A Fluorescence-Based Assay for Monitoring Helicase Activity (Dda Helcase/Stopped-Flow Sptospy/2-Amnope) KEVIN D

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Proc. Nati. Acad. Sci. USA Vol. 91, pp. 6644-6648, July 1994 Biochemistry A fluorescence-based assay for monitoring helicase activity (dda helcase/stopped-flow sptospy/2-amnope) KEVIN D. RANEY*, LAWRENCE C. SOWERSt, DAVID P. MILLAR*, AND STEPHEN J. BENKOVIC*§ *Department of Chemistry, The Pennsylvania State University, University Park, PA 16802; tDivision of Pediatrics, City of Hope National Medical Center, Duarte, CA 91010; and $Department of Molecular Biology, The Scripps Research Institute, La Jolla, CA 92037 Contributed by Stephen J. Benkovic, March 30, 1994 ABSTRACT A continuous fluorescence-based assay is de- models proposed for helicase-mediated unwinding of duplex scribed for measuring helkcase-mediated unwnding of duplex DNA are difficult to test using the traditional assay. DNA. The a-ay utilizes an olionudeotide substrate containing We describe here, an assay that should prove valuable in the fluorescent adenine analog, 2-aminopurine, at regular probing helicase activity. The adenine analog, 2-aminopurine Intervals. 2-Aminopurine forms a Watson-Crick-type base (2-AP), has fluorescent properties useful for studying DNA pair with thymine and does not distort normal B-form DNA. dynamics (8, 9) and also can form a Watson-Crick-type base Fluorescence of the 2-aminopurines within this oligonudeotide pair, thus, maintaining the overall structural integrity of is quenched 2-fold upon its hybridization to a complementary duplex DNA (10). Fluorescence of 2-AP has been used to strand. Unwinding of this bsrate by the T4 dda helicase measure the rate of nucleotide incorporation (11) and to restores the fluorescence of the 2-aminopurines and is easily monitor local melting of duplex termini (12) by the Klenow followed using stopped-flow or steady-state fluorescence spec- fiagment of DNA polymerase I. We have prepared an oligo- troscopy. The fluorescence-based assay provides rate data nucleotide containing seven regularly spaced 2-AP residues comparable to that obtained from conventional discontinuous that upon hybridization to a complementary oligonucleotide, assays using labeled substrates and additionally furnishes a quenches the 2-AP fluorescence 2-fold. This oligonucleotide means for following a single turnover. This assay should prove has been used as a substrate for studying DNA unwinding by usefl for dening the m n by which helicases unwind the T4 dda helicase, taking advantage of the restoration in duplex DNA. fluorescence upon going from duplex DNA to ssDNA. We believe this is an informative technique for studying the Many cellular processes involving DNA such as replication, mechanism by which helicases unwind DNA. repair, and recombination utilize single-strand (ss) DNA intermediates derived from unwinding of double-strand MATERIALS AND METHODS DNA. Helicases are the enzymes that perform this function, presumably using the energy of nucleotide hydrolysis for dda Protein. The dda helicase clone (pKHdda in E. coli breaking duplex hydrogen bonds (1). Much effort has re- SG934) was kindly provided by Kevin Hacker and Bruce cently been invested in determining the mechanism by which Alberts (University of California, San Francisco). The pro- helicases carry out this function (2, 3). Lohman and cowork- tein was purified by the described procedure (13) with one ers (2, 4, 5) have provided strong evidence for a rolling exception. The DNase I treatment was eliminated and addi- mechanism for the Escherichia coli Rep helicase, which tional sonication was applied to fully disrupt the cell mass. appears to function as a dimer (2-5). They propose that each Protein concentration was determined by UV absorbance in monomer, initially bound to ssDNA, alternates in binding to 6 M urea and the extinction coefficient calculated from the the duplex region at the DNA fork. Hydrolysis of ATP reported amino acid sequence (e280 = 59,060 MW-1cm-1). provides energy to unpair the bound duplex giving rise to a Oigonucleotides. Oligonucleotides were synthesized using new region of ssDNA. Their model predicts that the base the phosphoramidite method. Preparation of the 2-aminopu- pairs bound by the helicase are unwound simultaneously. von rine 2'-deoxynucleoside phosphoramidite will be described Hippel and coworkers (3, 6, 7) have provided a mechanism elsewhere. Oligonucleotides were purified by preparative gel for unwinding by the E. coli transcription termination factor, electrophoresis as described (14). Purified oligonucleotides Rho, which is a DNA-RNA helicase. This enzyme appears to were quantitated by using UV absorbance at 260 nm in 0.1 M function as a hexamer, and translocation along ssRNA is NaOH and calculated extinction coefficients. The extinction fueled by ATP hydrolysis that induces conformational coefficient for 2-AP at 260 nm is 1000 M-1 cm-1 (15) and thus changes in the enzyme and allows unidirectional movement contributes very little to the overall absorbance of