DOCSLIB.ORG

Roles for Recq Helicases in Telomere Preservation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Roles for RecQ Helicases in Telomere Preservation Patricia L. Opresko University of Pittsburgh Department of Environmental and Occupational Health Bridgeside Point 100 Technology Drive, Suite 350 Pittsburgh, PA 15219-3130 [email protected] Werner Syndrome Symptoms Average Age of Onset (yrs) Greying of hair 20 Wrinkling of the skin 25.3 Loss of hair 25.8 Cataracts 30 Skin Ulcers 30 14 Years Old Diabetes (type II) 34.2 Death 47 Osteoporosis Atherosclerosis Cancer 48 Years Old RecQ Family “Care Takers” of the Genome RecQ, E. coli Sgs1, S. cer. Rqh1, S. pombe FFA-1, X. laevis RecQ5β, D. melanogaster RecQL, H. sapiens BLM, H. sapiens WRN, H. sapiens RecQ4, H. sapiens RecQ5β, H. sapiens Exonuclease AcidicHelicase RecQ HRDC NLS 3’ to 5’ 3’ to 5’ conserved Cellular defects in WS cell lines • Genomic Instability • DNA Repair – Chromosomal – Hypersensitivity to rearrangements, 4-NQO translocations, dicentrics DNA crosslinking agents – Large deletions topoisomerase inhibitors methyl methanesulfonate • Replication – Reduced replicative lifespan • Telomere instability – Extended S-phase • Mitotic Homologous DNA Recombination – Defect in resolving intermediates Telomere-Associated Replicative Senescence Germ cells: Germ sufficient telomerase activity - no shortening A dul Adult stem cells: t S s variable levels of telomerase activity o te m m a + exogenous - slow shortening t ic telomerase Somatic cells: most have no telomerase activity - exhibit faster rates of shortening telomere- senescencesenescence se dependent era m Cancer cells: Telo ALT 90% show high telomerase activity 10% use an alternative pathway - no telomere loss Modified from Campisi 2001 Exp. Geron. Telomeres Protect Chromosome Ends Complex of Protein and DNA Shelterin/ 6 protein complex CLOSED TRF2 TRF1 Bind duplex repeats POT1 Binds single strand DNA (TTAGGG)n TTAGGGTTAG 3’ (AATCCC)n Loss of Telomerase telomeric DNA DNA Repair proteins Genomic ALT (HR) (TTAGGG)n instability 3’ (AATCCC)n Activate DNA damage response OPEN Senescence/ Apoptosis Telomere Dysfunction Contributes to WS Pathology WS primary fibroblasts Exhibit telomere loss 1. Accelerated decrease of mean telomere lengths (Shulz 1996) 2. Increased loss of telomeres from sister chromatids (Crabbe 2004) Expression of either WRN or telomerase can prevent 1. Premature senescence (Wyllie 2000) 2. Sister telomere loss (Crabbe 2004) 3. Accumulation of aberrant chromosomes (fusions, breaks, translocations) (Crabbe 2007) Mouse models Wrn-/- mice appear normal late generation Wrn-/-Terc-/- mice with shortened telomeres exhibit WS phenotypes (Chang 2004, Du 2004) Evidence For WRN Activity at Telomeres Telomere Replication WRN localizes to telomeres in S-phase telomerase deficient cells • In telomerase-negative ALT cells (Opresko 2004) HcRed-PCNA ECFP-TRF1 EYFP-WRN 3’ • In primary fibroblasts - WRN helicase prevents the loss of telomeres replicated from the G-rich lagging strand; by CO-FISH (Crabbe 2004). - Pot1a and FEN1 defects also cause preferential loss of lagging strand telomeres (Wu 2006; Saharia 2008) Evidence For WRN Activity at Telomeres Telomere Recombination WRN and POT1 suppress aberrant telomere recombination and exchanges (Laud 2005, Wu 2006, He 2006, Li 2008) Late generation Wrn-/-Terc-/- mice and Pot1a-/- mice exhibit: increased telomeric sister chromatid exchanges intra-telomere recombination WS human and Pot1a -/- mouse cells exhibit increased telomere circles HJ cleavage of telomere T-loop Griffith et al 1999, Cell WRN and BLM Roles at Telomeres Intra-telomeric D-loop Telomere Binding Inter-telomeric D-loop Proteins 5’ 3’ 3’ 5’ TRF2 TRF1 POT1 3’ 5’ 3’ 3’ intra- or inter- telomeric WRN BLM G-quadruplex 3’ Hypothesis: WRN and BLM protein cooperate with telomeric proteins to dissociate alternate DNA structures at telomeres during replication and repair • TRF2 recruits WRN and BLM to telomeric DNA (Opresko 2002; Machwe 2004) • POT1 physically binds WRN in HeLa cells (BLM interaction is weaker) (Opresko 2005) POT1 stimulates the WRN and BLM helicase activity 5’ (TTAGGG)4 5’ 34 bp X-WRN - + + + + - RecQ - + + + + + X-WRN - + + + + POT1 - - ▲ + POT1 - - ▲ POT1 - - ▲ + 45 40 POT1 35 +POT1 • Increases the amount and rate of WRN strand 30 displacement; also BLM helicase 25 20 15 • Does not alter WRN or BLM unwinding of a 10 non-telomeric fork % Displacement 5 0 0 2 4 6 8 10 12 14 16 18 • Does not alter unwinding by bacterial Time (min.) helicases UvrD and RecQ Opresko 2005 WRN Helicase and Exonuclease Cooperate to Dissociate Fork-like Substrates 5’ 5’ 5’ 34 bp helicase exo 3’ X 3’ 3’ ▪ WRN