DOCSLIB.ORG

Bio 102 Practice Problems Recombinant DNA and Biotechnology Multiple Choice: Unless Otherwise Directed, Circle the One Best Answer: 1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Bio 102 Practice Problems Recombinant DNA and Biotechnology Multiple Choice: Unless Otherwise Directed, Circle the One Best Answer: 1 Bio 102 Practice Problems Recombinant DNA and Biotechnology Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which of the following DNA sequences could be the recognition site for a restriction enzyme? A. TGCCGT B. TGCGCA C. TGCTGC D. All of the above. E. None of the above. 2. Which of the following is not needed for DNA sequencing by the method we discussed in class? A. Radioactive primer B. DNA polymerase C. Fluorescent dideoxy nucleotides D. Ordinary nucleotides (dNTPs) E. All of the above are required. 3. What is the key enzyme used in PCR? A. ATP synthase B. Taq DNA polymerase C. DNA ligase D. Restriction enzymes E. Sigma factor Short answer (show your work or thinking to get partial credit): 1. Recombinant human insulin, produced by bacteria carrying a cloned insulin gene, is now the major form of insulin used to treat diabetes. The human insulin gene encodes an mRNA only 333 nucleotides long, but the entire gene spans more than 4000 nucleotides. There are three exons and two introns. a. If we were to clone this gene directly from the nuclear DNA, bacteria would not be able to express the insulin protein. Explain why this is true. This gene has introns; bacteria don't. If we cloned the gene directly, the bacteria would produce mRNA that includes the introns and be unable to splice it. Therefore, no functional protein could be made. b. What technique should be used instead in order to get a functional insulin coding sequence cloned into bacteria? Describe briefly how this technique works. We should use cDNA cloning. In this technique, we isolate mRNA from the cytoplasm of a cell, so that it has already been spliced. We then use reverse transcriptase enzyme to make a DNA copy (cDNA) of the mRNA. This DNA can then be cloned, producing a bacteria-readable gene that lacks introns. c. Every cell in the human body has the same DNA, so every cell has an insulin gene. However, in order to use the technique you described in "b," you would have to start with cells from the pancreas--the only body cells that actually produce the insulin protein . Why are these the only cells that would work? We need insulin mRNA in order to do cDNA cloning. If the cells are the only ones that make insulin protein, then most likely they are also the only ones that make significant amounts of insulin mRNA. 2. Human gene therapy remains a promising possibility but is still plagued by problems. In the table below are listed two possible vectors and two problems. For each combination, please briefly explain if the specific problem is expected to be encountered for the vector. Retroviral Vector Liposome Could be a problem; someone who’s had a retroviral infection before could Should not be a problem. Proteins, Immune be immune to the vector, or if multiple not lipids, usually trigger the immune Response treatments are necessary, development response. of immunity could be a big drawback. Could be a problem, because the Liposomes usually deliver plasmids Insertional retrovirus inserts DNA randomly into or other DNA that won’t integrate Mutagenesis the cell’s genome; it could hit a gene into the genome. Shouldn’t be a by chance. problem. 3. The diagram below represents a section of the human genome. The coding sequence of a gene, YFG, is shown by an arrow, and boxes indicate the locations of some regulatory sequences. Locations of recognition sequences (cut sites) for three common restriction enzymes (EcoRI, BamHI, and NcoI) are also marked. You would like to clone this gene in E. coli for further study. You have available the expression vector (plasmid) shown below: a. Why is it important for this plasmid to be an expression vector? Eukaryotic genes have regulatory signals like enhancers and TATA boxes that are not recognized by bacteria and lack the -10 and -35 sequences that bacterial RNA polymerase needs to start transcription. In addition, eukaryotic ribosomes find the correct AUG codon by scanning from the cap to the first AUG, while bacteria rely on a Shine-Dalgarno sequence in the mRNA. These bacterial regulatory signals are provided by the expression vector. If we use a plasmid that did not have these signals, it's very unlikely that the bacteria would be able to transcribe and translate our gene. b. Why is it important for this plasmid to have an antibiotic-resistance gene? This gives a way to select for bacteria that acquire the plasmid. The frequency of successful transformation is small, so we need a way to know that we got the clone into a cell. Only