR with the 5’ external and 3’ external primers in a 1 to 1 ratio. Primers (5’-3’) used were:

5’ external primer: CCT GCC CTA CAG GGA ATT CTA TG

3’ external primer: TCA CAT AAG CGA TCG CCT GG

3’ internal primer 580A: GCA GCT GTG GCA GAT TTG CT

5’ internal primer 580A: AGC AAA TCT GCC ACA GCT GC

3’ internal primer 580D: GGC AGC TGT GTC AGA TTT GCT

5’ internal primer 580D: AGC AAA TCT GAC ACA GCT GCC

3’ internal 577/579A: CTG TGG AAG CTT TGG CGG CTG

5’ internal 577/579A: CAG CCG CCA AAG CTT CCA CAG

3’ internal 577/579D: CTG TGG AAT CTT TGT CGG CTG

5’ internal 577/579D: CAG CCG ACA AAG ATT CCA CAG

3’ internal 577/580A: CTG TGG CAG ATT TGG CGG CTG

5’ internal 577/580A: CAG CCG CCA AAT CTG CCA CAG

3’ internal 577/580D: CTG TGT CAG ATT TGT CGG CTG

5’ internal 577/580D: CAG CCG ACA AAT CTG ACA CAG

3’ internal 579/580A: CTG TGG CAG CTT TGC TGG CTG

5’ internal 579/580A: CAG CCA GCA AAG CTG CCA CAG

3’ internal 579/580D: CTG TGT CAT CTT TGC TGG CTG

5’ internal 579/580D: CAG CCA GCA AAG ATG ACA CAG

Inserts and pEGFP-BLM were digested by EcoRI-HF and AsiSI at 37°C for 1 hour and gel-purified (Qiagen). T4 ligase (NEB) was used to ligate vectors and inserts per manufacturers’ instructions. Ligation reactions were transformed into DH5α-competent cells. Sequencing at The Ohio State University Nucleic Acids Shared Resource confirmed mutations and accurate sequences in each plasmid.

Co-localization studies. GM08505 cells (BLM-/-) were grown on glass coverslips

(Fisher), washed in PBS and fixed in 4% paraformaldehyde for 15 minutes at room temperature. Cells were permeabilized in 0.25% Triton-x-100 in PBS and washed before blocking in 10% normal goat serum and subsequent staining with the indicated antibodies in 1% BSA/0.1 % Tween/PBS: 1:1000 anti-B23 (Sigma B0556), 1:1000 anti-PML

(Abcam 53773) or 1:1500 anti-TOP2A (Topogen TG2011-1). Cells were washed in

0.1% Tween/PBS; primary antibodies were visualized with fluorescent AlexaFluor

(Invitrogen) secondary antibodies. Coverslips were mounted with VectaShield DAPI mounting medium (Vector Labs) onto glass slides (Fisher). Cells were imaged using a

Zeiss AxioVert 200M with an attached AxioCam MRm camera. Fifty cells from each of two independent and blinded experiments were counted for co-localization. Data were analyzed using Student’s T-test. P-values less than an alpha of 0.05 were considered significant.

Protein purification. The pYES-BLM expression vector (pJK1) used in site-directed mutagenesis was kindly provided by Ian Hickson (University of Oxford, Oxford, UK).

BLM phospho-mutants were purified as previously described for wild-type BLM.

(Lillard-Wetherell et al., 2004; Grierson et al., 2013). Hexa-histidine (6X-His)-tagged

BLM was overexpressed in Jel1 protease-deficient Saccharomyces cerevisiae. Yeast were lysed at 20k psi using a French Press Cell Disrupter (Thermo) and lysates were separated by ultracentrifugation at 65,000g for 1hr at 4°C. Cleared lysates were purified by FPLC using Ni-NTA Superflow (Qiagen), followed by Q-Sepharose (Sigma) and finally Heparin-Sepharose (GE Life Sciences). BLM purity was determined by 10%

SDS-PAGE and staining of gels with SYPRO Ruby Protein Gel Stain (Sigma). Gels were analyzed using ImageQuant software as previously described.

Cell cycle analysis. GM08505 cells (BLM-/-) were treated with 2mM thymidine (Sigma) for 18 hours. Cells were washed with PBS and fresh media added for 9 hours. 2mM thymidine was added for 17 hours. Cells were then washed with PBS and collected at 4 hours for G1/S-phase or 11 hours for M-phase. M-phase samples were treated with

40ng/µl colcemid (Sigma) 6 hours prior to collection. Cytokinesis samples were treated with 5µg/mL cytochalasin B (Sigma.)

Micronuclei analysis. GM08505 cells (BLM-/-) were transfected with Effectene (Qiagen) and treated 30 hours post transfection with 5 µg/mL cytochalasin B (Sigma). At 48 hours post-transfection, cells were fixed in 4% paraformaldehyde, permeabilized in 0.25%

Triton-x-100 in PBS and washed before blocking in 10% normal goat serum and subsequent staining with 1:800 anti β-tubulin (Novus) in 1% BSA/0.1% Tween/PBS.

Cells were mounted with VectaShield DAPI mounting medium (Vector Labs) onto glass sides (Fisher). Cells were imaged using a Zeiss AxioVert 200M with an attached

AxioCam MRm camera. One hundred cells from three independent and blinded experiments were counted for micronuclei. ANOVA was used to analyze significance for micronuclei assays by comparing each treatment group to the control. P-values less than an alpha of 0.05 were considered significant.

Ultra-fine bridge analysis. GM08505 cells (BLM-/-) were transfected with Effectene

(Qiagen) and cultured for 24 hours. At 24 hours, cells were treated with 0.1µg/ml nocodazole (Sigma) for 3 hours and incubated in fresh medium for 1 hour. Cells were fixed in 4% paraformaldehyde for 15 minutes at room temperature, permeabilized in

0.25% Triton-X-100 in PBS and washed before blocking in 10% normal goat serum and subsequent staining with the indicated antibodies in 1% BSA/0.1% Tween/PBS: 1:1000 anti-GFP (Abcam 290) overnight. Nontransfected cells were treated in the same manner but stained with 1:1500 anti-TOP2A (Topogen TG2011-1) overnight. Primary antibodies were visualized with fluorescent AlexaFluor (Invitrogen) secondary antibodies. Cells were mounted with VectaShield DAPI mounting medium (Vector Labs) onto glass sides

(Fisher) and imaged using a Zeiss AxioVert 200M with an attached AxioCam MRm camera or Olympus Fluoview 1200 with FV-OSRASW software for confocal images.

Fifty GFP-positive cells from each of two independent and blinded experiments were counted. Data were analyzed using Student’s t-test. P-values < 0.05 were considered significant.

In vitro immunoprecipitation. 200 ng of BLM or BLM phospho-mutant protein was incubated with an equal amount of topoisomerase IIα (Topogen) in Buffer Z+ (25mM

HEPES pH 7.9, 50mM KCl, 10mM MgCl2 , 150mM NaCl, 1mM EGTA, 1mM NaF,

0.1% NP-40, 0.1% Trition X-100) for 2 hours rotating at 4°C. Rabbit anti-BLM (Bethyl

A300-110A) was added after 2 hours and incubated at 4°C overnight. Protein A/G beads were added for 4 hours at 4°C. Proteins were separated using 8% SDS-PAGE and transferred overnight. Immunoblotting used goat anti-BLM (Bethyl A300-120A) or mouse anti-TOP2A (Calbiochem SWT3D1). Secondary antibodies were used at 1:10,000

(Jackson ImmunoResearch).

Helicase assays. Oligonucleotides were purchased from Invitrogen. Oligonucleotide sequences (5’– 3’ orientation) are:

DNA38: ATGAGAAGCAGCCGTATCAGGAAGAGGGAAAGGAAGAA

DNA68:TTCTTCCTTTCCCTCTTCCTGATACGGCTGCTTCTCATCTACAACGTGA

TCCGTCATGGTTCGGAGTG

32 DNA38 was P-end-labeled using polynucleotide kinase (PNK; NEB) according to manufacturer's instructions. 3’ overhang substrates was generated by heating to 95°C for

5 min and slow cooling to room temperature. Helicase assays were performed as previously described (Lillard-Wetherell et al., 2004). Topoisomerase IIα (Topogen) was used at equimolar concentrations. Helicase products were separated using 10% non- denaturing polyacrylamide gels, dried and analyzed by ImageQuant (GE LifeSciences) 63 software. Percentages of % DNA unwound were fitted to Michaelis-Menton kinetics using KaleidaGraph (Synergy) software.

Chk2 phosphorylation in vitro. 100 ng of phosphatased BLM, BLMC2A or BLMC2D were used in 20 ul reactions with 1X kinase buffer (40 mM MOPS pH 7.5, 0.5 mM

EDTA), 100 µM ATP and 100 ng Chk2 (Active Motif) at 30°C for 30 minutes. Reactions were subsequently used in helicase assays.

Chk2 inhibition. GM08505 cells (BLM-/-) were transfected with Effectene (Qiagen) and expression of transfected vectors confirmed by microscopy of GFP. 45 hours post- transfection cells were treated with 5µM Chk2 inhibitor (Calbiochem, CAS 516480-79-8) or DMSO for 3 hours prior to cell collection. Inhibition was confirmed via immunoblot using anti-Chk2-S516 (Cell Signaling, 2669S), anti-Chk2 (Santa Cruz, sc8813) or

RPA194 (Santa Cruz, sc48385) as a loading control.

Comet assays. Neutral comet assays were performed using the CometAssay kit

(Trevigen) as previously described (Saldivar et al., 2012). Expression of all transfected vectors was confirmed by microscopy of GFP. Micrographs were acquired using a Zeiss

AxioVert 200M with an attached AxioCam MRm camera. Comet tail moments were scored using Comet Score 1.5 (TriTek). Non-parametric data were analyzed using the

Kruskal-Wallis test for multiple comparisons. P-values less than an alpha of 0.05 were considered significant. 64

III. Results

In silico phosphorylation programs predict 15 putative sites within the topoisomerase IIα interaction region of BLM.

Previous experiments were performed with globally de-phosphorylated BLM.

We next asked whether specific amino acids within the interaction domain regulate the phosphorylation-dependent interaction and stimulation of BLM by topoisomerase IIα.

Putative phosphorylation sites in the BLM/topoisomerase IIα interaction domain (498-

587) were identified using four different phosphorylation site prediction programs:

KinasePhos 2.0, NetPhos 2.0, Phosida and PPSP. Fifteen putative phosphorylation sites within the topoisomerase IIα interaction domain of BLM were identified (Figure 11,

Keirsey, 2012). The relevant solubility accessibility (RSA) and conservation of each site was examined using SABLE and COBALT, respectively. The RSA takes into account how accessible a site is to a potential kinase, while phosphorylation sites that are vital for protein function usually show conservation in different species. Additional analysis revealed five single sites, clustered into two groups within the interaction region, with the highest likelihood of being phosphorylated. Grouping of these high-scoring sites made two clusters: cluster one (C1, S517/S518) and cluster two (C2, S577/S579/S580). In vitro mutagenesis of BLM was then used to mutate serines to alanine for phospho-dead

(BLMC1A, BLMC2A) or aspartate (BLMC1D, BLMC2D) for phospho-mimic versions of each cluster. Phospho-mutant versions of BLM were generated either by mimicking a

65 phosphorylated amino acid by replacing the respective serines with a negatively charged aspartate acid or by mutating it to a non-phoshorylatable amino acid alanine. These mutants were then used to generate pairs of mammalian expression vectors representing a constitutively phosphorylated or dephosphorylated cluster mutant tagged with GFP and yeast expression vectors, for cytological analyses and protein production respectively.

Figure 11: Putative BLM phosphorylation sites in the topoisomerase IIα interaction region. 1: Putative phosphorylation sites (bold) and the surrounding sequence. 2: Checkmark indicates sites predicted by Phosida with the following settings: precision (pS/T)=95%, recall (pS)=81%, recall (pT)=43%. 3: NetPhos 2.0 prediction scores with scores closest to 1.0 indicate the greatest chance of being phosphorylated. 4: PSPP predicted sites with the putative kinases indicated DDR=DNA damage-response kinases ATM/ATR/DNA-PK. 5: KinasePhos 2.0 prediction scores with scores closest to 1.0 indicate the greatest chance of being phosphorylated.