exonuclease is inefficient on short ssDNA ▪ WRN is inactive on blunt ended duplex DNA ▪ Junctions in the substrate active the exonuclease at blunt ends ▪ Also cooperate to release invading strand of a D-loop helicase exonuclease 5’ 3’ POT1 Limits WRN Exonuclease by Stimulating WRN Helicase (TTAGGG)4 (TTAGGG)4 34 bp WRN - + + + + + + ATP + + - + + + - - - POT1 - - R Δ WRN - + + + + + + + + POT1 - - - D-loop shortened products Native Gel • POT1 does not alter the WRN shortened products exonuclease in the absence of ATP/helicase activity (Opresko, JBC 2005) Possible Mechanisms of WRN Helicase Stimulation by POT1 5’ (TTAGGG)4 3’ POT1 WRN helicase 1st Binding cycle WRN exo > 39 nt X 2nd Binding cycle < 33 nt > 39 nt X X Can POT1 Pre-loading Stimulate WRN Helicase ? (TTAGGG)4 (TTAGGG)4 3’ 34 bp 3’ 22 bp 3’ 22 bp (TTAGGG)4 WRN - + + + + WRN - + + + + WRN - + + + + POT1 - - POT1 - - POT1 - - Shorter Products %TD 71 71 71 69 % TD 89 89 88 73 %TD 66 63 61 51 POT1 pre-loading - is not sufficient to stimulate WRN helicase - does not prevent WRN activity POT1 and RPA Differ in Regulation of WRN on Open Telomeric Ends (TTAGGG)7 (TTAGGG)3TTAG POT1 3’ WRN helicase 3’ 36 bp 36 bp WRN exo POT1 RPA Non-telomeric tail WRN - + + + + - - - + + + - WRN - + + + + SSBP - - + - - + POT1 - - shortened products 6x↓ 19x↑ POT1 inhibition requires POT1 inhibits WRN, RPA stimulates a telomeric tail Addition of a 5’ ssDNA Tail (Fork) Restores POT1 Stimulation of WRN Telomeric Tail (TTAGGG)7 3’ exo helicase 36 bp WRN - + + + + - - + + + + POT1 - - + -- Shorter Products +ATP +ATPγS (no helicase activity) POT1 Pre-loading Promotes WRN Helicase Unwinding of Telomeric Forks (TTAGGG)3 TTAG 3’ 4 Fold Tel 3’ tail sequence Increase 3 Mix CTGTTTGCATCGATCTGC 1.5 Tel-G Tel-B Tel GGTTAGGGTTAGGGTTAGGG 3.7 2 Tel-A Tel-A GGTTACGGTTAGGGTTAGGG 1.8 Mix Tel-B GGTTAGGGTTAGGCTTAGGG 2.3 1 Intact Telomeric Product Tel-G GGTTAGGGTTAGGGTTAG 2.6 0 20406080100120 = POT1 binding site POT1 (nM) POT1 loading near the junction (Tel-B) is more important for WRN stimulation Summary of POT1 Modulation of WRN Activity Substrate Effect on Exonuclease not =(TTAGGG)n WRN Helicase altered directly 3’ Stimulation 3’ No effect 3’ Inhibition of activity 3’ Stimulation POT1 binding mode may regulate WRN activity POT1 POT1 3’ 3’ WRN WRN ATC-5’ OFF ON POT1 May Protect Telomeric Ends from Fraying by DNA Helicases • Yeast lacking Taz1 (TRF2) and expressing mutant RPA (mRPA) exhibit rapid telomere loss • Telomere loss is suppressed if Rqh1 (RecQ) is knocked out OR POT1 is overexpressed • Coating of the telomeric tail with POT1 vs. RPA has profound consequences for WRN helicase activity Kibe et al MBC, 2007, p. 2378. Fission Yeast Taz1 and RPA Are Synergistically Required to Prevent Rapid Telomere Loss POT1 Does Not Retain WRN on Telomeric 34 bp Telomeric Forks During Unwinding 3’ WRN - + + + + Mix 22 bp POT1 3’ POT1 -- bound to ssDNA product 5.0 4.0 3.0 2.0 1.0 unwound forks Ratio of long:short 0.0 050100150 POT1 nM POT1 does not alter the ratio of unwound long telomeric forks to short mixed sequence forks MCM helicase N-terminus increases the ratio of unwound long:short duplexes - acts as a processivity clamp (Barry et al 2007, NAR) Summary and Conclusions 1. POT1 stimulates WRN and BLM helicases, but not E. coli RecQ - species specific 2. POT1 pre-loading on telomeric tails: A. is not sufficient to stimulate WRN; does not recruit WRN B. inhibits WRN activity on 3’ tailed telomeric duplexes - POT1 protects telomeres in the OPEN form C. stimulates WRN unwinding of telomeric forks - POT1 interaction with the ssDNA/dsDNA junction regulates WRN 3. POT1 does not retain WRN on telomeric forks during unwinding - stimulation is by preventing strand re-annealing rather than WRN dissociation 4. WRN show increased processivity on plasmid D-loops compared to oligomeric D-loops - POT1 stimulates WRN helicase on telomeres in the CLOSED form Roles for WRN Protein at Telomeric Ends POT1 3’ TRF2 WRN helicase helicasehelicase5’5’ exonuclease WRN exo 3’3’ exonuclease + WRN Replication stall Restore replication in telomere fork +WRN Dissociate without -WRN strand cross over Fork collapse Initiation of HR and DS break mediated repair Resolve with telomerase -WRN -WRN strand cross over Sister telomere T-SCE loss shortened telomere Acknowledgements Opresko lab • Jerry Nora • Vilhelm Bohr, NIA •Greg Sowd • Ming Lei, U. of Michigan • Fujun Liu • Peter Baumann, Stowers Inst. • Rama Damerla • James Keck, U. of Wisconsin • Walter Chazin, Vanderbilt Funding • Ellison Medical Foundation •NIEHS.
Recommended publications
  • Introduction of Human Telomerase Reverse Transcriptase to Normal Human Fibroblasts Enhances DNA Repair Capacity