cells that acquire this plasmid will be able to grow in the presence of this antibiotic. c. What restriction enzyme would you use to clone this gene? Explain your choice. The plasmid has sites for all three restriction enzymes. However, Eco RI cuts the plasmid twice , so we would wind up chopping out a piece of the plasmid, including the needed Shine-Dalgarno region. This is a bad choice. Bam HI is also a bad choice, because it cuts in the middle of the gene we want to clone. We want an enzyme that will leave our gene intact. Not I is the best choice. It will cut our gene out of the genome and makes a single cut for inserting it into the plasmid. Notice that it's not important that the enhancer and TATA sequences will be left behind; the plasmid provides the needed regulatory signals. 4. You would like to use PCR to amplify (make many copies of) the boxed section of the DNA sequence below: 5´ ACGACCGATAGACGACGTAGGACTTACTTACTTACGTAGGCA 3´ 3´ TGCTGGCTATCTGCTGCATCCTGAATGAATGAATGCATCCGT 5´ You ask your lab partner to order a pair of primers that can be used in the PCR reaction. The sequences of the primers he orders are: Primer #1: 5´ ATAGAC 3´ Primer #2: 5´ ACTTAC 3´ a. Oops! Looks like you shouldn’t have trusted your lab partner on this one. Which of the two primers is wrong, and why won’t it work? Primer #1 is OK: it will bind to the bottom strand, and its 3’ end will then be pointed in the right direction for Taq DNA polymerase to synthesize the desired DNA. Primer #2 won’t work, because it binds to other end of the same strand and so its 3’ end is pointed out away from the sequence to be copied: 5’ATAGAC-> 5´ ACTTAC-> 3´ TGCTGGCTATCTGCTGCATCCTGAATGAATGAATGCATCCGT 5´ b. Give the sequence of a primer that will work and could be used instead of the wrong one. Be sure to indicate the 5´ and 3´ ends. We need a primer that will bind to the top strand, with its 3’ end pointed toward the left so that the other strand can be copied. For example, 5’ GTAAGT 3’: 5´ ACGACCGATAGACGACGTAGGACTTACTTACTTACGTAGGCA 3´ <-TGAATG 5’ 5’ATAGAC-> 3´ TGCTGGCTATCTGCTGCATCCTGAATGAATGAATGCATCCGT 5´ 5. You are trying to find the gene responsible for a human genetic disorder. You have mapped the gene to a particular chromosome region, and examining the human genome sequence for that region gives you the nucleotide sequence below: 5’ CATACTTACTACTAGATTACGATTAGACGATTAGGATG|GCC |GAC |TCG |TGC |AGT |AAC | AGC |ATG |ACC |GAG |GCC |TAGACCAGATTAGGAGCCGGACCAGGACGGACCAGCGACT 3’ a. Assuming you are reading the non-coding strand and that there are no introns, find an open reading frame (ORF) in this region. Circle the point where translation will start, and put a box around the point where translation will stop. Then give the number of amino acids in the protein this gene would encode: 12 amino acids (start codon encodes an amino acid; stop codon doesn’t) b. If you wanted to express this gene in E. coli , what would need to be present in your cloning vector to ensure that it will be transcribed and translated? The gene’s promoter sequence won’t be recognized by E. coli’s sigma factor, so you’ll need a prokaryotic promoter (–10 and –35 sequences). E. coli ribosomes can only find the correct start codon by first binding the Shine-Dalgarno sequence, so the vector should also have this sequence positioned just before the desired start codon. c. How might the protein produced by E. coli differ from the protein produced from the same gene in a human cell? The amino-acid sequence (primary structure) will be the same. However, eukaryotic proteins are often modified in the ER or Golgi: carbohydrates added, phosphate groups added, etc. These modifications probably won’t happen in E. coli. Also, it’s possible that the protein won’t be correctly folded, if some specific protein or condition in the eukaryotic cell is needed for folding. 6. You have cloned a cDNA encoding a human hormone, and you hope to produce the hormone in bacteria in order to treat a severe genetic disorder. Unfortunately, when you insert this DNA into a plasmid and transform it into the bacteria, you get no hormone production. Give two valid reasons for your failure, and suggest a possible solution in each case. (1) Hormone must be modified after synthesis; bacteria lack ER and Golgi. Solution: determine the needed modification and try to reproduce it chemically, clone needed enzymes or use a eukaryotic host. (2) cDNA has no promoter and can’t be transcribed. Solution: insert it into an expression vector that includes a promoter. (3) cDNA from a eukaryotic cell doesn’t have a Shine-Dalgarno sequence needed for translation initiation in bacteria. Solution: insert it into an expression vector that includes a promoter. (4) cDNA is made from mRNA, and the mRNA for the hormone will only be present in a cell that normally produces the hormone.
