sign in sign up
<<
Home , Helicase, Replication factor C, Replication protein A, Replisome

1 2 Reconstitution of a eukaryotic reveals suppression mechanisms 3 that define leading/lagging strand operation 4 5 6 Roxana E. Georgescu, Grant D. Schauer, Nina Y. Yao, Lance D. Langston, Olga Yurieva, Dan 7 Zhang, Jeff Finkelstein, and Mike E. O’Donnell 8 9 DNA Replication Laboratory 10 Howard Hughes Medical Institute 11 The Rockefeller University 12 New York, NY, 10065 13 14 15 Correspondence should be addressed to M.O.D. ([email protected]) 16 17 Impact statement: This study reveals that the different at eukaryotic replication 18 forks achieve their asymmetric placement on the leading and lagging strands through 19 exclusion processes that prevent their function on the “wrong” strand. 20 21 Keywords: DNA Replication, Replication fork, CMG, PCNA, RFC, Pol α, Pol ε, Pol δ 22 23 Running Title: Reconstitution of a leading-lagging strand eukaryotic replisome. 24 25

1 26 ABSTRACT 27 We have reconstituted a eukaryotic leading/lagging strand replisome comprising 31 distinct 28 polypeptides. This study identifies a process unprecedented in bacterial . While 29 bacteria and phage simply recruit polymerases to the fork, we find that suppression 30 mechanisms are used to position the distinct eukaryotic polymerases on their respective 31 strands. Hence, Pol ε is active with CMG on the leading strand, but it is unable to function on 32 the lagging strand, even when Pol δ is not present. Conversely, Pol δ-PCNA is the only 33 capable of extending in the presence of Pols ε and α. We have shown 34 earlier that Pol δ-PCNA is suppressed on the leading strand with CMG (Georgescu, Langston et 35 al. 2014). We propose that CMG, the 11-subunit , is responsible for one or both of 36 these suppression mechanisms that spatially control occupancy at the fork. 37 38 39 INTRODUCTION 40 41 Composition of the eukaryotic replisome and the function of its various is an 42 area of active investigation. Cellular studies reveal that use two different DNA 43 polymerases for the leading and lagging strands, Pols ε and δ, respectively (Lee, Eki et al. 44 1989; Weinberg and Kelly 1989; Tsurimoto, Melendy et al. 1990; Waga and Stillman 1998; 45 Benkovic, Valentine et al. 2001; Pursell, Isoz et al. 2007; Kunkel and Burgers 2008; Nick 46 McElhinny, Gordenin et al. 2008; Stillman 2008). Priming is performed by Pol α, a 4 subunit 47 enzyme that contains an RNA and DNA polymerase activity and makes short RNA- 48 DNA hybrid primers of 25-35 nucleotides (Kaguni and Lehman 1988; Waga and Stillman 49 1998; Benkovic, Valentine et al. 2001; Stillman 2008). The 11-subunit CMG complex consisting 50 of the Mcm2-7 “motor”, a GINS heterotetramer, and one Cdc45 subunit (Moyer, Lewis et al. 51 2006; Ilves, Petojevic et al. 2010; Costa, Ilves et al. 2011; Costa, Renault et al. 2014) provides 52 the helicase activity. Numerous other proteins travel with eukaryotic replication forks and 53 have no bacterial homologue or known function. In addition, many replication fork associated 54 proteins undergo modifications in response to the cell cycle or DNA damage. 55 While synthesis of the leading strand replisome has been accomplished with 56 the purified CMG complex from budding yeast (Georgescu, Langston et al. 2014), the 57 discontinuous lagging strand is a much more difficult process and the number of proteins

2 58 required for lagging strand synthesis is currently unknown. Indeed, epitope tagging of CMG 59 subunits, followed by cell extract pull-outs and mass spectrometry, has identified a large 60 “Replisome Progression Complex” (RPC) that contains CMG along with several other factors, 61 some of which are essential for cell viability (Gambus, Jones et al. 2006; Gambus, van Deursen 62 et al. 2009). Thus, RPCs contain CMG along with Mcm10, Ctf4, Pol α, Mrc1, Csm3, Tof1, FACT 63 and Topo I. Furthermore, there is evidence that nucleosomes may be involved in determining 64 the size of eukaryotic lagging strand fragments (Smith and Whitehouse 2012). We 65 demonstrate here a 31 system, requiring the three replicative Pols α, ε and δ, that 66 performs both leading and lagging strand synthesis and generates Okazaki fragments of a size 67 similar to those observed in cells. 68 Study of the eukaryotic replisome identifies a new process that has no precedent in 69 bacterial systems. Bacteria use simple recruitment processes to attract and polymerases 70 to the fork. These are typically mediated by polymerase interactions with other proteins at the 71 replication fork, such as the helicase and sliding clamps (Benkovic, Valentine et al. 2001). 72 However, we find that in addition to recruitment processes that attract polymerases to the 73 fork, eukaryotes use suppressive mechanisms, which prevent polymerase action on one 74 strand or the other. Thus, while Pol ε extends the leading strand, its activity is suppressed on 75 the lagging strand, even in the absence of Pol δ. In opposite fashion, we demonstrate here that 76 Pol δ is active on the lagging strand in the presence of Pol ε and Pol α. This activity stands in 77 contrast to the suppression of Pol δ on the leading strand shown in our earlier report 78 (Georgescu, Langston et al. 2014). We also find that Pol α functions with CMG on both the 79 leading and lagging strands. However, Pol α lacks a proofreading and thus has 80 lower fidelity than Pols ε and δ. Interestingly, Pol α extension activity is suppressed by Pol ε 81 on the lagging strand even though Pol ε is inactive on the lagging strand. Likewise, Pol δ 82 suppresses Pol α on the leading strand despite its inefficient extension of this strand. Thus, 83 multiple suppression reactions exist that prevent the activity of a polymerase positioned on 84 the “wrong” strand, and the only active solution is the asymmetric Pol ε/δ leading-lagging 85 strand replisome with use of Pol α to prime the strands. 86 RESULTS 87 We expressed and purified yeast CMG helicase in our previous studies and demonstrated its 88 function in leading strand synthesis with Pol ε (Georgescu, Langston et al. 2014). The

3 89 discontinuous lagging strand is a more difficult process than continuous leading strand 90 synthesis and the current study aims to identify how polymerases are coordinated during 91 coupled leading-lagging strand synthesis. To facilitate this study, we designed a synthetic 92 of 3.2 kb that lacks dG on one strand and thus lacks dC on the other. We then ligated 93 a synthetic fork onto one end (illustrated in Figure 1A). This nucleotide-biased fork enables 94 separate monitoring of leading and lagging strand synthesis using either 32P-dCTP (leading) 95 or 32P-dGTP (lagging). 96 Pol α functions on both strands of a replication fork with CMG. Pol α is the eukaryotic 97 primase, and thus is required for lagging strand studies. To obtain the 4-subunit Pol α, we 98 reconstituted it by expressing the Pol1 polymerase subunit of Pol α in yeast and Pol12 and the 99 primase subunits, Pri1 and Pri2, in E. coli. A mixture of cells containing the 4 subunits were 100 lysed and Pol α was purified as an intact 4-subunit holoenzyme (Figure 1- Supplement 1). We 101 then studied the behavior of Pol α with the 11-subunit CMG helicase and RPA on the forked 102 DNA substrate. We initially assumed the lagging strand specific Pol α would not function on 103 the leading strand with CMG, especially since Pol δ-PCNA did not function well on the leading 104 strand with CMG in our earlier study (Georgescu, Langston et al. 2014). To test Pol α function 105 with CMG, we primed the leading strand with an oligonucleotide and examined Pol α DNA 106 synthesis with CMG using 32P-dCTP (see scheme in Fig. 1B). In contrast to our expectations, 107 Pol α was highly active with CMG and completely extended the leading strand (Figure 1B, 108 lanes 4-6). Dropout reactions demonstrated that CMG is absolutely required and therefore Pol 109 α cannot perform this action alone (Figure 1 – Supplement 2). 110 Models of priming at bidirectional origins in the SV40 and bacterial systems indicate that 111 leading strand primers are formed on the lagging strand of one fork, and then extended from 112 the leading strand of the opposite fork (Waga and Stillman 1998; Mendez and Stillman 2003; 113 Kaguni 2011; O'Donnell, Langston et al. 2013). The current study uses a unidirectional linear 114 fork, and thus has no opposite fork from which to prime the leading strand. Therefore, we did 115 not expect to observe leading strand synthesis using an unprimed leading strand fork. 116 However, Pol α was fully active on unprimed DNA and thus the primase within Pol α is 117 capable of priming the leading strand directly, while the polymerase subunit of Pol α is able to 118 extend it (Figure 1B, lanes 1-3). We support and expand this observation again later in Figure 119 2.