    Introduction of Human Telomerase Reverse Transcriptase to Normal Human Fibroblasts Enhances DNA Repair Capacity

    Vol. 10, 2551–2560, April 1, 2004 Clinical Cancer Research 2551 Introduction of Human Telomerase Reverse Transcriptase to Normal Human Fibroblasts Enhances DNA Repair Capacity Ki-Hyuk Shin,1 Mo K. Kang,1 Erica Dicterow,1 INTRODUCTION Ayako Kameta,1 Marcel A. Baluda,1 and Telomerase, which consists of the catalytic protein subunit, No-Hee Park1,2 human telomerase reverse transcriptase (hTERT), the RNA component of telomerase (hTR), and several associated pro- 1School of Dentistry and 2Jonsson Comprehensive Cancer Center, University of California, Los Angeles, California teins, has been primarily associated with maintaining the integ- rity of cellular DNA telomeres in normal cells (1, 2). Telomer- ase activity is correlated with the expression of hTERT, but not ABSTRACT with that of hTR (3, 4). Purpose: From numerous reports on proteins involved The involvement of DNA repair proteins in telomere main- in DNA repair and telomere maintenance that physically tenance has been well documented (5–8). In eukaryotic cells, associate with human telomerase reverse transcriptase nonhomologous end-joining requires a DNA ligase and the (hTERT), we inferred that hTERT/telomerase might play a DNA-activated protein kinase, which is recruited to the DNA role in DNA repair. We investigated this possibility in nor- ends by the DNA-binding protein Ku. Ku binds to hTERT mal human oral fibroblasts (NHOF) with and without ec- without the need for telomeric DNA or hTR (9), binds the topic expression of hTERT/telomerase. telomere repeat-binding proteins TRF1 (10) and TRF2 (11), and Experimental Design: To study the effect of hTERT/ is thought to regulate the access of telomerase to telomere DNA telomerase on DNA repair, we examined the mutation fre- ends (12, 13).
  • Telomeres.Pdf