Continued 67

Figure 11 continued... 6: Relative solvent accessibility (RSA) scores from SABLE secondary structure; a 0-9 scale with 9 indicating residues fully exposed and 0 indicating residues completely buried. 7: Evolutionary conservation of the phosphorylation site; C=chimp, Pan troglodytes, B=cow, Bos taurus, P=pig, Sus scrofa domesticus, M=mouse, Mus musculus, D=fruit fly, Drosophila melanogaster, X=frog, Xenopus laevis, S=budding yeast, Saccharomyces cerevisiae, p=fission yeast, Schizosaccharomyces pombe. Cluster one (S517 and S518) and Cluster two (S579, S580, and S581) are highlighted by bold letters. Domain structure and topoisomerase IIα (TOP2A) interaction region (489-587), helicase domain, RQC=RecQ family domain and HRDC=Helicase- and-RNase-D-C-terminal (HRDC) domain are identified. Expanded TOP2A domain illustrates BLMC1A, BLMC1D, BLMC2A and BLMC2D phospho-mutants used in forthcoming assays.

Phosphorylation of BLM C2 (S577/S579/S580) is required for correction of elevated chromosome breakage.

The interaction of BLM and topoisomerase IIα is required to correct the elevated chromosome breakage characteristic of cells without the BLM helicase (Russell et al.,

2011). BLM lacking the topoisomerase IIα interaction region (Δ489-587) fails to reduce the number of micronuclei in the BLM-negative cell line GM08505. Micronuclei arise from improper chromosome segregation or unrepaired DNA double-stranded breaks that fail to be included in daughter nuclei during mitosis (Bonassi et al., 2007). During telophase, the lagging chromosome fragment recruits its own nuclear envelope to form a separate compartment from daughter nuclei. Micronuclei are strongly correlated with mitotic errors, and therefore an accurate indicator of genomic instability and aneuploidy

(Fenech, 2007). The micronuclei assay is one of the most sensitive methods for detecting cellular chromosome damage and numerous reports have shown high levels of micronuclei in cells from patients with Bloom’s syndrome (BS), the autosomal recessive 68 disorder caused by the mutation of BLM (Rosin and German 1985, Froath et al., 1984,

Russell et al., 2011, Naim and Rosselli 2009). Re-expression of BLM, for as little as 48 hours, can reduce the number of micronuclei present in BS cell lines (Russell et al.,

2011). Cluster mutants were tested for their ability to recover the elevated number of micronuclei in GM08505 (BLM-/-) cells. Cell were transfected with pEGFP-empty, pEGFP-BLM, pEGFP-BLMD795A (helicase-dead mutant), pEGFP-BLMΔ489-587, pEGFP-BLMC1A, pEGFP-BLMC1D, pEGFP-BLMC2A or pEGFP-BLMC2D, and then fixed and examined for the presence of micronuclei. Transfection of wild-type BLM significantly reduces the percentage of cells containing micronuclei from 67.3% to 48.5%

(Figure 12). Cells transfected with pEGFP-empty, pEGFP-BLMD795A or pEGFP-

BLMΔ489-587 display a high number of cells with at least one micronucleus (67.3%).

Cells transfected with vectors expressing mutated cluster 1 (S517/S518) to either alanine

(BLMC1A) or aspartate (BLMC1D) exhibit recovery comparable to wild-type BLM

(54.0%, 53.3%, respectively). Cells transfected with vectors expressing mutated cluster 2

(S577/S579/S580) show a phosphorylation-dependent recovery only with the phospho- mimic BLMC2D trending toward a wild-type BLM recovery (53.8% compared to

48.5%). In comparison, the phospho-dead BLMC2A fails to reduce significantly the percentage of cells with micronuclei (66.3%, p=0.0239). Single mutants of each site within this phosphosite cluster (577A/D, 579A/D, 580A/D) behave similarly to wild-type

BLM, as do double mutants (577/579A, 577/580A, 579/580A) (Figure 13).

Serine 581 was also identified as a potential phosphorylation site by the in silico prediction programs (Figure 11). Interestingly, this site is four amino acids C-terminal to

69 serine 577, a site predicted to be regulated by GSK3, defining serine 581 as a potential pre-phosphorylation priming site (Cohen and Frame, 2001). Micronuclei studies with pEGFP-BLM577A, pEGFP-BLM577D, pEGFP-BLM581A and pEGFP-BLM581D did not lower chromosome breakage (Figure 13). These data also confirm that the three serines within cluster 2 play a critical role in micronuclei recovery and that phosphorylation of three serines is the likely modulator of this recovery.

Figure 12: Phosphorylation of BLM C2 (S577/S579/S580) is required for correction of chromosome breakage in BLM-/- cells. A: GMO8505 (BLM-/-) cells were transfected with pEGFP-empty, pEGFP-BLM, pEGFP-D795A, pEGFP-BLMΔ489-587, pEGFP- BLMC2D, pEGFP-BLMC2A, pEGFP-BLMC1D or pEGFP-BLMC1A vectors. Post- transfection, cells were treated with cytochalasin B to arrest binucleated cells in mitosis. Eighteen hours post-cytochalasin B treatment, cells were fixed and stained with anti-β- tubulin and DAPI for nuclear staining. White arrows point to three micronuclei. White dotted lines indicate cell boundaries. Scale bar (white) is 10µm. B: Percentages represent the average number of MNi counted per 100 cells. Four independent experiments resulted in at least 400 cells counted per vector group. pEGFP-empty, pEGFP-D795A, pEGFP-BLMΔ489-587 and pEGFP-BLMC2A failed to reduce MNi frequency significantly compared to pEGFP-BLM. Data were analyzed by ANOVA, * p<0.05 was considered significant. GFP=0.0113 C2A= 0.0239 D795A=0.0130 Δ489-587=0.0147

Figure 13: All three serines within BLM C2 (S577/S579/S580) are required for correction of chromosome breakage in BLM-/- cells. GMO8505 (BLM-/-) cells were transfected with pEGFP-empty, pEGFP-BLM, pEGFP-D795A, pEGFP-BLMΔ489-587, pEGFP-C2D, pEGFP-C2A, pEGFP-C1D, pEGFP-C1A, pEGFP-577D, pEGFP-577A, pEGFP-579A, pEGFP-579D, pEGFP-580A, pEGFP-580D, pEGFP-581D, pEGFP- 581D, pEGFP-577/579A, pEGFP-577/580A or pEGFP-579/580A vectors. Post- transfection, cells were treated with cytochalasin B to arrest binucleated cells in mitosis. Eighteen hours post-cytochalasin B treatment, cells were fixed and stained with anti-β- tubulin and DAPI for nuclear staining. Percentages represent the average number of MNi counted per 100 cells (controls from Figure 12). Three independent experiments resulted in at least 300 cells counted per vector group. Data were analyzed by ANOVA, * p<0.05 was considered significant.

To confirm the phenotypes from micronuclei assays, an additional DNA damage assay was performed. The neutral comet assay, also known as the single cell gel electrophoresis assay, is a method routinely used to detect DNA double-strand breaks

(DSBs). Fragmented DNA arising from DSBs isolated from cellular lysates migrates faster than intact DNA, creating a “comet” with a “head” containing intact, non- fragmented DNA and a “tail” containing DNA DSBs (Figure 14). We calculated the “tail moment”, the product of the length of the tail and percent of DNA in the tail, of lysates from each experimental group of cells transfected with pEGFP-empty, pEGFP-BLM, pEGFP-D795A, pEGFP-BLMΔ489-587, pEGFP-BLMC2A or pEGFP-BLMC2D.

Transfection of pEGFP-BLM or pEGFP-BLMC2D reduced the tail moment, indicative of the efficient repair of DNA DSBs, while transfection of pEGFP-empty, helicase-dead pEGFP-D795A, pEGFP-BLMΔ489-587 or pEGFP-BLMC2A displayed a higher tail moment score, indicative of high levels of DNA DSBs (Figure 14). Transfection of pEGFP-empty, helicase-dead pEGFP-D795A and pEGFP-BLMΔ489-587 exhibit mean tail movement values of 11.2, 13.8 and 8.90 respectively, while pEGFP-BLM and pEGFP-BLMC2D lowered the mean tail movements to 4.0 and 4.9 respectively.

Interestingly, transfection of pEGFP-BLMC2A showed an even higher mean tail movement value of 20.6 that those of pEGFP-empty, helicase-dead pEGFP-D795A and pEGFP-BLMΔ489-587. These data correlate with micronuclei data and, taken together, suggest that serines 577, 579 and 580 of BLM may constitute a novel phosphosite cluster vital for the ability of BLM to repair chromosome breaks.

Figure 14: Phosphorylation of BLM C2 (S577/S579/S580) is required for correction of DNA DSBs in BLM-/- cells. A: Photomicrographs of stained DNA of GMO8505 (BLM-/-) cells used in the neutral comet assay. B: GMO8505 (BLM-/-) cells were transfected with pEGFP-empty, pEGFP-BLM, pEGFP-D795A, pEGFP-BLMΔ489-587, pEGFP-BLMC2A or pEGFP-BLMC2D. Box plots of tail moments are shown. Statistical significance was determined using the Mann-Whitney rank sum test. * p<0.05 was considered significant. GFP, D795A, Δ489-587 AND C2A = p>0.0001

Phosphorylation of BLM C2 (S577/S579/S580) is required for co-localization with topoisomerase IIα.

The topoisomerase IIα-interaction domain of BLM (489-587) is required for the association of BLM and topoisomerase IIα and for the correction of elevated chromosome breakage in cells without BLM (Russell et al., 2011). As phospho-dead

BLMC2A fails to reduce the micronuclei in transfected BLM-/- cells, we tested whether

74 serines 577, 579 and 580 could control the co-localization of BLM with topoisomerase

IIα. BLM and topoisomerase IIα are minimally expressed during G1-, increase in S- and peak in G2/M-phases of the cell cycle (Dutertre et al., 2000, Heck et al., 1988). Both

BLM and topoisomerase IIα expression is cell cycle-regulated and their interaction is most prominent in M-phase (Russell et al., 2011). Therefore, their co-localization was examined during G1/S and G2/M (Russell et al., 2011).

BLM-/- cells were transfected with pEGFP-BLM, pEGFP-BLMΔ489-587, pEGFP-

BLMC2A or pEGFP-BLMC2D. Cells were synchronized using a double-thymidine block and collected 4 hours post-release to obtain cells in G1/S or 11 hours plus colcemid treatment to obtain cells in G2/M. FACS analysis confirmed synchronization (Figure 15).

Immunofluorescence studies demonstrate that phospho-dead mutant BLMC2A is significantly reduced in co-localization with topoisomerase IIα in G2/M-phase (18% in cells expressing BLMC2A compared to 50% in cells expressing wild-type BLM, p=<.0001) (Figure 15). The reduction in co-localization of topoisomerase IIα and

BLMC2A is comparable to that in cells expressing the topoisomerase IIα-interaction domain mutant BLMΔ489-587 in G2/M (10% co-localization). In comparison, cells expressing the phospho-mimic BLMC2D retain the ability to co-localize the BLM mutant with topoisomerase IIα similarly to cells expressing wild-type BLM (54% in cells expressing BLMC2D compared to 50% in cells expressing BLM). These data suggest that phosphorylation of serines 577, 579 and 580 of BLM alters BLM and topoisomerase

IIα co-localization in vivo.

Figure 15: Phosphorylation of BLM C2 (S577/S579/S580) is required for co- localization with topoisomerase IIα in BLM-/- cells. A: GMO8505 (BLM-/-) cells were transfected with pEGFP-BLM, pEGFP-BLMΔ489-587, pEGFP-C2D or pEGFP-C2A. 24 hours post-transfection, cells were treated with 2mM thymidine (Sigma) for 18 hours. Cells were then washed with PBS and fresh media added for 9 hours. After 9 hours, 2mM thymidine was added for 17 hours. Cells were then washed with PBS and collected at 4 hours for G1/S-phase or 11 hours for M-phase. M-phase samples were treated with 40ng/µl colcemid (Sigma) 6 hours prior to collection. Cells were fixed and stained for TOP2A with anti-TOP2A (Topogen)/Alexaflor 594 and DAPI. Inserts show co-localized BLM and TOP2A in asynchronous, G1/S or G2/M cells. Scale bar (white) is 10µm B: Cells with more than one GFP-BLM/TOP2A focus were counted as positive for co- localization. 50 GFP-positive cells were counted blindly in two independent experiments. The percentages of cells with BLM/TOP2A co-localization are represented graphically. Data were analyzed by Student’s T-test* p<0.05 was considered significant from corresponding matching cell cycle. BLMΔ489-587 G2/M=<.0001, C2A G2/M=<.0001, BLMΔ489-587 Asynchronous=0.0031. C: FACS analysis of representative cells used for co-localization assays.

Phosphorylation of BLM C2 is required for resolution of ultra-fine bridges, but not anaphase bridges.