the oligo- along the bound RNA strand. This model does not invoke nucleotide. interactions between the enzyme and duplex region and Fluorescence Titration. Experiments were performed using suggests, instead, that the helicase movement might "unzip- an SLM Aminco 8000 spectrofluorometer. The oligonucleo- per" the DNARNA hybrid (3, 6, 7). tide containing the 2-APs (250 nM, referred to as 2-AP leading The standard assay for measuring helicase activity uses gel strand; Fig. 1B) was added to helicase unwindingbuffer(1 ml) electrophoresis to observe unwinding of double-strand DNA in a temperature-controlled cuvette at 25TC. Helicase un- by separating substrate (duplex strands) from product (single winding buffer contained 25 mM Tris acetate (pH 7.4), 10 mM strands) on a native polyacrylamide or agarose gel (1). This potassium acetate, 10 mM magnesium acetate, 3 mM ATP, 4 assay is discontinuous and only measures substrate that has mM phosphoenolpyruvate, pyruvate kinase (10 units/ml), 1 been completely unwound. It is not suitable for pre-steady- mM 2-mercaptoethanol, and bovine serum albumin (0.1 mg/ state analysis in the sense that unwinding cannot be observed ml). The partially complimentary oligonucleotide (referred to prior to complete unwinding of the substrate. Thus, the as the lagging strand in Fig. 1B) was titrated into the solution in 50-pmol aliquots. The two strands were allowed to anneal The publication costs ofthis article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" Abbreviations: 2-AP, 2-aminopurine, ss, single strand. in accordance with 18 U.S.C. §1734 solely to indicate this fact. §To whom reprint requests should be addressed. 6644 Downloaded by guest on October 1, 2021 Biochemistry: Raney et al. Proc. Natl. Acad. Sci. USA 91 (1994) 6645 A dR A'T base pair 2-AP-T base pair B Lagging Strand 5'-TAACGTATTCAAGATACCTCGTACTCTG T A CTGACTGCGTTCCTGCATGCCTGCATGAGT GACTGACGCAAGGACGTACGGACGTACT A T 3'-TGAACTTAGTGCATGATATACTGTGTATT 2-AP Leading Strand FiG. 1. (A) Base-pairing scheme for 2-aminopurine 2'-deoxynucleoside with thymidine. Normal base pairing for deoxyadenosine and thymidine are also shown. The overall structure ofB-form DNA is maintained with 2-AP. (B) Oligonucleotide fork containing seven 2-APresidues (underlined) regularly spaced in the duplex region. The nomenclature of the two strands of the DNA fork is based on their roles in DNA replication. for =5 min before fluorescence spectra were obtained. The Applied Photophysics (Leatherhead, Surrey, U.K.). Dda excitation wavelength was set at 310 nm. helicase was incubated with the 2-AP DNA fork in helicase DNA Uni Measured by Gel Electrophoresis. The unwinding buffer at 25°C in one syringe ofthe instrument, and leading strand (10 pmol) ofthe DNA fork was 5'-end-labeled ATP and MgOAc were incubated in the second syringe. The with 32p. The labeled 2-AP leading strand was annealed to an unwinding reaction was initiated by rapid mixing of the two equivalent amount of lagging strand and the labeled 2-AP solutions. Concentrations after mixing were as follows: 50 DNA fork was then added to a stock solution of unlabeled nM dda helicase, 250 nM 2-AP DNA fork, 3 mM ATP, and 2-AP DNA fork. A second leading strand identical to the 10 mM MgOAc. Excitation wavelength was set at 310 nm 2-AP strand except containing adenine instead of 2-AP was with a bandpass of30 nm. A 330-nm cutofffilter was used for also end-labeled, annealed to lagging strand, and added to a observing fluorescence emission of 2-AP. Kinetic simula- stock solution ofunlabeled DNA fork substrate. Either ofthe tions were performed using the KINSIM program as described two DNA substrates was added to helicase assay buffer up to (14). a final concentration of 250 nM. Dda helicase was added to the reaction mixture at levels up to 50 nM and incubated for 3 min at 250C. The unwinding reaction was initiated by adding RESULTS 10 j4 of a solution of ATP and MgOAc to give final concen- Fluorescence of the 2-AP DNA Strand Is Quenched Upon trations of 3 mM and 10 mM, respectively. Total volume for Annelug to a Complementary Stad. The adenosine analog, the reaction mixture was 60 td. Aliquots (10 1d) of the 2-aminopurine 2'-deoxyribonucleoside, can form a Watson- unwinding reaction mixture were taken at 10-s intervals and Crick-type base pair with thymidine (Fig. 1A) and maintain added to 10 Ad ofquench solution. Quench solution contained the overall structure ofduplex DNA (10). An oligonucleotide EDTA (0.5 M) and a 30-mer oligonucleotide (10 uM) that was was prepared in which seven 2-AP residues were incorpo- complimentary to the duplex region ofthe lagging strand. The rated at regular intervals by using phosphoramidite DNA 30-mer served as a trap to prevent reannealing ofthe unpaired synthesis methods (Fig. 1B, 2-AP leading strand). A partially strands after the reaction was quenched. Final trap concen- 1B, strand) was tration in quenched samples was 5 puM (40-fold in excess of complementary oligonucleotide (Fig.
Recommended publications
  • Saccharomyces Rrm3p, a 5 to 3 DNA Helicase That Promotes Replication