    Telomeres.Pdf

    Telomeres Secondary article Elizabeth H Blackburn, University of California, San Francisco, California, USA Article Contents . Introduction Telomeres are specialized DNA–protein structures that occur at the ends of eukaryotic . The Replication Paradox chromosomes. A special ribonucleoprotein enzyme called telomerase is required for the . Structure of Telomeres synthesis and maintenance of telomeric DNA. Synthesis of Telomeric DNA by Telomerase . Functions of Telomeres Introduction . Telomere Homeostasis . Alternatives to Telomerase-generated Telomeric DNA Telomeres are the specialized chromosomal DNA–protein . Evolution of Telomeres and Telomerase structures that comprise the terminal regions of eukaryotic chromosomes. As discovered through studies of maize and somes. One critical part of this protective function is to fruitfly chromosomes in the 1930s, they are required to provide a means by which the linear chromosomal DNA protect and stabilize the genetic material carried by can be replicated completely, without the loss of terminal eukaryotic chromosomes. Telomeres are dynamic struc- DNA nucleotides from the 5’ end of each strand of this tures, with their terminal DNA being constantly built up DNA. This is necessary to prevent progressive loss of and degraded as dividing cells replicate their chromo- terminal DNA sequences in successive cycles of chromo- somes. One strand of the telomeric DNA is synthesized by somal replication. a specialized ribonucleoprotein reverse transcriptase called telomerase. Telomerase is required for both
  • Expression of Telomerase Activity, Human Telomerase RNA, and Telomerase Reverse Transcriptase in Gastric Adenocarcinomas Jinyoung Yoo, M.D., Ph.D., Sonya Y

    Expression of Telomerase Activity, Human Telomerase RNA, and Telomerase Reverse Transcriptase in Gastric Adenocarcinomas Jinyoung Yoo, M.D., Ph.D., Sonya Y

    Expression of Telomerase Activity, Human Telomerase RNA, and Telomerase Reverse Transcriptase in Gastric Adenocarcinomas Jinyoung Yoo, M.D., Ph.D., Sonya Y. Park, Seok Jin Kang, M.D., Ph.D., Byung Kee Kim, M.D., Ph.D., Sang In Shim, M.D., Ph.D., Chang Suk Kang, M.D., Ph.D. Department of Pathology, St. Vincent’s Hospital, Catholic University, Suwon, South Korea esis of gastric cancer and may reflect, along with Telomerase is an RNA-dependent DNA polymerase enhanced hTR, the malignant potential of the tu- that synthesizes TTAGGG telomeric DNA onto chro- mor. It is noteworthy that methacarn-fixed tissue mosome ends to compensate for sequence loss dur- cannot as yet substitute for the frozen section in the ing DNA replication. It has been detected in 85–90% TRAP assay. of all primary human cancers, implicating that the telomerase seems to be reactivated in tumors and KEY WORDS: hTR, Stomach cancer, Telomerase, that such activity may play a role in the tumorigenic TERT. process. The purpose of this study was to evaluate Mod Pathol 2003;16(7):700–707 telomerase activity, human telomerase RNA (hTR), and telomerase reverse transcriptase (TERT) in Recent studies of stomach cancer have been di- stomach cancer and to determine their potential rected toward gaining a better understanding of relationships to clinicopathologic parameters. Fro- tumor biology. Molecular analysis has suggested zen and corresponding methacarn-fixed paraffin- that alterations in the structures and functions of embedded tissue samples were obtained from 51 oncogenes and tumor suppressor genes, genetic patients with gastric adenocarcinoma and analyzed instability, as well as the acquisition of cell immor- for telomerase activity by using a TRAPeze ELISA tality may be of relevance in the pathogenesis of kit.
  • Saccharomyces Rrm3p, a 5 to 3 DNA Helicase That Promotes Replication

