sign in sign up
<<
Home , Helicase, Shelterin, Telomerase

Roles for RecQ in Preservation

Patricia L. Opresko

University of Pittsburgh Department of Environmental and Occupational Health Bridgeside Point 100 Technology Drive, Suite 350 Pittsburgh, PA 15219-3130 [email protected]

Symptoms Average Age of Onset (yrs) Greying of hair 20 Wrinkling of the skin 25.3 Loss of hair 25.8 Cataracts 30 Skin Ulcers 30 14 Years Old (type II) 34.2 Death 47

Osteoporosis Atherosclerosis

48 Years Old RecQ Family “Care Takers” of the Genome

RecQ, E. coli

Sgs1, S. cer.

Rqh1, S. pombe

FFA-1, X. laevis

RecQ5β, D. melanogaster

RecQL, H. sapiens

BLM, H. sapiens

WRN, H. sapiens

RecQ4, H. sapiens

RecQ5β, H. sapiens

Exonuclease AcidicHelicase RecQ HRDC NLS 3’ to 5’ 3’ to 5’ conserved Cellular defects in WS lines

• Genomic Instability • DNA Repair – Chromosomal – Hypersensitivity to rearrangements, 4-NQO translocations, dicentrics DNA crosslinking agents – Large deletions inhibitors methyl methanesulfonate

• Replication – Reduced replicative lifespan • Telomere instability – Extended S-phase

• Mitotic Homologous DNA Recombination – Defect in resolving intermediates Telomere-Associated Replicative

Germ cells: Germ sufficient activity - no shortening

A dul Adult stem cells: t S s variable levels of telomerase activity o te m m a + exogenous - slow shortening t ic telomerase cells: most have no telomerase activity - exhibit faster rates of shortening telomere- senescencesenescence se dependent era m Cancer cells: Telo ALT 90% show high telomerase activity 10% use an alternative pathway - no telomere loss

Modified from Campisi 2001 Exp. Geron. Protect Ends Complex of and DNA

Shelterin/ 6 protein complex

CLOSED TRF2 TRF1 Bind duplex repeats

POT1 Binds single strand DNA (TTAGGG)n TTAGGGTTAG 3’

(AATCCC)n Loss of Telomerase telomeric DNA DNA Repair Genomic ALT (HR) (TTAGGG)n instability 3’ (AATCCC)n Activate DNA damage response OPEN

Senescence/ Telomere Dysfunction Contributes to WS Pathology

WS primary fibroblasts

Exhibit telomere loss 1. Accelerated decrease of mean telomere lengths (Shulz 1996) 2. Increased loss of telomeres from sister (Crabbe 2004)

Expression of either WRN or telomerase can prevent 1. Premature senescence (Wyllie 2000) 2. Sister telomere loss (Crabbe 2004) 3. Accumulation of aberrant (fusions, breaks, translocations) (Crabbe 2007)

Mouse models Wrn-/- mice appear normal

late generation Wrn-/-Terc-/- mice with shortened telomeres exhibit WS phenotypes (Chang 2004, Du 2004) Evidence For WRN Activity at Telomeres

Telomere Replication

WRN localizes to telomeres in S-phase telomerase deficient cells • In telomerase-negative ALT cells (Opresko 2004)

HcRed-PCNA ECFP-TRF1 EYFP-WRN

3’

• In primary fibroblasts - WRN prevents the loss of telomeres replicated from the G-rich lagging strand; by CO-FISH (Crabbe 2004). - Pot1a and FEN1 defects also cause preferential loss of lagging strand telomeres (Wu 2006; Saharia 2008) Evidence For WRN Activity at Telomeres

Telomere Recombination

WRN and POT1 suppress aberrant telomere recombination and exchanges (Laud 2005, Wu 2006, He 2006, Li 2008)

Late generation Wrn-/-Terc-/- mice and Pot1a-/- mice exhibit:

increased telomeric sister exchanges intra-telomere recombination

WS human and Pot1a -/- mouse cells exhibit

increased telomere circles HJ cleavage of telomere T-loop

Griffith et al 1999, Cell WRN and BLM Roles at Telomeres

Intra-telomeric D-loop Telomere Binding Inter-telomeric D-loop Proteins 5’ 3’ 3’ 5’ TRF2 TRF1 POT1 3’ 5’ 3’ 3’

intra- or inter- telomeric WRN BLM G-quadruplex 3’

Hypothesis: WRN and BLM protein cooperate with telomeric proteins to dissociate alternate DNA structures at telomeres during replication and repair

• TRF2 recruits WRN and BLM to telomeric DNA (Opresko 2002; Machwe 2004) • POT1 physically binds WRN in HeLa cells (BLM interaction is weaker) (Opresko 2005) POT1 stimulates the WRN and BLM helicase activity

5’ (TTAGGG)4 5’ 34 bp

X-WRN - + + + + - RecQ - + + + + + X-WRN - + + + + POT1 - - ▲ + POT1 - - ▲ POT1 - - ▲ +

45 40 POT1 35 +POT1 • Increases the amount and rate of WRN strand 30 displacement; also BLM helicase 25 20 15 • Does not alter WRN or BLM unwinding of a 10 non-telomeric fork % Displacement 5 0 0 2 4 6 8 10 12 14 16 18 • Does not alter unwinding by bacterial Time (min.) helicases UvrD and RecQ Opresko 2005 WRN Helicase and Exonuclease Cooperate to Dissociate Fork-like Substrates

5’ 5’ 5’ 34 bp helicase exo 3’ X 3’ 3’ ▪ WRN exonuclease is inefficient on short ssDNA

▪ WRN is inactive on blunt ended duplex DNA

▪ Junctions in the active the exonuclease at blunt ends

▪ Also cooperate to release invading strand of a D-loop

helicase exonuclease

5’ 3’ POT1 Limits WRN Exonuclease by Stimulating WRN Helicase

(TTAGGG)4 (TTAGGG)4 34 bp WRN - + + + + + + ATP + + - + + + - - - POT1 - - R Δ WRN - + + + + + + + + POT1 - - - D-loop

shortened products Native Gel

• POT1 does not alter the WRN shortened products exonuclease in the absence of ATP/helicase activity (Opresko, JBC 2005) Possible Mechanisms of WRN Helicase Stimulation by POT1

5’ (TTAGGG)4 3’ POT1

WRN helicase 1st Binding cycle WRN exo

> 39 nt X

2nd Binding cycle

< 33 nt > 39 nt

X X Can POT1 Pre-loading Stimulate WRN Helicase ?