Load more

Recommended publications
  • Introduction of Human Telomerase Reverse Transcriptase to Normal Human Fibroblasts Enhances DNA Repair Capacity
    Vol. 10, 2551–2560, April 1, 2004 Clinical Cancer Research 2551 Introduction of Human Telomerase Reverse Transcriptase to Normal Human Fibroblasts Enhances DNA Repair Capacity Ki-Hyuk Shin,1 Mo K. Kang,1 Erica Dicterow,1 INTRODUCTION Ayako Kameta,1 Marcel A. Baluda,1 and Telomerase, which consists of the catalytic protein subunit, No-Hee Park1,2 human telomerase reverse transcriptase (hTERT), the RNA component of telomerase (hTR), and several associated pro- 1School of Dentistry and 2Jonsson Comprehensive Cancer Center, University of California, Los Angeles, California teins, has been primarily associated with maintaining the integ- rity of cellular DNA telomeres in normal cells (1, 2). Telomer- ase activity is correlated with the expression of hTERT, but not ABSTRACT with that of hTR (3, 4). Purpose: From numerous reports on proteins involved The involvement of DNA repair proteins in telomere main- in DNA repair and telomere maintenance that physically tenance has been well documented (5–8). In eukaryotic cells, associate with human telomerase reverse transcriptase nonhomologous end-joining requires a DNA ligase and the (hTERT), we inferred that hTERT/telomerase might play a DNA-activated protein kinase, which is recruited to the DNA role in DNA repair. We investigated this possibility in nor- ends by the DNA-binding protein Ku. Ku binds to hTERT mal human oral fibroblasts (NHOF) with and without ec- without the need for telomeric DNA or hTR (9), binds the topic expression of hTERT/telomerase. telomere repeat-binding proteins TRF1 (10) and TRF2 (11), and Experimental Design: To study the effect of hTERT/ is thought to regulate the access of telomerase to telomere DNA telomerase on DNA repair, we examined the mutation fre- ends (12, 13).
    [Show full text]
  • Recombinant DNA and Elements Utilizing Recombinant DNA Such As Plasmids and Viral Vectors, and the Application of Recombinant DNA Techniques in Molecular Biology
    Fact Sheet Describing Recombinant DNA and Elements Utilizing Recombinant DNA Such as Plasmids and Viral Vectors, and the Application of Recombinant DNA Techniques in Molecular Biology Compiled and/or written by Amy B. Vento and David R. Gillum Office of Environmental Health and Safety University of New Hampshire June 3, 2002 Introduction Recombinant DNA (rDNA) has various definitions, ranging from very simple to strangely complex. The following are three examples of how recombinant DNA is defined: 1. A DNA molecule containing DNA originating from two or more sources. 2. DNA that has been artificially created. It is DNA from two or more sources that is incorporated into a single recombinant molecule. 3. According to the NIH guidelines, recombinant DNA are molecules constructed outside of living cells by joining natural or synthetic DNA segments to DNA molecules that can replicate in a living cell, or molecules that result from their replication. Description of rDNA Recombinant DNA, also known as in vitro recombination, is a technique involved in creating and purifying desired genes. Molecular cloning (i.e. gene cloning) involves creating recombinant DNA and introducing it into a host cell to be replicated. One of the basic strategies of molecular cloning is to move desired genes from a large, complex genome to a small, simple one. The process of in vitro recombination makes it possible to cut different strands of DNA, in vitro (outside the cell), with a restriction enzyme and join the DNA molecules together via complementary base pairing. Techniques Some of the molecular biology techniques utilized during recombinant DNA include: 1.