4 120 A titration of Pol α into reactions with CMG shows an increasing rate of leading strand 121 elongation as the Pol α concentration is raised, indicating that DNA synthesis by Pol α is 122 distributive (autoradiograph illustrated in Figure 1C left panel and quantified on the right 123 panel). The leading strand is continuously extended to full-length product; consequently, 124 once Pol α has switched to the DNA elongation mode, it does not appear to switch back to the 125 priming mode. This behavior has not previously been observed at a moving fork with CMG. 126 Moreover, there are reports to suggest that the eukaryotic fork is discontinuous on both 127 strands (reviewed in (Langston and O'Donnell 2006)). The results of Figure 1, however, 128 indicate that the leading strand of the eukaryotic replication fork is synthesized continuously 129 under our assay conditions. 130 To determine whether this minimal replication system is competent to prime and 131 extend the lagging strand, we utilized 32P-dGTP to specifically label lagging strand products. 132 We assembled CMG on the forked DNA then titrated Pol α into the reaction in the presence of 133 RPA, dNTPs and rNTPs. We expected to observe the small hybrid RNA/DNA 25-35 nucleotide 134 primers known to be generated by Pol α (Kaguni and Lehman 1988; Waga and Stillman 1998; 135 Benkovic, Valentine et al. 2001; Stillman 2008). However, we were surprised to observe 136 sizeable Okazaki fragments (autoradiograph illustrated in Figure 1D left panel and quantified 137 on the right panel). At 10-20 nM Pol α, a concentration consistent with intracellular 138 concentrations of Pol α subunits (Kulak, Pichler et al. ; Ghaemmaghami, Huh et al. 2003), 139 Okazaki fragments were in the range of 200 bp, similar to their length in vivo (Smith and 140 Whitehouse 2012). The fact that the Okazaki fragment size decreases with increasing Pol α 141 concentration indicate that priming is stochastic, occurring with lower as the Pol α 142 concentration is decreased (Figure 1D). These results demonstrate that small Okazaki 143 fragments are intrinsic to Pol α action with CMG in the absence of nucleosomes. 144 Pol α requires CMG for priming function. To determine if CMG is needed for Pol α priming 145 function we used φ29 DNA Pol, an efficient strand displacing enzyme (Blanco, Bernad et al. 146 1989), to perform leading strand synthesis and generate a lagging single-strand (ss) without 147 CMG, and asked whether Pol α primase could prime the lagging strand ssDNA template and 148 produce Okazaki fragments with RPA present (illustrated in Figure 2A). The control shows 149 φ29 Pol efficiently extends a primer through the 3.2 kb duplex (Figure 2B, lanes 1 and 5) and 150 thus produces a ssDNA lagging strand. However, the lagging strand ssDNA did not serve as a

5 151 template to generate Okazaki fragments when Pol α and RPA were present (Figure 2B, lane 6). 152 In contrast, lagging strand synthesis by Pol α with CMG supports robust Okazaki fragment 153 production by Pol α (lane 4). The requirement of CMG for Pol α primase activity suggests that 154 Pol α forms a transient but specific interaction with CMG for priming action, since use of a 155 heterologous enzyme to unwind DNA does not support Pol α priming activity. Although both 156 Ctf4 and the essential Mcm10 proteins are known to bind Pol α (Gambus, van Deursen et al. 157 2009; Warren, Huang et al. 2009), these results demonstrate that neither Ctf4 nor Mcm10 are 158 required for Pol α priming function with CMG in vitro. To support this observation, we 159 examined our protein preparations for trace contaminating Ctf4 and/or Mcm10 by mass 160 spectrometry, but no Ctf4 or Mcm10 was detected. Consistent with results of Figure 1B, Pol α 161 also primes the leading strand directly and priming is stimulated by the presence of CMG 162 (compare lanes 3 and 7). The results suggest Pol α binds CMG in the absence of Ctf4 or Mcm10 163 and therefore we tried to pull down a complex of Pol α with CMG, but did not obtain a positive 164 result. Thus the interaction, if it exists, may be weak, consistent with weak helicase-primase 165 interactions in phage T4 and E. coli replication systems that can be deduced by activity assays 166 but elude direct detection methods (Benkovic and Valentine, et al. 2001). 167 To determine if Okazaki fragments are distributed over the length of the DNA template, 168 we used 32P-dGTP to label Okazaki fragments and then analyzed the distribution of 169 radioactivity across the DNA by restriction enzyme analysis in a native gel (Figure 3). The 170 analysis using CMG and Pol α shows that all the restriction fragments are radioactive, and 171 therefore Okazaki fragments are synthesized along the entire length of the DNA (lanes 4-9). 172 To create size markers, φ29 Pol was used to extend the leading strand using 32P-dCTP, 173 followed by restriction digestion (lanes 10-12). The analysis also confirms that Pol α cannot 174 perform priming and extension in the absence of CMG (lanes 1-3) and that φ29 Pol cannot 175 perform lagging strand synthesis (lanes 13-15). 176 Pol ε switches with Pol α polymerase on the leading strand. Pol ε is the leading strand 177 enzyme and presumably takes over the leading strand from Pol α after this distributive 178 enzyme dissociates from DNA. To determine if the Pol α/ε switch occurs as expected, we 179 preloaded CMG on the forked DNA, then added increasing amounts of Pol α either with or 180 without Pol ε and stopped the reactions after 20 min. If Pol ε takes over the leading strand 181 from Pol α, full-length products will be observed sooner in reactions that contain