BLM localizes to a class of DAPI-negative/histone-negative anaphase bridges known as ultra-fine bridges (UFBs) (Chan et al., 2007). As BLM-/- cells and those treated with topoisomerase II inhibitors exhibit high numbers of UFBs, we examined the localization of BLM mutants to UFBs. BLM-/- cells were transfected with pEGFP-BLM, pEGFP-BLMD795A (helicase-dead mutant), pEGFP-BLMΔ489-587, pEGFP-BLMC2A or pEGFP-BLMC2D and examined for the presence of UFBs. The BLM phospho- mutants, BLMC2A and BLMC2D, retain the ability to localize to UFBs, as did

BLMΔ489-587 and BLMD795A (Figure 16). However, the percentage of mitotic cells exhibiting UFBs is significantly higher in cells expressing BLMC2A and BLMΔ489-587 compared to cells expressing wild-type BLM (24% and 25% compared to 9%, p=0.0271, p=0.0339) (Figure 16). The percentage of cells expressing the phospho-mimic BLMC2D show similar numbers of UFBs to cells expressing wild-type BLM (7% versus 9%).

Interestingly, a similar increase in DAPI-positive anaphase bridges were not observed in cells expressing BLMC2A or BLMΔ489-587, highlighting the unique nature of UFBs with regard to BLM and topoisomerase IIα function at UFBs versus anaphase bridges

(Figure 17). These data suggest that the BLM/ topoisomerase IIα interaction is vital for the resolution of UFBs, but perhaps not anaphase bridges.

Figure 16: Phosphorylation of BLM C2 (S577/S579/S580) is required for resolution of ultra-fine bridges (UFBs). A: Representative anaphase cells showing BLM UFBs in GMO8505 (BLM-/-) cells transfected with pEGFP-BLM, pEGFP-BLMΔ489-587, pEGFP- BLMC2A or pEGFP-BLMC2D. Scale bar (white) in confocal image is 5µm. B: Quantification of the percentage of anaphase cells that exhibit BLM UFBs. 50 GFP- positive cells were counted blindly in two independent experiments. The percentages of cells with BLM UFBs are represented graphically. Error bars represent ± SD. Data were analyzed by Student’s T-test * p<0.05 was considered significant in comparison to wild- type BLM: BLMC2A=0.0271; BLMΔ489-587=0.0339.

Figure 17: Phosphorylation of BLM C2 (S577/S579/S580) is required for resolution of UFBs but not anaphase bridges. The percentages of normal anaphase cells, cells with DAPI+/BLM+ anaphase bridges and cells with DAPI+/BLM- anaphase bridges are represented graphically. Error bars represent ± SD. Data were analyzed by Student’s T- test * p<0.05 was considered significant from BLM: DAPI+/BLM- anaphase bridges: D795A=0.0039

Topoisomerase IIα localizes to anaphase bridges.

Similar to BLM, topoisomerase IIα is cell cycle-regulated with highest expression in G2/M cell cycle phases of proliferating cells (Prosperi et al., 1994, Turley et al., 1997).

As the BLM/topoisomerase IIα interaction is most prominent in M-phase and BLM localizes to ultra-fine bridges in M-phase, we examined the presence of topoisomerase

IIα these structures (Figure 16, Russell et al., 2011). Cells with and without endogenous

BLM expression were treated according to the ultra-fine bridge method, minus the transfection of GFP-BLM. Topoisomerase IIα localization was observed at DAPI- positive anaphase bridges, but not DAPI-negative ultra-fine bridges (UFBs) (Figure 18).

Experiments were repeated with GFP-tagged topoisomerase IIα (Origene) and yielded identical results. In Saccharomyces cerevisiae, topoisomerase II is visualized at UFBs using time-lapse microscopy (Germann et al., 2014). It is possible we are unable to visualize topoisomerase IIα at UFBs due to temporal restraints of fixed-cell microscopy.

Figure 18: Topoisomerase IIα localizes to anaphase bridges. GMO8505 (BLM -/-) and VA13 (BLM+/+) cells were s with treated with 0.1µg/ml nocodazole (Sigma) for 3 hours and incubated in fresh medium for 1 hour, fixed, permeabilized and subsequently stained 1:1500 anti-TOP2A (Topogen TG2011-1) overnight. Topoisomerase IIα localizes to DAPI-positive anaphase bridges in cells with and without endogenous BLM expression. No examples of topoisomerase IIα at ultra-fine bridges (DAPI-negative) were observed.

To rule out any changes in cellular localization of the phospho-mutants, we examined their localization pattern. BLM normally localizes to promyelocytic leukemia protein (PML) bodies and the nucleolus. PML bodies are discrete nuclear bodies that contain the PML protein, BLM and other DNA repair proteins (Zhong et al., 1999).

While their exact function remains elusive, PML bodies are believed to be “storage depots” for DNA repair proteins until they are required at sites of damaged DNA. BLM

81 also localizes to the nucleolus, where it interacts with topoisomerase I to promote efficient rRNA transcription. (Sanz et al., 2000, Grierson et al., 2013). BLM-/- cells were transfected with pEGFP-empty, pEGFP-BLM, pEGFP-D795A, pEGFP-BLMΔ489-587, pEGFP-BLMC1A, pEGFP-BLMC1D, pEGFP-BLMC2A or pEGFP-BLMC2D and then stained for anti-PML or anti-nucleophosmin (NPM). Those cells transfected with pEGFP-BLMC1A, pEGFP-BLMC1D, pEGFP-BLMC2A or pEGFP-BLMC2D show localization to both PML bodies and the nucleolus similar to pEGFP-BLM (Figure 18).

Cells transfected with pEGFP-D795A or pEGFP-BLMΔ489-587 also localize to PML bodies and the nucleolus, suggesting that neither the helicase activity nor their ability to interact with topoisomerase IIα plays a role in the BLM localization (Figure 19). These data suggest that phosphorylation of BLM serines 577, 579 and 580 regulates BLM and topoisomerase IIα co-localization in vivo but is not involved in BLM localization.

Figure 19: BLM phospho-mutants exhibit similar cellular localization to BLM. Immunofluorescence of GMO8505 (BLM-/-) cells transfected with pEGFP-empty, pEGFP-BLM, pEGFP-D795A, pEGFP-BLMΔ489-587, pEGFP-C1A, pEGFP-C1D, pEGFP-C2A or pEGFP-C2D vectors. 48 hours post-transfection, cells were fixed and stained with anti-NPM for nucleolus staining (Panel A) or anti-PML (Panel B) and DAPI for nuclear staining. Alexaflor 594 was used as a secondary antibody. Co-localization is indicated by a yellow color. Scale bar (white) is 10µm.

Phosphorylation of BLM C2 (S577/S579/S580) does not alter in vitro interactions with topoisomerase IIα.

Changes in in vivo co-localization between proteins are often associated with changes in their direct interaction. As changes in the co-localization of BLMC2A with topoisomerase IIα were observed, we examined whether the phosphorylation-mutants

BLMC1A, BLMC1D, BLMC2A or BLMC2D would exhibit changes in their ability to interact with purified topoisomerase IIα in an in vitro immunoprecipitation assay. Each mutant BLM was expressed in S. cervisiae and purified by fast-protein liquid chromatography (FPLC) over nickel, Heparin-sepharose and finally Q-sepharose resins

(Figure 20). A series of immunoprecipitations were performed using purified mutants,

Purified BLM, BLMC1A, BLMC1D, BLMC2A or BLMC2D was incubated with topoisomerase IIα (Topogen). Two hours of protein incubation was followed with the addition of an anti-BLM antibody and an overnight mixture of the protein/antibody.

Protein A/G beads successfully immunoprecipitated (IP) the anti-BLM antibody; IP proteins were separated using 8% SDS-PAGE. Figure 21 shows in vitro IP-westerns of

BLM, BLMC2D, BLMC2A, BLMC1D or BLMC1A and topoisomerase IIα. These westerns confirmed an in vitro association between topoisomerase IIα and BLM, and each of the BLM phospho-mutants. In vitro biochemical studies do not correlate with the in vivo topoisomerase IIα co-localization defect of BLMC2A, although topoisomerase IIα interactions are difficult to assess in vitro due to the high protein-binding affinities of all topoisomerases.

Figure 20: Purified BLM phospho-mutants are phosphorylated. Coomassie staining of FPLC-purified BLM and each BLM phospho-mutant (BLMC1A, BLMC1D, BLMC2A and BLMC2D) with and without phosphatase treatment (PP). Proteins were separated using 8% SDS-PAGE and stained with Coomassie. Protein mobility gel shifts are observed in the phosphatased (PP) protein samples.

Figure 21: BLM phospho-mutants exhibit in vitro interactions with topoisomerase IIα. A: BLM, BLMC2D and BLMC2A, and DNA topoisomerase IIα (TOP2A, Topogen) were used in in vitro protein co-immunoprecipitations using αBLM. B: BLM, BLMC1A, and BLMC1D and TOP2A were used in in vitro protein co-immunoprecipitations using αBLM. Immunoprecipitated proteins were separated using 8% SDS-PAGE and detected by western blotting using αBLM and αTOP2A. Goat IgG was used as an isotype-matched negative control for αBLM.

BLM S577, S579 and S580 are required for topoisomerase IIα-mediated stimulation of BLM helicase activity.

Topoisomerase IIα stimulates the helicase activity of BLM in a phosphorylation- dependent manner (Figure 8). To determine whether the phosphorylation-mutants 86

BLMC1A, BLMC1D, BLMC2A or BLMC2D are similarly stimulated, we expressed each mutant in S. cervisiae, followed by fast-protein liquid chromatography (FPLC) purification over nickel, Heparin-sepharose and finally Q-sepharose resins (Figure 20).

Purified mutants were used in time-dependent helicase assays with and without topoisomerase IIα using a 3’ overhang DNA substrate. Basal levels of DNA substrate unwinding of each mutant, measured by specific activity, was unaffected by the amino acid changes, as indicated by the grey boxes in Figure 20. Specific activity of BLM and each of the mutants was calculated to be 4 fmol/ul/min. Addition of topoisomerase IIα to

BLMC2D (upside empty triangles) or BLMC2A (empty triangles) exhibited a significantly reduced stimulation in comparison to BLM (Figure 22). Equimolar topoisomerase IIα stimulates BLM helicase activity approximately two-fold, while

BLMC2A and BLMC2D only showed a 1.3-fold increase upon topoisomerase IIα addition (Figure 20). There were no significant differences between the specific activities of BLMC2D+topoisomerase IIα (BLMC2D+TOP2A) and

BLMC2A+topoisomerase IIα (BLMC2A+TOP2A), suggesting but not confirming that cluster 2 (S577, S579, S580) plays a role in topoisomerase IIα-mediated stimulation of

BLM unwinding.

Figure 22: BLM C2 (S577/S579/S580) is necessary for topoisomerase IIα-mediated stimulation of BLM helicase activity. A: Unwinding curves of 1 nM BLM, BLMC2D and BLMC2A plus or minus 1nM TOP2A. Filled squares, triangles and upside-down triangles represent BLM, BLMC2A or BLMC2D alone. BLM, BLMC2A or BLMC2D unwinding abilities using a 3’ DNA duplex are identical. Empty squares, triangles and upside-down triangles represent BLM, BLMC2A or BLMC2D with equimolar TOP2A. TOP2A stimulation of BLM helicase activity is decreased in reactions with BLMC2D or BLMC2A. B: Specific activity (fmol/min/µM) of BLM, BLMC1A, BLMC1D, BLMC2A and BLMC2D plus or minus equimolar TOP2A are shown. Grey boxes represent BLM or phospho-mutant alone, while black boxes represent the samples with addition of TOP2A. The specific activities of BLMC2D+TOP2A and BLMC2A+TOP2A are significantly decreased compared to wild-type BLM plus TOP2A. Data were analyzed by ANOVA, * p<0.05 was considered significant.

Chk2 phosphorylation of phosphatased BLM recovers topoisomerase IIα-mediated stimulation and requires S577, S579 and S580 of BLM.