    [Show full text]
  • Molecular Cloning of DNA Fragments Produced by Restriction
    Proc. Natl. Acad. Sci. USA Vol. 73, No. 5, pp. 1537-1541, May 1976 Biochemistry Molecular cloning of DNA fragments produced by restriction endonucleases SailI and BamI (DNA joining/plasmid/insertional inactivation of genes/Drosophila melanogaster) DEAN H. HAMER AND CHARLES A. THOMAS, JR. Department of Biological Chemistry, Harvard Medical School, Boston, Massachusetts 02115 Communicated by Bernard D. Dats, February 25,1976 ABSTRACT The highly specific restriction endonucleases cleaves various DNAs about once every 8 kb (kilobases), as SalI and BamI produce DNA fragments with complementary, compared to about once every 4 kb for EcoRI (16, 18). The cohesive termini that can be covalently joined by DNA ligase. resulting fragments have cohesive termini, and can be joined The Escherichia coli kanamycin resistance factor pML21 has to one another in head-to-tail, head-to-head, and one Sall site, at which DNA can be inserted without interfering probably with the expression of drug resistance or replication of the tail-to-tail orientation. Another highly specific restriction en- plasmid. A more convenient cloning vehicle can be made with donuclease that produces cohesive termini is BamI, from Ba- the tetracycline resistance factor pSC101, since insertion of cillus amyloliqefaciens H (G. Wilson and F. Young, personal DNA either at its single site for Sall or at that for BamI inacti- communication). We have shown that it cleaves D. melano- vates plasmid-specified drug resistance but not replication. To gaster DNA about once every 6 kb. This report describes the take advantage of this insertional inactivation, pSC101 was construction and verification of plasmid vehicles that allow one joined to a ColEl-ampicillin resistance plasmid having no Sall site, and to a ColEl-kanamycin resistance plasmid having no to clone and amplify potentially any DNA fragment produced BamI site.
    [Show full text]
  • Purification and Characterization of the Reverse Transcriptase Expressed In
    Volume 270, number 1,2, 76-80 FEBS 08845 September 1990 Purification and characterization of the RNase H domain of HIV-l reverse transcriptase expressed in recombinant Escherichia coli S. Patricia Becerra’, G. Marius Clore2, Angela M. Gronenbornz, Anders R. Karlstr6m3, Stephen J. Stahl‘+, Samuel H. Wilson’ and Paul T. Wingfield 1Laboratory of Biochemistry, NCI, ZLaboratory of Chemical Physics, NIDDK, 3Laboratory of Biochemistry, NHLB and 4Protein Expression Laboratory, National Institutes of Health, Bethesda, MD 20892, USA Received 2 July 1990 The ribonuclease H (RNase H) domain of human immuno-deficiency virus (HIV-l) reverse transcriptase has been produced with the aim of provid- ing sufficient amounts of protein for biophysical studies. A plasmid vector is described which directs high level expression of the RNase H domain under the control of the I PL promoter. The domain corresponds to residues 427-560 of the 66 kDa reverse transcriptase. The protein was expressed in Escherichia cob’ and was purified using ion-exchange and size exclusion chromatography. The purified protein appears to be in a native-like homogeneous conformational state as determined by iH-NMR spectroscopy and circular dichroism measurements. HIV-protease treatment of the RNase H domain resulted in cleavage between Phe-440 and Tyr-441. HIV-l reverse transcriptase; HIV-l RNase H; HIV protease; Protein expression; Protein purification; Protein conformation 1. INTRODUCTION as a separate 15 kDa protein. The purified protein ap- pears suitable for structural studies by both NMR spec- Ribonuclease H (RNase H) activity resides in the C- troscopy and X-ray analysis, thereby providing an addi- terminal region of retroviral polymerases as shown by tional target in the search for therapeutic agents against deletion experiments [ 11, linker insertion [2] and point the spread of HIV infection.
