DNA Helicase) Is Required for Interleukins-13/-4-Induction of 15-Lipoxygenase-1 Gene Expression in Human Epithelial Cells

Home , Helicase, Kinase, Ku (protein), Protein kinase

Genes and Immunity (2000) 1, 237–250  2000 Macmillan Publishers Ltd All rights reserved 1466-4879/00 $15.00 www.nature.com/gene Ku autoantigen (DNA helicase) is required for interleukins-13/-4-induction of 15-Lipoxygenase-1 gene expression in human epithelial cells

UP Kelavkar, S Wang and KF Badr Center for Glomerulonephritis, Renal Division, Emory University and the Atlanta Veterans Affairs Medical Center, 1639 Pierce Drive, 3304 WMB, Atlanta, GA 30322, USA

As reported previously in human monocytes, a human lung epithelial cell line, A549, showed de novo induction of 15- Lipoxygenase-1 (15-LO-1) in response to interleukins-13 (IL-13) and −4 (IL-4). In this cell line, 15-LO-1 expression, by RT-

PCR and western blotting, was observed following 6 and 24 h of exposure to human IL-13 (ED50 5 ng/ml) and IL-4 (ED50 0.2 ng/ml). We have previously shown that no cis-acting regulatory elements exist within the 15-LO-1 promoter region. To define IL-13 and IL-4 responsive trans-acting elements, we identified a region (DP2: −353 to −304 bp site) within the 15- LO-1 promoter (by footprinting experiments) to which IL-13-responsive elements (or factors) bind specifically (Kelavkar et al, 1998, Mol Biol Rep 25, 173–182). To further delineate this region, we constructed (by site-directed mutagenesis) several deletion mutants in the ‘LOPB5’ region containing the 29 bp within the −353 to −304 bp of the DP2 core element. These were: DP3 (site totally deleted), DP4 (5 bp deleted at the center of the site), DP5 (8 bp at the 5Ј-end of the site) and DP6 (13 bp at the 3Ј-end of the site). Cotransfection of these deletion constructs (driving luciferase reporter genes) was associated with 90% (DP4, DP5 and DP6) or 100% (DP3) abrogation of promoter activity at 24 h. Purification of nuclear protein extracts from IL-13 and IL-4-stimulated A549 cells, using a DP2 core containing affinity column, identified a 150 kDa protein under non-denaturing conditions, and two, 70 and 85 kDa proteins under denaturing conditions. These were not detectable by Coomassie blue staining in control nuclear protein extracts. Matrix assisted laser desorption ionization mass spectrometry (MALDI-MS) of the tryptic digests of these proteins, identified one as the 86 kDA Lupus KU autoantigen protein P86 and the second as the 70 kDa Lupus KU autoantigen protein P70. Gel shift and supershift experiments using monoclonal antibodies toward Ku antigen and its individual subunits, and utilizing DP2 and other mutant oligonucleotides with purified nuclear protein extracts from control and cytokine-treated A549 cells, confirmed our findings. Furthermore, electroporation of neutralizing anti-Ku70, Ku 80 and Ku70/80 antibodies into A549 cells totally suppressed IL-13 and IL-4-stimulated 15-LO-1 induction in these cells. Further, immunoprecipitation experiments data suggests that IL-4 and IL-13 activate Ku antigens and 15-LO-1 expression through distinct signaling events. In summary, in A549 cells, Ku antigen is induced in response to the cytokines, IL-13 and −4, and a 29 bp region within the −353 to −304 bp region of the 15-LO-1 promoter is required for its binding and subsequent induction of 15-LO-1 gene expression. The findings may provide an important link between the established dysregulated function of Ku antigen in auto-immune diseases, such as systemic lupus erythematosus and thyroiditis, and the increasingly recognized ‘anti-inflammatory’ role of 15-LO-1. Genes and Immunity (2000) 1, 237–250.

Keywords: 15-Lipoxygenase-1; interleukin-13; interleukin-4; human epithelial cells

Introduction to the elucidation of the JAK-STAT (signal transducer and activator of transcription) signaling pathway, which Cytokines mediate their pleiotropic effects on cells by is now known to transduce signals for other cytokines as binding to specific transmembrane-spanning receptors, well.1–3 Interleukin (IL)-13 and −4 are cytokine products whose activation often results in the induction of new of TH2 cells which exert similar profiles of biological acti- ␥ genes. Characterization of the ability of IFN- and vation in a variety of cell types. Like IL-4, IL-13 is a regu- interleukin-4 (IL-4) to rapidly induce new genes has led lator of human B cell and monocyte functions.4 Recently Yu et al5 demonstrated that IL-13 induces distinct STAT6- DNA binding complexes and tyrosine phosphorylation Correspondence: UP Kelavkar, Center for Glomerulonephritis, Renal of STAT6 and Janus kinase 3 (JAK3) in NK and T cells. Division, Emory University and the Atlanta Veterans Affairs Medical Curiel et al6 have identified a Stat-6-responsive element Center, 1639 Pierce Drive, 3304 WMB, Atlanta, GA 30322, USA. (Stat-6RE) in the promoter of the human IL-4 gene, as Ȱ E-mail: kelavkar emory.edu well as two specific IL-4 responsive DNA-protein com- This work was supported in part by National Institutes of Health plexes in nuclear extracts of both human Th1 and Th2 (NIH) grant No. 2R01DK43883 (to K.F.B). We thank M. Ushio-Fukai for help in electroporation experiments. clones. Their results indicate a possible autocrine mech- Received 30 July 1999; revised 12 November 1999; accepted 19 Nov- anism for the regulation of IL-4 gene transcription ember 1999 through Stat-6RE, as well as a possible mechanism for IL- Ku autoantigen and 15-Lipoxygenase-1 induction UP Kelavkar et al 238 13 regulation of the human IL-4 promoter. Several studies phosphorylate several nuclear DNA-binding regulatory have reported that both IL-4 and IL-13 share common transcription factor proteins (eg, Sp1 and p53), which signaling events, such as those observed in human colon suggests that DNA-PKcs may play a role in regulating carcinoma cell lines HT-29 and WiDr.7,8 These studies transcription, replication, recombination as well as DNA demonstrate that a single cytokine can activate different repair.17,18 We have also shown by site-directed combinations of Stat proteins under different physiologi- mutagenesis (creating mutant DP2 plasmids), gel-shift, cal conditions, and also indicate mechanisms by which and transfection experiments, that the entire 29 bp region distinct cytokines can activate the same Stat protein. within the −353 to −304 bp (+1 is adenine in the ATG start IL-4 was the only cytokine known to induce 15-Lipoxy- codon) region of the 15-LO-1 promoter is required for the genase-1 (15-LO-1) in human monocytes/ macro- binding of Ku-autoantigen 70/80 and that this DNA phages.9,10 We demonstrated that IL-13 also induces 15- binding protein/factor is responsible for cytokine- LO-1 mRNA and protein synthesis in those cells leading induced upregulation of 15-LO-1 in A549 cells. to enhanced production of 15-(S)-HETE.11 These effects were inhibited by IFN-␥, as was seen in IL-4-induced 15- LO-1 expression.10 Similar results have been observed by Results Brinkmann et al.12 in a human epithelial cell line, A549 in which induction of 15-LO-1 by IL-13 and IL-4 was dem- Purification and identification of the 15-LO-1 onstrated. promoter core binding proteins in human A549 cells Arachidonate 15-Lipoxygenase-1 (arachidonate:oxygen We previously identified a protein/s binding region 15-oxidoreductase, EC 1.13.11.33) (15-LO-1) is implicated (DP2) of the 15-LO-1 promoter by footprinting and gel in oxidizing arachidonic acid and low-density lipopro- retardation studies in HeLa cells and human mono- tein, reactions of potential relevance to inflammation, cytes.16 In order to purify and identify these IL-13 and membrane remodeling and atherosclerosis.13 Recently, -4 responsive elements in human A549 cells, we prepared we have demonstrated regulation of 15-LO-1 gene proteins from whole-cell extracts of cells grown in control expression by the mutant form of p53 tumor suppressor and experimental conditions and examined the extracts protein.14 Formation of 15-(S)-hydroxyeicosatetraenoic for protein binding to the DP2 core element. The proteins acid (15-(S)-HETE) and lipoxin (LX) A4 in human leuko- were purified by affinity chromatography using biotin cytes, mediated by 15-LO-1 dependent catalysis of arachi- labeled double-stranded oligonucleotides immobilized donic acid, likely represents a component of endogenous on streptavidin-coated Dynabeads (DP2-DNA affinity anti-inflammatory influences that ultimately regulate the chromatography). extent and severity of inflammatory reaction.15 In order Briefly, proteins from whole-cell extracts of A549 to study the transcriptional control of 15-LO-1 expression, (control and experimentally grown) were prepared from we have previously cloned and sequenced the human 15- cells, added to an eppendorf tube containing biotin lab- LO-1 promoter region.16 We have also shown that there eled double-stranded oligonucleotides immobilized on are no STAT binding DNA sequences in this promoter, streptavidin-coated Dynabeads and then eluted as and that no cis-acting elements could account for the described in the scheme of Figure 1b. Proteins specifically upregulation of 15-LO-1 expression.13 recognizing the DP2 core sequence were finally purified We therefore sought to isolate the transcription from the crude proteins from whole-cell extracts. The factor/s that is/are induced in response to IL-13 and 4 individually purified proteins were then analyzed by gel respectively, and which lead to 15-LO-1 expression in electrophoresis, followed by either Coomassie blue stain- human cells. The usefulness of freshly obtained human ing and/or Western blotting. By SDS-gel electrophoresis monocytes for addressing mechanistic questions of 15- (denaturing), two bands due to 70 and 85 kDa proteins LO-1 expression at the molecular level is limited by the were detectable, but none at 150 kDa (Figure 1c, lanes 4 biological variability of these cells, and their relative and 5). Under native conditions without SDS, on the resistance to transfection. To circumvent this problem, we other hand, a single band was detected at approximately performed studies in the permanent human epithelial cell 150 kDa (data not shown). The results suggest that the 70 line A549 which expresses IL-13 and IL-4 receptors, as and 85 kDa proteins exist in dimeric forms in the absence described by Brinckmann et al.12 of denaturing reagents. The binding specificity of the In this paper, we report the isolation of a transcription purified proteins was then verified by competition factor for IL-13/IL-4 induction of 15-LO-1, namely Ku- experiments as described later in the section. To identify autoantigen 70/80. This is an abundant acidic nuclear these proteins, mass-spectrometry on the proteolytic protein first identified in sera from patients with poly- digest was carried out at the biotechnology resource lab- myositis-scleroderma overlap syndrome. It belongs to a oratory at Yale University, CT. The primary program family of proteins known to play a critical role in mam- used for identification carried out a PeptideSearch algor- malian DNA double-strand break repair and lymphoid ithm using European Molecular Biology (EMBL)/non- V(D)J recombination, which includes the autoantigens redundant database. The criteria used were: (1) matching Ku86 and Ku70 and the 465 kDa serine/threonine protein of peptide masses to Ͼ25% of the predicted protein kinase catalytic subunits (DNA-PKcs). The DNA-depen- sequence using a mass tolerance of ±0.2 amu for mono- dent protein kinase (DNA-PK) is a trimeric enzyme con- isotopic and ± 0.5 amu for observed masses; and (2) Pep- sisting of a 460 kDa catalytic subunit (DNA-PKcs) and a tideSearch probability of 1.0 e+00. These analyses of the heterodimeric regulatory complex called Ku (also defined results suggest strongly that the protein purified as DP2 as ATP-dependent-DNA helicase), which is comprised of core binding protein is Ku antigen. 70 (Ku70) and 86 (Ku80) kDa subunits. These proteins In further experiments, the purified DP2 core binding physically associate to form a complex (DNA-PK) with proteins were blotted onto a PVDF membrane and then DNA-dependent protein kinase activity. DNA-PKcs also reacted with a mixture of two different anti-Ku antigen