    Saccharomyces Rrm3p, a 5 to 3 DNA Helicase That Promotes Replication

    Downloaded from genesdev.cshlp.org on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press Saccharomyces Rrm3p, a 5؅ to 3؅ DNA helicase that promotes replication fork progression through telomeric and subtelomeric DNA Andreas S. Ivessa,1 Jin-Qiu Zhou,1,2 Vince P. Schulz, Ellen K. Monson, and Virginia A. Zakian3 Department of Molecular Biology, Princeton University, Princeton, New Jersey 08544-1014, USA In wild-type Saccharomyces cerevisiae, replication forks slowed during their passage through telomeric ؅ C1–3A/TG1–3 tracts. This slowing was greatly exacerbated in the absence of RRM3, shown here to encode a 5 ,to 3؅ DNA helicase. Rrm3p-dependent fork progression was seen at a modified Chromosome VII-L telomere at the natural X-bearing Chromosome III-L telomere, and at Y؅-bearing telomeres. Loss of Rrm3p also resulted in replication fork pausing at specific sites in subtelomeric DNA, such as at inactive replication origins, and at internal tracts of C1–3A/TG1–3 DNA. The ATPase/helicase activity of Rrm3p was required for its role in telomeric and subtelomeric DNA replication. Because Rrm3p was telomere-associated in vivo, it likely has a direct role in telomere replication. [Key Words: Telomere; helicase; telomerase; replication; RRM3; yeast] Received February 7, 2002; revised version accepted April 10, 2002. Telomeres are the natural ends of eukaryotic chromo- Because conventional DNA polymerases cannot repli- somes. In most organisms, the very ends of chromo- cate the very ends of linear DNA molecules, special somes consist of simple repeated sequences. For ex- mechanisms are required to prevent the loss of terminal ample, Saccharomyces cerevisiae chromosomes end in DNA.
  • Fructose Causes Liver Damage, Polyploidy, and Dysplasia in the Setting of Short Telomeres and P53 Loss

    Fructose Causes Liver Damage, Polyploidy, and Dysplasia in the Setting of Short Telomeres and P53 Loss

    H OH metabolites OH Article Fructose Causes Liver Damage, Polyploidy, and Dysplasia in the Setting of Short Telomeres and p53 Loss Christopher Chronowski 1, Viktor Akhanov 1, Doug Chan 2, Andre Catic 1,2 , Milton Finegold 3 and Ergün Sahin 1,4,* 1 Huffington Center on Aging, Baylor College of Medicine, Houston, TX 77030, USA; [email protected] (C.C.); [email protected] (V.A.); [email protected] (A.C.) 2 Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, TX 77030, USA; [email protected] 3 Department of Pathology, Baylor College of Medicine, Houston, TX 77030, USA; fi[email protected] 4 Department of Physiology and Biophysics, Baylor College of Medicine, Houston, TX 77030, USA * Correspondence: [email protected]; Tel.: +1-713-798-6685; Fax: +1-713-798-4146 Abstract: Studies in humans and model systems have established an important role of short telomeres in predisposing to liver fibrosis through pathways that are incompletely understood. Recent studies have shown that telomere dysfunction impairs cellular metabolism, but whether and how these metabolic alterations contribute to liver fibrosis is not well understood. Here, we investigated whether short telomeres change the hepatic response to metabolic stress induced by fructose, a sugar that is highly implicated in non-alcoholic fatty liver disease. We find that telomere shortening in telomerase knockout mice (TKO) imparts a pronounced susceptibility to fructose as reflected in the activation of p53, increased apoptosis, and senescence, despite lower hepatic fat accumulation in TKO mice compared to wild type mice with long telomeres. The decreased fat accumulation in TKO Citation: Chronowski, C.; Akhanov, is mediated by p53 and deletion of p53 normalizes hepatic fat content but also causes polyploidy, V.; Chan, D.; Catic, A.; Finegold, M.; Sahin, E.
  • The Architecture of a Eukaryotic Replisome