When BLM is dephosphorylated by phosphatase treatment, topoisomerase IIα does not increase the ability of BLM to unwind DNA in comparison to wild-type phosphorylated BLM (Figure 8). However, in vitro phosphorylation by Chk2, but not

Chk1, recues the ability of topoisomerase IIα to stimulate phosphatased-BLM (Figures 9 and 10). These data indicate that Chk2 may be phosphorylating specific resides that control the functional interaction between BLM and topoisomerase IIα. To test whether serines 577, 579 and 580 are directly involved in the topoisomerase IIα stimulation recovery by Chk2 phosphorylation, we repeated the experiment performed in Chapter 3

(Figure 9) with phosphatased-BLMC2D and phosphatased-BLMC2A. Mutagenesis of

BLM serines 577, 579 and 580 to either aspartate or alanine in BLMC2D or BLMC2A, followed by Chk2 phosphorylation is no longer able to recover topoisomerase IIα- mediated stimulation. Compared to the 61.8% of DNA unwound by phosphatased-BLM treated with Chk2 and topoisomerase IIα, BLMC2D and BLMC2A (PP-

C2D+CHK2+TOP2A or PP-C2A+CHK2+TOP2A) treated identically exhibit unwinding activity of 40.2% and 38.4% respectively (Figure 23). These data suggest that serines

577, 579 or 580 or a combination of these sites in cluster 2 of BLM are Chk2 phosphorylation targets that play a role in the functional interactions of BLM and topoisomerase IIα. Negative data with Chk2-kinased PP-BLMC2D may reflect the insufficient functional replacement of phosphorylated serines by aspartic acid substitution in such sensitive in vitro reactions.

Figure 23: Chk2 phosphorylation of phosphatased BLM recovers topoisomerase IIα-mediated stimulation of helicase activity and is dependent on its ability to modify BLM C2. Unwinding curves are shown for 1nM phosphatased BLM (PP-BLM), PP-BLMC2A, PP-BLMC2D plus or minus 1nM TOP2A in addition to CHK2 kinase treatment. Filled triangles represent PP- BLM alone, while empty triangles represent PP- BLM + TOP2A (from Figure 9). Filled circles represent Chk2 phosphorylation of PP- BLM, while empty circles represent Chk2 phosphorylation of PP-BLM + TOP2A (from Figure 9). Empty squares represent Chk2 phosphorylation of PP-BLMC2D and empty upside triangles represent Chk2 phosphorylation of PP-BLMC2A. TOP2A stimulation of helicase activity is observed following Chk2 phosphorylation of PP-BLM only. Helicase assays were repeated three times with the mean plotted and error bars representing ± SD.

DNA damage following Chk2 inhibition in vivo is corrected by the phosphomimetic

BLMC2D.

Chk2 inhibition in cultured human cells results in mitotic catastrophe in some

(HCT116 colon carcinoma cells) and increased apoptosis in others (p53-defective

HEK293 cells) (Castedo et al., 2004; Yu et al., 2001). Dominant-negative Chk2 and siRNA-mediated Chk2 reduction confirm a role for Chk2 in the S- and G2-checkpoints in response to DNA DSBs in human cell lines (Falck et al., 2001 and 2002). In order to avoid the cell cycle defects associated with Chk2 loss, we tested a role for Chk2 in the

DNA damage response of BLM using a pharmacological Chk2 inhibitor, CAS 516480-

79-8. BLM-/- cells were transfected with pEGFP-empty, pEGFP-BLM, pEGFP-D795A, pEGFP-BLMΔ489-587, pEGFP-BLMC2A or pEGFP-BLMC2D. Transfected cells were then treated with CAS 516480-79-8 for three hours and subjected to the neutral comet assay to visualize DNA DSBs. Chk2 inhibition was confirmed by immunoblot using anti-Chk2-S516 (Cell Signaling) or anti-Chk2 (Santa Cruz), and anti-RPA-194 (Santa

Cruz, sc48385) to identify a loading control. Loss of the phospho-Chk2 (S516) signal confirmed inhibition (Figure 24). Cells were then lysed and used in the comet assay.

Chk2 inhibition increases the tail moment in cells transfected with of pEGFP-empty, pEGFP-BLM, pEGFP-D795A, pEGFP-BLMΔ489-587 or pEGFP-BLMC2A indicating the presence of unrepaired DNA DSBs. Mean tail moment values were 17.6, 18.9, 19.4,

18.4 and 19.5 respectively (Figure 24). The mean tail moment value in cells transfected with pEGFP-BLMC2D is significantly lower, with a mean tail moment value of 12.45, p

=<0.0001. These data suggest that aspartate-substituted BLMC2D represents a constitutively activated form of BLM in vivo that can facilitate DNA damage repair resulting from Chk2 inhibition.

Figure 24: Phosphorylation of BLM C2 (S577/S579/S580) prevents DNA damage following Chk2 inhibition. A: Treatment with 5µM CAS 516480-79-8, a Chk2 inhibitor (In), for three hours in GMO8505 (BLM-/-) cells reduces activated Chk2 (pS516-Chk2) as observed by immunoblot. B: GMO8505 (BLM-/-) cells were transfected with pEGFP- empty, pEGFP-BLM, pEGFP-D795A, pEGFP-BLMΔ489-587, pEGFP-C2A or pEGFP- C2D. At 45 hours post-transfection, cells were treated with 5µM CAS 516480-79-8, a Chk2 inhibitor (CalBioChem) for three hours. Cells were collected at 48 hours and subjected to the neutral comet assay. Box plots of tail moments include data from three independent experiments. For all boxplots, bottom and top of the box correspond to the 25th and 75th percentiles, respectively, and whiskers represent data points within 1.5×IQR (interquartile range). The line extending through the boxplot indicates the mean value, and the black line contained within the boxplot represents the median value. Statistical significance was determined using the Mann-Whitney rank sum test. * p<0.05 was considered significant. C2D+In.=<0.0001

IV. Discussion

Experiments in this chapter demonstrate that the interaction of the BLM helicase and topoisomerase IIα, required to maintain low levels of chromosome breakage, is regulated by Chk2 kinase. A novel phosphosite cluster (serines 577/579/580) within

BLM is required for these functions through BLM interaction and co-localization with topoisomerase IIα. Modification of all three serines (577/579/580) within the cluster affects co-localization of BLM/topoisomerase IIα in G2/M-phases of the cell cycle, micronuclei formation, persistence of UFBs and DNA damage as measured by DNA breaks. Decreased co-localization with topoisomerase IIα and high levels of chromosome breakage are present in cells transfected with the alanine-substituted, “phospho-dead” mutant BLMC2A. In comparison, the aspartate-substituted, “phospho-mimic” mutant

BLMC2D behaves similarly to wild-type BLM in its ability to co-localize with topoisomerase IIα and effectively reduce high levels of chromosome breakage in BLM-/- cells. Interestingly, none of the mutants shows a complete loss of the ability to associate with topoisomerase IIα in vitro. Neither BLMC2A and BLMC2D display a capacity to enhanced helicase activity to be mediated by topoisomerase IIα, although this most likely is the result of the inability of aspartatic acid substitution to mimic in vitro the full effects of serine phosphorylation in vitro or in vivo. Subsequently, in vivo experiments with transfected mammalian expression vectors expressing phospho-mutants BLMC2A and

BLMC2D correlated serine substitution with correction of the chromosome breakage phenotype by BLMC2D but not BLMC2A. Together, these data may illustrate the

94 limitations of an in vitro purified-protein system that does not accurately represent the complexity of in vivo interactions between BLM and topoisomerase IIα, the role of other unidentified interaction partners or, as mentioned, the inability of aspartic acid to represent a phosphorylated serine. We also present data that excludes BLM serines 517,

518 and 581 as required phosphosites for BLM to reduce chromosome breakage. In total, these data support the hypothesis that the functional interaction between BLM and topoisomerase IIα is regulated by phosphorylation of phosphosite cluster 2 and suggest that phosphorylation at these C2 serines controls targeting of the BLM/topoisomerase IIα complex to sites of DNA damage in G2/M-phase and contributes to genomic stability in vivo.

Finally, our data suggest Chk2 as the likely kinase for BLM modifications required for the functions evaluated here. Chk2 inhibition in vivo or its in vitro activity recapitulates the respective in vivo and in vitro effects of cluster modification. Mass spectrometry studies, however, examining in vitro modified BLM were inconclusive.

A series of serines (577/579/580) identified by in silico prediction programs within the BLM topoisomerase IIα-interaction domain is a central regulatory region that determines BLM function in the correction of chromosome breakage. Phosphosite clusters are hypothesized to play a functional role by regulating the robustness of the cellular response to phosphorylation (Schweiger and Linial 2010, Gunawardena 2005).

Additionally, phosphosite clusters or multisite phosphorylation may enable a single or a specific combination of phosphosites to determine the rate and duration of biological responses. Our study has identified a novel phosphosite cluster in BLM at amino acids

577, 579 and 580 that determines the ability of BLM to reduce chromosome breakage and resolve ultra-fine bridges. Correction of the chromosome breakage phenotype of

BLM-/- cells with single and double phospho-mutants was not observed, suggesting that these three amino acids compose a functional and bona fide cluster of three serines

(577/579/580) dynamically regulating the interaction of BLM and topoisomerase IIα.

These data also argue for expanding the conical approach of studying single amino acids when examining phosphorylation-dependent processes.

Our experiments suggest a model in which DNA DSBs induce Chk2 activation which in turn dynamically phosphorylates BLM at serines 577, 579 and 580. Data from mass spectrometry studies were inconclusive but site-directed mutagenesis permitted the localization of the amino acids within BLM required for these functions. These serine modifications promote the functional interaction of BLM with topoisomerase IIα, which then stimulates BLM helicase activity and allows for proper localization of topoisomerase IIα to sites of entangled chromosomes. There, topoisomerase IIα decatenates chromosomes while BLM dissolves hemicatenates between sister chromatids. These actions would reduce the number of anaphase bridges or lagging chromosomes that would become chromosome breaks and permit faithful segregation of genetic information to daughter cells.

Further research using co-localization studies of BLM and topoisomerase IIα at anaphase bridges and lagging chromosomes are underway. Unfortunately, we did not observe the normal thread-like staining of topoisomerase IIα at UFBs. It is possible that topoisomerase IIα is still present at UFBs, but in a different staining pattern (i.e. punctate

96 instead of a continuous thread). Co-localization studies and live-cell imaging studies will answer this question. Our model is still supported by early observations in BS and recent published findings: cells from individuals with BS often exhibit abnormally high numbers of chromosome breaks at the centromere; the interaction of BLM and topoisomerase IIα is required for the resolution of centromeric chromatin; BLM reduction by siRNA increases lagging chromosomes and anaphase bridges; and cells lacking Chk2 have increased numbers of lagging chromosomes (German et al., 1965, Meyer-Kuhn and

Therman 1979, Rouzeau et al., 2012, Chan et al., 2007, Stolz et al., 2010).

Finally, by manipulating the BLM/topoisomerase IIα interaction by Chk2 kinase inhibitors, it may be possible to create catastrophic genomic instability in treated cells and push cells into stasis or apoptosis, and/or enhance the effectiveness of other chemotherapeutic approaches. In the large number of cancers with mutations or defects in checkpoint and cell cycle components, inhibition of checkpoint kinases, such as Chk2, represents an opportunity for increasing the effect of DNA-damaging agents by inhibiting the remaining intact DNA-damage response. The therapeutic value of Chk2 inhibition is well studied and supports our hypothesis. Its combination with the topoisomerase II inhibitor doxorubicin enhances the inhibition of Chk2 and the level of mitotic catastrophe in HCT116 colon carcinoma cells; inhibition of Chk2 by siRNA increases apoptosis in p53-defective HEK293 cells (Castedo et al., 2004, Yu et al., 2001). However, only

Chk1-specific or dual Chk1/Chk2 inhibitors have been used in the clinic, which raises questions of the feasibility and effectiveness of Chk2-specific inhibition in humans. Our research provides mechanistic evidence that other than the well-documented prevention

97 of cell cycle arrest and DNA repair, inhibition of Chk2 creates DNA damage by disruption of the BLM/topoisomerase IIα interaction controlled by BLM amino acids

577, 579 and 580.

Chapter 5: BLM stimulates topoisomerase IIα relaxation of supercoiled DNA.

I. Introduction

Topoisomerases are enzymes that change DNA topology by over- and under- winding of DNA or by unraveling knotted DNA. Due to their unique function, this class of enzymes is responsible for facilitating gene expression, transcription, DNA replication and cellular division. Topoisomerase IIα belongs to the type II subfamily of topoisomerases and relaxes DNA by passing one double-stranded segment (the transfer- or T-segment) through a temporary DNA break formed (the gate- or G-segment) in either the same or different DNA molecules (reviewed in Champoux, 2000). Topological stress generated during DNA replication results in positive supercoiling in front of the replication machinery and pre-catenanes behind the replication machinery. Unresolved pre-catenanes form catenated duplex daughter chromosomes. Topoisomerase IIα efficiently alleviates torsional stress ahead of replication forks by DNA relaxation of supercoiling and torsional stress behind the replication fork by decatenation (Osheroff et al., 1983, McClendon et al., 2005, Luo et al., 2009).