Genes and Immunity Ku autoantigen and 15-Lipoxygenase-1 induction UP Kelavkar et al 239

Figure 1 (a) Sequence of the human 15-LO-1 [GenBank accession No. U63384] 5Ј flanking region. Nucleotides are numbered from the translational start codon (+1). The location of DP2 region is indicated by open box, and the region of DP2 wherein mutations were created is indicated in bold. The names and sequences of the mutants are described in the Materials and methods section. (b) Purification scheme for isolation of DP2 binding proteins from A549 cells. (c) SDS-gel electrophoresis of total and purified extracts from A549 cells. Lane 1: Total proteins from whole cell extracts of control (no cytokine added) cells. Lane 2: Total proteins from whole cell extracts of IL-4 induced cells. Lane 3: Total proteins from whole cell extracts of IL-13 induced cells. Lane 4: DP2 bound proteins from step 4 (described in Figure 1(b) eluted from whole cell extracts of IL-4 induced cells. Lane 5: DP2 bound proteins from step 4 (described in Figure 1(b) eluted from whole cell extracts of IL-13 induced cells. Lane 6: DP2 bound proteins from step 4 (described in (b)) eluted from whole cell extracts of IL- 13 induced cells. Lane 6: DP2 bound proteins from step 4 (described in (b)) eluted from nuclear extracts of control cells. Lane 7: Supernatant (unbound to DP2) of proteins from step 4 (described in (b)) from whole cell extracts of control cells. Lane 8: Supernatant (unbound to DP2) of proteins from step 4 (described in (b)) whole cell extracts of IL-4 induced cells. Lane 9: Supernatant (unbound to DP2) of proteins from step 4 (described in (b)) from whole cell extracts of IL-13 induced cells. Arrows indicate specific bands.

Genes and Immunity Ku autoantigen and 15-Lipoxygenase-1 induction UP Kelavkar et al 240 antisera, Ku70 and Ku80 respectively. The DP2 core bind- cells grown in control and experimental conditions ing proteins showed bands at 70 and 85 kDa (data not yielded the following: DP3 completely lost its promoter shown). However, the immunoprecipitation also shows activity. With the other mutants, almost 90% promoter the presence of Ku70 and Ku80 in control grown cells, activity in experimental conditions was abrogated when suggesting that these proteins are constitutively compared to LOPB5 (Table 1). expressed in A549 cells, and is likely that Ku is present in both stimulated and unstimulated cells, but that stimu- Binding of DP2 and mutant derivatives to Ku lation of the cells with IL-4 or -13 alters the DNA binding Gel-shift experiments, using labeled ds DP2 oligonucleo- properties of Ku. This property allows the protein to bind tide (and other mutants described previously) with pur- to DNA, hence be purified by affinity chromatography ified protein extracts of control and experimentally thus levels undetectable by Coomassie blue staining. By grown A549 cells indicate that DP2-binding proteins are densitometric scanning of Western blots of immunopreci- induced only in response to IL-13 and IL-4 treatments pitated proteins by mixture of anti-Ku70, -Ku80 and - and bind, albeit weakly, to other mutants, except DP3 Ku70/80 antibody indicate a two to three-fold increased (Figure 3). Of note, during the initial purification pro- expression of these proteins. These results indicated that cedure (described above), nuclear extracts were pre- the purified DP2 core binding proteins of 70 and 85 kDa eluted over streptavidin beads conjugated with DP3 were expressed in response to cytokines and are (completely deleted DP2) to remove non-specific binding immunologically indistinguishable from the p70 and p80 proteins, and subsequently, the unbound proteins were subunits of Ku antigen. added to the streptavidin beads conjugated with DP2 In our earlier studies with 15-LO-1 promoter in HeLa (Figure 1a). Further, the proteins that bound to DP3 did cells and monocytes, inhibition of DP2-protein binding not contain Ku antigen as assessed by Western blotting was observed with excess amounts of competitor oligon- (data not shown). These observations clearly indicate that ucleotide sequences homologous to the probes, whereas the target proteins do not bind non-specifically to oligon- no inhibition was seen in the presence of the non-specific ucleotide ends, as proposed by others.16 To further con- oligonucleotide TGF␤.16 The proteins purified from A549 firm that the purified protein indeed directly bound to cells were thus good candidates for specific recognition the respective oligonucleotides, data of super-shift assay of the DP2 core of the 15-LO-1 promoter sequence. using monoclonal anti-Ku70 antibody is shown in this Gel-shift assays with purified nuclear extracts and 32P- paper (Data with anti-Ku80 and anti-Ku70/80 show labeled double-stranded (ds) DP2 probe as described in identical data and hence not shown). Protein binding to ‘Experimental procedures’, confirmed the binding of Ku. DP2 oligonucleotide was near-abolished by antibody Three bands along with non-specific protein-DNA com- addition, indicating that the DP2 core sequence was plexes (NS) were formed on the DP2 when the gel shift bound directly by the purified protein, ie Ku antigen. The experiments are conducted with IL-4 or -13 stimulated purified DP2 binding proteins that reacted with anti-Ku extracts that bind to the probe specifically, as charac- antibodies were subjected to the supershift assays with terized by a competition with an excess of cold probe. the labeled DP2 and its mutant derivative core oligonu- Non-specific binding was significantly competed in the cleotides (Figure 3a–d). These complexes of DP2 and its presence of an excess amount of non-labeled oligonucleo- mutant derivatives with the binding proteins were abol- tide with the same sequence as the probe (Figure 2a). ished by pretreatment with either anti-Ku antiserum. Two of the bands are super-shifted by anti-Ku antibodies, Also, pretreatment of these proteins with non-specific