6 182 Pol ε because in the presence of CMG, this enzyme synthesizes DNA faster than Pol α. The 183 results show full length product in all the lanes containing Pol ε with Pol α (autoradiograph in 184 Figure 4A left, compare lanes 1-4 with 5-8; the quantification on the right panel is based on 185 the autoradiograph analysis shown in Figure 4 - Supplement 1A). These observations indicate 186 that after Pol α primes the DNA, Pol ε takes over and rapidly extends the leading strand. The 187 reactions lack RFC/PCNA, but the presence of RFC/PCNA does not alter the outcome (Figure 4 188 – Supplement 2). At sufficiently high concentrations, RFC/PCNA compete with Pol α and 189 suppress its extension activity with CMG, as previously reported without CMG (Mossi, Keller 190 et al. 2000) (Figure 4B and quantification analysis shown in Figure 4 -Supplement 1B). The 191 results show that RFC/PCNA also inhibit Pol α polymerase extension of primers on the lagging 192 strand. 193 The ability of Pol ε to suppress Pol α function with CMG might be facilitated by direct 194 interaction of Pol ε with CMG, thus holding Pol ε at the leading strand primer terminus and 195 preventing Pol α from binding. The Dpb2 subunit of Pol ε is known to bind the Psf1 subunit of 196 GINS (Sengupta, van Deursen et al. 2013), and we have previously used a glycerol gradient to 197 demonstrate that intact Pol ε can bind CMG helicase, forming a 1:1 CMG-Pol ε (CMGE) complex 198 (Langston, Zhang et al. 2014). In Figure 4 – Supplement 3, we document that the CMGE 199 complex can also be reconstituted in a bead-based protein-binding assay. In these 200 experiments we purified Pol ε containing an N-terminal streptag, incubated it with CMG and 201 then added Strep-Tactin magnetic beads. Biotin specific elution of CMG in complex with 202 streptag-Pol ε demonstrates that CMG is retained by Pol ε, forming the 15-protein “CMGE” 203 leading strand complex. No CMG was eluted from the column in the absence of Pol ε. 204 Pol ε activity is suppressed specifically on the lagging strand. Considering that Pol ε takes 205 over the primed template from Pol α on the leading strand, one may presume that Pol ε will 206 also take over from Pol α on the lagging strand. In Figure 4C, we separately monitored leading 207 and lagging strand synthesis in Pol α/CMG reactions in the absence or presence of Pol ε. The 208 first two lanes are Pol α/CMG on the leading (lane1) and lagging (lane2) strands. At the 209 concentration used, Pol α extended the leading strand DNA to about half of full length (lane 1), 210 and the signal for Okazaki fragment synthesis was quite strong (lane 2). When Pol ε was 211 added, it took over the leading strand and extended it full-length (Figure 4C, lane 3); however, 212 lagging strand Okazaki fragments were inhibited, a result we did not expect (lane 4). We also

7 213 tested a higher concentration of Pol ε, to see if more Pol ε was required to efficiently extend 214 the Okazaki fragments, but lagging strand synthesis was not enhanced (Figure 4C, lane 6)(for 215 quantification see Figure 4C right-panel and Figure 4 - Supplement 1C). This result is contrary 216 to conventional wisdom, because one would normally expect more synthesis upon addition of 217 more polymerase. This is especially true considering that Pol ε enhances the leading strand in 218 the very same reaction in which it inhibits the lagging strand (i.e. the only difference is the 219 radioisotope). 220 The results of Figure 4C indicate that Pol ε activity is suppressed on the lagging strand. 221 Moreover, Pol ε suppresses Pol α, suggesting that Pol ε gains access to lagging strand primed 222 sites, but is inactive on them. Considering that Pol ε extends DNA on RPA coated primed 223 ssDNA in the absence of CMG (Wold 1997; Garg and Burgers 2005; Georgescu, Langston et al. 224 2014), it is possible that CMG controls the activity of Pol ε on the lagging strand. We further 225 supported this observation in Figure 5A by titrating Pol ε into Pol α priming reactions and 226 monitoring lagging strand synthesis. As Pol ε is titrated into the reaction, Okazaki fragment 227 synthesis is inhibited, confirming that Pol ε suppresses Pol α polymerase but is unable to 228 extend lagging strand primers (see quantification in Figure 5A, right-panel). Although Pol ε 229 inhibits Pol α on the lagging strand, a combination of Pol ε and RFC/PCNA inhibits Pol α more 230 than either Pol ε or RFC/PCNA alone (Figure 5 – Supplement 1A, lanes 1-2 and 4-7 versus 231 lanes 8-11; quantification shown in Figure 5-Supplement 1B). Inhibition of Pol α synthesis by 232 RFC/PCNA is also consistent with results in the SV40 system (Tsurimoto and Stillman 1991) 233 and model studies using primed ssDNA (Figure 5 – Supplement 2) (Mossi, Keller et al. 2000). 234 Hence, RFC/PCNA contributes to the observed inhibition of Pol α synthesis in addition to Pol ε. 235 236 Pol δ–PCNA activity is suppressed on the leading strand but active on the lagging strand. 237 Our earlier study demonstrated that Pol δ–PCNA was slow and distributive on the leading 238 strand in the presence of CMG and at 50 mM potassium glutamate (Georgescu, Langston et al. 239 2014). However, Pol δ-PCNA is highly processive during synthesis of the 5.4 kb primed RPA 240 coated φX174 ssDNA under the 50 mM potassium glutamate conditions used in the 3 kb 241 replisome assays (Langston and O'Donnell 2008). Pol δ-PCNA has been shown to be much less 242 processive in reactions containing 125 mM added NaOAc (Chilkova, Stenlund et al. 2007). A 243 high ionic strength is known to decrease of , as the highly processive

8 244 bacterial Pol III-β clamp replicase is decreased significantly at 100 mM NaCl (Griep and 245 McHenry 1989). Potassium glutamate is the physiological osmolyte in E. coli (Richey, Cayley et 246 al. 1987), but to the authors’ knowledge, neither the intracellular ionic strength nor the major 247 intracellular osmolytes are known for budding yeast. We do not know why Pol δ-PCNA is not 248 very active on the leading strand with CMG. However, we have shown in this report that 249 RFC/PCNA compete with Pol α on the leading strand (Figure 4B, lanes 1-5), indicating that 250 PCNA is in fact loaded onto the leading strand. We demonstrate in Figure 6A that Pol δ added 251 to the reaction exacerbates inhibition of Pol α in the presence of RFC/PCNA, while both Pol α 252 and Pol ε are active in the presence of CMG and the amount of RFC/PCNA used (see 253 quantifications in Figure 6B, C). Hence Pol δ-PCNA does not function with CMG and severely 254 competes and limits the function of Pol α with CMG. The addition of Pol δ to reactions 255 containing Pols α and ε shows no significant effect on the leading strand reactions (Figure 6 – 256 Supplement 1). The result of this three polymerase reaction is consistent with, and anticipated 257 from our earlier study of leading synthesis using primed forks (i.e. no Pol α) in which we 258 demonstrate that Pol δ is inefficient and distributive on the leading strand and that Pol ε 259 suppresses Pol δ by taking over the 3’ primed site in the CMG dependent leading strand 260 reaction (Georgescu, Langston et al. 2014). 261 Next, we tested whether Pol δ-PCNA could function on the lagging strand with CMG in 262 the presence of Pol ε, Pol α, RFC, PCNA and RPA, conditions in which Pol ε extends the leading 263 strand with CMG but suppresses Okazaki fragment extension by Pol α. In Figure 5B, Pol δ was 264 titrated into lagging strand reactions and surprisingly, Pol δ was capable of extending Okazaki 265 fragments under these circumstances. In fact, it is the only polymerase that we observed to 266 perform this function. Hence, CMG does not prevent Pol δ function on the lagging strand, even 267 while Pol δ-PCNA activity is suppressed on the leading strand. 268 Leading and Lagging strand synthesis occurs at similar rates. In order to compare total 269 leading and lagging strand synthesis rates, we setup standard replication reactions by loading 270 CMG onto the nucleotide biased forked-DNA, followed by the addition of all three DNA 271 polymerases in the presence of RFC and PCNA; the reactions were divided and replication was 272 initiated by the addition of either 32P-dCTP or 32P-dGTP along with ATP, RPA, dNTPs and 273 rNTPS (see Materials and Methods for experimental details). Quantification of leading and 274 lagging strand synthesis using either 32P-dCTP (leading) or 32P-dGTP (lagging) in the three