Regulation of topoisomerase IIα activity in decatenation by helicases is well studied: RECQL5, a RecQ helicase similar to BLM, stimulates the decatenation activity

99 of topoisomerase IIα; BLM is unable to stimulate the decatenation activity of topoisomerase IIα (Ramamoorthy et al., 2012, Russell et al., 2011). The regulation of topoisomerase IIα by RecQ helicases in DNA relaxation, however, is unknown. Previous chapters demonstrate the ability of topoisomerase IIα to stimulate BLM helicase activity in vitro using DNA substrates mimicking a DNA DSB. This chapter demonstrates that

BLM alters topoisomerase IIα enzymatic activities in vitro in the relaxation of supercoiled DNA.

II. Materials and methods

Protein purification. The pYES-BLM expression vector (pJK1) used in site-directed mutagenesis was kindly provided by Ian Hickson, then at the University of Oxford,

Oxford, UK. BLM phospho-mutants were purified as previously described for wild-type

BLM. (Grierson et al., 2013). Hexa-histidine (6X-His)-tagged BLM proteins are overexpressed in Jel1 protease-deficient Saccharomyces cerevisiae. Yeast were lysed at

20k psi using a French Press Cell Disrupter (Thermo) and lysates separated by ultracentrifugation at 65,000g for 1hr at 4°C. Cleared lysates were purified by FPLC using Ni-NTA Superflow (Qiagen), followed by Q-Sepharose (Sigma) and finally

Heparin-Sepharose (GE Life Sciences). Protein purity was determined by 10% SDS-

PAGE and staining of the gel with SYPRO Ruby Protein Gel Stain (Sigma). Gels were analyzed using ImageQuant (GE Healthcare) software as previously described.

100

DNA relaxation assay. DNA relaxation assays were performed as suggested by the manufacturer (Topogen) using supercoiled pEGFP-empty. Varying amounts of BLM (5 or 10 nM), BLMC2A or BLMC2D were incubated on ice for 5 minutes with 5 units of

TOP2A (Topogen). Proteins were added to a reaction containing 300 ng of kDNA in

20 µl supplied reaction buffer (50 mM Tris–HCl pH 8.0, 100 mM NaCl, 10 mM MgCl2,

2 mM ATP and 1 mM DTT) at 30°C for 15 min. The reactions were terminated by adding

SDS. The entire reaction mixtures were separated on 1% agarose gel and then stained in

TBE containing ethidium bromide (1 µg/ml) for 30 min. Results were analyzed using

ImageQuant (GE Healthcare) software.

III. Results

BLM stimulates topoisomerase IIα DNA relaxation of supercoiled DNA.

Supercoiling of DNA alters the overall form of DNA and results in a more compact DNA molecule compared to an identically relaxed or non-supercoiled DNA molecule. The unique structure of supercoiled DNA (known as form I) within a circular plasmid results in a faster gel electrophoresis migration compared to a nicked, relaxed circular plasmid (known as form II) or a linear plasmid (Fortune and Osheroff 1998).

Topoisomerase IIα relaxes supercoiled DNA (form I) into nicked, circular DNA (form II)

(Osheroff et al., 1983). The relaxation of supercoiled DNA was monitored with topoisomerase IIα or topoisomerase IIα pre-incubated with BLM (5nM or 10nM) using a

101 gel electrophoresis assay. Figure 25 demonstrates an increase of form II DNA and complete conversion of form I DNA when 10nM BLM is added to reactions with topoisomerase IIα. These data show that BLM stimulates topoisomerase IIα-mediated relaxation of supercoiled DNA. BLM by itself does not affect the topology of DNA, as seen in the control lane in which 10 nM BLM is added in the absence of topoisomerase

IIα. They also show that the interaction of BLM and topoisomerase IIα affects enzymatic functions of both proteins: interaction increases both BLM helicase activity and topoisomerase IIα relaxation of DNA supercoiling.

102

Figure 25: BLM stimulates topoisomerase IIα-mediated relaxation of DNA supercoiling. Topoisomerase IIα (Topogen) was pre-incubated with 5nM or 10nM of BLM for 5 minutes prior to addition of protein complex to reactions containing 300 ng of supercoiled DNA (form I). Relaxation of supercoiled DNA results in various topoisomers (slower migrating, diffuse band) and circular, nicked DNA (Form II). A complete conversion of form I to form II is observed with the addition of 10nM BLM.

Modification of BLM C2 (S577/S579/S580) does not alter topoisomerase IIα relaxation of supercoiled DNA.

Chapters 3 and 4 show that a novel phosphosite cluster (serines 577/579/580) within BLM is required to maintain low levels of chromosome breakage through its interaction and co-localization with topoisomerase IIα. Modification of all three serines

(577/579/580) within the cluster affects co-localization of BLM/topoisomerase IIα in

G2/M-phases of the cell cycle, ultra-fine bridge resolution and micronuclei formation as a

103 measure of DNA damage. To test whether this phosphosite cluster also has a role in the stimulation of topoisomerase IIα relaxation of supercoiled DNA, purified phospho- mutants were pre-incubated with topoisomerase IIα and used in DNA relaxation assays

(Figure 26). BLM stimulates topoisomerase IIα relaxation of supercoiled DNA, as previously shown. Heat-denatured (HD) and thus enzymatically-dead BLM is unable to stimulate topoisomerase IIα relaxation of supercoiled DNA. BLMC2A and BLMC2D similarly to control BLM stimulate topoisomerase IIα relaxation of supercoiled DNA.

This experiment suggests that this phosphosite cluster is not necessary for BLM-mediated effects on topoisomerase IIα and that the interaction of the proteins is not required to carry out relaxation synergistically.

104

Figure 26: Modification BLM C2 (S577/S579/S580) does not alter topoisomerase IIα relaxation of supercoiled DNA. Topoisomerase IIα (Topogen) was pre-incubated with 10nM BLM, heat-denatured BLM (HD), BLMC2A or BLMC2D for 5 minutes prior to addition of protein complexes to reactions containing 300 ng of supercoiled DNA (form I). Relaxation of supercoiled DNA results in various topoisomers (slower migrating, diffuse band) and circular nicked DNA (form II). A complete conversion of Form I to Form II is observed with BLM, BLMC2A and BLMC2D.

105

IV. Discussion

Topoisomerase IIα is a highly conserved enzyme that plays a vital role in relieving DNA topological stress through decatenation and relaxation of compacted

DNA. Sgs1, the BLM homolog in yeast, also interacts with topoisomerase II to segregate chromosomes faithfully (Watt et al., 1995). Previous work from our laboratory shows that BLM interacts with topoisomerase IIα to stimulate BLM helicase activity using DNA substrates mimicking early recombination intermediates (Russell et al., 2011). In this thesis, my work shows a functional interaction of BLM and topoisomerase IIα regulated by a novel BLM phosphosite cluster (S577/S579/S580) that reduces chromosome breakage, potentially caused by inefficient decatenation of sister chromatids during cell division. Interestingly, BLM does not play a role in topoisomerase IIα-mediated decatenation in vitro by (Russell et al., 2011). Here, data show that BLM can stimulate topoisomerase IIα relaxation of supercoiled DNA in vitro compared to topoisomerase IIα alone.

Topoisomerase IIα alleviates torsional stress ahead of replication forks by relaxing supercoiled DNA. Replication fork stability is also preserved by BLM during normal DNA replication through interactions of BLM with DNA polymerase δ and the

FEN1 endonuclease (Selak et al., 2008, Sharma et al., 2003). FEN1 and DNA polymerase δ are components of the replication machinery and are stimulated enzymatically by BLM. BLM localizes to stalled replication forks and functions in the repair and restart of stalled replication forks (Sengupta et al., 2003). These experiments

106 support the hypothesis that BLM, in addition to its functions in homologous recombination processes at stalled replication forks, promotes topoisomerase IIα relaxation of supercoiled DNA in front of the fork to promote efficient replication along with the topoisomerase IIα.

107

Chapter 6: Thesis Discussion and Summary

The BLM helicase, a human RecQ-like helicase, has central roles in DNA damage signaling and repair, replication, transcription and telomere maintenance. BLM expression is required for maintaining genomic stability as high levels of sister chromatid exchanges (SCE) and abnormal chromosome structures are observed in cells lacking

BLM. The BLM-encoding gene BLM is mutated in Bloom’s syndrome (BS), an autosomal recessive chromosome breakage disorder. Those affected with BS have a greatly increased rate of cancer, highlighting the role of BLM in promoting genomic stability.

BLM maintains normal DNA repair functions through its participation in homologous recombination and non-homologous end joining (Chu and Hickson 2009,

Langland et al., 2002), although the mechanisms by which it acts to prevent or response to chromosome breakage are less understood. BLM also interacts with a wide variety of other proteins that modulate its repair functions, helicase activity and cellular localization. Topoisomerase IIα, a type-2A topoisomerase that senses the catenation of sister chromatids following DNA replication, directly interacts with BLM within a region of BLM that includes amino acids 489-587. Topoisomerase IIα stimulates BLM helicase activity with DNA substrates mimicking early recombination intermediates, a 3’

108 overhang or a bubble (Russell et al., 2011). BLM lacking the topoisomerase IIα interaction domain fails to recover elevated chromosome breaks in cells without endogenous BLM, as measured by micronuclei numbers. These data suggested that the physical interaction between BLM and topoisomerase IIα was required for genomic stability in vivo. Understanding the regulation of the BLM/ topoisomerase IIα interaction is the topic of this dissertation research.

BLM regulation by post-translational modifications, including phosphorylation,

SUMOylation or ubiquitination, is vital for its specific cellular functions and localization

(Ouyang et al., 2013, Wang et al., 2013). Post-translational BLM modifications affecting helicase activity have not been previously reported. Preliminary data from our laboratory suggested that phosphorylation is a negative regulator of helicase activity, but that it is required for topoisomerase IIα-mediated stimulation of helicase activity (Kiersey, 2012).

This thesis tests the hypothesis that phosphorylation regulates the interaction between

BLM and topoisomerase IIα to prevent chromosome breakage, and confirms that global phosphorylation negatively regulates helicase activity.

Lambda phosphatase treatment in vitro is a common method to detect protein characteristics that may be controlled by phosphorylation as its activity is directed toward phosphorylated serine, threonine and tyrosine residues. BLM was expressed in S. cerevisiae, and purified by FPLC. To test whether lambda phosphatase treatment would alter BLM enzymatic activity, purified BLM was treated with phosphatase and subjected to protein mobility gel shift assays, in-gel digestion and examination by LC-mass spectrometry. BLM was sensitive to lambda phosphatase treatment and was subsequently

109 used in additional experiments. Helicase assays were performed with a 3’ overhang DNA substrate, a structure that mimics a double-strand DNA break (DSB), and demonstrated that phosphatased BLM had a greater specific activity in DNA unwinding. Although we did not pursue these findings further, we would predict that this observation is a complex event potentially involving a number of phosphorylation sites.

BLM and topoisomerase IIα expression levels are cell cycle-regulated; both proteins are most prevalent during mitosis when BLM is highly phosphorylated (Russell et al., 2011). Therefore, we tested the hypothesis that BLM phosphorylation controls its interaction with topoisomerase IIα. We demonstrate using phosphatased BLM that BLM phosphorylation is required for topoisomerase IIα-mediated stimulation of BLM helicase activity with a 3’ overhang substrate. Since this DNA substrate mimics a DNA DSB and

Chk2 phosphorylates unidentified sites within the first 660 amino acids of BLM (Kaur et al., 2010), we predicted that in vitro phosphorylation by Chk2 would recover topoisomerase IIα-mediated stimulation of dephosphorylated BLM by phosphorylating a specific amino acid or amino acids. Indeed, Chk2 phosphorylation of lambda phosphatased-treated BLM recovered topoisomerase IIα-mediated stimulation of BLM.

These data suggest that Chk2 is a key player in regulating the BLM/ topoisomerase IIα interaction by BLM phosphorylation at serines, threonines or tyrosines.

The topoisomerase IIα-interaction region of BLM (489-587) and Chk2 phosphorylation of BLM are required for topoisomerase IIα-mediated helicase stimulation (Russell et al., 2011, Figure 8). These data suggested that specific BLM phosphorylation sites within the interaction domain promote the topoisomerase IIα-

110 mediated stimulation of BLM helicase activity. Putative phosphorylation sites in the

BLM/topoisomerase IIα interaction domain (498-587) were identified using four different phosphorylation site prediction programs: KinasePhos 2.0, NetPhos 2.0, Phosida and

PPSP. Fifteen putative phosphorylation sites were identified (Figure 11, Keirsey, 2012).