    Saccharomyces Rrm3p, a 5 to 3 DNA Helicase That Promotes Replication

    Downloaded from genesdev.cshlp.org on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press Saccharomyces Rrm3p, a 5؅ to 3؅ DNA helicase that promotes replication fork progression through telomeric and subtelomeric DNA Andreas S. Ivessa,1 Jin-Qiu Zhou,1,2 Vince P. Schulz, Ellen K. Monson, and Virginia A. Zakian3 Department of Molecular Biology, Princeton University, Princeton, New Jersey 08544-1014, USA In wild-type Saccharomyces cerevisiae, replication forks slowed during their passage through telomeric ؅ C1–3A/TG1–3 tracts. This slowing was greatly exacerbated in the absence of RRM3, shown here to encode a 5 ,to 3؅ DNA helicase. Rrm3p-dependent fork progression was seen at a modified Chromosome VII-L telomere at the natural X-bearing Chromosome III-L telomere, and at Y؅-bearing telomeres. Loss of Rrm3p also resulted in replication fork pausing at specific sites in subtelomeric DNA, such as at inactive replication origins, and at internal tracts of C1–3A/TG1–3 DNA. The ATPase/helicase activity of Rrm3p was required for its role in telomeric and subtelomeric DNA replication. Because Rrm3p was telomere-associated in vivo, it likely has a direct role in telomere replication. [Key Words: Telomere; helicase; telomerase; replication; RRM3; yeast] Received February 7, 2002; revised version accepted April 10, 2002. Telomeres are the natural ends of eukaryotic chromo- Because conventional DNA polymerases cannot repli- somes. In most organisms, the very ends of chromo- cate the very ends of linear DNA molecules, special somes consist of simple repeated sequences. For ex- mechanisms are required to prevent the loss of terminal ample, Saccharomyces cerevisiae chromosomes end in DNA.
  • The Architecture of a Eukaryotic Replisome