the slowest migrating band completely, and to a lesser anti-hamster mouse IgG1 control antibody, affected extent the middle band. The fastest migrating band does neither complex formation nor gel migration. Our data not appear to be super-shifted by the antibody. This suggest that while Ku does bind to the 15-LO-1 promoter argues that there may be two DNA protein complexes in a sequence-specific manner, other proteins that are that contain Ku, while the slowest migrating and most regulated by IL-4 and -13 do as well. The analysis with plentiful complex contains a protein that co-purifies with gel shift conducted with the deletion mutants as probes the Ku proteins. Therefore, even though the complexes indicate clearly that DP3 does not bind to the same pro- that formed on the DNA in the presence and absence of teins. When DP4 is used as a probe the pattern is similar IL-4/13 appear to be of similar size and intensity, they to the pattern seen with the DP2 probe. However, when are distinct. DP5 and DP6 are used as probes, the control extract and Ku did not bind to ds DP3 (DP2 site totally deleted) the DP5 probe have the same pattern as the DP2 probe, (Figure 2b). These results indicated that protein which but when IL-4/13 extracts are used the NS complex is specifically recognized the DP2 core sequence exists in not formed. The NS complex re-appears when the anti- A549 cells, similar to one described by us previously.16 Ku antibodies are added and the S complex is super- shifted. This suggests that there is a competition between Site-directed mutagenesis and promoter analysis of the proteins for DNA binding. The pattern obtained with DP2 and its derivatives the DP6 probe is particularly interesting since the NS To delineate the identity and ascertain the specificity of complex does not form on this DNA sequence, arguing discreet sequences in LOPB5 containing the DP2 region that the sequences that are required for binding of this within the 15-LO-1 promoter, which are responsible for protein are deleted in this probe. Super-shifts were Ku binding, several deletion mutant plasmids, namely observed with all the ds oligonucleotitides. These obser- DP3 (site totally deleted), DP4 (5 bp deleted at the center vations could be explained by three possibilities: (1) of the site), DP5 (8 bp at the 5Ј-end of the site) and DP6 examining the studies with DP5 (mutated region (13 bp at the 3Ј-end of the site) were constructed by site- TACACACG) and DP6 (mutated region ACTCCTACCC) directed mutagenesis. Co-transfections of these mutant (Figure 3c–d), it appears that there are two sites essential constructs (driving luciferase reporter genes) into A549 for, but not limited to, Ku70/80 complex binding; (2)

Genes and Immunity Ku autoantigen and 15-Lipoxygenase-1 induction UP Kelavkar et al 241

Figure 2 Gel shift [Mobility shift DNA binding analysis (or EMSA)] of purified protein extracts from human A549 cells grown for 24 h under control and experimental conditions, showing specific DNA-protein interaction involving the 15-LO-1 promoter (DP2) and its derived mutant (DP3). Binding reaction were conducted using the individually radiolabeled DNA fragments (2 × 104 cpm, 40 fmol for each reaction. Whenever added, 3 pmol competitor (unlabeled fragment) was used. (a) (DP2): Lane 1: probe alone. Lane 2: probe plus nuclear extracts from control A549 cells (a). Lane 3: (a) plus competitor unlabeled fragment. Lane 4: (a) plus anti-Ku70 antibody. Lane 5: probe plus nuclear extracts of IL-4 induced A549 cells (b). Lane 6: (b) plus competitor unlabeled fragment. Lane 7: (b) plus anti-Ku70 antibody. Lane 8: probe plus nuclear extracts from IL-13 induced A549 cells (c). Lane 9: (c) plus competitor unlabeled fragment. Lane 10: (c) plus anti-Ku70 antibody. (b) (DP3): Lane 1: probe alone. Lane 2: probe plus nuclear extracts from control A549 cells (a). Lane 3: (a) plus competitor unlabeled fragment. Lane 4: (a) plus anti-Ku70 antibody. Lane 5: probe plus nuclear extracts of IL-4 induced A549 cells (b). Lane 6: (b) plus competitor unlabeled fragment. Lane 7: (b) plus anti-Ku70 antibody. Lane 8: probe plus nuclear extracts from IL-13 induced A549 cells (c). Lane 9: (c) plus competitor unlabeled fragment. Lane 10: (c) plus anti-Ku70 antibody. Arrows indicate supershift, specific (S), non-specific (NS) bands and free probe.

Ku70/80 complex may not be essential for DNA binding; and (3) Ku70 or Ku80 could individually bind to DNA Table 1 Analysis of activation or inhibition of mutant 15-LO-1 pro- independent of each other. However, our data with DP2 moter constructs in A549 cells and its mutant plasmid transfections (Table 1) and with the anti-Ku antibody electroporation studies described Plasmid Renilla/Luciferase activity Fold relative to pGL2 basic activity (%) activation or below, strongly suggest that Ku70/80 complex binding inhibition to the DP2 (15-LO-1 promoter region) is essential for 15- Uninduced Induced (experimental) LO-1 transcription, although the precise characterization (control) or roles of individual Ku’s in gene transcription is still IL-13 IL-4 IL-13 IL-4 unexplored and remains to be studied. These results further confirm that: (1) the protein responsible for DP2 LOPB5 30 ± 8.0 246 ± 12.0 212 ± 11.0 8.2 7.0 core binding is sequence specific; and (2) it is, or contains, (containing DP2) Ku antigen. Mutant 1 (DP3) 2 ± 0.7 1 ± 0.2 1 ± 0.3 0 0 Taken together these observations suggest that the Mutant 2 (DP4) 11 ± 2.0 23 ± 4.0 19 ± 3.0 2.0 1.7 entire 29-bp region within the −353 to −304 bp region of Mutant 3 (DP5) 12 ± 1.7 20 ± 1.6 17 ± 2.0 1.6 1.4 ± ± ± the 15-LO-1 promoter within DP2 is required specifically Mutant 4 (DP6) 14 2.0 22 1.0 18 1.0 1.6 1.3 for Ku binding.

Human 15-LO-1 promoter (DP2) and (mutant promoters) activities in A549 cells. A549 cells were transfected with the promoter con- Radiolabeling and immunoprecipitation of Ku struct LOPB-5 (containing DP2) and its derived mutants (DP3-DP6) antigens [1.0 ␮g] along with Renilla expression plasmid DNA (0.1 ␮g) by To examine potential differences in the cellular actions of FuGENE 6 Transfection reagent. The cells were grown in appro- both cytokines, to determine the turn-over and stability priate medium containing 10% FBS for 24 h before being harvested of Ku and the possibility of any other protein binding to for determination of luciferase activity. Each experiment was 35 repeated twice with triplicate samples. The values are expressed as Ku, cells were radiolabeled with [ S]methionine in the percent relative activities of Renilla/Luciferase (%). The values presence and absence of cyclohexamide. Individual shown are the averages ± s.e. of the relative promoter activities nuclear protein extracts from control and cytokine- (n = 6). treated A549 cells were immunoprecipitated with monoclonal antibodies against Ku70, Ku80 and Ku70/80 respectively (Figures 4a–b, 5a–b and 6a–b) and protein

Genes and Immunity Ku autoantigen and 15-Lipoxygenase-1 induction UP Kelavkar et al 242

Figure 3 Effect of antibodies on gelshift complexes (supershift) formed with A549 cell purified protein extracts and the DP2 binding site DNA fragment compared to mutant oligonucleotides. Gel shifts were similarly performed as described for Figure 2. For supershift experiments, individual mABs (1 ␮l of ammonium sulfate precipitated ascitic fluid 200 ␮g/ml) were added to the binding mixture 5 min after adding probe and incubated for an additional 30 min at 22°C before electrophoresis). Where added, anti-hamster mouse IgG1 (control) antibody was used. (a) (DP3): Lane 1: probe alone. Lane 2: probe plus nuclear extracts from control A549 cells (a). Lane 3: (a) plus non- specific anti-hamster mouse IgG1 (control) antibody. Lane 4: (a) plus anti-Ku70 antibody. Lane 5: probe plus nuclear extracts of IL-4 induced A549 cells (b). Lane 6: (b) plus non-specific anti-hamster mouse IgG1 (control) antibody. Lane 7: (b) plus anti-Ku70 antibody. Lane 8: probe plus nuclear extracts from IL-13 induced A549 cells (c). Lane 9: (c) plus non-specific anti-hamster mouse IgG1 (control) antibody. Lane 10: (c) plus anti-Ku70 antibody. (b) (DP4): Lane 1: probe plus nuclear extracts from control A549 cells (a). Lane 2: (a) plus non-specific anti- hamster mouse IgG1 (control) antibody. Lane 3: (a) plus anti-Ku70 antibody. Lane 4: probe plus nuclear extracts of IL-4 induced A549 cells (b). Lane 5: (b) plus non-specific anti-hamster mouse IgG1 (control) antibody. Lane 6: (b) plus anti-Ku70 antibody. Lane 7: probe plus nuclear extracts from IL-13 induced A549 cells (c). Lane 8: (c) plus non-specific anti-hamster mouse IgG1 (control) antibody. Lane 9: (c) plus anti-Ku70 antibody. (c) (DP5): Lane 1: probe plus nuclear extracts from control A549 cells (a). Lane 2: (a) plus non-specific anti-hamster mouse IgG1 (control) antibody. Lane 3: (a) plus anti-Ku70 antibody. Lane 4: probe plus nuclear extracts of IL-4 induced A549 cells (b). Lane 5: (b) plus non-specific anti-hamster mouse IgG1 (control) antibody. Lane 6: (b) plus anti-Ku70 antibody. Lane 7: probe plus nuclear extracts from IL-13 induced A549 cells (c). Lane 8: (c) plus non-specific anti-hamster mouse IgG1 (control) antibody. Lane 9: (c) plus anti- Ku70 antibody. (d) (DP6): Lane 1: probe plus nuclear extracts from control A549 cells (a). Lane 2: (a) plus non-specific anti-hamster mouse IgG1 (control) antibody. Lane 3: (a) plus anti-Ku70 antibody. Lane 4: probe plus nuclear extracts of IL-4 induced A549 cells (b). Lane 5: (b) plus non-specific anti-hamster mouse IgG1 (control) antibody. Lane 6: (b) plus anti-Ku70 antibody. Lane 7: probe plus nuclear extracts from IL-13 induced A549 cells (c). Lane 8: (c) plus non-specific anti-hamster mouse IgG1 (control) antibody. Lane 9: (c) plus anti-Ku70 antibody.