9 275 polymerase replisome system shows similar amounts of leading and lagging strand synthesis 276 (Figure 7). We tested the rate of dNTP incorporation using primed, as well as, unprimed 277 forked-DNA templates. While leading- and lagging-strand rates are similar using either DNA 278 forked substrate, there is 20-25% more synthesis using primed DNA forks relative to 279 unprimed DNA forks. We presume this difference reflects the additional time required for Pol 280 α to prime the leading strand on the unprimed fork DNA, relative to use of forks that are pre- 281 primed with a DNA oligonucleotide (i.e. primed forks). 282 283 Discussion 284 The current report is the first reconstitution of a eukaryotic tri-polymerase leading/lagging 285 strand replisome from purified proteins. Our earlier study used CMG with Pol ε to reconstitute 286 leading strand replication (Georgescu, Langston et al. 2014). The continuous nature of the 287 leading strand is relatively simple compared to the discontinuous process of the lagging 288 strand. Indeed, PCNA and RFC were not even required for the leading strand (Georgescu, 289 Langston et al. 2014). There are a multitude of proteins that travel with eukaryotic replication 290 forks, many of which have been identified in the large RPC assembly (Gambus, Jones et al. 291 2006; Gambus, van Deursen et al. 2009). This report demonstrates that leading/lagging 292 strand replication is recapitulated in vitro with CMG, Pol ε, Pol α, Pol δ, RFC, PCNA and RPA, 293 comprising 31 different proteins. Hence nucleosomes are not needed to size Okazaki 294 fragments in vitro, the essential Mcm10 protein that binds Pol α is not required, nor is the 295 Ctf4 trimer that connects Pol α to CMG (Simon, Zhou et al. 2014). Study of the leading/lagging 296 strand reaction revealed many facets of replication that were unanticipated, as summarized 297 below. 298 Suppression reactions, not recruitment specifies eukaryotic replisome architecture. 299 The current report reveals that suppression reactions specify correct polymerase placement 300 at the fork, and that when a polymerase occupies the “wrong strand” it is excluded from 301 functioning. This stands in contrast to current views in which the mechanism of polymerase 302 placement is thought to be via recruitment (i.e. each polymerase binds a particular protein on 303 each strand). Indeed, polymerase recruitment by binding clamps and the helicase underlies 304 attraction of polymerases to replication forks of bacteria, its phages and the SV40 virus. 305 Recruitment is also partly responsible for polymerase placement in eukaryotes. For example, 306 Pol ε binds directly to CMG helicase, stabilizing it on the leading strand (Langston, Zhang et al.

10 307 2014). However, the current study reveals the importance of suppression of polymerase 308 action to the specific use of Pol ε and Pol δ on the leading and lagging strands, respectively. 309 Thus Pol ε function is suppressed on the lagging strand, even when Pol δ is not present. 310 Likewise, our earlier study, confirmed here, showed that Pol δ-PCNA function is suppressed 311 on the leading strand, even in the absence of Pol ε (Georgescu, Langston et al. 2014). 312 We were surprised to find that Pol α polymerase activity is highly functional with CMG 313 on both leading and lagging strands in the absence of other polymerases. Pol α lacks the high 314 fidelity of Pols ε and δ, and does not provide bulk leading or lagging strand synthesis in cells, 315 and thus processes must exist that suppress the polymerase activity of Pol α. In fact, we find 316 many ways that Pol α polymerase is suppressed. One mechanism is by Pol ε positioning on the 317 lagging strand. Interestingly, Pol ε is also suppressed on the lagging strand; perhaps Pol ε is 318 suppressed from function on the lagging strand by the relative orientation in which CMG 319 holds Pol ε. On the leading strand, Pol ε simply prevents Pol α polymerase extension by 320 switching with it and becoming processive with CMG. This can be likened to the switch of Pol 321 δ with Pol α that prevents leading strand synthesis by Pol α in the SV40 system (Tsurimoto 322 and Stillman 1991). Pol α polymerase activity is also inhibited by RFC/PCNA as shown in this 323 report, and an earlier study (Mossi, Keller et al. 2000). 324 The exclusion processes that underlie eukaryotic fork leading/lagging strand function are 325 summarized in Figure 8. Pol α primes both leading and lagging strands (diagram A). 326 Pol ε prevents further polymerase activity of Pol α by trading places with it, probably by 327 waiting for the distributive Pol α to dissociate from DNA (diagram B); Pol ε, then takes over 328 the leading strand. Diagram C illustrates that Pol δ/RFC/PCNA also switch with Pol α, but that 329 Pol δ-PCNA cannot function in the presence of CMG on the leading strand. However, Pol δ- 330 PCNA is uniquely capable of extending Okazaki fragments in the complete system (diagram D). 331 Hence, the three-polymerase-CMG replisome is the product of polymerase suppression 332 reactions that enable a unique asymmetric arrangement of DNA polymerases to advance the 333 replication fork. 334 Possible mechanisms of the polymerase suppression reactions. Yeast Pol δ is highly 335 processive with PCNA on primed ssDNA under the conditions of this report (Langston and 336 O'Donnell 2008), yet Pol δ-PCNA is not effective in extending the leading strand with CMG 337 helicase. The distributive behavior of Pol δ-PCNA with CMG suggests that CMG exerts a

11 338 negative effect upon Pol δ, causing it to frequently dissociate from PCNA/DNA. A possible 339 explanation for how CMG may cause distributive behavior of Pol δ with PCNA/DNA lies in our 340 earlier finding that Pol δ self-ejects from PCNA upon completing replication of a template 341 (Langston and O'Donnell 2008). This property was originally noted for the highly processive E. 342 coli Pol III replicase (O'Donnell 1987; Studwell, Stukenberg et al. 1989). Pol III remains firmly 343 attached to the β clamp until reaching the last nucleotide (Stukenberg, Turner et al. 1994). 344 This also holds true for T4 polymerase upon colliding with a hairpin (Hacker and Alberts 345 1994). Self-ejection of polymerase is thought to be useful for recycling among numerous 346 lagging strand primers (Benkovic, Valentine et al. 2001). In eukaryotes however, the self- 347 ejection process may be used to promote polymerase asymmetry at the fork. A 348 straightforward mechanism could be that CMG occludes the leading strand ssDNA, tricking Pol 349 δ-PCNA to eject as if it were at the end of an Okazaki fragment. If CMG were to trigger the 350 Pol δ−PCNA self-ejection process, it would result in distributive behavior of Pol δ-PCNA, 351 suppressing its activity on the leading strand. Another possible mechanism could be that the 3’ 352 terminus of the leading strand is sequestered and held in a posture that Pol δ can not freely 353 access. 354 The suppression of Pol ε on the lagging strand could possibly result from the geometry 355 of CMG-Pol ε (CMGE) complex, directing the single Pol ε molecule to the leading strand. 356 Suppression of Pol α by Pol ε on the lagging strand could perhaps be explained by competition 357 of these polymerases for CMG, where Pol ε is suppressed from extending the primer. In this 358 connection, the Pol2 encoding the catalytic polymerase actually contains two polymerase 359 structures: the active polymerase/exonuclease on the N-terminal half, and B-family 360 polymerase in the C-terminal half of Pol2 that is presumed to be inactive (Tahirov, Makarova 361 et al. 2009). One possible mechanism by which Pol ε may suppress synthesis on the lagging 362 strand could be that CMG positions Pol ε such that the “inactive polymerase” binds lagging 363 strand primers, preventing their elongation by Pol α and Pol ε. Interestingly, genetic studies 364 have shown that the C-terminal “inactive polymerase” region of Pol ε is required for cell 365 viability, while the N-terminal region containing the active polymerase is dispensable (Dua, 366 Levy et al. 1999; Kesti, Flick et al. 1999). The binding of Pol ε to CMG involves Dpb2, and 367 possibly the Dpb3, Dpb4 subunits of Pol ε and regions of Pol2 as well. Expression and 368 purification of a mutant Pol ε that lacks the active N-terminal half of Pol2 (ΔN-Pol ε) yields a 4