    The Architecture of a Eukaryotic Replisome

    The Architecture of a Eukaryotic Replisome Jingchuan Sun1,2, Yi Shi3, Roxana E. Georgescu3,4, Zuanning Yuan1,2, Brian T. Chait3, Huilin Li*1,2, Michael E. O’Donnell*3,4 1 Biosciences Department, Brookhaven National Laboratory, Upton, New York, USA 2 Department of Biochemistry & Cell Biology, Stony Brook University, Stony Brook, New York, USA. 3 The Rockefeller University, 1230 York Avenue, New York, New York, USA. 4 Howard Hughes Medical Institute *Correspondence and requests for materials should be addressed to M.O.D. ([email protected]) or H.L. ([email protected]) ABSTRACT At the eukaryotic DNA replication fork, it is widely believed that the Cdc45-Mcm2-7-GINS (CMG) helicase leads the way in front to unwind DNA, and that DNA polymerases (Pol) trail behind the helicase. Here we use single particle electron microscopy to directly image a replisome. Contrary to expectations, the leading strand Pol ε is positioned ahead of CMG helicase, while Ctf4 and the lagging strand Pol α-primase (Pol α) are behind the helicase. This unexpected architecture indicates that the leading strand DNA travels a long distance before reaching Pol ε, it first threads through the Mcm2-7 ring, then makes a U-turn at the bottom to reach Pol ε at the top of CMG. Our work reveals an unexpected configuration of the eukaryotic replisome, suggests possible reasons for this architecture, and provides a basis for further structural and biochemical replisome studies. INTRODUCTION DNA is replicated by a multi-protein machinery referred to as a replisome 1,2. Replisomes contain a helicase to unwind DNA, DNA polymerases that synthesize the leading and lagging strands, and a primase that makes short primed sites to initiate DNA synthesis on both strands.
  • The Biochemical Activities of the Saccharomyces Cerevisiae Pif1 Helicase Are Regulated by Its N-Terminal Domain

    The Biochemical Activities of the Saccharomyces Cerevisiae Pif1 Helicase Are Regulated by Its N-Terminal Domain

    G C A T T A C G G C A T genes Article The Biochemical Activities of the Saccharomyces cerevisiae Pif1 Helicase Are Regulated by Its N-Terminal Domain David G. Nickens y, Christopher W. Sausen y and Matthew L. Bochman * Molecular and Cellular Biochemistry Department, Indiana University, Bloomington, IN 47405, USA; [email protected] (D.G.N.); [email protected] (C.W.S.) * Correspondence: [email protected] These authors contributed equally to this work. y Received: 31 March 2019; Accepted: 20 May 2019; Published: 28 May 2019 Abstract: Pif1 family helicases represent a highly conserved class of enzymes involved in multiple aspects of genome maintenance. Many Pif1 helicases are multi-domain proteins, but the functions of their non-helicase domains are poorly understood. Here, we characterized how the N-terminal domain (NTD) of the Saccharomyces cerevisiae Pif1 helicase affects its functions both in vivo and in vitro. Removal of the Pif1 NTD alleviated the toxicity associated with Pif1 overexpression in yeast. Biochemically, the N-terminally truncated Pif1 (Pif1DN) retained in vitro DNA binding, DNA unwinding, and telomerase regulation activities, but these activities differed markedly from those displayed by full-length recombinant Pif1. However, Pif1DN was still able to synergize with the Hrq1 helicase to inhibit telomerase activity in vitro, similar to full-length Pif1. These data impact our understanding of Pif1 helicase evolution and the roles of these enzymes in the maintenance of genome integrity. Keywords: DNA helicase; Saccharomyces cerevisiae; Pif1; telomerase; telomere 1. Introduction DNA helicases are enzymes that couple DNA binding and ATP hydrolysis to unwind double-stranded DNA (dsDNA) into its component single strands [1].
  • Mcm10 Has Potent Strand-Annealing Activity and Limits Translocase-Mediated Fork Regression

    Mcm10 Has Potent Strand-Annealing Activity and Limits Translocase-Mediated Fork Regression

    Mcm10 has potent strand-annealing activity and limits translocase-mediated fork regression Ryan Maylea, Lance Langstona,b, Kelly R. Molloyc, Dan Zhanga, Brian T. Chaitc,1,2, and Michael E. O’Donnella,b,1,2 aLaboratory of DNA Replication, The Rockefeller University, New York, NY 10065; bHoward Hughes Medical Institute, The Rockefeller University, New York, NY 10065; and cLaboratory of Mass Spectrometry and Gaseous Ion Chemistry, The Rockefeller University, New York, NY 10065 Contributed by Michael E. O’Donnell, November 19, 2018 (sent for review November 8, 2018; reviewed by Zvi Kelman and R. Stephen Lloyd) The 11-subunit eukaryotic replicative helicase CMG (Cdc45, Mcm2-7, of function using genetics, cell biology, and cell extracts have GINS) tightly binds Mcm10, an essential replication protein in all identified Mcm10 functions in replisome stability, fork progres- eukaryotes. Here we show that Mcm10 has a potent strand- sion, and DNA repair (21–25). Despite significant advances in the annealing activity both alone and in complex with CMG. CMG- understanding of Mcm10’s functions, mechanistic in vitro studies Mcm10 unwinds and then reanneals single strands soon after they of Mcm10 in replisome and repair reactions are lacking. have been unwound in vitro. Given the DNA damage and replisome The present study demonstrates that Mcm10 on its own rap- instability associated with loss of Mcm10 function, we examined the idly anneals cDNA strands even in the presence of the single- effect of Mcm10 on fork regression. Fork regression requires the strand (ss) DNA-binding protein RPA, a property previously unwinding and pairing of newly synthesized strands, performed by associated with the recombination protein Rad52 (26).
  • Huh7 HK4+ HK2- Cells a Protein Complementation Assay B Coimmunoprecipitation Even If NS3 Is Able to Stimulates Glycolysis in Cells Expressing Replicate