The relevant solubility accessibility (RSA) and conservation of each site was examined using SABLE and COBALT, respectively. RSA measures how accessible a putative phosphorylation site is to a potential kinase, while phosphorylation sites vital for protein function typically show conservation across different species. The five single sites with the highest likelihood of being phosphorylated clustered into two groups within the interaction region. Grouping of these high-scoring sites made two clusters: cluster one

(C1) composed of S517/S518 and cluster two (C2) S577/S579/S580. In vitro mutagenesis of BLM was then used to mutate serines to alanine (BLMC1A, BLMC2A) or aspartate

(BLMC1D, BLMC2D) to generate phospho-dead or phospho-mimic versions of each cluster, respectively.

Nearly fifty years ago, Bloom’s syndrome (BS) was described as the first genetically determined human chromosome breakage disorder in man, highlighting the vital role of this disease gene in preventing or repairing chromosome breaks (German et al., 1965). BLM was positionally cloned using somatic crossover point mapping in 1995 and was identified as a RecQ-like DNA helicase (Ellis et al., 1995). Subsequent biochemical characterizations established a role for BLM in the repair of stalled replication forks and DNA double strand break repair, among other processes (reviewed in Larson and Hickson 2013). Protein partners include several DNA repair proteins,

111 including many members of the topoisomerase family. Russell et al. (2011) reported that

BLM protein without the topoisomerase IIα-interaction region (Δ489-587) failed to reduce the number of micronuclei (used as a measure of chromosome breakage) in a

BLM-/- cell line and that the interaction of BLM and topoisomerase IIα is required to correct the elevated chromosome breakage characteristic of cells lacking the BLM helicase.

Phospho-site mutations were made within the topoisomerase IIα-interaction region and these cluster mutants were tested for their ability to recover the elevated number of micronuclei in GM08505 (BLM-/-) cells. Cells were transfected with pEGFP- empty, pEGFP-BLM, pEGFP-BLMD795A (helicase-dead mutant), pEGFP-BLMΔ489-

587, pEGFP-BLMC1A, pEGFP-BLMC1D, pEGFP-BLMC2A or pEGFP-BLMC2D and were then fixed and examined for micronuclei. Cells transfected with vectors expressing mutated cluster 1 (S517/S518) to either alanine (BLMC1A) or aspartate (BLMC1D) exhibit recovery comparable to those transfected with wild-type BLM. Cells transfected with vectors expressing mutated cluster 2 (S577/S579/S580) show a phosphorylation- dependent recovery only with the phospho-mimic BLMC2D trending toward a wild-type

BLM recovery (53.8% compared to 48.5%). In comparison, the phospho-dead BLMC2A fails to reduce significantly the percentage of cells containing micronuclei (66.3%, p=0.0239). Single mutants of each site within this phosphosite cluster (577A/D, 579A/D,

580A/D) behave similarly to wild-type BLM, as do double mutants (577/579A,

577/580A, 579/580A). These observations suggest that all three serines within cluster 2 play a critical role in micronuclei recovery, that none alone is capable of regulating this

112 effect and that phosphorylation of these three serines is the likely modulator of this recovery.

Cluster mutants were tested for their ability to reduce DSBs in GM08505 (BLM-/-) cells using the comet assay as a complementary approach. Similar to the data from the micronuclei assay, BLMC2D behaved identically to wild-type BLM with each vector reducing DSBs. BLMC2A fails to reduce DSBs once again suggesting that cluster 2 plays a critical role in the ability of BLM to recover DSBs and that phosphorylation of these three serines is the likely modulator of this recovery.

BLMC2A fails to reduce the micronuclei in transfected BLM-/- cells, we next tested whether serines 577, 579 and 580 could control the co-localization of BLM with topoisomerase IIα. Co-localization was examined during G1/S- and G2/M-phases of the cell cycle. BLM-/- cells were transfected with pEGFP-BLM, pEGFP-BLMΔ489-587, pEGFP-BLMC2A or pEGFP-BLMC2D. Immunofluorescence studies demonstrate that phospho-dead mutant BLMC2A protein is significantly reduced in its co-localization with topoisomerase IIα in G2/M-phase. Additionally, BLMC2A exhibited higher levels of ultra-fine bridges, but not anaphase bridges, than wild-type BLM and BLMC2D.

Unfortunately, localization of topoisomerase IIα at UFBs was not observed. Localization to PML bodies and the nucleolus was examined to rule out other changes in cellular localization for these mutants. BLMC1A, BLMC1D, BLMC2A and BLMC2D localize to

113

PML bodies and the nucleolus as does wild-type BLM. Interestingly, all of the BLM phospho-mutants retain the ability to associate with topoisomerase IIα in in vitro immunoprecipitation assays. One caveat for these experiments is that the level of sensitivity needed to detect small differences in protein-protein interactions is not possible with the antibodies and proteins used. Immunoprecipitation from in vivo cell lysates or ELISA assays with varying amounts of BLM or topoisomerase IIα may overcome this lack of sensitivity. In total, these data show that phosphorylation of serines

577, 579 and 580 of BLM alters BLM and topoisomerase IIα co-localization in vivo but changes in physical interaction are inconclusive.

Topoisomerase IIα stimulates BLM helicase activity in a phosphorylation- dependent manner. To determine whether the phosphorylation-mutants BLMC1D,

BLMC1A BLMC2D or BLMC2A had a similar characteristic, we performed time- dependent helicase assays with and without the addition of topoisomerase IIα using a 3’ overhang DNA substrate. The basal level of substrate unwinding, measured by specific activity, of each of the mutants was not affected. However upon the addition of topoisomerase IIα, both BLMC2D and BLMC2A exhibited a significantly reduced topoisomerase IIα-mediated stimulation. There were no significant differences between the specific activities of BLMC2D+topoisomerase IIα (BLMC2D+TOP2A) and

BLMC2A+topoisomerase IIα (BLMC2A+TOP2A). This finding could reflect the type of amino acid mutation made (serine to aspartate) as a phospho-mimic, as this does not exactly reproduce in vivo phosphorylation (Posada and Cooper, 1992). It is also possible

114 that the simultaneous mutagenesis of the three sites, 577, 579 and 580 masks single positive or single negative effects from each of the serines separately.

Chk2 phosphorylation of phosphatased wild-type BLM recovers topoisomerase

IIα-mediated stimulation of its helicase activity. Additional helicase assays using phosphatased-BLMC2D and phosphatased-BLMC2A show that phosphorylation by

Chk2 is unable to recover topoisomerase IIα-mediated stimulation when serines 577, 579 and 580 are mutated. These data indicate that serines 577, 579 or 580 or a combination of these sites in BLM cluster two are Chk2 phosphorylation targets that regulate the functional interactions of BLM and topoisomerase IIα. Mass spectrometry data did not identify these sites in samples directly purified from S. cerevisiae. In vitro phosphorylation by Chk2 followed by mass spectrometry may identify these sites when modified more completely.

Finally, we tested the role of Chk2 in the DNA damage response of BLM by transient Chk2 inhibition in cultured cells. BLM-/- cells were transfected with pEGFP- empty, pEGFP-BLM, pEGFP-D795A, pEGFP-BLMΔ489-587, pEGFP-BLMC2A or pEGFP-BLMC2D. Transfected cells were then treated with Chk2 inhibitor and subjected to the neutral comet assay to visualize DNA DSBs. Inhibition of Chk2, confirmed by western, increases the tail moment, a measure of DSBs, in cells transfected with pEGFP- empty, pEGFP-BLM, pEGFP-D795A, pEGFP-BLMΔ489-587 or pEGFP-BLMC2A indicating the presence of unrepaired DNA DSBs. However, the mean tail moment value in cells transfected with pEGFP-BLMC2D is significantly lower. These data suggest that

115 aspartate-substituted BLMC2D can represent a constitutively active form of BLM in vivo that can facilitate DNA damage repair after Chk2 inhibition.

As topoisomerase IIα stimulates BLM helicase activity, we examined whether the reciprocal was true by testing whether BLM had an effect on topoisomerase IIα enzymatic activities. Topoisomerase IIα is a type II topoisomerase that can both decatenate DNA and relax supercoiled DNA. Previous work from our laboratory ruled out a function for BLM in the stimulation in topoisomerase IIα decatenation (Russell et al., 2011). Preliminary results from these dissertation experiments indicate that BLM may stimulate topoisomerase IIα in the relaxation of supercoiled DNA. Additionally, both

BLMC2A and BLMC2D show stimulation of topoisomerase IIα in the relaxation of supercoiled DNA. Future studies will determine the role of BLM-mediated stimulation of topoisomerase IIα relaxation of supercoiled DNA in vitro and in vivo.

This thesis describes a novel pathway regulating the ability of BLM to correct chromosome breakage. We describe Chk2 phosphorylation of BLM at serines 577, 579 and 580 as the key step in its ability to interact with topoisomerase IIα. This functional interaction then reduces chromosome breakage. We hypothesize that the ability of BLM to reduce chromosome breakage has two components: first, topoisomerase IIα stimulates

BLM helicase activity to promote HR-mediated repair of DSBs to form non-crossover products; and second, that BLM phosphorylation and its interaction with topoisomerase

IIα allows for proper topoisomerase IIα localization to sites of catentated DNA, perhaps at ultra-fine anaphase bridges. The first statement is strongly supported by data presented in this thesis, while additional experiments examining co-localization of BLM and

116 topoisomerase IIα at sites of catentated DNA would provide data to support the second statement. While we have visualized a higher number of ultra-fine bridges in cells when

BLMC2A is present, we have not been successful in the visualization of topoisomerase

IIα at these structures. Co-localization studies supplemented with Chk2 inhibition would provide additional support of our hypothesis. Other reports support this hypothesis as in the absence of BLM, topoisomerase IIα fails to localize to the centromere resulting in a higher frequency of anaphase ultra-fine bridges and centromeric nondisjunction (Rouzeau et al., 2012).

117

Figure 27: Model for the role of Chk2 phosphorylation in BLM/ topoisomerase IIα interaction to resolve chromosome breaks. DNA DSBs activate the ATM kinase which phosphorylates Chk2 and in turn Chk2 phosphorylates BLM S577, S579 and S580. BLM phosphorylation promotes its interaction and co-localization with topoisomerase IIα, specifically in M-phase. This functional interaction of BLM and topoisomerase IIα increases BLM helicase activity and topoisomerase IIα relaxation activity, while decreases the presence of ultra-fine bridges and micronuclei. BLM would dissolves hemicatenates between sister chromatids to form non-crossover products, while topoisomerase IIα would decatenate and relax supercoiled DNA. We propose that this phosphorylation-mediated interaction is also required for proper BLM/topoisomerase IIα localization to anaphase bridges and ultra-fine bridges (UFBs) to resolve chromosome breaks, separate duplicated chromosomes, and prevent lagging fragments from persisting through cell division 118

Those affected by BS have an increased risk of cancers of nearly every type. This thesis demonstrates that the Chk2/BLM/topoisomerase IIα interactions are critical for preventing chromosome breakage in a DNA repair pathway that may be required to prevent tumor formation. Therapeutics that disrupt Chk2 function certainly disrupt many aspects of the DNA damage response, not only the interaction of BLM and topoisomerase

IIα. Additionally, we show that Chk2 inhibition in cells with or without BLM expression results in a higher accumulation of DNA damage than non-treated cells. This finding lends support to the idea that Chk2 inhibition could be combined with other chemotherapeutics, or used in tumors already carrying DNA repair gene mutations, to create synthetic lethality. Synthetic lethality is based on the unique balance of tumor cells’ ability to promote mutations to gain a survival advantage while also being dependent on adequately functioning DNA repair mechanisms in order to maintain cell division. Tumor cells become “addicted” to alternative DNA repair pathways other than the one in which disruption led to the ability of the tumor to acquire other tumor- promoting mutations. One example of synthetic lethality occurs in BRCA1/2-mutated breast and ovarian cancers, in which one or the other of these essential DNA DSB repair protein is lost. These tumors are characterized by reliance on the poly-ADP ribose polymerase (PARP1) for replication fork progression during replication to permit continued cell division. Inhibition of PARP1 in these tumors leads to catastrophic and non-repairable DNA DSBs, and cell death (Bryant et al., 2005). This hypothesis is

119 supported by recent findings that a novel Chk2 inhibitor (CCT241533) is synthetically lethal with PARP1 inhibitors in human tumor cell lines (Anderson et al., 2011).

This thesis characterizes how the interaction and localization of BLM and topoisomerase IIα is controlled by the Chk2 kinase to resolve chromosome breaks and prevent the formation of micronuclei during M-phase of the cell cycle. The identification of specific serines 577, 579 and 580 in the control of BLM/topoisomerase IIα co- localization and enhanced helicase activity also suggests that this cluster represents a region of the protein, as does the Chk2 kinase, that can be manipulated to induce or repair chromosome breaks. These studies also tell us how one of the primary cellular defects associated with BS occurs, although it is unclear whether the chromosome breaks in BS are the result of the absence of BLM, improperly localized topoisomerase IIα to anaphase bridges, or both.