    [Show full text]
  • Saccharomyces Rrm3p, a 5 to 3 DNA Helicase That Promotes Replication
    Downloaded from genesdev.cshlp.org on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press Saccharomyces Rrm3p, a 5؅ to 3؅ DNA helicase that promotes replication fork progression through telomeric and subtelomeric DNA Andreas S. Ivessa,1 Jin-Qiu Zhou,1,2 Vince P. Schulz, Ellen K. Monson, and Virginia A. Zakian3 Department of Molecular Biology, Princeton University, Princeton, New Jersey 08544-1014, USA In wild-type Saccharomyces cerevisiae, replication forks slowed during their passage through telomeric ؅ C1–3A/TG1–3 tracts. This slowing was greatly exacerbated in the absence of RRM3, shown here to encode a 5 ,to 3؅ DNA helicase. Rrm3p-dependent fork progression was seen at a modified Chromosome VII-L telomere at the natural X-bearing Chromosome III-L telomere, and at Y؅-bearing telomeres. Loss of Rrm3p also resulted in replication fork pausing at specific sites in subtelomeric DNA, such as at inactive replication origins, and at internal tracts of C1–3A/TG1–3 DNA. The ATPase/helicase activity of Rrm3p was required for its role in telomeric and subtelomeric DNA replication. Because Rrm3p was telomere-associated in vivo, it likely has a direct role in telomere replication. [Key Words: Telomere; helicase; telomerase; replication; RRM3; yeast] Received February 7, 2002; revised version accepted April 10, 2002. Telomeres are the natural ends of eukaryotic chromo- Because conventional DNA polymerases cannot repli- somes. In most organisms, the very ends of chromo- cate the very ends of linear DNA molecules, special somes consist of simple repeated sequences. For ex- mechanisms are required to prevent the loss of terminal ample, Saccharomyces cerevisiae chromosomes end in DNA.
    [Show full text]
  • Rapidxfire Thermostable Reverse Transcriptase Application Note
    Application note RapiDxFire Thermostable Reverse Transcriptase Introduction RNA target, which improves cDNA yield and A reverse transcriptase (RT) is a DNA subsequent detection sensitivity from difficult polymerase enzyme that synthesises cDNA RNA targets. Thermostability also is an from an RNA template. RTs are widely indicator of general enzyme stability for storage, used to study gene expression in cells or automation applications, and lyophilisation. tissues, in next-generation sequencing Processivity, which refers to the number of (NGS) applications, and in conjunction with nucleotides incorporated into cDNA during quantitative PCR (qPCR) or isothermal a single enzyme binding event, can affect amplification methods to detect and identify cDNA length, RT efficiency, and RT reaction RNAs that are of clinical or functional time. Native RT enzymes also have RNase H significance. endonuclease activity that will cleave the RNA from a DNA-RNA duplex and limit cDNA length. RT enzymes may differ in key characteristics Some RT variants also have been engineered that affect their performance in different to reduce RNase H activity to allow longer applications. Their thermostability allows cDNA products. cDNA synthesis to be performed at higher temperatures (above 50 °C), enabling them Commercially available RTs used in molecular to melt areas of secondary structure in the biology are generally derived from Moloney Application note RapiDxFire Thermostable Reverse Transcriptase murine leukaemia virus (MMLV) or avian Skeletal Muscle Total RNA (Thermo Fisher myeloblastosis virus (AMV), which have optimal Scientific Cat No. AM7982), RNA, MS2 (Roche activity at 37-42 °C. Cloned AMV RT and Cat No. 10165948001), Zika virus ATCC® engineered variants of AMV RT and MMLV VR-1843™ (ATCC Cat No.
    [Show full text]
  • The Architecture of a Eukaryotic Replisome
    The Architecture of a Eukaryotic Replisome Jingchuan Sun1,2, Yi Shi3, Roxana E. Georgescu3,4, Zuanning Yuan1,2, Brian T. Chait3, Huilin Li*1,2, Michael E. O’Donnell*3,4 1 Biosciences Department, Brookhaven National Laboratory, Upton, New York, USA 2 Department of Biochemistry & Cell Biology, Stony Brook University, Stony Brook, New York, USA. 3 The Rockefeller University, 1230 York Avenue, New York, New York, USA. 4 Howard Hughes Medical Institute *Correspondence and requests for materials should be addressed to M.O.D. ([email protected]) or H.L. ([email protected]) ABSTRACT At the eukaryotic DNA replication fork, it is widely believed that the Cdc45-Mcm2-7-GINS (CMG) helicase leads the way in front to unwind DNA, and that DNA polymerases (Pol) trail behind the helicase. Here we use single particle electron microscopy to directly image a replisome. Contrary to expectations, the leading strand Pol ε is positioned ahead of CMG helicase, while Ctf4 and the lagging strand Pol α-primase (Pol α) are behind the helicase. This unexpected architecture indicates that the leading strand DNA travels a long distance before reaching Pol ε, it first threads through the Mcm2-7 ring, then makes a U-turn at the bottom to reach Pol ε at the top of CMG. Our work reveals an unexpected configuration of the eukaryotic replisome, suggests possible reasons for this architecture, and provides a basis for further structural and biochemical replisome studies. INTRODUCTION DNA is replicated by a multi-protein machinery referred to as a replisome 1,2. Replisomes contain a helicase to unwind DNA, DNA polymerases that synthesize the leading and lagging strands, and a primase that makes short primed sites to initiate DNA synthesis on both strands.