    Huh7 HK4+ HK2- Cells a Protein Complementation Assay B Coimmunoprecipitation Even If NS3 Is Able to Stimulates Glycolysis in Cells Expressing Replicate

    Dengue virus protein NS3 activates hexokinase activity in SAT-390 hepatocytes to support virus replication Marianne FIGL, Clémence JACQUEMIN, Patrice ANDRE, Laure PERRIN-COCON, Vincent LOTTEAU, Olivier DIAZ International Center for Infectiology Research (CIRI), INSERM U1111, CNRS UMR5308, Université de Lyon, FRANCE 1 INTRODUCTION 4 RESULTS 5 CONCLUSIONS Result 2: DENV NS3 protein interacts with hexokinases Viruses are mandatory parasites that use metabolism machinery to Result 1: DENV efficiently replicates in HuH7 HK4+ HK2- cells A Protein Complementation Assay B Coimmunoprecipitation Even if NS3 is able to stimulates glycolysis in cells expressing replicate. Growing literature demonstrates that viruses manipulate A.A. DENV-NS3 versus human metabolism enzymes DENVB.B.-NS3 versus hexokinases A. HuH7 HuH7 HK4+ HK2- B. (a) (b) 60 Lysate Co-IP HK2 or HK4, we observe an higher DENV replication in HuH7 central carbon metabolism (CCM) and more specifically glycolysis for HuH7 HuH7 55 NS3-3xFlag - + - + HuH7 HK4+ HK2- HK4+ HK2- suggesting that HK4 positive cells are more susceptible their propagation [1]. However, the underlying mechanisms are not HuH7 HK4+ HK2- 50 HK1 α-Gluc 45 α-Flag to DENV replication. fully described. Our team has already demonstrated that hepatitis C 40 80 80 HK2 α-Gluc *** 35 NS5A protein interacts and activates hexokinases (HKs) to favor viral 70 70 α-Flag cells 30 Poster presented at: presented Poster Fluorescente light Fluorescente 60 cells 60 α-Gluc replication [2]. It was described that dengue infection (DENV) 25 HK3 We observed that HuH7 HK4+HK2- cells have a rewiring of their 50 50 α-Flag 20 increases glycolysis [3] and thus we wondered if control of 40 40 glycolytic pathway resulting in intracellular lipids accumulation (see 15 HK4 α-Gluc 30 hexokinase activity was shared by DENV, another Flavivirus.
  • A Coupled Complex of T4 DNA Replication Helicase (Gp41)

    A Coupled Complex of T4 DNA Replication Helicase (Gp41)

    Proc. Natl. Acad. Sci. USA Vol. 93, pp. 14456–14461, December 1996 Biochemistry A coupled complex of T4 DNA replication helicase (gp41) and polymerase (gp43) can perform rapid and processive DNA strand-displacement synthesis (helicase–polymeraseyDNA unwindingyATPaseykineticsymacromolecular crowding) FENG DONG,STEVEN E. WEITZEL, AND PETER H. VON HIPPEL* Institute of Molecular Biology and Department of Chemistry, University of Oregon, Eugene, OR 97403-1129 Contributed by Peter H. von Hippel, September 30, 1996 ABSTRACT We have developed a coupled helicase– determine how fast the helicase moves through the dsDNA in polymerase DNA unwinding assay and have used it to monitor carrying out the unwinding reaction. Furthermore the ‘‘prod- the rate of double-stranded DNA unwinding catalyzed by the uct’’ of such assays is, of course, simply two separated DNA phage T4 DNA replication helicase (gp41). This procedure can strands that will spontaneously rehybridize unless some means be used to follow helicase activity in subpopulations in systems is found to ‘‘trap’’ the products without interfering with the in which the unwinding-synthesis reaction is not synchronized reaction. Due to difficulties in achieving efficient and synchro- on all the substrate-template molecules. We show that T4 nized loading of the T4 DNA helicase (which has a fairly low replication helicase (gp41) and polymerase (gp43) can be affinity for DNA; see ref. 6), recently developed methods that assembled onto a loading site located near the end of a long are based on observing overall populations (7–9) have not double-stranded DNA template in the presence of a macro- been useful in studying the unwinding of dsDNA by the gp41 molecular crowding agent, and that this coupled ‘‘two- helicase.
  • A Novel DNA Primase-Helicase Pair Encoded by Sccmec Elements Aleksandra Bebel†, Melissa a Walsh, Ignacio Mir-Sanchis‡, Phoebe a Rice*