    The Architecture of a Eukaryotic Replisome

    The Architecture of a Eukaryotic Replisome Jingchuan Sun1,2, Yi Shi3, Roxana E. Georgescu3,4, Zuanning Yuan1,2, Brian T. Chait3, Huilin Li*1,2, Michael E. O’Donnell*3,4 1 Biosciences Department, Brookhaven National Laboratory, Upton, New York, USA 2 Department of Biochemistry & Cell Biology, Stony Brook University, Stony Brook, New York, USA. 3 The Rockefeller University, 1230 York Avenue, New York, New York, USA. 4 Howard Hughes Medical Institute *Correspondence and requests for materials should be addressed to M.O.D. ([email protected]) or H.L. ([email protected]) ABSTRACT At the eukaryotic DNA replication fork, it is widely believed that the Cdc45-Mcm2-7-GINS (CMG) helicase leads the way in front to unwind DNA, and that DNA polymerases (Pol) trail behind the helicase. Here we use single particle electron microscopy to directly image a replisome. Contrary to expectations, the leading strand Pol ε is positioned ahead of CMG helicase, while Ctf4 and the lagging strand Pol α-primase (Pol α) are behind the helicase. This unexpected architecture indicates that the leading strand DNA travels a long distance before reaching Pol ε, it first threads through the Mcm2-7 ring, then makes a U-turn at the bottom to reach Pol ε at the top of CMG. Our work reveals an unexpected configuration of the eukaryotic replisome, suggests possible reasons for this architecture, and provides a basis for further structural and biochemical replisome studies. INTRODUCTION DNA is replicated by a multi-protein machinery referred to as a replisome 1,2. Replisomes contain a helicase to unwind DNA, DNA polymerases that synthesize the leading and lagging strands, and a primase that makes short primed sites to initiate DNA synthesis on both strands.
  • The Conserved Structure of Plant Telomerase RNA Provides the Missing Link for an Evolutionary Pathway from Ciliates to Humans

    The Conserved Structure of Plant Telomerase RNA Provides the Missing Link for an Evolutionary Pathway from Ciliates to Humans

    The conserved structure of plant telomerase RNA provides the missing link for an evolutionary pathway from ciliates to humans Jiarui Songa, Dhenugen Logeswaranb,1, Claudia Castillo-Gonzáleza,1, Yang Lib, Sreyashree Bosea, Behailu Birhanu Aklilua, Zeyang Mac,d, Alexander Polkhovskiya,e, Julian J.-L. Chenb,2, and Dorothy E. Shippena,2 aDepartment of Biochemistry and Biophysics, Texas A&M University, College Station, TX 77843; bSchool of Molecular Sciences, Arizona State University, Tempe, AZ 85287; cNational Maize Improvement Center of China, China Agricultural University, 100193 Beijing, China; dCollege of Agronomy and Biotechnology, China Agricultural University, 100193 Beijing, China; and eCenter of Life Sciences, Skolkovo Institute of Science and Technology, 121205 Moscow, Russian Federation Edited by Thomas R. Cech, University of Colorado Boulder, Boulder, CO, and approved October 24, 2019 (received for review September 4, 2019) Telomerase is essential for maintaining telomere integrity. Although transcribed by RNA polymerase III (Pol III) (6, 7). The La-related telomerase function is widely conserved, the integral telomerase protein P65 in Tetrahymena recognizes the 3′ poly-U tail of TR RNA (TR) that provides a template for telomeric DNA synthesis has and bends the RNA to facilitate telomerase RNP assembly (8, 9). diverged dramatically. Nevertheless, TR molecules retain 2 highly In contrast, fungi maintain much larger TR molecules (900 to conserved structural domains critical for catalysis: a template- 2,400 nt) that are transcribed by RNA polymerase II (Pol II) (3). proximal pseudoknot (PK) structure and a downstream stem-loop The 3′ end maturation of fungal TRs requires components of the structure. Here we introduce the authentic TR from the plant canonical snRNA biogenesis pathway and results in RNP assembly Arabidopsis thaliana, called AtTR, identified through next-generation sequencing of RNAs copurifying with Arabidopsis TERT.
  • A Balanced Transcription Between Telomerase and the Telomeric DNA