    [Show full text]
  • Genetic Engineering and Sustainable Crop Disease Management: Opportunities for Case-By-Case Decision-Making
    sustainability Review Genetic Engineering and Sustainable Crop Disease Management: Opportunities for Case-by-Case Decision-Making Paul Vincelli Department of Plant Pathology, 207 Plant Science Building, College of Agriculture, Food and Environment, University of Kentucky, Lexington, KY 40546, USA; [email protected] Academic Editor: Sean Clark Received: 22 March 2016; Accepted: 13 May 2016; Published: 20 May 2016 Abstract: Genetic engineering (GE) offers an expanding array of strategies for enhancing disease resistance of crop plants in sustainable ways, including the potential for reduced pesticide usage. Certain GE applications involve transgenesis, in some cases creating a metabolic pathway novel to the GE crop. In other cases, only cisgenessis is employed. In yet other cases, engineered genetic changes can be so minimal as to be indistinguishable from natural mutations. Thus, GE crops vary substantially and should be evaluated for risks, benefits, and social considerations on a case-by-case basis. Deployment of GE traits should be with an eye towards long-term sustainability; several options are discussed. Selected risks and concerns of GE are also considered, along with genome editing, a technology that greatly expands the capacity of molecular biologists to make more precise and targeted genetic edits. While GE is merely a suite of tools to supplement other breeding techniques, if wisely used, certain GE tools and applications can contribute to sustainability goals. Keywords: biotechnology; GMO (genetically modified organism) 1. Introduction and Background Disease management practices can contribute to sustainability by protecting crop yields, maintaining and improving profitability for crop producers, reducing losses along the distribution chain, and reducing the negative environmental impacts of diseases and their management.
    [Show full text]
  • A Short History of DNA Technology 1865 - Gregor Mendel the Father of Genetics
    A Short History of DNA Technology 1865 - Gregor Mendel The Father of Genetics The Augustinian monastery in old Brno, Moravia 1865 - Gregor Mendel • Law of Segregation • Law of Independent Assortment • Law of Dominance 1865 1915 - T.H. Morgan Genetics of Drosophila • Short generation time • Easy to maintain • Only 4 pairs of chromosomes 1865 1915 - T.H. Morgan •Genes located on chromosomes •Sex-linked inheritance wild type mutant •Gene linkage 0 •Recombination long aristae short aristae •Genetic mapping gray black body 48.5 body (cross-over maps) 57.5 red eyes cinnabar eyes 67.0 normal wings vestigial wings 104.5 red eyes brown eyes 1865 1928 - Frederick Griffith “Rough” colonies “Smooth” colonies Transformation of Streptococcus pneumoniae Living Living Heat killed Heat killed S cells mixed S cells R cells S cells with living R cells capsule Living S cells in blood Bacterial sample from dead mouse Strain Injection Results 1865 Beadle & Tatum - 1941 One Gene - One Enzyme Hypothesis Neurospora crassa Ascus Ascospores placed X-rays Fruiting on complete body medium All grow Minimal + amino acids No growth Minimal Minimal + vitamins in mutants Fragments placed on minimal medium Minimal plus: Mutant deficient in enzyme that synthesizes arginine Cys Glu Arg Lys His 1865 Beadle & Tatum - 1941 Gene A Gene B Gene C Minimal Medium + Citruline + Arginine + Ornithine Wild type PrecursorEnz A OrnithineEnz B CitrulineEnz C Arginine Metabolic block Class I Precursor OrnithineEnz B CitrulineEnz C Arginine Mutants Class II Mutants PrecursorEnz A Ornithine
    [Show full text]
  • The Biochemical Activities of the Saccharomyces Cerevisiae Pif1 Helicase Are Regulated by Its N-Terminal Domain