    A Novel DNA Primase-Helicase Pair Encoded by Sccmec Elements Aleksandra Bebel†, Melissa a Walsh, Ignacio Mir-Sanchis‡, Phoebe a Rice*

    RESEARCH ARTICLE A novel DNA primase-helicase pair encoded by SCCmec elements Aleksandra Bebel†, Melissa A Walsh, Ignacio Mir-Sanchis‡, Phoebe A Rice* Department of Biochemistry and Molecular Biology, University of Chicago, Chicago, United States Abstract Mobile genetic elements (MGEs) are a rich source of new enzymes, and conversely, understanding the activities of MGE-encoded proteins can elucidate MGE function. Here, we biochemically characterize three proteins encoded by a conserved operon carried by the Staphylococcal Cassette Chromosome (SCCmec), an MGE that confers methicillin resistance to Staphylococcus aureus, creating MRSA strains. The first of these proteins, CCPol, is an active A-family DNA polymerase. The middle protein, MP, binds tightly to CCPol and confers upon it the ability to synthesize DNA primers de novo. The CCPol-MP complex is therefore a unique primase- polymerase enzyme unrelated to either known primase family. The third protein, Cch2, is a 3’-to-5’ helicase. Cch2 additionally binds specifically to a dsDNA sequence downstream of its gene that is also a preferred initiation site for priming by CCPol-MP. Taken together, our results suggest that this is a functional replication module for SCCmec. *For correspondence: Introduction [email protected] Staphylococcus aureus is a dangerous human pathogen, due in part to the emergence of multi- drug-resistant strains such as MRSA (methicillin-resistant S. aureus). MRSA strains have acquired † Present address: Phage resistance to b-lactam antibiotics (including methicillin) mainly through horizontal gene transfer of a Consultants, Gdynia, Poland; mobile genomic island called staphylococcal cassette chromosome (SCC) (Moellering, 2012). ‡Umea˚ University, Umea˚ , SCCmec is a variant of SCC that carries a methicillin resistance gene, mecA.
  • Helicase-DNA Polymerase Interaction Is Critical to Initiate Leading-Strand DNA Synthesis

    Helicase-DNA Polymerase Interaction Is Critical to Initiate Leading-Strand DNA Synthesis

    Helicase-DNA polymerase interaction is critical to initiate leading-strand DNA synthesis Huidong Zhang1, Seung-Joo Lee1, Bin Zhu, Ngoc Q. Tran, Stanley Tabor, and Charles C. Richardson2 Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, MA 02115 Contributed by Charles C. Richardson, April 27, 2011 (sent for review March 3, 2011) Interactions between gene 4 helicase and gene 5 DNA polymerase (gp5) are crucial for leading-strand DNA synthesis mediated by the replisome of bacteriophage T7. Interactions between the two pro- teins that assure high processivity are known but the interactions essential to initiate the leading-strand DNA synthesis remain uni- dentified. Replacement of solution-exposed basic residues (K587, K589, R590, and R591) located on the front surface of gp5 with neu- tral asparagines abolishes the ability of gp5 and the helicase to mediate strand-displacement synthesis. This front basic patch in gp5 contributes to physical interactions with the acidic C-terminal tail of the helicase. Nonetheless, the altered polymerase is able to replace gp5 and continue ongoing strand-displacement synthesis. The results suggest that the interaction between the C-terminal tail of the helicase and the basic patch of gp5 is critical for initiation of strand-displacement synthesis. Multiple interactions of T7 DNA polymerase and helicase coordinate replisome movement. DNA polymerase-helicase interaction ∣ strand-displacement DNA synthesis ∣ T7 bacteriophage ∣ T7 replisome acteriophage T7 has a simple and efficient DNA replication Bsystem whose basic reactions mimic those of more complex replication systems (1). The T7 replisome consists of gene 5 DNA polymerase (gp5), the processivity factor, Escherichia coli Fig.
  • Promiscuous Usage of Nucleotides by the DNA Helicase Of