12 369 subunit complex, while the active polymerase half of Pol ε is monomeric (Hogg, Osterman et al. 370 2014). Hence, the ΔN-Pol ε probably connects to CMG similar to wild-type Pol ε, and may carry 371 out a vital function at the fork. Alternatively, the C-terminal portion of Pol2 could be 372 important to an origin activation step prior to replisome formation. Although direct evidence 373 is lacking, Pol δ is presumed to function on the leading strand in the ΔN-Pol ε genetic 374 background. However, the finding in this report that Pol α functions on the leading strand 375 with CMG while Pol δ–PCNA is suppressed, leaves open the possibility that Pol α could 376 participate as the leading strand polymerase in ΔN-Pol ε mutants. 377 Other aspects of replisome operations emanating from this study. Numerous proteins 378 travel with the replication fork and it is not possible to know a priori how many are needed 379 for functional leading and lagging strand replication. This is the first study to reconstitute 380 leading/lagging strand replication with three pure polymerases in a eukaryotic system. It 381 reveals that many of the proteins that move with forks are not required to recapitulate 382 leading/lagging strand synthesis in vitro. For example, Ctf4/AND-1 is essential in most cells 383 (not in budding yeast), and yeast Ctf4 helps recruit Pol α bind to RPCs (Gambus, van Deursen 384 et al. 2009), yet the current study shows that Pol α functionally interacts with CMG without 385 Ctf4. Hence, the complete role of Ctf4 remains unknown. Likewise, the essential Mcm10 386 protein is known to bind Pol α (Warren, Huang et al. 2009), but this study shows that Mcm10 387 is not required for fork function in vitro. The same can be said for a myriad of proteins that 388 form the RPC complex, including Mrc1, Csm3, Tof1, Topo I, Mcm10, Ctf4 and FACT complex 389 (Gambus, Jones et al. 2006; Gambus, van Deursen et al. 2009). It is important to note however, 390 that in vitro fork progression is 4-5 ntds/s, 5-10 times slower than in vivo measurements, and 391 thus one or more of these proteins may be required to increase the rate of fork movement. 392 The current report also reveals that Pol α can prime the leading strand directly. To our 393 knowledge, before this report all proposed models of leading strand initiation in bacteria and 394 SV40 show priming on the lagging strand of a bidirectional origin, which becomes the leading 395 strand of one fork, rather than directly priming the leading strands (Waga and Stillman 1998; 396 Mendez and Stillman 2003; Kaguni 2011). We show here that this is not necessary. Pol α is 397 robust in initiating the leading strand directly and targets CMG to do so. 398 Cellular studies indicate that nucleosomes are involved in determining Okazaki fragment 399 size (Smith and Whitehouse 2012), but data in this report show that short Okazaki fragments

13 400 of the size observed in vivo do not require nucleosomes. However, nucleosomes may still be 401 needed for greater precision in Okazaki fragment length. We also demonstrate that 402 Pol ε forms a stable and isolable complex with CMG, which stands in contrast to the inability 403 to isolate Pol ε in RPCs as defined by a complex that stays associated during two successive 404 affinity columns (Gambus, Jones et al. 2006). Presumably, the time involved in preparing RPC 405 through two columns is sufficiently long for the CMGE complex to dissociate. However, some 406 Pol ε can be recovered when isolated in a one-step single step pull down with epitope tagged 407 CMG from cell extracts (Sengupta, van Deursen et al. 2013). 408 Reconstitution of cellular replisomes in vitro should provide a framework to explore the 409 effects of other proteins that move with forks, and of post-translational modifications that 410 control eukaryotic forks in response to the cell cycle and DNA checkpoint mechanisms. 411 Reconstituted systems should also enable detailed study of factors that maintain the 412 epigenetic state of a cell during replication. 413 414 Materials and Methods 415 Reagents and buffers. Radioactive nucleotides were from Perkin Elmer. Unlabeled 416 nucleotides were from GE Healthcare. DNA modification enzymes and φ29 DNA polymerase 417 were from New England Biolabs. DNA oligonucleotides were from Integrated DNA 418 Technologies. Protein concentrations were determined using the Bio-Rad Bradford Protein 419 stain and bovine serum albumin as a standard. Buffer A is 20mM Tris-HCl, pH 7.5, 5 mM DTT, 420 0.1 mM EDTA, 4 % glycerol. Buffer B is the same as buffer A except 20 mM Tris-acetate, pH 7.5 421 was used in place of 20 nM Tris-HCl. Buffer C is 25 mM Tris-Cl pH 7.9, 10% glycerol, 1 mM

422 DTT, 1 mM MgCl2, 5 mM imidazole, 20 mM KOAc and 350 mM KCl. Buffer D is 25 mM Tris-OAc

423 pH 7.6, 40 mM K-OAc, 40 mM K glutamate, 2 mM Mg-OAc2, 1 mM DTT, 20% glycerol and 0.25 424 mM EDTA. Stop buffer is 1% SDS, 40 mm EDTA. Buffer H is 20 mM Hepes pH 7.5, 10% glycerol,

425 1 mM EDTA, 2 mM DTT, 350 mM KCl, 1 mM ATP and 4 mM MgCl2. 426 Proteins. Proteins were purified as described RPA (Henricksen, Umbricht et al. 1994), E. coli 427 SSB (Georgescu, Kurth et al. 2011), PCNA (Yao, Coryell et al. 2003), RFC containing full-length 428 RFC1 (Finkelstein, Antony et al. 2003). Pol ε was expressed in yeast as described (Georgescu, 429 Langston et al. 2014), in which a 3XFLAG tag was placed on the N-terminus of Pol2 in 430 pRS425/GAL and transformed into yeast along with pJL6 expressing encoding Dpb2, 431 Dpb3, and Dpb4 (Chilkova, Jonsson et al. 2003). All buffers were degassed before use to

14 432 prevent oxidation of Fe-S centers. Pol δ was expressed and purified as described(Georgescu, 433 Langston et al. 2014). CMG was purified as described (Georgescu, Langston et al. 2014). Ctf4 434 with a N-terminal 3X FLAG tag was expressed from a Gal1/10 promoter and purified from 435 yeast using an anti-FLAG column, similar to methods described for Pol ε (Georgescu, Langston 436 et al. 2014). Pol α was prepared by integrating the gene encoding Pol α with a C-terminal 437 3XFLAG tag into the yeast pRS402 vector under control of the Gal1/10 promoter, then 438 integrated into strain OYO1 (ade2-1 ura3-1 his3-11,15 trp1-1 leu2-3,112 can1-100 bar1Δ MATa, 439 pep4::KANMX6), a strain constructed from W303 (a gift from Alan Tackett and Brian Chait, 440 Rockefeller University) (Georgescu, Langston et al. 2014). The Pol12, Pri1 and Pri2 subunits 441 were cloned into E. coli vectors pRSFDuet, pCDFDuet and pACYCDuet/RIL, respectively 442 (Novagen Inc). Pol12 was transformed into E. coli BL21(DE3)codon plus RIL (Agilent), then 443 induced with IPTG for 8h at 15oC. Pri1 and Pri2 were co-expressed in E. coli BL21(DE3) cells 444 by IPTG induction for 8 h at 15oC. A 12L culture of induced yeast cells for Pol1 and 1 L of each 445 induced E. coli cultures for Pol12 and Pri1 and Pri2 were co-crushed in a cryogenic mill as 446 described for CMG (Georgescu, Langston et al. 2014). Frozen crushed cells were thawed at 447 12oC and the re-suspended with 20 ml of 250mM Hepes pH 7.4, 1.25 M potassium glutamate, 448 5 mM EDTA. The lysate was spun at 42,000 X g for 1 h at 4oC. Anti-Flag agarose (1.2 ml) was 449 added to the supernatant (80 ml) and incubated with slow rotation for 1.5 hour at 12oC. Beads 450 were collected by centrifugation at 1,500 X g, washed twice with 5 ml 50 mM Hepes pH 7.4, 451 250 mM potassium glutamate, 1 mM EDTA, then loaded into a gravity column. The column 452 was washed with 15 ml 50 mM Hepes pH 7.4, 250 mM potassium glutamate, 1 mM EDTA, 10% 453 glycerol and Pol α was eluted with 5 ml 50 mM Hepes pH 7.4, 250 mM potassium glutamate, 1 454 mM EDTA, 10% glycerol containing 20 μg/ml Flag peptide. The eluent was diluted to a 455 conductivity equal to 150 mM NaCl using 25 mM Hepes pH 7.4, 1mM EDTA and 10% glycerol, 456 then applied to a 1 ml Heparin agarose column. Pol α was eluted with a gradient of 100 mM to 457 1M NaCl in 25 mM Hepes pH 7.4, 1mM EDTA, 10% glycerol. Peak fractions were pooled, 458 aliquoted and stored at -80oC. Typical yield of Pol α was about 3 mg. 459 Linear forked DNA substrate. To make the linear fork DNA substrate, a 3.2 kb sequence of 460 DNA was designed such that one strand lacked dC residues and thus the other strand lacked 461 dG. The G rich strand was examined to eliminate runs of four G residues. The resulting 3260 462 bp sequence was synthesized by Biomatik (Wilmington, Delaware). The first 4 and last two 463 bases represent overhangs generated by BsaI and BtsC1, respectively. Both of these enzymes