120

Bibliography

Ababou, M., Dutertre, S., Lecluse, Y., Onclercq, R., Chatton, B., Amor-Gueret, M. (2000) ATM-dependent phosphorylation and accumulation of endogenous BLM protein in response to ionizing radiation. Oncogene 19, 5955-5963.

Acharya, S., Kaul, Z., Gocha, A.S., Martinez, A.R., Harris, J., Parvin, J.D., Groden, J. (2014) Association of BLM and BRCA1 during telomere maintenance in ALT cells. PLoS One 9(8), e103819.

Akimitsu, N., Adachi, N., Hirai, H., Hossain, M.S., Hamamoto, H., Kobayashi, M., Aratani, Y., Koyama, H., Sekimizu, K. (2003) Enforced cytokinesis without complete nuclear division in embryonic cells depleting the activity of DNA topoisomerase IIalpha. Genes Cells 8, 393-402.

Anderson, V.E., Walton, M.I., Eve, P.D., Boxall, K.J., Antoni, L., Caldwell, J.J., Aherne, W., Pearl, L.H., Oliver, A.W., Collins, I., Garrett, M.D. (2011) CCT241533 is a potent and selective inhibitor of CHK2 that potentiates the cytotoxicity of PARP inhibitors. Cancer Res 71, 463-472.

Barefield, C., and Karlseder, J. (2012) The BLM helicase contributes to telomere maintenance through processing of late-replicating intermediate structures. Nucleic Acids Res 40, 7358-7367.

Bartek, J., and Lukas, J. (2003) Chk1 and Chk2 kinases in checkpoint control and cancer. Cancer Cell 3, 421-429.

Baumann, C., Korner, R., Hofmann, K., Nigg, E.A. (2007) PICH, a centromere- associated SNF2 family ATPase, is regulated by Plk1 and required for the spindle checkpoint. Cell 128, 101–114.

Beresten, S., Stan, R., van Brabant, A., Ye, T., Naureckiene, S., Ellis, N. (1999) Purification of overexpressed hexahistidine-tagged BLM N431 as oligomeric complexes. Protein Expr Purif 17, 239-248.

Bernardi, R., and Pandolfi, PP. (2007) Structure, dynamics, and functions of promyelocytic leukaemia nuclear bodies. Nat Rev Mol Cell Biol 8, 1006–1016.

Bhattacharyya, S., Keirsey, J., Russell, B., Kavecansky, J., Lillard-Wetherell, K., Tahmaseb, K., Turchi, J.J., Groden, J. (2009) Telomerase-associated protein 1, HSP90, and topoisomerase IIalpha associates directly with the BLM helicase in immortalized cells using ALT and modulate its helicase activity using telomeric DNA substrates. J Biol Chem 284, 14966-14977.

121

Bischof, O., Kim, S.H., Irving, J., Beresten, S., Ellis, N.A., Campisi, J. (2001) Regulation and localization of the Bloom syndrome protein in response to DNA damage. J Cell Biol 153, 367-380.

Bloom, D. (1954) Congenital telangiectatic erythema resembling lupus erythematosus in dwarfs; probably a syndrome entity. AMA Am J Dis Child 88, 754-758.

Bohr, V.A. (2008) Rising from the RecQ-age: The role of human RecQ helicases in genome maintenance. Trends Biochem Sci 33, 609-620.

Bryant, H.E., Schultz, N., Thomas, H.D., Parker, K.M., Flower, D., Lopez, E., Kyle, S., Meuth, M., Curtin, N.J., Helleday, T. (2005) Specific killing of BRCA2-deficient tumours with inhibitors of poly (ADP-ribose) polymerase. Nature 434, 913-917.

Bromberg, K.D., Vélez-Cruz, R., Burgin, A.B., Osheroff, N. (2004) DNA ligation catalyzed by human topoisomerase II alpha. Biochemistry 43, 13416-13423.

Brosh, R.M. Jr., Li, J.L., Kenny, M.K., Karow, J.K., Cooper, M.P., Kureekattil, R.P., Hickson, I.D., Bohr, V.A. (2000) Replication protein A physically interacts with the Bloom’s syndrome protein and stimulates its helicase activity. J Biol Chem 275, 23500- 23508.

Chaganti, R.S., Schonberg, S., German, J. (1974) A manyfold increase in sister chromatid exchanges in Bloom's syndrome lymphocytes. Proc Natl Acad Sci 71, 4508-4512.

Champoux, J.J. (2001) DNA topoisomerases: Structure, function and mechanism. Annu Rev Biochem 70, 369-413.

Chan, K.L., North, P.S., Hickson, I.D. (2007) BLM is required for faithful chromosome segregation and its localization defines a class of ultrafine anaphase bridges. EMBO J 26, 3397-4309.

Chan, K.L., Palmai-Pallag, T., Ying, S., Hickson, I.D. (2009) Replication stress induces sister-chromatid bridging at fragile site loci in mitosis. Nat Cell Biol 11, 753-760.

Davalos, A.R., and Campisi, J. (2003) Bloom syndrome cells undergo p53-dependent apoptosis and delayed assembly of BRCA1 and NBS1 repair complexes at stalled replication forks. J Cell Biol 162, 1197-1209.

Davies, S.L., North, P.S., Dart, A., Lakin, N.D., Hickson, I.D. (2004) Phosphorylation of the Bloom's syndrome helicase and its role in recovery from S-phase arrest. Mol Cell Biol 3, 1279-1291.

122

Druker, B., Talpaz, M., Resta, D., Peng, B., Buchdunger, E., Ford, J., Lydon, N., Kantarjian, H., Capdeville, R., Ohno-Jones, S., and Sawyers, C. (2001) Efficacy and safety of a specific inhibitor of the BCR-ABL tyrosine kinase in chronic myeloid leukemia. N Engl J Med. 344, 1031-1037.

Dutertre, S., Ababou, M., Onclercq, R., Delic, J., Chatton, B., Jaulin, C., Amor-Guéret, M. (2000) Cell cycle regulation of the endogenous wild-type Bloom's syndrome DNA helicase. Oncogene 19, 2731-2738.

Eladad, S., Ye, T.Z., Hu, P., Leversha, M., Beresten, S., Matunis, M.J., Ellis, N.A. (2005) Intra-nuclear trafficking of the BLM helicase to DNA damage-induced foci is regulated by SUMO modification. Hum Mol Genet 14, 1351-1365.

Ellis, N.A., Groden, J., Ye, T,Z., Straughen, J., Lennon, D.J., Ciocci, S., Proytcheva, M., German, J. (1995) The Bloom's syndrome gene product is homologous to RecQ helicases. Cell 83, 655-666.

Fenech, M. (2007) Cytokinesis-block micronucleus cytome assay. Nat Protoc 2, 1084- 1104.

Fischer, E., and Krebs, E. (1955) Conversion of phosphorylase B to phosphorylase A in muscle extracts. J Biol Chem 216, 121-132.

Fortune, J.M., and Osheroff, N. (1998) Merbarone inhibits the catalytic activity of human topoisomerase IIalpha by blocking DNA cleavage. J Biol Chem 273, 17643-17650.

German, J. (1997) Bloom's syndrome. XX. The first 100 cancers. Cancer Genet Cytogenet 93, 100-106.

German, J., Archibald, R., Bloom, D. (1965) Chromosomal breakage in a rate and probably genetically determined syndrome of man. Science 148, 506-507.

German, J., Sanz, M.M., Ciocci, S., Ye, T.Z., Ellis, N.A. (2007) Syndrome-causing mutations of the BLM gene in persons in the Bloom's syndrome registry. Hum Mutat 28, 743-753.

German, J., Schonberg, S., Louie, E., Chaganti, R.S. (1977) Bloom's syndrome. IV. Sister-chromatid exchanges in lymphocytes. Am J Hum Genet 29, 248-255.

Germann, S.M., Schramke, V., Pedersen, R.T., Gallina, I., Eckert-Boulet, N., Oestergaard, V.H., Lisby, M. (2014) TopBP1/Dpb11 binds DNA anaphase bridges to prevent genome instability. J Cell Biol 204, 45-59.

123

Gharibyan, V., and Youssoufian, H. (1999) Localization of the Bloom syndrome helicase to punctate nuclear structures and the nuclear matrix and regulation during the cell cycle: Comparison with the Werner's syndrome helicase. Mol Carcinog 26, 261-273.

Grabarz, A., Guirouilh-Barbat, J., Barascu, A., Pennarun, G., Genet, D., Rass, E., Germann, S.M., Bertrand, P., Hickson, I.D., Lopez, B.S. (2013) A role for BLM in double-strand break repair pathway choice: Prevention of CtIP/Mre11-mediated alternative nonhomologous end-joining. Cell Rep 5, 21-28.

Grierson, P.M., Acharya, S., Groden, J. (2013) Collaborating functions of BLM and DNA topoisomerase I in regulating human rDNA transcription. Mutat Res 743, 89-96.

Grierson, P.M., Lillard, K., Behbehani, G.K., Combs, K.A., Bhattacharyya, S., Acharya, S., Groden, J. (2012) BLM helicase facilitates RNA polymerase I-mediated ribosomal RNA transcription. Hum Mol Genet 21, 1172-1183.

Gross, S.J., Pletcher, B.A., Monaghan, K.G. (2008) Carrier screening in individuals of Ashkenazi Jewish descent. Genet Med 10, 54-56.

Guo, R.B., Rigolet, P., Ren, H., Zhang, B., Zhang, X.D., Dou, S.X., Wang, P.Y., Amor- Gueret, M., Xi, X.G. (2007) Structural and functional analyses of disease-causing missense mutations in Bloom syndrome protein. Nucleic Acids Res 35, 6297-6310.

Gyimesi, M., Pires, R.H., Billington, N., Sarlós, K., Kocsis, Z.S., Módos, K., Kellermayer, M.S., Kovács, M. (2013) Visualization of human Bloom's syndrome helicase molecules bound to homologous recombination intermediates. FASEB J 27, 4954-4964.

Hand, R., and German, J. (1975) A retarded rate of DNA chain growth in Bloom's syndrome. Proc Natl Acad Sci 72, 758-762.

Hickson, I.D. (2003) RecQ helicases: Caretakers of the genome. Nat Rev Cancer 3, 169- 178.

Holm, C., Stearns, T., Botstein, D. (1989) DNA topoisomerase II must act at mitosis to prevent nondisjunction and chromosome breakage. Mol Cell Biol 9, 159-168.

Huber, M.D., Duquette, M.L., Shiels, J.C., Maizels, N. (2006) A conserved G4 DNA binding domain in RecQ family helicases. J Mol Biol 358, 1071-1080.

Johnson, M., Phua, H.H., Bennett, S.C., Spence, J.M., Farr, C.J. (2009) Studying vertebrate topoisomerase 2 function using a conditional knockdown system in DT40 cells. Nucleic Acids Res 37, e98.

124

Kaneko, H., Orii, K.O., Matsui, E., Shimozawa, N., Fukao, T., Matsumoto, T., Shimamoto, A., Furuichi, Y., Hayakawa, S., Kasahara, K., Kondo, N. (1997) BLM (the causative gene of Bloom syndrome) protein translocation into the nucleus by a nuclear localization signal. Biochem Biophys Res Commun 240, 348-353.

Karow, J.K., Chakraverty, R.K., Hickson, I.D. (1997) The Bloom's syndrome gene product is a 3'-5' DNA helicase. J Biol Chem 272, 30611-30614.

Karow, J.K., Newman, R.H., Freemont, P.S., Hickson, I.D. (1999) Oligomeric ring structure of the Bloom’s syndrome helicase. Curr Biol 9, 597-600.

Kaufmann, W.K., and Kies, P.E. (1998) DNA signals for G2 checkpoint response in diploid human fibroblasts. Mutat Res 400, 153-167.

Kaur, S., Modi, P., Srivastava, V., Mudgal, R., Tikoo, S., Arora, P., Mohanty, D., Sengupta, S. (2010) Chk1-dependent constitutive phosphorylation of BLM helicase at serine 646 decreases after DNA damage. Mol Cancer Res 8, 1234-1247.

Ke, Y., Huh, J.W., Warrington, R., Li, B., Wu, N., Leng, M., Zhang, J., Bal, H.L., Li, B., Yu, H. (2011) PICH and BLM limit histone association with anaphase centromeric DNA threads and promote their resolution. EMBO J 30, 3309-2331.