    Promiscuous Usage of Nucleotides by the DNA Helicase Of

    Supplemental Material can be found at: http://www.jbc.org/cgi/content/full/M900557200/DC1 THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 284, NO. 21, pp. 14286–14295, May 22, 2009 © 2009 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A. Promiscuous Usage of Nucleotides by the DNA Helicase of Bacteriophage T7 DETERMINANTS OF NUCLEOTIDE SPECIFICITY*□S Received for publication, January 26, 2009, and in revised form, March 12, 2009 Published, JBC Papers in Press, March 17, 2009, DOI 10.1074/jbc.M900557200 Ajit K. Satapathy, Donald J. Crampton1, Benjamin B. Beauchamp, and Charles C. Richardson2 From the Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, Massachusetts 02115 The multifunctional protein encoded by gene 4 of bacterioph- to single-stranded DNA (ssDNA)3 as a hexamer and translo- age T7 (gp4) provides both helicase and primase activity at the cates 5Ј to 3Ј along the DNA strand using the energy of hydrol- replication fork. T7 DNA helicase preferentially utilizes dTTP ysis of dTTP (5–7). T7 helicase hydrolyzes a variety of ribo and to unwind duplex DNA in vitro but also hydrolyzes other nucle- deoxyribonucleotides; however, dTTP hydrolysis is optimally otides, some of which do not support helicase activity. Very little coupled to DNA unwinding (5). is known regarding the architecture of the nucleotide binding Most hexameric helicases use rATP to fuel translocation and Downloaded from site in determining nucleotide specificity. Crystal structures of unwind DNA (3). T7 helicase does hydrolyze rATP but with a the T7 helicase domain with bound dATP or dTTP identified 20-fold higher Km as compared with dTTP (5, 8).
  • Crystal Structure of the Yeast Eif4a-Eif4g Complex: an RNA-Helicase Controlled by Protein– Protein Interactions

    Crystal Structure of the Yeast Eif4a-Eif4g Complex: an RNA-Helicase Controlled by Protein– Protein Interactions

    Crystal structure of the yeast eIF4A-eIF4G complex: An RNA-helicase controlled by protein– protein interactions Patrick Schu¨ tz*, Mario Bumann*†, Anselm Erich Oberholzer*‡, Christoph Bieniossek*§, Hans Trachsel¶, Michael Altmann¶ʈ, and Ulrich Baumann*ʈ *Departement fu¨r Chemie und Biochemie, Universita¨t Bern, Freiestrasse 3, CH-3012 Bern, Switzerland; and ¶Institut fu¨r Biochemie und Molekulare Medizin, Universita¨t Bern, Bu¨hlstrasse 28, CH-3012 Bern, Switzerland Edited by Thomas A. Steitz, Yale University, New Haven, CT, and approved May 1, 2008 (received for review January 15, 2008) Translation initiation factors eIF4A and eIF4G form, together with protein encoded by a pair of duplicated genes, TIF1 and TIF2. the cap-binding factor eIF4E, the eIF4F complex, which is crucial for eIF4A is probably necessary for the translation of all mRNAs, recruiting the small ribosomal subunit to the mRNA 5؅ end and for presumably by unwinding mRNA secondary structures that subsequent scanning and searching for the start codon. eIF4A is an could hinder the recruitment of 43S preinitiation complexes to ATP-dependent RNA helicase whose activity is stimulated by bind- the 5Ј end and its subsequent scanning. Like other DEAD-box ing to eIF4G. We report here the structure of the complex formed helicases, eIF4A possesses nine conserved sequence motifs, Q, by yeast eIF4G’s middle domain and full-length eIF4A at 2.6-Å I, Ia, Ib, II, III, IV, V, and VI (Fig. 1B), which are important for resolution. eIF4A shows an extended conformation where eIF4G nucleotide and RNA binding and for helicase activity (13). The Q holds its crucial DEAD-box sequence motifs in a productive con- motif is responsible for the recognition of the adenine moiety of formation, thus explaining the stimulation of eIF4A’s activity.
  • The Complete Structure of the Human TFIIH Core Complex Basil J Greber1,2, Daniel B Toso1, Jie Fang3, Eva Nogales1,2,3,4*