15 464 cut outside of their recognition sequences, and their recognition sequences are excluded from 465 the template. 466 CGGTATTCTAACCACATTAATCTACACCTCTCACACACTACTCATATCATCTTCCAAAACCCACCTT 467 TAAAAAACCCTTTATCCACACTCATCACCATTTCACCAACCTTTTTCTTAATTCTACACAAATCCAA 468 TTAACCTATCTCCAATTTTAACTCCATCACCTCTTATATTAACCCACCTACTACTCCAACAATACCC 469 TATCAAATCTACTTCTATCTCAAAACTATCACCTACTCCTTCCATCATAATCCACTCTTATCAATTA 470 AACAATTATCCTTCTTTCCCACCATCACTCACCATCTTTTCTTAACACCCTTAACATTTCCTTTTAT 471 AAAACACTTCCAATCCTATTTTCTCACTATCCCACCCACCATAAAAACTATCTCACCCTAACTCAAC 472 CCTTTCCCTCTCACCAACACTCCTTTATCACACACACTTTACCACACAAATCCCTCCATCATACACC 473 TTTACCCTCAAATCCTAAACCACCTAACTATTCCACACAATATATCTACAAAAATTTACTTTTCCAC 474 ATCTCCAACCCTTCCAACACCTTAATCCCAAACCTTAACTAACCTCTCTTTAATACTTCCTCCCATT 475 CCCACCACATACACCAAATTATCTTCAACTCAAAAACCTAAACTCTCCTTTTTATTCCCTATAAAAA 476 CTCTTAACCCTCCAATATACAACTCTAACTAACTTCATTATCAACCAATCTTCCTCTACTTCCTCAT 477 CTTATAATTTATCCATTCAAAATAACCTACCTACCACCTCTCCTCTTCACTTCCTACCCTAAAATCA 478 CCACCTTATCCCTAATTTACCTCTTTCAACTTTCCTTAACCCAACTTCTCAATCCTACTTCACTTAC 479 TTCTTATAAAACCATCATTATCACACTACACATTACTCTATCTATCCAATCATCACCTTCTACAATC 480 CAAACTATCCCACTACCCTCTCATTCTACCTTTTCATCTATCTCAAACTATCCACCAATCCATACCT 481 CAAACTTTAACCACCCACTCCAAATCTACAACATAAAATTAACCTATCACATTCCAAACTAATCACC 482 CTAACCCTAACACCCTTTTATCCTCACCAAAATTACCATTTTCCTCTTTACTCATAAACAAACATTC 483 TCACCCATTTATAAAACACTTAATACCCACTTAATTCACTTCCTTTTTCTACCTCACCATCATCAAC 484 TCCTAATATCAACAACCCAAAATCACCACCTATATCCTCATCTCCTATATAAAAAACTTCACATCTC 485 AACCTCAAACCACCTATTCCACTTAATCCCAATCAACCTATCAACTCTACAACCTACTCTTCAAATA 486 CATCTCCTATCACTTTCCCACCTCCTTCAATCAATTATAACTTTATCACCTAAACATTCTAAAATCT 487 CCTATCCACTACATCACATAAACCTAAACCTACTACCAACCTACCATTATCCTTATCAAACATCATC 488 AATTCCATCTTTCTTTATACCCTCTCCATATCTCTCTCATTAAAAAAACCAAAATCTAACAACTTCT 489 TATTTCTAATCAAAAAAACAATCAACCTAACTCATAAAATCTTCACCTTAAAATTCCTTTACATTTA 490 ACAAATCCACTCTCCCTATCTTTTTCATATCAAACTTATCTAAACCACTATCCTCATTTATCCTAAT 491 ACTCCATATACAACACCAAATTTCTTATATCTCATCTAAAATCCTCCACCAATATAAACTCCTCTTT 492 ACCATTTCCACTCAACACACCAAATCTTATTATTCCATCAAATCTAATCCATTACCATCATCAACCC 493 TAATAAACCTACTTCCCAACTTTTATCTCTCCACTACCACACCAAAAATTAACCTCCTCTAAAAACT 494 ATCATTCCCTTTACCTCTTCCACATTCCACCTATAACTCCTCATCTTAAAACCAATCAACACCAAAC 495 AACTATCTCACCATATTTCCTCTCCAAACCAACAAATTAACAATCCTACCCACTCCAACCTCCACAT 496 TACTAATAACTAAACTTACCTTACCTACCACACCCTATCAACCATATTTAAAAAATTACTTATTCAC 497 TAACTAAAACATCACCCACAAACTTAAATCATCACCTCCTCTTTTCCACCTTATTCACCAACCCAAT 498 CTATCTATCTCACCTATACCTTTCCCTAATATCTTTTACTAACCCTATAAATACCACAATTCTAAAA 499 AACCCATACTTATCTCACACATCACTTTATACTTCACTCTTAAAATACCCTCCAATATATATTACAA 500 CCCAAAAATATCTCCCTTCTATCTCCTACACACAAATTATACCACTTTTAAACCACTCCTCATCTCT