    G C A T T A C G G C A T genes Article The Biochemical Activities of the Saccharomyces cerevisiae Pif1 Helicase Are Regulated by Its N-Terminal Domain David G. Nickens y, Christopher W. Sausen y and Matthew L. Bochman * Molecular and Cellular Biochemistry Department, Indiana University, Bloomington, IN 47405, USA; [email protected] (D.G.N.); [email protected] (C.W.S.) * Correspondence: [email protected] These authors contributed equally to this work. y Received: 31 March 2019; Accepted: 20 May 2019; Published: 28 May 2019 Abstract: Pif1 family helicases represent a highly conserved class of enzymes involved in multiple aspects of genome maintenance. Many Pif1 helicases are multi-domain proteins, but the functions of their non-helicase domains are poorly understood. Here, we characterized how the N-terminal domain (NTD) of the Saccharomyces cerevisiae Pif1 helicase affects its functions both in vivo and in vitro. Removal of the Pif1 NTD alleviated the toxicity associated with Pif1 overexpression in yeast. Biochemically, the N-terminally truncated Pif1 (Pif1DN) retained in vitro DNA binding, DNA unwinding, and telomerase regulation activities, but these activities differed markedly from those displayed by full-length recombinant Pif1. However, Pif1DN was still able to synergize with the Hrq1 helicase to inhibit telomerase activity in vitro, similar to full-length Pif1. These data impact our understanding of Pif1 helicase evolution and the roles of these enzymes in the maintenance of genome integrity. Keywords: DNA helicase; Saccharomyces cerevisiae; Pif1; telomerase; telomere 1. Introduction DNA helicases are enzymes that couple DNA binding and ATP hydrolysis to unwind double-stranded DNA (dsDNA) into its component single strands [1].
    [Show full text]
  • Barriers to Adoption of GM Crops
    Iowa State University Capstones, Theses and Creative Components Dissertations Fall 2021 Barriers to Adoption of GM Crops Madeline Esquivel Follow this and additional works at: https://lib.dr.iastate.edu/creativecomponents Part of the Agricultural Education Commons Recommended Citation Esquivel, Madeline, "Barriers to Adoption of GM Crops" (2021). Creative Components. 731. https://lib.dr.iastate.edu/creativecomponents/731 This Creative Component is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Creative Components by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Barriers to Adoption of GM Crops By Madeline M. Esquivel A Creative Component submitted to the Graduate Faculty in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE Major: Plant Breeding Program of Study Committee: Walter Suza, Major Professor Thomas Lübberstedt Iowa State University Ames, Iowa 2021 1 Contents 1. Introduction ................................................................................................................................. 3 2. What is a Genetically Modified Organism?................................................................................ 9 2.1 The Development of Modern Varieties and Genetically Modified Crops .......................... 10 2.2 GM vs Traditional Breeding: How Are GM Crops Produced?
    [Show full text]
  • World Resources Institute the Monsanto Company
    World Resources Institute Sustainable Enterprise Program A program of the World Resources Institute The Monsanto Company: Quest for Sustainability (A) “Biotechnology represents a potentially sustainable For more than a decade, WRI's solution to the issue, not only of feeding people, but of providing Sustainable Enterprise Program (SEP) the economic growth that people are going to need to escape has harnessed the power of business to poverty…… [Biotechnology] poses the possibility of create profitable solutions to leapfrogging the industrial revolution and moving to a post- environment and development industrial society that is not only economically attractive, but challenges. BELL, a project of SEP, is also environmentally sustainable.i ” focused on working with managers and academics to make companies --Robert Shapiro, CEO, Monsanto Company more competitive by approaching social and environmental challenges as unmet market needs that provide Upon his promotion to CEO of chemical giant The business growth opportunities through Monsanto Company in 1995, Robert Shapiro became a vocal entrepreneurship, innovation, and champion of sustainable development and sought to redefine the organizational change. firm’s business strategy along principles of sustainability. Shapiro’s rhetoric was compelling. He captured analysts’ Permission to reprint this case is attention with the specter of mass hunger and environmental available at the BELL case store. degradation precipitated by rapid population growth and the Additional information on the Case
    [Show full text]