analyzed by SDS-electrophoresis. As seen in Figures 4b, Cytosolic anti-Ku antibody abolish cytokine-induced 5b and 6b, lanes 4–6 (cyclohexamide-treated), compared 15-LO-1 expression to Figures 4b, 5b and 6b, lanes 1–3 (cyclohexamide- The time course of 15-LO-1 gene by reverse transcriptase- untreated), there seems to be a rapid turnover of Ku anti- polymerase chain reaction (RT-PCR) and protein gen, because the levels of these proteins as analyzed by (Western-blotting) expression in A549 cell line, observed SDS-electrophoresis seem to be steady (Figures 4a, 5a and at 4 and 24 h respectively, following exposure to human 6a). In a different set of experiments, we analyzed by IL-13 and IL-4 suggested that Ku might be involved in densitometric scanning the Western blots of immunopre- 15-LO-1 transcriptional regulation during the initial cipitated proteins by mixture of anti-Ku70, -Ku80 and phases of cytokine induction. To explore this further, -Ku70/80 antibody. The values indicate a two to three- monoclonal antibodies (anti-Ku70, anti-Ku80 or anti- fold increased expression of these proteins in stimulated, Ku70/80) speciﬁc to each of the subunits of Ku were elec- compared to unstimulated, cells (data not shown). Also troporated in A549 cells prior to treatment with IL-13

there were two slow migrating proteins that co- (ED50 5 ng/ml) and IL-4 (ED50 0.2 ng/ml) and grown immunoprecipitated with the anti-Ku70 and -Ku70/80 further for 4 h to check for 15-LO-1 mRNA. In control (Figures 4a and 6a), while only a single protein in the experiments, cells were electroporated with anti-hamster lower levels were detectable by anti-Ku80 (Figure 5a). We mouse IgG1 (mockelectroporation). Under electropor- have not identiﬁed and characterized these proteins so ation conditions described previously,19 approximately far. 70% of electroporated cells survive and, of these, greater

Genes and Immunity Ku autoantigen and 15-Lipoxygenase-1 induction UP Kelavkar et al 243

Figure 4 SDS-gel electrophoresis of [35S]methionine and [35S]cystine labeled proteins isolated from A549 cells (C-Control, IL-4 treated and IL-13 treated) with and without cyclohexamide and immunoprecipitated by monoclonal anti-Ku70 antibody (Panel a). Panel (b) is the autoradiography of the gel stained with Coomassie blue from panel (a). Arrows indicate speciﬁc bands.

Figure 5 SDS-gel electrophoresis of [35S]methionine and [35S]cystine labeled proteins isolated from A549 cells (C-Control, IL-4 treated and IL-13 treated) with and without cycloheximide and immunoprecipitated by monoclonal anti-Ku80 antibody (Panel a). Panel (b) is the autoradiography of the gel stained with Coomassie blue from panel (a). Arrows indicate speciﬁc bands.

Genes and Immunity Ku autoantigen and 15-Lipoxygenase-1 induction UP Kelavkar et al 244

Figure 6 SDS-gel electrophoresis of [35S]methionine and [35S]cystine labeled proteins isolated from A549 cells (C-Control, IL-4 treated and IL-13 treated) with and without cycloheximide and immunoprecipitated by monoclonal anti-Ku70/80 antibody (Panel a). Panel (b) is the autoradiography of the gel stained with Coomassie blue from panel (a). Arrows indicate speciﬁc bands.

than 95% contain electroporated antibody. As shown by core element identified two proteins of 70 and 85 kDa semiquantitative-RT-PCR in Figure 7, electroporation of (Figure 1c). The profiles of the purified proteins on poly- either anti-Ku70, -Ku80 or -Ku70/80 antibodies com- acrylamide gels under denaturing and non-denaturing pletely abrogated IL-13- and IL-4-stimulated induction of conditions, suggested that the 70 and 85 kDa proteins are 15-LO-1 mRNA expression in A549. heterodimers. In addition to heterodimer formation, the 70 and 85 kDa proteins we identified were immuno- Discussion logically indistinguishable from Ku antigen, and the interaction of the proteins with the DP2 core sequence Arachidonate 15-LO-1 is implicated in oxidizing arachi- was specific by super-shift assays with the addition of donic acid, membrane lipids and low-density lipoprotein, anti-Ku antibodies (Figure 3). reactions of potential relevance to inflammation, mem- Our data showed no difference in the proteolytic digest brane remodeling and atherosclerosis.13 Recently, we patterns of the DP2 core binding protein and standard have demonstrated regulation of 15-LO-1 gene expression Ku antigen (data obtained from biotechnology resource by the mutant form of p53 tumor suppressor protein.14 laboratory at Yale University, CT and not shown). IL-13, a cytokine similar to IL-4, is a regulator of human Ku autoantigen is present in cell nuclei and cytoplasm B cell and monocyte functions, and stimulates formation and is known to have DNA binding activity. Our data of 15-(S)-hydroxyeicosatetraenoic acid (15-(S)-HETE) and with A549 cells also suggests that 15-LO-1 expression lipoxin (LX) A4 in human monocytes via specific de novo may also be regulated, at least in part, through changes induction of gene expression.11 The IL-13 and -4 depen- in the nuclear expression of Ku. Recently, the roles and dent 15-LO-1 expression likely represents a component of functions of Ku protein and its DNA-dependent protein endogenous anti-inflammatory influences that ultimately kinase catalytic subunit (helicase) with nucleic acids have regulate the extent and severity of inflammatory reac- been reviewed.18 Here, we provide evidence that Ku tions.15 In order to study the transcriptional control of 15- binds to the DP2 core region of the 15-LO-1 promoter and LO-1 expression by IL-13 and -4, we previously cloned is induced in response to IL-13 and IL-4. The cDNAs for and sequenced the human 15-LO-1 promoter region.16 subunits, Ku-p70 and Ku-p80, have been cloned20,21 and Brinkmann et al12 demonstrated induction of 15-LO-1 by shown to be similar to Human DNA helicase II.22 Ku has IL-13 and IL-4 in human epithelial cells A549. been shown to phosphorylate several proteins that regu- In the present study, we describe the purification and late transcription.23,24 functional analyses of the 15-LO-1 promoter DNA bind- Our findings by purification experiments (Figure 1b), ing proteins present in human A549 cells exposed to IL- gel-shift analysis (Figures 2 and 3), plasmid transfections 13 and -4. A DNA affinity column containing the DP2 (Table 1), and electroporation data (Figure 7) are some-

Genes and Immunity Ku autoantigen and 15-Lipoxygenase-1 induction UP Kelavkar et al 245