Kerisey, J. (2012) Phosphorylation regulation of the function, localization and protein interactions of the BLM helicase. Masters Thesis, The Ohio State University. https://etd.ohiolink.edu/

Kim, Y.M., and Choi, B.S. (2010) Structure and function of the regulatory HRDC domain from human Bloom syndrome protein. Nucleic Acids Res 38, 7764-7777.

Krebs, E., and Fischer, E. (1955) Phosphorylase activity of skeletal muscle extracts. J Biol Chem 216, 113-120.

Langlois, R.G., Bigbee, W.L., Jensen, R.H., German, J. (1989) Evidence for increased in vivo mutation and somatic recombination in Bloom's syndrome. Proc Natl Acad Sci 86, 670-674.

Larsen, N.B., and Hickson, I.D. (2013). RecQ helicases: Conserved guardians of genomic integrity. Adv Exp Med Biol 767, 161-184.

Leng, M., Chan, D.W., Luo, H., Zhu, C., Qin, J., Wang, Y. (2006) MPS1-dependent mitotic BLM phosphorylation is important for chromosome stability. Proc Natl Acad Sci 103, 11485-11490.

125

Lillard-Wetherell, K., Machwe, A., Langland, G.T., Combs, K.A., Behbehani, G.K., Schonberg, S.A., German, J., Turchi, J.J., Orren, D.K., Groden, J. (2004) Association and regulation of the BLM helicase by the telomere proteins TRF1 and TRF2. Hum Mol Genet 13, 1919-1932.

Lucas, I., and Hyrien, O. (2000) Hemicatenanes form upon inhibition of DNA replication. Nucleic Acids Res 28, 2187-2193.

Lukas, C., Bartkova, J., Latella, L., Falck, J., Mailand, N., Schroeder, T., Sehested, M., Lukas, J., Bartek. J. (2001) DNA damage-activated kinase Chk2 is independent of proliferation or differentiation yet correlates with tissue biology. Cancer Res 61, 4990- 4993.

Luo, K., Yuan, J., Chen, J., Lou, Z. (2009) Topoisomerase IIalpha controls the decatenation checkpoint. Nat Cell Biol 11, 204-210.

Manning, G., Whyte, D. B., Martinez, R., Hunter, T., Sudarsanam, S. (2002) The protein kinase complement of the human genome. Science 298, 1912-1934.

Manthei, K.A., and Keck, J.L. (2013) The BLM dissolvasome in DNA replication and repair. Cell Mol Life Sci 70, 4067-4084.

McClendon, A.K., Rodriguez, A.C., Osheroff, N. (2005) Human topoisomerase IIalpha rapidly relaxes positively supercoiled DNA: Implications for enzyme action ahead of replication forks. J Biol Chem 280, 39337-39345.

Meetei, A.R., Sechi, S., Wallisch, M., Yang, D., Young, M.K., Joenje, H., Hoatlin, M.E., Wang, W. (2003) A multiprotein nuclear complex connects Fanconi anemia and Bloom syndrome. Mol Cell Biol 23, 3417-3426.

Nguyen, G.H., Tang, W., Robles, A.I., Beyer, R.P., Gray, L.T., Welsh, J.A., Schetter, A.J., Kumamoto, K., Wang, X.W., Hickson, I.D., Maizels, N., Monnat, R.J. Jr., Harris, C.C. (2014) Regulation of gene expression by the BLM helicase correlates with the presence of G-quadruplex DNA motifs. Proc Natl Acad Sci 111, 9905-9910.

Osheroff, N., Shelton, E.R., Brutlag, D.L. (1983) DNA topoisomerase II from Drosophila melanogaster: Relaxation of supercoiled DNA. J Biol Chem 258, 9536-9543.

Ouyang, K.J., Yagle, M.K., Matunis, M.J., Ellis, N.A. (2013) BLM SUMOylation regulates ssDNA accumulation at stalled replication forks. Front Genet 4,167.

Popuri, V., Bachrati, C.Z., Muzzolini, L., Mosedale, G., Costantini, S., Giacomini, E., Hickson, I.D., Vindigni, A. (2008) The human RecQ helicases, BLM and RECQ1, display distinct DNA substrate specificities. J Biol Chem 283, 17766-17776. 126

Posada, J., and Cooper, J.A. (1992) Requirements for phosphorylation of MAP kinase during meiosis in Xenopus oocytes. Science 255, 212-215.

Prosperi, E., Negri, C., Marchese, G., Ricotti, G.C. (1994) Expression of the 170-kDa and 180-kDa isoforms of DNA topoisomerase II in resting and proliferating human lymphocytes. Cell Prolif 27, 257-267.

Ramamoorthy, M., Tadokoro, T., Rybanska, I., Ghosh, A.K., Wersto, R., May, A., Kulikowicz, T., Sykora, P., Croteau, D.L., Bohr, V.A. (2012) RECQL5 cooperates with Topoisomerase II alpha in DNA decatenation and cell cycle progression. Nucleic Acids Res 40, 1621-3165.

Rao, V.A., Conti, C., Guirouilh-Barbat, J., Nakamura, A., Miao, Z.H., Davies, S.L., Sacca, B., Hickson, I.D., Bensimon, A., Pommier, Y. (2007) Endogenous gamma-H2AX- ATM-Chk2 checkpoint activation in Bloom’s syndrome helicase deficient cells is related to DNA replication arrested forks. Mol Cancer Res 5, 713-724.

Rao, V.A., Fan, A.M., Meng, L., Doe, C.F., North, P.S., Hickson, I., Pommier, Y. (2005) Phosphorylation of BLM, dissociation from topoisomerase IIIα, and colocalization with γ-H2AX after topoisomerase I-induced replication damage. Mol Cell Biol 25, 8925-8931.

Rosin, M.P., and German, J. (1985) Evidence for chromosome instability in vivo in Bloom syndrome: Increased numbers of micronuclei in exfoliated cells. Hum Genet 71, 187-191.

Rouzeau, S., Cordelières, F.P., Buhagiar-Labarchède, G., Hurbain, I., Onclercq-Delic, R., Gemble, S., Magnaghi-Jaulin, L., Jaulin, C., Amor-Guéret, M. (2012) Bloom's syndrome and PICH helicases cooperate with topoisomerase IIα in centromere disjunction before anaphase. PLoS One 7, e33905.

Russell, B., Bhattacharyya, S., Keirsey, J., Sandy, A., Grierson, P., Perchiniak, E., Kavecansky, J., Acharya, S., Groden, J. (2011) Chromosome breakage is regulated by the interaction of the BLM helicase and topoisomerase IIalpha. Cancer Res 71, 561-571.

Sanz, M.M., Proytcheva, M., Ellis, N.A., Holloman, W.K., German, J. (2000) BLM, the Bloom's syndrome protein, varies during the cell cycle in its amount, distribution, and co- localization with other nuclear proteins. Cytogenet Cell Genet 91, 217-223.

Selak, N., Bachrati, C.Z., Shevelev, I., Dietschy, T., van Loon, B., Jacob, A., Hübscher, U., Hoheisel, J.D., Hickson, I.D., Stagljar, I. (2008) The Bloom's syndrome helicase (BLM) interacts physically and functionally with p12, the smallest subunit of human DNA polymerase delta. Nucleic Acids Res 36, 5166-5179.

127

Sengupta, S., Linke, S.P., Pedeux, R., Yang, Q., Farnsworth, J., Garfield, S.H., Valerie, K., Shay, J.W., Ellis, N.A., Wasylyk, B., Harris, C.C. (2003) BLM helicase-dependent transport of p53 to sites of stalled DNA replication forks modulates homologous recombination. EMBO J 22, 1210-1222.

Sharma, S., Sommers, J.A., Wu, L., Bohr, V.A., Hickson, I.D., Brosh, R.M. Jr. (2004) Stimulation of flap endonuclease-1 by the Bloom's syndrome protein. J Biol Chem 279, 9847-9856.

Stavropoulos, D.J., Bradshaw, P.S., Li, X., Pasic, I., Truong, K., Ikura, M., Ungrin, M., and Meyn, M.S. (2002) The Bloom syndrome helicase BLM interacts with TRF2 in ALT cells and promotes telomeric DNA synthesis. Hum Mol Genet 11, 3135-3144.

Stolz, A., Ertych, N., Bastians, H. (2010) Tumor suppressor Chk2: Regulator of DNA damage response and mediator of chromosomal stability. Clin Cancer Res 17, 401-405.

Stracker, T.H., Usui, T., Petrini, J.H. (2009) Taking the time to make important decisions: The checkpoint effector kinases Chk1 and Chk2, and the DNA damage response. DNA Repair 8, 1047-1054.

Straughen, J.E., Johnson, J., McLaren, D., Proytcheva, M., Ellis, N., German, J., and Groden, J. (1998) A rapid method for detecting the predominant Ashkenazi Jewish mutation in the Bloom's syndrome gene. Hum Mutat 11, 175-8.

Sun, H., Karow, J.K., Hickson, I.D., Maizels, N. (1998) The Bloom's syndrome helicase unwinds G4 DNA. J Biol Chem 273, 27587-27592.

Therman, E., Otto, P.G., and Shahidi, N.T. (1981) Mitotic recombination and segregation of satellites in Bloom’s syndrome. Chromosoma 82, 627-636.

Tikoo, S., Madhavan, V., Hussain, M., Miller, E.S., Arora, P., Zlatanou, A., Modi, P., Townsend, K., Stewart, G.S., Sengupta S. (2013) Ubiquitin-dependent recruitment of the Bloom syndrome helicase upon replication stress is required to suppress homologous recombination. EMBO J 32, 1778-1792.

Turley, H., Comley, M., Houlbrook, S., Nozaki, N., Kikuchi, A., Hickson, I.D., Gatter, K., Harris, A.L. (1997) The distribution and expression of the two isoforms of DNA topoisomerase II in normal and neoplastic human tissues. Br J Cancer 75, 1340-1346.

Walpita, D., Plug, A.W., Neff, N.F., German, J., Ashley, T. (1999) Bloom’s syndrome protein, BLM, colocalizes with replication protein A in meiotic prophase nuclei of mammalian spermatocytes. Proc Natl Acad Sci U S A 96, 5622-5627.

128

Wang, Y., Cortez, D., Yazdi, P., Neff, N., Elledge, S.J., Qin, J. (2000) BASC, a super complex of BRCA1-associated proteins involved in the recognition and repair of aberrant DNA structures. Genes Dev 14, 927-939.

Wang, L.H., Mayer, B., Stemmann, O., Nigg, E.A. (2010) Centromere DNA decatenation depends on cohesin removal and is required for mammalian cell division. J Cell Sci 1, 806-813.

Wang, J., Chen, J., Gong, Z. (2013) TopBP1 controls BLM protein level to maintain genome stability. Mol Cell 52,667-678.

Watt, P.M., Hickson, I.D., Borts, R.H., Louis, E.J. (1996) SGS1, a homologue of the Bloom's and Werner's syndrome genes, is required for maintenance of genome stability in Saccharomyces cerevisiae. Genetics 144, 935-945.

Watt, P.M., Louis, E.J., Borts, R.H., Hickson, I.D. (1995) Sgs1: A eukaryotic homolog of E. coli RecQ that interacts with topoisomerase II in vivo and is required for faithful chromosome segregation. Cell 81, 253-260.

Wu, L., and Hickson, I.D. (2003) The Bloom’s syndrome helicase suppresses crossing over during homologous recombination. Nature 42, 6870-6874.

Xu, Y.N., Bazeille, N., Ding, X.Y., Lu, X.M., Wang, P.Y., Bugnard, E., Grondin, V., Dou, S.X., Xi, X.G. (2012) Multimeric BLM is dissociated upon ATP hydrolysis and functions as monomers in resolving DNA structures. Nucleic Acids Res 40, 9802-9814.

Yin, J., Sobeck, A., Xu, C., Meetei, A.R., Hoatlin, M., Li, L., Wang, W. (2005) BLAP75, an essential component of Bloom’s syndrome protein complexes that maintain genome integrity. EMBO J 24, 1465-1476.

Zhang, J., Yang, P.L., Gray, N.S. (2009) Targeting cancer with small molecule kinase inhibitors. Nature Reviews Cancer 9, 28-39.

Zhong, S., Hu, P., Ye, T.Z., Stan, R., Ellis, N.A., Pandolfi, P.P. (1999) A role for PML and the nuclear body in genomic stability. Oncogene 18, 7941-7947.

Zhu, J., Zhu, S., Guzzo, C.M., Ellis, N.A., Sung, K.S., Choi, C.Y., Matunis, M.J. (2008) Small ubiquitin-related modifier (SUMO) binding determines substrate recognition and paralog-selective SUMO modification J Biol Chem 283, 29405-294.

129