Proc. Nati. Acad. Sci. USA Vol. 91, pp. 6644-6648, July 1994 Biochemistry A fluorescence-based assay for monitoring helicase activity (dda helcase/stopped-flow sptospy/2-amnope) KEVIN D. RANEY*, LAWRENCE C. SOWERSt, DAVID P. MILLAR*, AND STEPHEN J. BENKOVIC*§ *Department of Chemistry, The Pennsylvania State University, University Park, PA 16802; tDivision of Pediatrics, City of Hope National Medical Center, Duarte, CA 91010; and $Department of Molecular Biology, The Scripps Research Institute, La Jolla, CA 92037 Contributed by Stephen J. Benkovic, March 30, 1994 ABSTRACT A continuous fluorescence-based assay is de- models proposed for helicase-mediated unwinding of duplex scribed for measuring helkcase-mediated unwnding of duplex DNA are difficult to test using the traditional assay. DNA. The a-ay utilizes an olionudeotide substrate containing We describe here, an assay that should prove valuable in the fluorescent adenine analog, 2-aminopurine, at regular probing helicase activity. The adenine analog, 2-aminopurine Intervals. 2-Aminopurine forms a Watson-Crick-type base (2-AP), has fluorescent properties useful for studying DNA pair with thymine and does not distort normal B-form DNA. dynamics (8, 9) and also can form a Watson-Crick-type base Fluorescence of the 2-aminopurines within this oligonudeotide pair, thus, maintaining the overall structural integrity of is quenched 2-fold upon its hybridization to a complementary duplex DNA (10). Fluorescence of 2-AP has been used to strand. Unwinding of this bsrate by the T4 dda helicase measure the rate of nucleotide incorporation (11) and to restores the fluorescence of the 2-aminopurines and is easily monitor local melting of duplex termini (12) by the Klenow followed using stopped-flow or steady-state fluorescence spec- fiagment of DNA polymerase I. We have prepared an oligo- troscopy. The fluorescence-based assay provides rate data nucleotide containing seven regularly spaced 2-AP residues comparable to that obtained from conventional discontinuous that upon hybridization to a complementary oligonucleotide, assays using labeled substrates and additionally furnishes a quenches the 2-AP fluorescence 2-fold. This oligonucleotide means for following a single turnover. This assay should prove has been used as a substrate for studying DNA unwinding by usefl for dening the m n by which helicases unwind the T4 dda helicase, taking advantage of the restoration in duplex DNA. fluorescence upon going from duplex DNA to ssDNA. We believe this is an informative technique for studying the Many cellular processes involving DNA such as replication, mechanism by which helicases unwind DNA. repair, and recombination utilize single-strand (ss) DNA intermediates derived from unwinding of double-strand MATERIALS AND METHODS DNA. Helicases are the enzymes that perform this function, presumably using the energy of nucleotide hydrolysis for dda Protein. The dda helicase clone (pKHdda in E. coli breaking duplex hydrogen bonds (1). Much effort has re- SG934) was kindly provided by Kevin Hacker and Bruce cently been invested in determining the mechanism by which Alberts (University of California, San Francisco). The pro- helicases carry out this function (2, 3). Lohman and cowork- tein was purified by the described procedure (13) with one ers (2, 4, 5) have provided strong evidence for a rolling exception. The DNase I treatment was eliminated and addi- mechanism for the Escherichia coli Rep helicase, which tional sonication was applied to fully disrupt the cell mass. appears to function as a dimer (2-5). They propose that each Protein concentration was determined by UV absorbance in monomer, initially bound to ssDNA, alternates in binding to 6 M urea and the extinction coefficient calculated from the the duplex region at the DNA fork. Hydrolysis of ATP reported amino acid sequence (e280 = 59,060 MW-1cm-1). provides energy to unpair the bound duplex giving rise to a Oigonucleotides. Oligonucleotides were synthesized using new region of ssDNA. Their model predicts that the base the phosphoramidite method. Preparation of the 2-aminopu- pairs bound by the helicase are unwound simultaneously. von rine 2'-deoxynucleoside phosphoramidite will be described Hippel and coworkers (3, 6, 7) have provided a mechanism elsewhere. Oligonucleotides were purified by preparative gel for unwinding by the E. coli transcription termination factor, electrophoresis as described (14). Purified oligonucleotides Rho, which is a DNA-RNA helicase. This enzyme appears to were quantitated by using UV absorbance at 260 nm in 0.1 M function as a hexamer, and translocation along ssRNA is NaOH and calculated extinction coefficients. The extinction fueled by ATP hydrolysis that induces conformational coefficient for 2-AP at 260 nm is 1000 M-1 cm-1 (15) and thus changes in the enzyme and allows unidirectional movement contributes very little to the overall absorbance of the oligo- along the bound RNA