    A Balanced Transcription Between Telomerase and the Telomeric DNA

    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by HAL-ENS-LYON A balanced transcription between telomerase and the telomeric DNA-binding proteins TRF1, TRF2 and Pot1 in resting, activated, HTLV-1-transformed and Tax-expressing human T lymphocytes. Emmanuelle Escoffier, Am´elieRezza, Aude Roborel de Climens, Aur´elie Belleville, Louis Gazzolo, Eric Gilson, Madeleine Duc Dodon To cite this version: Emmanuelle Escoffier, Am´elieRezza, Aude Roborel de Climens, Aur´elieBelleville, Louis Gaz- zolo, et al.. A balanced transcription between telomerase and the telomeric DNA-binding proteins TRF1, TRF2 and Pot1 in resting, activated, HTLV-1-transformed and Tax-expressing human T lymphocytes.. Retrovirology, BioMed Central, 2005, 2, pp.77. <10.1186/1742-4690- 2-77>. <inserm-00089278> HAL Id: inserm-00089278 http://www.hal.inserm.fr/inserm-00089278 Submitted on 16 Aug 2006 HAL is a multi-disciplinary open access L'archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destin´eeau d´ep^otet `ala diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publi´esou non, lished or not. The documents may come from ´emanant des ´etablissements d'enseignement et de teaching and research institutions in France or recherche fran¸caisou ´etrangers,des laboratoires abroad, or from public or private research centers. publics ou priv´es. Retrovirology BioMed Central Research Open Access A balanced transcription between telomerase and the
  • Anti-TERF2 / Trf2 Antibody (ARG59099)

    Anti-TERF2 / Trf2 Antibody (ARG59099)

    Product datasheet [email protected] ARG59099 Package: 50 μg anti-TERF2 / Trf2 antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes TERF2 / Trf2 Tested Reactivity Hu, Rat Tested Application IHC-P, WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name TERF2 / Trf2 Antigen Species Human Immunogen Recombinant protein corresponding to A81-K287 of Human TERF2 / Trf2. Conjugation Un-conjugated Alternate Names Telomeric DNA-binding protein; TRF2; TTAGGG repeat-binding factor 2; TRBF2; Telomeric repeat- binding factor 2 Application Instructions Application table Application Dilution IHC-P 0.5 - 1 µg/ml WB 0.1 - 0.5 µg/ml Application Note IHC-P: Antigen Retrieval: By heat mediation. * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Calculated Mw 60 kDa Properties Form Liquid Purification Affinity purification with immunogen. Buffer 0.9% NaCl, 0.2% Na2HPO4, 0.05% Sodium azide and 5% BSA. Preservative 0.05% Sodium azide Stabilizer 5% BSA Concentration 0.5 mg/ml Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C or below. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. www.arigobio.com 1/3 Note For laboratory research only, not for drug, diagnostic or other use. Bioinformation Gene Symbol TERF2 Gene Full Name telomeric repeat binding factor 2 Background This gene encodes a telomere specific protein, TERF2, which is a component of the telomere nucleoprotein complex.
  • The Biochemical Activities of the Saccharomyces Cerevisiae Pif1 Helicase Are Regulated by Its N-Terminal Domain

    The Biochemical Activities of the Saccharomyces Cerevisiae Pif1 Helicase Are Regulated by Its N-Terminal Domain

    G C A T T A C G G C A T genes Article The Biochemical Activities of the Saccharomyces cerevisiae Pif1 Helicase Are Regulated by Its N-Terminal Domain David G. Nickens y, Christopher W. Sausen y and Matthew L. Bochman * Molecular and Cellular Biochemistry Department, Indiana University, Bloomington, IN 47405, USA; [email protected] (D.G.N.); [email protected] (C.W.S.) * Correspondence: [email protected] These authors contributed equally to this work. y Received: 31 March 2019; Accepted: 20 May 2019; Published: 28 May 2019 Abstract: Pif1 family helicases represent a highly conserved class of enzymes involved in multiple aspects of genome maintenance. Many Pif1 helicases are multi-domain proteins, but the functions of their non-helicase domains are poorly understood. Here, we characterized how the N-terminal domain (NTD) of the Saccharomyces cerevisiae Pif1 helicase affects its functions both in vivo and in vitro. Removal of the Pif1 NTD alleviated the toxicity associated with Pif1 overexpression in yeast. Biochemically, the N-terminally truncated Pif1 (Pif1DN) retained in vitro DNA binding, DNA unwinding, and telomerase regulation activities, but these activities differed markedly from those displayed by full-length recombinant Pif1. However, Pif1DN was still able to synergize with the Hrq1 helicase to inhibit telomerase activity in vitro, similar to full-length Pif1. These data impact our understanding of Pif1 helicase evolution and the roles of these enzymes in the maintenance of genome integrity. Keywords: DNA helicase; Saccharomyces cerevisiae; Pif1; telomerase; telomere 1. Introduction DNA helicases are enzymes that couple DNA binding and ATP hydrolysis to unwind double-stranded DNA (dsDNA) into its component single strands [1].
  • DNA Bound by the Oxytricha Telomere Protein Is Accessible to Telomerase and Other DNA Polymerases DOROTHY E