(TTAGGG)4 (TTAGGG)4

3’ 34 bp 3’ 22 bp 3’ 22 bp (TTAGGG)4

WRN - + + + + WRN - + + + + WRN - + + + + POT1 - - POT1 - - POT1 - - Shorter Products

%TD 71 71 71 69 % TD 89 89 88 73 %TD 66 63 61 51

POT1 pre-loading - is not sufficient to stimulate WRN helicase - does not prevent WRN activity POT1 and RPA Differ in Regulation of WRN on Open Telomeric Ends (TTAGGG)7 (TTAGGG)3TTAG POT1 3’ WRN helicase 3’ 36 bp 36 bp WRN exo

POT1 RPA Non-telomeric tail

WRN - + + + + - - - + + + - WRN - + + + + SSBP - - + - - + POT1 - -

shortened products 6x↓ 19x↑

POT1 inhibition requires POT1 inhibits WRN, RPA stimulates a telomeric tail Addition of a 5’ ssDNA Tail (Fork) Restores POT1 Stimulation of WRN

Telomeric Tail (TTAGGG)7 3’ exo helicase 36 bp

WRN - + + + + - - + + + + POT1 - - + --

Shorter Products

+ATP +ATPγS (no helicase activity) POT1 Pre-loading Promotes WRN Helicase Unwinding of Telomeric Forks

(TTAGGG)3 TTAG 3’

4 Fold Tel 3’ tail sequence Increase 3 Mix CTGTTTGCATCGATCTGC 1.5 Tel-G Tel-B Tel GGTTAGGGTTAGGGTTAGGG 3.7 2 Tel-A Tel-A GGTTACGGTTAGGGTTAGGG 1.8 Mix Tel-B GGTTAGGGTTAGGCTTAGGG 2.3 1 Intact Telomeric Product Tel-G GGTTAGGGTTAGGGTTAG 2.6 0 20406080100120 = POT1 POT1 (nM)

POT1 loading near the junction (Tel-B) is more important for WRN stimulation Summary of POT1 Modulation of WRN Activity

Substrate Effect on Exonuclease not =(TTAGGG)n WRN Helicase altered directly

3’ Stimulation

3’ No effect

3’ Inhibition of activity 3’ Stimulation

POT1 binding mode may regulate WRN activity

POT1 POT1 3’ 3’ WRN WRN ATC-5’ OFF ON POT1 May Protect Telomeric Ends from Fraying by DNA Helicases

• Yeast lacking Taz1 (TRF2) and expressing mutant RPA (mRPA) exhibit rapid telomere loss

• Telomere loss is suppressed if Rqh1 (RecQ) is knocked out OR POT1 is overexpressed

• Coating of the telomeric tail with POT1 vs. RPA has profound consequences for WRN helicase activity

Kibe et al MBC, 2007, p. 2378. Fission Yeast Taz1 and RPA Are Synergistically Required to Prevent Rapid Telomere Loss POT1 Does Not Retain WRN on Telomeric 34 bp Telomeric Forks During Unwinding 3’

WRN - + + + + Mix 22 bp POT1 3’ POT1 -- bound to ssDNA product 5.0

4.0

3.0

2.0

1.0 unwound forks Ratio of long:short 0.0 050100150 POT1 nM

POT1 does not alter the ratio of unwound long telomeric forks to short mixed sequence forks MCM helicase N-terminus increases the ratio of unwound long:short duplexes - acts as a clamp (Barry et al 2007, NAR) Summary and Conclusions

1. POT1 stimulates WRN and BLM helicases, but not E. coli RecQ - species specific

2. POT1 pre-loading on telomeric tails: A. is not sufficient to stimulate WRN; does not recruit WRN

B. inhibits WRN activity on 3’ tailed telomeric duplexes - POT1 protects telomeres in the OPEN form

C. stimulates WRN unwinding of telomeric forks - POT1 interaction with the ssDNA/dsDNA junction regulates WRN

3. POT1 does not retain WRN on telomeric forks during unwinding - stimulation is by preventing strand re-annealing rather than WRN dissociation

4. WRN show increased processivity on plasmid D-loops compared to oligomeric D-loops - POT1 stimulates WRN helicase on telomeres in the CLOSED form Roles for WRN Protein at Telomeric Ends

POT1

3’ TRF2 WRN helicase helicasehelicase5’5’ exonuclease WRN exo 3’3’ exonuclease

+ WRN Replication stall Restore replication in telomere fork

+WRN Dissociate without -WRN strand cross over Fork collapse Initiation of HR and DS break mediated repair Resolve with telomerase -WRN -WRN strand cross over Sister telomere T-SCE loss shortened telomere Acknowledgements Opresko lab • Jerry Nora • Vilhelm Bohr, NIA •Greg Sowd • Ming Lei, U. of Michigan • Fujun Liu • Peter Baumann, Stowers Inst. • Rama Damerla • James Keck, U. of Wisconsin • Walter Chazin, Vanderbilt

Funding • Ellison Medical Foundation •NIEHS