Figure 7 Effect of anti-Ku70, anti-Ku80 and anti-Ku70/80 antibody electroporation on IL-13- and IL-4-stimulated induction of 15LO mRNA expression in A549 cells. A549 cells were electroporated with anti-Ku70, anti-Ku80 and anti-Ku70/80, or anti-hamster mouse IgG1 (control) antibodies prior to treatment with IL-13 (ED50 5 ng/ml) and IL-4 (ED50 0.2 ng/ml) for the times indicated in Experimental Procedures. Amplified DNA by semiquantitative-RT-CR from individual RNA samples is shown. Lane 1: 100 bp Molecular weight marker (Gibco-BRL). Lane 2: Control. Lane 3: IL-4 treated cells. Lane 4: IL-13 treated cells. Lane 5: Control cells electroporated with anti-hamster mouse IgG1 (control) antibody. Lane 6: Cells electroporated with anti-hamster mouse IgG1 (control) antibody and then treated with IL-4. Lane 7: Cells electroporated with anti-hamster mouse IgG1 (control) antibody and then treated with IL-13. Lane 8: Control cells electroporated with anti- Ku70 antibody. Lane 9: Cells electroporated with anti-Ku70 antibody and then treated with IL-13. Lane 11: Control cells electroporated with anti-Ku80 antibody. Lane 12: Cells electroporated with anti-Ku80 antibody and then treated with IL-4. Lane 13: Cells electroporated with anti-Ku80 antibody and then treated with IL-13. Lane 14: Control cells electroporated with anti-Ku70/80 antibody. Lane 15: Cells electroporated with anti-Ku70/80 antibody and then treated with IL-4. Lane 16: Cells electroporated with anti-Ku70/80 antibody and then treated with IL-13. Lane 17: 15-LO-1 standard. Lane 18: GAPDH standard. Arrows indicate specific bands. what at variance with those previously described by Ono lagen IV, heat-shock protein 70, and HTLV-1 genes, et al,25 on the binding properties of Ku. These authors respectively, in a sequence-specific manner and regulate have shown by electrophoretic mobility shift assay that the gene transcription (reviewed in Reeves et al).17 Little recombinant Ku binds only to linear double-stranded similarity, however, seems to exist among the various DNA, but not to supercoiled, nicked circular, or linear Ku-binding DNA sequences reported so far, including single-stranded DNA, and that neither subunit binds the DP2 core element we identified here. One possible DNA by itself, suggesting that heterodimerization is explanation for the lack of binding specificity is that dif- essential for function.25 It is also apparent that none of ferent sequences may be recognized by Ku antigen in the deletions mutants obliterated Ku binding completely. complexes with different proteins.17 Our results with However, the results suggest an interaction between Ku affinity column purification and Coomassie blue staining and an unidentified protein/s, and that the regulation of of isolated proteins showed that the fraction purified here 15-LO-1 promoter by IL-4 and IL-13 is complex and may as DP2 core binding protein contained no other detect- not be solely by Ku proteins. While our studies argue that able proteins. However, the association of other factors Ku interacts with the DNA in a sequence-specific man- with Ku antigen or the presence of an as yet unidentified ner, we have not demonstrated (by UV-crosslinking) that protein that may be homologous to Ku certainly cannot Ku directly binds to the DNA. be ruled out. Recently, however, Wang et al26 have shown that two Further, by immunoprecipitation experiments data domains of p70 mediate DNA binding, one on the C- (Figures 4–6), it is tempting to speculate that distinct terminal and one on the N-terminal portion. The latter cytokines such as IL-4 and IL-13 can activate Ku antigens dimerizes with p80 in order to bind DNA, whereas the and thus 15-LO-1 expression by different signaling former is p80-independent. Interestingly, both the p80- events. (1) IL-4 induced Ku70 and Ku 80 exclusively in dependent and the p80-independent DNA binding sites the monomeric form (two separate proteins, 70 and preferentially bound to DNA ends, suggesting a model 80 kDa each). (2) IL-13 induced Ku 70 and Ku 80 as separ- in which a single Ku heterodimer may juxtapose two ate monomers, but also allowed expression of the dimeric broken DNA ends physically, facilitating their rejoining form (Ku70/80, molecular weight Ϸ150 kDa). (3) Both by DNA ligases. Further, functions of Ku antigen have monomeric and dimeric forms of Ku 70/80 bound to the also been suggested in transcription, DNA replication, 29 bp region from −353 to −304 nt of the 15-LO-1 pro- recombination, and repair, especially excision-repair.18 moter, resulting in transcription initiation. These findings Various transcription factors, including PSE, TREF, are the first demonstration of an intracellular divergence CTCBF, and CHBF, are considered to be identical or point for biological actions of IL-4 and IL-13 in a human related to Ku antigen. These factors recognize the pro- epithelial cell line. Also, there were two slow migrating moters of small nuclear RNA, transferrin receptor, col- proteins that co-immunoprecipitated with the anti-Ku70

Genes and Immunity Ku autoantigen and 15-Lipoxygenase-1 induction UP Kelavkar et al 246 and -Ku70/80, while only a single protein in lower levels and thyroiditis, and the increasingly recognized ‘anti- detectable by anti-Ku80. We have not identified and inflammatory’ role of 15-LO-1. characterized these proteins so far. Again, the possibility of association of other factors with Ku antigen cannot be ruled out. Experimental procedures However, the data suggest that IL-4 and IL-13 have specific roles in the induction of Ku proteins, and that Materials these interleukins possibly regulate protein–protein bind- Tween 20, acrylamide, sodium dodecylsulphate (SDS), ing of Ku subunits and, hence, their DNA-binding non-fat dry milk, low molecular weight protein markers, properties—possibly accounting for their unequal rabbit anti-sheep and donkey anti-rabbit IgG-horseradish potency in the upregulation of 15-LO-1 gene expression. peroxidase (HRP)-conjugate were purchased from Bio- The biological significance of Ku expression has also Rad. Murine monoclonal antibodies (mABs) specific for been studied in aging and in cancer. Salminen et al,27 have the human Ku antigen and control antibodies were pur- shown in WI-38 fibroblasts that replicative senescence chased from either Oncogene Research Products (MA, and, to some extent, cellular quiescence, down-regulate USA) or Lab Vision Corp (CA, USA). Recombinant − the recognition system of DNA damage involving Ku human IL-13 and 4 were purchased from Upstate autoantigens and DNA-PKcs. This could enhance the Biotechnology (Lake Placid, NY, USA). The enhanced accumulation of DNA damage during aging. A role for chemiluminescence (ECL) Western blotting detection sys- Ku80 in autocrine and paracrine IL-6-mediated multiple tem and polyvinylidene difluoride (PVDF) membranes ␮ myeloma cell growth and survival has been demon- (0.45 m) were purchased from Millipore (Bedford, MA, strated by Teoh et al.28 Their data suggest that CD40 USA). The pGL2 and pRL-SV40 vector, reporter lysis ligand treatment of multiple myeloma cells with buffer and dual-luciferase reporter assay kit were pur- TM 5E2 mAbs induces a shift of Ku from the cytoplasm to chased from Promega (Madison, WI, USA). FuGENE 6 the cell surface. Thus, Ku may function as an adhesion Transfection reagent, bovine serum albumin and phenyl- molecule that mediates homotypic adhesion of tumor methanesulfonyl fluoride was from Boehringer cells, as well as heterotypic adhesion of tumor cells to Mannheim (Mannheim, Germany). Penicillin, strepto- bone marrow stromal cells and to human fibronectin. mycin, F-12 nutrient mixture (HAM) medium, and tryp- Of relevance to our studies reported here, Serve et al29 sin: EDTA were purchased from Life Technologies, Inc. have demonstrated antiproliferative effects for IL-4 and (Gaithersburg, MD, USA). TRI reagent was from Molecu- IL-13 on breast cancer cell lines which express IL-13 bind- lar Research Center (Cincinnati, OH, USA). RT-PCR kit TM ing sites, while Maini et al,30 show that, IL-13 increased was from Perkin–Elmer (CA, USA). QuickChange Site- proliferation of all prostate cancer cell lines they studied. Directed Mutagenesis kit were from Stratagene ␥ 32 Similarly, immunoafinity-purified Ku protein used to (Menasha, WI, USA). [ - P] ATP (3000 Ci/mmole) was screen (by quantitative immunoblot assay) sera from from NEN Life Science Products Inc (Wilmington, DE, patients with systemic lupus erythematosus (SLE), sclero- USA). Common buffer salts and chemicals were obtained derma, myositis and Sjo¨gren’s syndrome for anti-Ku anti- from Fisher (Pittsburgh, PA, USA). Fetal calf serum, apro- bodies indicated a strong correlation between anti-Ku tinin and iodoacetamide was from Sigma (St Louis, MO, antibodies and the class II HLA antigen DQw1, suggest- USA). A/G-Agarose beads were from Pierce (Rockford, ing participation of major histocompatibility complex IL, USA). (MHC) genes in the mounting of the anti-Ku immune response.31 It has also been shown previously that at least Cell culture seven additional auto-epitopes (immunodominant A549 lung carcinoma cells (alveolar type II epithelial epitopes) are present on the Ku particle, located on p70, cells) were obtained from ATCC and cultured in F-12 p80, or both subunits, and that autoantibodies to p70, nutrient mixture (HAM) medium (Gibco-BRL, Rockville, p80, and DNA are produced tandemly by patients with MD, USA), containing 10% fetal bovine serum (FBS), SLE. It was thus suggested that the multiple specificities 100 U of penicillin per ml, 100 ␮g of streptomycin per ml, ␮ ° of anti-Ku autoantibodies and the tandem production of and 25 g of fungizone per ml in 5% CO2 at 37 C. When antibodies to the various constituents of the Ku particle the cells were 70–80% confluent, cytokines namely are consistent with a role of either ‘molecular mimicry’ interleukin-13 (IL-13) and interleukin-4 (IL-4) at concen- or ‘intermolecular help’ in the generation of auto- trations of ED50 5 ng/ml and ED50 0.2 ng/ml were added immunity to this antigen.32 Thus, it is possible that dysre- respectively. Controls were not treated with either cyto- gulation of Ku function in SLE patients will render Ku kine. unable to upregulate 15-LO-1, a molecule having an ‘anti- inflammatory’ role. It is intriguing to speculate that dys- Plasmids and site directed mutagenesis regulation of this system may thus result in favoring To create mutations by site-directed mutagenesis in the ‘pro-inflammatory’ stimuli which, in turn, mediate the DP2 sequence (Figure 1a), we used QuickChange Site- classical expression of SLE and other auto-immune dis- Directed Mutagenesis kit (Stratagene). Plasmid used is orders. similar to that described previously by Kelavkar et al.16 In conclusion, the results of the present study demon- A 605 bp 15-LO-1 promoter fragment, containing the DP2 strate that in human epithelial A549 cells, Ku appears to binding site is cloned into a pGL-2 basic vector (Promega) play a permissive role (‘putative’) in cytokine induction and named LOPB-5. Briefly complementary oligonucleot- of 15-LO-1, likely by acting as a transcription factor. The ides containing the desired mutation (indicated by lower findings may provide an important link between the case letters), flanked by unmodified nucleotide sequence established dysregulated function of Ku antigen in auto- were synthesized and reverse-HPLC purified. In a total immune diseases, such as systemic lupus erythematosus of 50 ␮l reaction system following components were