    DNA Bound by the Oxytricha Telomere Protein Is Accessible to Telomerase and Other DNA Polymerases DOROTHY E

    Proc. Natl. Acad. Sci. USA Vol. 91, pp. 405-409, January 1994 Biochemistry DNA bound by the Oxytricha telomere protein is accessible to telomerase and other DNA polymerases DOROTHY E. SHIPPEN*, ELIZABETH H. BLACKBURNt, AND CAROLYN M. PRICE0§ tDepartment of Microbiology and Immunology, University of California, San Francisco, CA 94143; and tDepartment of Chemistry, University of Nebraska, Lincoln, NB 68588 Contributed by Elizabeth H. Blackburn, August 25, 1993 ABSTRACT Macronuclear telomeres in Oxytricha exist as oftelomere protein in these two populations is not altered by DNA-protein complexes in which the termini of the G-rich additional nuclease treatment. strands are bound by a 97-kDa telomere protein. During The fragment of DNA bound by the majority of telomere telome'ic DNA replication, the replication machinery must protein molecules corresponds to the most terminal 13 or 14 have access to the G-rich strand. However, given the stability nucleotides of the T4G4T4G4 overhang (4). Dimethyl sulfate of telomere protein binding, it has been unclear how this is footprinting demonstrated that the complex formed between accomplished. In this study we investigated the ability of the telomere protein and the residual DNA fragment retains several different DNA polymerases to access telomeric DNA in the same DNA-protein contacts present at native telomeres Oxytricha telomere protein-DNA complexes. Although DNA (4). Thus, these telomeric DNA-protein complexes are useful bound by the telomere protein is not degraded by micrococcal substrates for in vitro investigations of telomere structure nuclease or labeled by terminal deoxynucleotidyltrnsferase, (10). In this study we have employed the DNA-protein this DNA serves as an efficient primer for the addition of complexes to analyze the interaction of protein-bound telo- telomeric repeats by telomerase, a specialized RNA-dependent meric DNA with components of the DNA replication ma- DNA polymerase (ribonucleoprotein reverse tanscriptase), chinery.
  • Mcm10 Has Potent Strand-Annealing Activity and Limits Translocase-Mediated Fork Regression

    Mcm10 Has Potent Strand-Annealing Activity and Limits Translocase-Mediated Fork Regression

    Mcm10 has potent strand-annealing activity and limits translocase-mediated fork regression Ryan Maylea, Lance Langstona,b, Kelly R. Molloyc, Dan Zhanga, Brian T. Chaitc,1,2, and Michael E. O’Donnella,b,1,2 aLaboratory of DNA Replication, The Rockefeller University, New York, NY 10065; bHoward Hughes Medical Institute, The Rockefeller University, New York, NY 10065; and cLaboratory of Mass Spectrometry and Gaseous Ion Chemistry, The Rockefeller University, New York, NY 10065 Contributed by Michael E. O’Donnell, November 19, 2018 (sent for review November 8, 2018; reviewed by Zvi Kelman and R. Stephen Lloyd) The 11-subunit eukaryotic replicative helicase CMG (Cdc45, Mcm2-7, of function using genetics, cell biology, and cell extracts have GINS) tightly binds Mcm10, an essential replication protein in all identified Mcm10 functions in replisome stability, fork progres- eukaryotes. Here we show that Mcm10 has a potent strand- sion, and DNA repair (21–25). Despite significant advances in the annealing activity both alone and in complex with CMG. CMG- understanding of Mcm10’s functions, mechanistic in vitro studies Mcm10 unwinds and then reanneals single strands soon after they of Mcm10 in replisome and repair reactions are lacking. have been unwound in vitro. Given the DNA damage and replisome The present study demonstrates that Mcm10 on its own rap- instability associated with loss of Mcm10 function, we examined the idly anneals cDNA strands even in the presence of the single- effect of Mcm10 on fork regression. Fork regression requires the strand (ss) DNA-binding protein RPA, a property previously unwinding and pairing of newly synthesized strands, performed by associated with the recombination protein Rad52 (26).