strand. This model does not invoke nucleotide. interactions between the enzyme and duplex region and Fluorescence Titration. Experiments were performed using suggests, instead, that the helicase movement might "unzip- an SLM Aminco 8000 spectrofluorometer. The oligonucleo- per" the DNARNA hybrid (3, 6, 7). tide containing the 2-APs (250 nM, referred to as 2-AP leading The standard assay for measuring helicase activity uses gel strand; Fig. 1B) was added to helicase unwindingbuffer(1 ml) electrophoresis to observe unwinding of double-strand DNA in a temperature-controlled cuvette at 25TC. Helicase un- by separating substrate (duplex strands) from product (single winding buffer contained 25 mM Tris acetate (pH 7.4), 10 mM strands) on a native polyacrylamide or agarose gel (1). This potassium acetate, 10 mM magnesium acetate, 3 mM ATP, 4 assay is discontinuous and only measures substrate that has mM phosphoenolpyruvate, pyruvate kinase (10 units/ml), 1 been completely unwound. It is not suitable for pre-steady- mM 2-mercaptoethanol, and bovine serum albumin (0.1 mg/ state analysis in the sense that unwinding cannot be observed ml). The partially complimentary oligonucleotide (referred to prior to complete unwinding of the substrate. Thus, the as the lagging strand in Fig. 1B) was titrated into the solution in 50-pmol aliquots. The two strands were allowed to anneal The publication costs ofthis article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" Abbreviations: 2-AP, 2-aminopurine, ss, single strand. in accordance with 18 U.S.C. §1734 solely to indicate this fact. §To whom reprint requests should be addressed. 6644 Downloaded by guest on October 1, 2021 Biochemistry: Raney et al. Proc. Natl. Acad. Sci. USA 91 (1994) 6645 A dR A'T base pair 2-AP-T base pair B Lagging Strand 5'-TAACGTATTCAAGATACCTCGTACTCTG T A CTGACTGCGTTCCTGCATGCCTGCATGAGT GACTGACGCAAGGACGTACGGACGTACT A T 3'-TGAACTTAGTGCATGATATACTGTGTATT 2-AP Leading Strand FiG. 1. (A) Base-pairing scheme for 2-aminopurine 2'-deoxynucleoside with thymidine. Normal base pairing for deoxyadenosine and thymidine are also shown. The overall structure ofB-form DNA is maintained with 2-AP. (B) Oligonucleotide fork containing seven 2-APresidues (underlined) regularly spaced in the duplex region. The nomenclature of the two strands of the DNA fork is based on their roles in DNA replication. for =5 min before fluorescence spectra were obtained. The Applied Photophysics (Leatherhead, Surrey, U.K.). Dda excitation wavelength was set at 310 nm. helicase was incubated with the 2-AP DNA fork in helicase DNA Uni Measured by Gel Electrophoresis. The unwinding buffer at 25°C in one syringe ofthe instrument, and leading strand (10 pmol) ofthe DNA fork was 5'-end-labeled ATP and MgOAc were incubated in the second syringe. The with 32p. The labeled 2-AP leading strand was annealed to an unwinding reaction was initiated by rapid mixing of the two equivalent amount of lagging strand and the labeled 2-AP solutions. Concentrations after mixing were as follows: 50 DNA fork was then added to a stock solution of unlabeled nM dda helicase, 250 nM 2-AP DNA fork, 3 mM ATP, and 2-AP DNA fork. A second leading strand identical to the 10 mM MgOAc. Excitation wavelength was set at 310 nm 2-AP strand except containing adenine instead of 2-AP was with a bandpass of30 nm. A 330-nm cutofffilter was used for also end-labeled, annealed to lagging strand, and added to a observing fluorescence emission of 2-AP. Kinetic simula- stock solution ofunlabeled DNA fork substrate. Either ofthe tions were performed using the KINSIM program as described two DNA substrates was added to helicase assay buffer up to (14). a final concentration of 250 nM. Dda helicase was added to the reaction mixture at levels up to 50 nM and incubated for 3 min at 250C. The unwinding reaction was initiated by adding RESULTS 10 j4 of a solution of ATP and MgOAc to give final concen- Fluorescence of the 2-AP DNA Strand Is Quenched Upon trations of 3 mM and 10 mM, respectively. Total volume for Annelug to a Complementary Stad. The adenosine analog, the reaction mixture was 60 td. Aliquots (10 1d) of the 2-aminopurine 2'-deoxyribonucleoside, can form a Watson- unwinding reaction mixture were taken at 10-s intervals and Crick-type base pair with thymidine (Fig. 1A) and maintain added to 10 Ad ofquench solution. Quench solution contained the overall structure ofduplex DNA (10). An oligonucleotide EDTA (0.5 M) and a 30-mer oligonucleotide (10 uM) that was was prepared in which seven 2-AP residues were incorpo- complimentary to the duplex region ofthe lagging strand. The rated at regular intervals by using phosphoramidite DNA 30-mer served as a trap to prevent reannealing ofthe unpaired synthesis methods (Fig. 1B, 2-AP leading strand). A partially strands after the reaction was quenched. Final trap concen- 1B, strand) was tration in quenched samples was 5 puM (40-fold in excess of complementary oligonucleotide (Fig.