Genes and Immunity Ku autoantigen and 15-Lipoxygenase-1 induction UP Kelavkar et al 247 added: 5 ␮l of 10X reaction buffer, 20 ng of dsDNA tem- Transient transfections and dual luciferase assays plate, 125 ng of each of the oligonucleotide primers, 1 ␮l Transient transfections were carried out using luciferase ␮ of dNTP mix and ddH2O to a final volume of 50 l. reporter construct (promoter fragment cloned into pGL2- One ␮lofPfu DNA polymerase (2.5 U/␮l) was then basic (Promega). Cells were plated at 40% confluency in added, overlaid with 30 ␮l of mineral oil and cycling was 12-well plates. After 24 h, the plasmid DNA (1 ␮g) performed in a thermal cycler (9600 ABI) as follows: 1 [LOPB5: containing DP2 binding site (Figure 1) and, cycle/95°C/30 s followed by 18 cycles at 95°C/30 s, mutants: DP3 through DP6], were individually co-trans- 55°C/1 min, 68°C/13 min. Following this reaction, tubes fected with co-reporter pRL-SV40 vector promoter were placed on ice for 2 min and then 1 ␮lofDpnI restric- upstream of Rluc (Promega) into A549 cells by FuGENE tion enzyme (10 U/␮l) added. After gentle mixing, these 6 Transfection reagent (Boehringer Mannheim). The pRL- reaction tubes were incubated further at 37°C for 1 h. Fol- SV40 vector is used to monitor transfection efficiency. lowing this incubation, 1 ␮l of reaction mixture from The cells were grown for 24 h before being harvested for individual tubes was used to transform the Epicurian assays. For assays, the cells were trypsinized, washed Coli XL1-Blue supercompetant cells. The cells were thrice with phosphate buffered saline (PBS). The cell plated on Luria agar plates containing 50 ␮g/ml ampicil- extracts were prepared with 400 ␮l reporter lysis buffer lin. Ten individual clones were picked from plates and (Promega), clarified by centrifugation at 20 000 g at 4°C sequenced to insure correct sequence of the desired for 2 min, and the supernatant transferred to a new tube. insert. Following are names and sequences of the oligo- The clarified supernatants were individually analyzed for nucleotides used to make the desired mutants: dual-luciferase reporter assays (100 ␮l) using a lumino- DP2 (Sense) meter with autoinjector (Turner design), as described by the manufacturer (Promega). Experiments were perfor- 5Ј-CCAAAGTCCGTGGTACACACGTGCATAACTCC med in duplicate or triplicate. TACCCCCACCTCGCCT GCCTGCTGTACCAG-3Ј Monoclonal antibodies DP22 (Complementary) The isotypes and specificities of murine monoclonal anti- 5Ј-CTGGTACAGCAGGCAGGCGAGGTGGGGGTAG bodies (mABs) specific for the human Ku antigen and GAGTTATGCACGTGTAC control antibodies are as follows: 162, IgG2a specific for CACGGACTTTGG-3Ј p70/p80 dimer (unreactive with free p70 or p80); 111, DP3a (totally deleted-Mutant # 1) (Sense) IgG1 specific for human p80 (amino acids 610–705); 5Ј-CCAAAGTCCGTGGTACACtgaattccgtggcctgaatgtacc N3H10, IgG2b specific for human p70 (amino acids 506– ttcctTGCCTGCTGTACCA 541); 265-F4, Control antibody-IgG1 specific for Hamster G-3Ј p170/p-Glycoprotein/MDR (does not react with human). DP33a (Complementary) Extraction of proteins, protein assay, gel mobility 5Ј-CTGGTACAGCAGGCAaggaaggtacattcaggccacggaatt shift and supershift assays and magnetic bead caGTGTACCACGGACTTTT purification of DNA binding factors GG-3Ј Proteins from whole-cell extracts of A549 cells grown for DP4a (Mutant # 2) (Sense) 24 h (control and experimentally grown) were prepared 5Ј-CCAAAGTCCGTGGTACACgcgctgccTAACTCCTA according to the method described by Dignam et al.34 Pro- CCCCCACCTCGCCTGCC TGCTGTACCAG-3Ј tein concentrations in whole-cell extracts were determ- DP44a (Complementary) ined by protein assay kit (Bio-Rad). Gel shift assay was 5Ј-CTGGTACAGCAGGCAGGCGAGGTGGGGGTAG performed as described by Austin et al,35 using DP2 con- GAGTTAggcagcgcGTACC ACGGACTTTGG-3Ј taining oligonucleotide (control) and mutant oligonucleo- DP5a (Mutant # 3) (Sense) tides that are described previously in this section. Briefly, 5Ј-GGCTTGGCCCAAAGTCCGTGGggcagcgcTGCATA 1 mg of annealed oligonucleotides were end-labeled with ACTCCTACCCCCACCT ␥ 32 Ј [ - P] ATP and T4 polynucleotide kinase, purified by gel CGCCTGCCTGC-3 filtration on Sephadex G25, separated on a 10% polyacryl- DP55a (Complementary) amide gel, and then eluted from the gel. Binding reac- 5Ј-GCAGGCAGGCGAGGTGGGGGTAGGAGTTAT Ј tions were conducted using the respective radiolabeled GCAgcgctgccCCACGGACTT TGGGCCAAGCC-3 × 4 # DNA fragments (2 10 cpm, 40 fmol for each reaction) DP6a (Mutant 4) (Sense) in 20 ␮l of binding buffer (20 mm Hepes, pH 7.9, 1 mm 5Ј-CCAAAGTCCGTGGTACACACGTGCATAttcggtcac Ј DTT, 5 mm EDTA, 10% glycerol and 150 mm NaCl) at tgccCACCTCGCCTGCCT GCTGTACCAG-3 22°C for 30 min. For supershift experiments, mABs (1 ␮l DP66a (Complementary) Ј of ammonium sulfate precipitated ascitic fluid 5 -CTGGTACAGCAGGCAGGCGAGGTGggcagtgaccg 200 ␮g/ml) were added to the binding mixture 5 min Ј aaTATGCACGTGTACCAC GGACTTTGG-3 after adding probe and incubated for an additional 30 min at 22°C before electrophoresis. Whenever added, Before selection of the targeted regions, the sequences 3 pmol competitor (unlabeled fragment) was used. Non- were screened for uniqueness in all non-redundant specific oligonucleotide (control): TGF␤-1, ATCCGT GenBank CDS translations + Protein Data Bank CTGCAGCGTCTTGCCCAATGTTCTGACGTATT was (PDB) + SwissProt + Protein Identification Resource used in competition experiments described earlier16 and Database (PIR) using Blast and Transfac version 3.5 for hence not included in the gel-shift experiments described identifying potential transcription factor binding sites. in this paper. The reactions products were run on a 13% They were also were tested for lack of internal secondary nondenaturing polyacrylamide gel in 0.5X TBE buffer at structure or pairing using Mulfold.33 100 V for 4 h. The gel was dried on a gel dryer and then