16 501 AACCCAACCCTCTACAATTCCATACATCTCTACTATCAACATCACTCCTTCTTTTCCACTCTTCTCT 502 CCACATCTTTATTAAACATCTCCTCCTCATTTTCACATAACTATTTACTAAATAAATTTACCTAAAC 503 TACATTTATTAAAACCCTACAACATACTCCTTATTCTCCTACCTACCATTCTCTAATCTCTTTACAT 504 TCTACTACTTTCCTACCTACTATCTCAATAAATTCACTTTCCTTTCACCACACACCAACACACCTTC 505 CTCCAAATTCTTTATATCTCCTTCTCCTAACCAAATTCCTCACTAATAACATCTTACCTCCCTACCT 506 TTTTCCTTCTACCCTCCACCATTTCCCAACCTCATACTCAATAATCAATTTACCCTCCCACAACATA 507 ACTCTATTAACACCCATTTTCTATCCATCAACTTCCTATTACTTAAATTATCTTTTAAACCAATAAA 508 ACTCCACCTCAACCACCCACCTCTCTCTTTCAATCCAATTTCAATCTTTCCAACCATTCTATCTACC 509 CTAAACTATTAACTATCTATCTCACCCACAATCCCTCCTACAATTCACAACAACATTCCACCACTTC 510 ACTTTATCTTCACCTCCAAACTTATTCCTTCCCATTATCACCTTCTCCAAAACCCACAAACATCTAA 511 CTCTCATCTCTCAACACTTTCTACCCATTCTCTCTAACAAAATTCCCTTACTCTTTATTCACAAAAC 512 CACTAAAATCACCACAACAACCCAACAAAAACAAAATCCTCACTTACCTATACTCAATAAATCCTTC 513 AACTCATTATTCTATTTCTAACCCTAAATCAAAACTCCCATATCTACCATTCTTTCCACTCAATTAA 514 ATCCCACCAACCCTTATTTTCCTCCAATAACTTAACC 515 The synthetic 3.2 kb DNA was cut from the plasmid using BsaI-HF and BtsCI and 516 purified from low melting agarose gel. 35 pmol of the 3.2 kb linear DNA template was ligated 517 to a 5-fold excess of forked junction on the BsaI end and to a 10-fold molar excess of a short 518 blocking duplex on the BtsCI end. To make the forked junction 1050 pmol 1T oligonucleotide 519 was annealed to 175 pmol 160mer oligonucleotide, as described (Georgescu, Langston et al. 520 2014). The 160mer is the leading stand template and contains a 3’ biotin and three 3’ terminal 521 thiophosphate linkages, to protect against nucleases. The synthetic fork contains a 5’- 522 phosphorylated-ACCG overhang in the duplex region that ligates to the BsaI end of the 3.2 kb 523 nucleotide biased duplex. To protect the BtsCI end of the 3.2 kb duplex from excision and fill- 524 in by the proofreading of Pols δ and ε, a short protecting duplex was ligated to 525 the BtsCI end of the forked junction. The blocking duplex was formed upon annealing 350 526 pmol 5’-tggttagtatagcaagtagagg-3’ and 2100 pmol 527 tctacttgctatactaaccat3’-‘3-dT. After ligation, this results in a 3.2 kb duplex with 528 two 5’ terminal nucleotides at one end, to resist digestion by 3’-5’ exonuclease inherent in the 529 DNA polymerases. Both the blocking duplex and the synthetic forked junction were present in 530 the ligation reaction. Ligation was for 18 hours at 15ºC with T4 DNA . Excess non- 531 ligated oligonucleotides were removed by gel filtration over a 20 ml bed volume of Sepharose 532 4B (GE Healthcare) equilibrated in 10 mM Tris-acetate pH 7.5, 1 mM EDTA and 100 mM 533 sodium acetate, pH 7.44. Peak fractions containing the nucleotide-biased linear forked DNA 534 were pooled and stored at -20°C. When the substrate was primed, a DNA oligonucleotide was

17 535 annealed to the leading strand template, DNA 37mer (C2) as described (Georgescu, Langston 536 et al. 2014). 537 Leading/lagging strand replication assays: Replication assays contained 1.5 nM linear 538 forked DNA, 24 nM CMG, 400 nM RPA (unless noted otherwise), 20 nM PCNA (unless noted 539 otherwise), 6 nM RFC (unless noted otherwise), and Pol α, Pol ε and Pol δ as indicated in the 540 figure legends, in 25 mM Tris-acetate pH 7.5, 10 mM Mg-acetate, 50 mM potassium glutamate, 541 5 mM DTT, 0.1 mM EDTA, 40 μg/ml BSA, 0.1 mM AMP–PNP, 5mM ATP, 200 μM each rCTP, 542 rUTP, rGTP, 60 μM of each unlabeled dNTP and 20 μM of the labeled dNTP. Reactions were 543 staged as follows. CMG was added first and preincubated with the DNA and 0.1 mM AMP-PNP 544 for 10 min at 30 oC, then the noted polymerases together with the RFC and PCNA (where 545 indicated) were added, along with dATP, dCTP for an additional 2 min. Replication was then 546 initiated upon the addition of a solution containing the RPA, ATP, dTTP and dGTP. It is 547 important to note that for leading strand replication reactions we used 20 μΜ dCTP and 10 548 μCi 32P-dCTP while for lagging-strand replications we used 20 μM dGTP and 10 μCi 32P-dGTP. 549 Exceptions to this protocol are noted in the figure legends. Timed aliquots were removed and 550 quenched upon adding SDS and EDTA to final concentrations of 0.5% and 20 mM, respectively. 551 Quenched reactions were analyzed in 0.7% or 2% alkaline agarose gels and imaged in a 552 Typhoon 9400 PhosphorImager (GE/Molecular Dynamics). 553 In order to compare total DNA synthesis rates on leading and lagging strand, we performed 554 standard replication reactions containing all three DNA polymerases at 10 nM, CMG (30 nM), 555 RFC (10 nM), PCNA (20 nM) and RPA (400nM) in presence of 1 mM ATP, rNTPs (C,G,U at 100 556 μM) and 30 μM dNTPs; reactions were divided and either 32P-dCTP (leading) or 32P-dGTP 557 (lagging) were added. Timed reactions were stopped with an equal volume of 2x STOP 558 solution (40 mM EDTA and 1% SDS) and spotted on DE81 filter papers, then analyzed using a 559 Perkin Elmer Liquid Scintillation Analyzer (Perkin Elmer, Tri-Carb 2910 TR). Separately, we 560 performed control replication reactions using φX174 ssDNA coated with RPA, containing a 561 known amount of Gs and Cs, confirm that 32P-dCTP and 32P-dGTP are equally incorporated by 562 each of the DNA polymerases in our experimental conditions. 563 Restriction enzyme analysis of Okazaki fragment distribution: Three replication 564 reactions were performed as described above with the following differences. The first 565 reaction used 1.5 nM unprimed forked DNA and 10 nM Pol α with 20 μM dGTP as well as 10

18 566 μCi 32P-dGTP to label the lagging strand; the second reaction utilized 1.5 nM unprimed forked 567 DNA and 10 nM each Pol ε and Pol α along with 20 μM dGTP and 10 μCi 32P-dGTP to label the 568 lagging strand, and the third reaction contained DNA primed forked DNA and 1U of φ29 DNA 569 polymerase along with 20 μM dCTP and 10 μCi 32P-dCTP to label the leading strand. Each 570 reaction was quenched upon heating to 65oC for 10 min to inactivate the CMG and 571 polymerases. Then reactions were divided into three tubes, one was untreated, the second 572 was treated with EarI and the third was treated with PsiI adjusting the reaction buffer for 573 each enzyme with the commercial provided buffer. Reactions were analyzed in a 2% native 574 agarose gel followed by autoradiography in a Typhoon 9400 PhosphorImager (GE/Molecular 575 Dynamics). 576 Primed ssDNA reactions. Reactions contained 1.5 nM φX174 circular ssDNA (as circles) 577 primed with a DNA 30-mer, and preincubated for 10 min with 420 nM RPA (as heterotrimer) 578 in 20 mM Tris-Cl (pH 7.5), 50 mM potassium glutamate, 5 mM DTT, 0.1 mM EDTA, 40 μg/ml 579 BSA, 8 mM MgOAc, 0.5 mm ATP, 5% glycerol, and 60 μM each of dGTP and dATP. Reactions 580 also contained the indicated amounts of RFC, PCNA, and Pol α and were preincubated for 5 581 min at 30oC. DNA synthesis was initiated by adding 15 μl of 60 μM dCTP, 20 μM dTTP, 15 μCi 582 of [α-32P]dTTP and incubated at 30°C. At the times indicated, 25-μl aliquots were removed 583 and quenched by addition of an equal volume of 1% SDS/40 mm EDTA. Products were 584 analyzed in 0.7% alkaline agarose gels. Gels were dried, exposed to PhosphorImager screens, 585 and imaged using a Typhoon 9400 PhosphorImager (GE/Molecular Dynamics). 586 Bead-based protein complex analysis: Proteins were premixed in the following amounts: 587 80 pmol Streptag-Pol ε, 120pmol CMG, and when present, 200 pmol Ctf4 (as trimer). Proteins 588 were brought to a final volume of 200 μl in 100 mM sodium phosphate, 150 mM NaCl pH 8.0 589 and incubated with 50 μl (as a 10% slurry) Strep-Tactin magnetic beads (Quigen) for 1 h at 590 4oC with end-over-end mixing. Beads were collected in a magnetic separator and washed 591 twice in 200 μl 100 mM sodium phosphate, 150 mM NaCl pH 8.0, then eluted in 75 μl 10 mM 592 biotin in 100 mM sodium phosphate, 150 mM NaCl pH 8.0 for 20 min on ice. Samples were 593 analyzed in 8% SDS PAGE followed by staining with Coomassie Blue Denville stain. 594 595 ACKNOWLEDGMENTS 596 The authors are grateful for support from the NIH (GM38839) and HHMI.