    The Complete Structure of the Human TFIIH Core Complex Basil J Greber1,2, Daniel B Toso1, Jie Fang3, Eva Nogales1,2,3,4*

    RESEARCH ARTICLE The complete structure of the human TFIIH core complex Basil J Greber1,2, Daniel B Toso1, Jie Fang3, Eva Nogales1,2,3,4* 1California Institute for Quantitative Biosciences, University of California, Berkeley, United States; 2Molecular Biophysics and Integrative Bio-Imaging Division, Lawrence Berkeley National Laboratory, Berkeley, United States; 3Howard Hughes Medical Institute, University of California, Berkeley, United States; 4Department of Molecular and Cell Biology, University of California, Berkeley, United States Abstract Transcription factor IIH (TFIIH) is a heterodecameric protein complex critical for transcription initiation by RNA polymerase II and nucleotide excision DNA repair. The TFIIH core complex is sufficient for its repair functions and harbors the XPB and XPD DNA-dependent ATPase/helicase subunits, which are affected by human disease mutations. Transcription initiation additionally requires the CdK activating kinase subcomplex. Previous structural work has provided only partial insight into the architecture of TFIIH and its interactions within transcription pre- initiation complexes. Here, we present the complete structure of the human TFIIH core complex, determined by phase-plate cryo-electron microscopy at 3.7 A˚ resolution. The structure uncovers the molecular basis of TFIIH assembly, revealing how the recruitment of XPB by p52 depends on a pseudo-symmetric dimer of homologous domains in these two proteins. The structure also suggests a function for p62 in the regulation of XPD, and allows the mapping of previously unresolved human disease mutations. DOI: https://doi.org/10.7554/eLife.44771.001 *For correspondence: [email protected] Introduction Transcription factor IIH (TFIIH) is a 10-subunit protein complex with a total molecular weight of 0.5 Competing interests: The MDa that serves a dual role as a general transcription factor for transcription initiation by eukaryotic authors declare that no RNA polymerase II (Pol II), and as a DNA helicase complex in nucleotide excision DNA repair (NER) competing interests exist.
  • Roles for Recq Helicases in Telomere Preservation

    Roles for Recq Helicases in Telomere Preservation

    Roles for RecQ Helicases in Telomere Preservation Patricia L. Opresko University of Pittsburgh Department of Environmental and Occupational Health Bridgeside Point 100 Technology Drive, Suite 350 Pittsburgh, PA 15219-3130 [email protected] Werner Syndrome Symptoms Average Age of Onset (yrs) Greying of hair 20 Wrinkling of the skin 25.3 Loss of hair 25.8 Cataracts 30 Skin Ulcers 30 14 Years Old Diabetes (type II) 34.2 Death 47 Osteoporosis Atherosclerosis Cancer 48 Years Old RecQ Family “Care Takers” of the Genome RecQ, E. coli Sgs1, S. cer. Rqh1, S. pombe FFA-1, X. laevis RecQ5β, D. melanogaster RecQL, H. sapiens BLM, H. sapiens WRN, H. sapiens RecQ4, H. sapiens RecQ5β, H. sapiens Exonuclease AcidicHelicase RecQ HRDC NLS 3’ to 5’ 3’ to 5’ conserved Cellular defects in WS cell lines • Genomic Instability • DNA Repair – Chromosomal – Hypersensitivity to rearrangements, 4-NQO translocations, dicentrics DNA crosslinking agents – Large deletions topoisomerase inhibitors methyl methanesulfonate • Replication – Reduced replicative lifespan • Telomere instability – Extended S-phase • Mitotic Homologous DNA Recombination – Defect in resolving intermediates Telomere-Associated Replicative Senescence Germ cells: Germ sufficient telomerase activity - no shortening A dul Adult stem cells: t S s variable levels of telomerase activity o te m m a + exogenous - slow shortening t ic telomerase Somatic cells: most have no telomerase activity - exhibit faster rates of shortening telomere- senescencesenescence se dependent era m Cancer cells: Telo ALT 90% show