Genes and Immunity Ku autoantigen and 15-Lipoxygenase-1 induction UP Kelavkar et al 248 exposed to X-ray film overnight at −70°C with an inten- including this inhibitor in the medium at concentrations sifying screen. of 150 ␮g/ml, for a 30-min incubation before the addition The transcription factor binding to the DP2 core of the radioisotope; the inhibitors were kept in the element was purified by affinity chromatography medium during a 6 h pulse but omitted during 10 h described previously by Kroeger and Abraham,36 with chase. slight modifications, using biotin labeled double- At the end of the incubations, the plates were washed stranded oligonucleotides immobilized on streptavidin- with ice-cold PBS (0.05 m sodium phosphate buffer, coated Dynabeads (Dynal, USA). The scheme is described pH 7.4, containing 0.15 m NaCl), containing unlabeled in Figure 1b. Briefly, prior to loading, Dynabeads were substrate (2 mm methionine). The cells were then har- washed twice in 1X coupling buffer [CB] (1X CB; 2 m vested by centrifugation after scraping into cold PBS con- NaCl, 10 mm Tris, pH 8.0, 1 mm EDTA) and then incu- taining 1 mm phenylmethylsulfonyl fluoride and aproti- bated with DNA at 100 pmol oligonucleotide/mg beads, nin (10 units/ml). Subsequently, the cells were submitted at room temperature for 30 min. Beads were then concen- to lysis at 4°C with a lysis buffer consisting of 50 mm trated using magnetic particle concentrator (MPC, Dynal) Tris/HCl, pH 7.6, 300 mm NaCl, 0.5% (v/v) Triton X-100, for 1–2 min. Protein was isolated from Ϸ100 mg crude 5mm EDTA, 10 ␮g/ml leupeptin, 10 units/ml aprotinin, extracts from individually-treated cells grown in a total 10 mm iodoacetamide, and 2 mm phenylmethylsulfonyl of 50 flasks respectively. Crude whole-cell extracts fluoride followed by centrifugation at 14 000 rpm in an (Ϸ2 mg), in 500 ␮l binding buffer was used for every Eppendorf microcentrifuge for 15 min. After the addition cycle and a total of 25 cycles were performed as described of 300 ␮l of the lysis buffer, the fractions from radio- in Figure 1b to obtain saturated binding of protein to labeled cells were analyzed by immunoprecipitation DNA. Incubations were carried out in the absence of non- followed by polyacrylamide gel electrophoresis (PAGE.). specific competitor DNA [poly(dI-dC)]. Following binding, unbound proteins were removed by concentrating Immunoprecipitation the beads and washing once for 5 min on ice with 500 ␮l Antibody-coated beads were prepared by gently shaking binding buffer. A second wash with binding buffer con- for 2 h at room temperature 30 ␮l of a 1:1 suspension of taining 5 ␮g of poly(dI-dC) and then a third wash with PBS-washed hybrid protein A/G-Agarose beads (Pierce) binding buffer alone were performed to remove proteins with 2 ␮g of monoclonal antibodies, followed by washing that had bound non-specifically. Immunoprecipitation with PBS and PBS-containing 0.1% (w/v) bovine serum and Western blotting of the flow-through fractions with albumin. Aliquots of cell lysates, precleared by centrifug- Ku antibody mixture was performed to ensure saturated ation at 14 000 g for 15 min in an Eppendorf microcentri- binding of the protein (data not shown). Specific DNA fuge, were then added to the coated beads and shaken binding proteins were then eluted from the beads by for 2 h at room temperature in a total volume of 400 ␮l incubating in 20 ␮l binding buffer containing 1 m KCl for of lysis buffer containing a mixture of protease inhibitors. 60 min on ice. These binding proteins were then concen- After pelleting by centrifugation (800 g for 10 min at 4°C), trated by ultrafiltration (Amicon YM10 membrane) and the beads were washed four times with 500 ␮l of a sol- stored in liquid nitrogen until further use. ution containing 50 mm Tris/HCl, pH 7.6, 300 mm NaCl, 0.1% (v/v) Triton X-100, 0.02% SDS, and protease inhibi- Electroporation tors. Protein was then released from the washed beads A549 cells in 30 mm culture dishes were electroporated by boiling for 5 min in PAGE sample buffer containing similarly to the method described previously19,37 with a 1% SDS and 2% (v/v) 2-mercaptoethanol. single pulse at 100 V for 40 ms (square wave) using a BTX Model T820 ElectroSquarePorator. Electroporation was SDS-PAGE and Western blotting performed in Ca2+- and Mg2+-free Hank’s balanced salt For detection of Ku antigen; 25 ␮g protein sample of

solution, pH 7.4 containing 5 mm KCl, 0.3 mm KH2PO4, whole-cell extract from control and experimentally × 6 138 mm NaCl, 4 mm NaHCO3, 0.3 mm NaHPO4, 1.26 mm grown A549 (2 10 cells) was mixed with loading buffer CaCl2 H2O and 0.82 mm MgSO4 and either anti-Ku70, boiled for 5 min, and then loaded onto a 10% polyacryla- anti-Ku80, Ku70/80 or control IgG1 antibodies at a final mide gel containing 0.1% SDS. The gel was run at 200 V concentration of 10 ␮g/ml were used. Following elec- for 40 min. The separated proteins were Coomassie blue troporation, cells were incubated for an additional 30 min stained or transferred onto individual PVDF membranes ° at 37 C and 5% CO2, washed once with serum-free F-12 by electroblotting. Ponceau S staining of the blots was nutrient mixture (HAM) medium, and then cultured in conducted to ensure equivalent loading. After being HAM medium with serum during the stimulation with blocked with 5% non-fat dry milk in PBS, the nitrocellu- IL-13 and IL-4. lose membranes were incubated with their respective antibodies (1:250 dilution) for 1 h at RT. Following incu- Radiolabeling of cultured cells bation with goat anti-mouse IgG peroxidase second anti- Radiolabeling was accomplished by incubating cells, body (1:5000 dilution), the proteins were visualized by which had reached approximately 80% confluency, on a using the Luminol/Enhancer (ECL) solutions as rocker platform at 37°C with 1 mCi [35S]methionine and described by the manufacturer. [35S]cystine [express protein labeling] (1110 Ci/mmol), from NEN Life Science products, in 2 ml of methionine- Isolation and analysis of mRNAs free medium, containing 4 mm sodium pyruvate and The A549 cells were harvested, and RNA was extracted 2mm glutamine. Subsequent to a pulse of 6 h duration, for semiquantitative-RT-PCR. Briefly, Reverse-tran- the medium was removed and replaced with 3 ml of F- scriptase (RT)-PCR of 15-Lipoxygenase-1 mRNA and 12 medium containing 2 mm methionine with a chase for GAPDH in A549 cells was performed using total RNA. 24 h. The effects of cycloheximide was evaluated by One ␮g was reverse-transcribed in 45 ␮lof50mm

Genes and Immunity Ku autoantigen and 15-Lipoxygenase-1 induction UP Kelavkar et al 249 Tris/HCl buffer, pH 8.2, containing 8 mm MgCl2,30mm 11 Nassar GM, Morrow JM, Roberts 2nd LJ, Lakkis FG, Badr KF. KCl, 1 mm dithiothreitol, 100 ␮g/ml BSA, 30 units of Induction of 15-Lipoxygenase-1 by interleukin-13 in human RNase inhibitor, 0.166 mm of each dNTP, 150 pmol of blood monocytes. J Biol Chem 1994; 269: 27631–27634. oligo(dT) primer and 15 units of reverse transcriptase 12 Brinckmann R, Topp MS, Zalan I. et al. Regulation of 15-Lipoxy- according to the manufacturers instructions (Perkin– genase-1 expression in lung epithelial cells by interleukin-4. Biochem J 1996; 318: 305–312. Elmer). Samples were heated to 95°C for 10 min. For 15- Ј 13 Samuelsson B, Dahln SE, Lindgren JA, Rouzer CA, Serhan CN. Lipoxygenase-1, the PCR primers (5 - GAGAGTT Leukotrienes and lipoxins: structures, biosynthesis, and biologi- GACTTTGAGGTTTCGC-3Ј and 5Ј-CAGCCACGTCT Ј cal effects. Science 1987; 237: 1171–1176. GTCTTATAGTGG-3 ) were selected from regions dis- 14 Kelavkar U, Badr K. Effects of mutant p53 expression on human playing minimal sequence similarity to the sequences of 15-Lipoxygenase-1-promoter activity and murine 12/15-Lipoxy- human 12-lipoxygenase and leucocyte 5-lipoxygenase, genase-1 gene expression: evidence that 15-Lipoxygenase-1 is a and proved to be not suitable for the amplification of the mutator gene. Proc Natl Acad Sci USA 1999; 96: 4378–4383. human cDNAs of these two enzymes. 15 Badr KF. Glomerulonephritis: roles for lipoxygenase pathways The primers for the PCR of glyceraldehyde-3-phos- in pathophysiology and therapy. Curr Opin Nephrol Hypertens phate dehydrogenase (GAPDH) were 5Ј-TCGGAGT 1997; 6: 111–118. CAACGGATTTGGTCGTA-3Ј and 5Ј-ATGGACTGTG 16 Kelavkar U, Wang S, Montero A, Murtagh J, Shah K, Badr K. GTCATGAGTCCTTC-3Ј. After initial denaturation for Human 15-Lipoxygenase-1 gene promoter: analysis and identi- 3 min at 94°C, PCR was carried out for 23 cycles. Each fication of DNA binding sites for IL-13-induced regulatory factors in monocytes. Mol Biol Rep 1998; 25: 173–182. cycle consisted of a denaturing period (40 s at 94°C), an ° ° 17 Reeves WH, Wang J, Ajmani AK, Stajanov L, Satoh M. The Anti- annealing phase (30 s at 60 C for GAPDH and at 62 C bodies: The Ku autoantigen. Vol 3. Harwood Academic Publishers: for 15-Lipoxygenase-1) and an extension period (30 s at Netherlands, 1997, pp 33–84. 72°C for both primer sets). The reaction mixture was 18 Dynan WS, Yoo S. Interaction of Ku protein and DNA-depen- 10 mm Tris/HCl buffer, pH 8.3, containing 50 mm KCl, dent protein kinase catalytic subunit with nucleic acids. Nucleic 2mm MgCl2, 0.1 mg/ml gelatine, 6 pmol of primer sets, Acids Res 1998; 26: 1551–1559. 100 ␮m of each dNTP, 100 ␮g/ml BSA and 2.5 units of 19 Marrero MB, Schieffer B, Paxton WG, Schieffer E, Bernstein KE. Taq DNA polymerase. PCR products were separated by Electroporation of pp60c-src antibodies inhibits the angiotensin 2% agarose gel electrophoresis. For semiquantification, II activation of phospholipase C-gamma 1 in rat aortic smooth DNA was stained with ethidium bromide and analyzed muscle cells. J Biol Chem 1995; 270: 15734–15738. densitometrically. 20 Mimori T, Ohosone Y, Hama N et al. Isolation and characterization of cDNA encoding the 80-kDa subunit protein of the human autoantigen Ku (p70/p80) recognized by autoantibodies References from patients with scleroderma-polymyositis overlap syn- 1 Schindler C, Darnell JE Jr. Transcriptional responses to polypep- drome. Proc Natl Acad Sci USA 1990; 87: 1777–1781. tide ligands: the JAK-STAT pathway. Annu Rev Biochem 1995; 21 Reeves WH, Sthoeger ZM. Molecular cloning of cDNA encoding 64: 621–651. the p70 (Ku) lupus autoantigen. J Biol Chem 1989; 264: 5047–5052. 2 Hou J, Schindler U, Henzel WJ, Ho TC, Brasseur M, McKnight 22 Tuteja N, Tuteja R, Ochem A et al. Human DNA helicase II: a SL. An interleukin-4-induced transcription factor: IL-4 Stat. novel DNA unwinding enzyme identified as the Ku autoanti- Science 1994; 265: 1701–1706. gen. EMBO J 1994; 13: 4991–5001. 3 Fasler-Kan E, Pansky A, Wiederkehr M, Battegay M, Heim MH. 23 Chan DW, Lees-Miller SP. The DNA-dependent protein kinase Interferon-alpha activates signal transducers and activators of is inactivated by autophosphorylation of the catalytic subunit. transcription 5 and 6 in Daudi cells. Eur J Biochem 1998; 254: J Biol Chem 1996; 271: 8936–8941. 514–519. 24 Peterson SR, Jesch SA, Chamberlin TN et al. Stimulation of the 4 Graber P, Gretener D, Herren S et al. The distribution of IL-13 DNA-dependent protein kinase by RNA polymerase II tran- receptor alphal expression on B cells, T cells and monocytes and scriptional activator proteins. J Biol Chem 1995; 270: 1449–1454. its regulation by IL-13 and IL-4. Eur J Immunol 1998; 28: 4286– 25 Ono M, Tucker PW, Capra JD. Production and characterization 4298. of recombinant human Ku antigen. Nucleic Acids Res 1994; 22: 5 Yu CR, Kirken RA, Malabarba MG, Young HA, Ortaldo JR. Dif- 3918–3924. ferential regulation of the Janus kinase-STAT pathway and bio- 26 Wang J, Dong X, Reeves WH. A model for Ku heterodimer logic function of IL-13 in primary human NK and T cells: a com- assembly and interaction with DNA. Implications for the func- parative study with IL-4. J Immunol 1998; 161: 218–227. tion of Ku antigen. J Biol Chem 1998; 273: 31068–31074. 6 Curiel RE, Lahesmaa R, Subleski J et al. Identification of a Stat- 27 Salminen A, Helenius M, Lahtinen T et al. Down-regulation of 6-responsive element in the promoter of the human interleukin- Ku autoantigen, DNA-dependent protein kinase, and 4 gene. Eur J Immunol 1997; 27: 1982–1987. poly(ADP-ribose) polymerase during cellular senescence. 7 Murata T, Noguchi PD, Puri RK. IL-13 induces phosphorylation Biochem Biophys Res Commun 1997; 238: 712–716. and activation of JAK2 Janus kinase in human colon carcinoma et al cell lines: similarities between IL-4 and IL-13 signaling. J Immu- 28 Teoh G, Urashima M, Greenfield EA . The 86-kD subunit of nol 1996; 156: 2972–2978. Ku autoantigen mediates homotypic and heterotypic adhesion 8 Lin JX, Migone TS, Tsang M et al. The role of shared receptor of multiple myeloma cells. J Clin Invest 1998; 101: 1379–1388. motifs and common Stat proteins in the generation of cytokine 29 Serve H, Oelmann E, Herweg A et al. Inhibition of proliferation pleiotropy and redundancy by IL-2, IL-4, IL-7, IL-13, and IL-15. and clonal growth of human breast cancer cells by interleukin Immunity 1995; 2: 331–339. 13. Cancer Res 1996; 56: 3583–3588. 9 Conrad DJ, Kuhn H, Mulkins M, Highland E, Sigal E. Specific 30 Maini A, Hillman G, Hass GP et al. Interleukin-13 receptors on inflammatory cytokines regulate the expression of human mon- human prostate carcinoma cell lines represent a novel target for ocyte 15-Lipoxygenase-1. Proc Natl Acad Sci USA 1992; 89: a chimeric protein composed of IL-13 and a mutated form of 217–221. Pseudomonas exotoxin. J Urol 1997; 158: 948–953. 10 Levy BD, Romano M, Chapman HA, Reilly JJ, Drazen J, Serhan 31 Yaneva M, Arnett FC. Antibodies against Ku protein in sera CN. Human alveolar macrophages have 15-Lipoxygenase-1 and from patients with autoimmune diseases. Clin Exp Immunol generate 15(S)-hydroxy-5,8,11-cis-13-trans-eicosatetraenoic acid 1989; 76: 366–372. and lipoxins. J Clin Invest 1993; 92: 1572–1579. 32 Reeves WH. Antibodies to the p70/p80 (Ku) antigens in sys-

Genes and Immunity Ku autoantigen and 15-Lipoxygenase-1 induction UP Kelavkar et al 250 temic lupus erythematosus. Rheum Dis Clin North Am 1992; 18: 36 Kroeger KM, Abraham LJ. Magnetic bead purification of specific 391–414. transcription factors using mutant competitor oligonucleotides. 33 Jaeger JA, Turner DH, Zuker M. Predicting optimal and subopti- Anal Biochem 1997; 250: 127–129. mal secondary structure for RNA. Methods Enzymol 1989; 183: 37 Marrero MB, Schieffer B, Li B, Sun J, Harp JB, Ling BN. Role of 281–306. Janus kinase/signal transducer and activator of transcription 34 Dignam JD, Labovitz RM, Roeder RG. Accurate transcription and mitogen-activated protein kinase cascades in angiotensin II- initiation by RNA polymerase II in a soluble extract from iso- and platelet-derived growth factor-induced vascular smooth lated mammalian nuclei. Nucleic Acids Res 1983; 11: 1475–1489. muscle cell proliferation. J Biol Chem 1997; 272: 24684–24690. 35 Austin GE, Zhao WG, Zhang W, Austin ED, Findlev HW, Murt- agh J. Identification and characterization of the human myelo- peroxidase promoter. Leukemia 1995; 9: 848–857.

Genes and Immunity