19 597 598 AUTHOR CONTRIBUTIONS 599 REG and MOD conceived the project and designed the experiments. REG, GDS and NYY 600 executed the experiments and analyzed the results together with MOD. DZ performed 601 purifications of CMG. JF made plasmid constructs for Pol α and Pol δ expression and designed 602 and constructed the 3.2 kb nucleotide biased DNA. OY made the yeast integration strains for 603 Pol α and Pol δ and purified them. LDL made earlier contributions leading to this project, and 604 editorial comments to the text. MOD and REG wrote the manuscript. 605 606 COMPETING FINANCIAL INTERESTS 607 The authors declare no competing financial interests. 608 609 REFERENCES 610 611 Benkovic, S. J., A. M. Valentine, et al. (2001). "Replisome-mediated DNA replication." Annu Rev 612 Biochem 70: 181-208. 613 Blanco, L., A. Bernad, et al. (1989). "Highly efficient DNA synthesis by the phage phi 29 DNA 614 polymerase. Symmetrical mode of DNA replication." J Biol Chem 264(15): 8935-40. 615 Chilkova, O., P. Stenlund, et al. (2007). " The eukaryotic leading and lagging strand DNA 616 polymerases are loaded onto primer-ends via separate mechanisms but have 617 comparable processivity in the presence of PCNA.." Res. 35 (19): 6588-97. 618 Costa, A., I. Ilves, et al. (2011). "The structural basis for MCM2-7 helicase activation by GINS 619 and Cdc45." Nat Struct Mol Biol 18(4): 471-7. doi: 10.1038/nsmb.2004. 620 Costa, A., L. Renault, et al. (2014). "DNA binding polarity, dimerization, and ATPase ring 621 remodeling in the CMG helicase of the eukaryotic replisome." Elife: e03273. doi: 622 10.7554/eLife.03273. 623 Dua, R., D. L. Levy, et al. (1999). "Analysis of the essential functions of the C-terminal 624 protein/protein interaction domain of Saccharomyces cerevisiae pol epsilon and its 625 unexpected ability to support growth in the absence of the DNA polymerase domain." J 626 Biol Chem 274(32): 22283-8.

20 627 Finkelstein, J., E. Antony, et al. (2003). "Overproduction and analysis of eukaryotic 628 multiprotein complexes in using a dual-vector strategy." Anal Biochem 629 319(1): 78-87. 630 Gambus, A., R. C. Jones, et al. (2006). "GINS maintains association of Cdc45 with MCM in 631 replisome progression complexes at eukaryotic DNA replication forks." Nat Cell Biol 632 8(4): 358-66. 633 Gambus, A., F. van Deursen, et al. (2009). "A key role for Ctf4 in coupling the MCM2-7 helicase 634 to DNA polymerase alpha within the eukaryotic replisome." EMBO J 28(19): 2992- 635 3004. doi: 10.1038/emboj.2009.226. 636 Garg, P. and P. M. Burgers (2005). "DNA polymerases that propagate the eukaryotic DNA 637 replication fork." Crit Rev Biochem Mol Biol 40(2): 115-28. 638 Georgescu, R. E., I. Kurth, et al. (2011). "Single-molecule studies reveal the function of a third 639 polymerase in the replisome." Nat Struct Mol Biol 19(1): 113-6. doi: 640 10.1038/nsmb.2179. 641 Georgescu, R. E., L. D. Langston, et al. (2014). "Mechanism of Asymmetric Polymerase 642 Assembly at the Eukaryotic Replication Fork." Nat Struct Mol Biol 8 : 664-70. doi: 643 10.1038/nsmb.2851. 644 Ghaemmaghami, S., W. K. Huh, et al. (2003). "Global analysis of protein expression in yeast." 645 Nature 425(6959): 737-41. 646 Griep, M. A. and C. S. McHenry (1989). "Glutamate overcomes the salt inhibition of DNA 647 polymerase III holoenzyme." J Biol Chem 264(19): 11294-301. 648 Hacker, K. J. and B. M. Alberts (1994). "The rapid dissociation of the T4 DNA polymerase 649 holoenzyme when stopped by a DNA hairpin helix. A model for polymerase release 650 following the termination of each Okazaki fragment." J Biol Chem 269(39): 24221-8. 651 Henricksen, L. A., C. B. Umbricht, et al. (1994). "Recombinant : expression, 652 complex formation, and functional characterization." J Biol Chem 269(15): 11121-32. 653 Hogg, M., P. Osterman, et al. (2014). "Structural basis for processive DNA synthesis by yeast 654 DNA polymerase varepsilon." Nat Struct Mol Biol 21(1): 49-55. doi: 655 10.1038/nsmb.2712. 656 Ilves, I., T. Petojevic, et al. (2010). "Activation of the MCM2-7 helicase by association with 657 Cdc45 and GINS proteins." Mol Cell 37(2): 247-58. doi: 10.1016/j.molcel.2009.12.030.

21 658 Kaguni, J. M. (2011). "Replication initiation at the Escherichia coli chromosomal origin." Curr 659 Opin Chem Biol 15(5): 606-13. 660 Kaguni, L. S. and I. R. Lehman (1988). "Eukaryotic DNA polymerase-primase: structure, 661 mechanism and function." Biochim Biophys Acta 950(2): 87-101. 662 Kesti, T., K. Flick, et al. (1999). "DNA polymerase epsilon catalytic domains are dispensable for 663 DNA replication, DNA repair, and cell viability." Mol Cell 3(5): 679-85. 664 Kulak, N. A., G. Pichler, et al. "Minimal, encapsulated proteomic-sample processing applied to 665 copy-number estimation in eukaryotic cells." Nat Methods 11(3): 319-24. doi: 666 10.1038/nmeth.2834. 667 Kunkel, T. A. and P. M. Burgers (2008). "Dividing the workload at a eukaryotic replication 668 fork." Trends Cell Biol 18(11): 521-7. doi: 10.1016/j.tcb.2008.08.005. 669 Kurth, I., Georgescu, R.E and M. E. O'Donnell (2013). "A solution to release twisted DNA during 670 replication by coupled DNA polymerases." Nature 496(7443): 119-22. 671 doi: 10.1038/nature11988. 672 Langston, L. D. and M. O'Donnell (2006). "DNA replication: keep moving and don't mind the 673 gap." Mol Cell 23(2): 155-60. 674 Langston, L. D. and M. O'Donnell (2008). "DNA polymerase delta is highly processive with 675 proliferating cell nuclear antigen and undergoes collision release upon completing 676 DNA." J Biol Chem 283(43): 29522-31. doi: 10.1074/jbc.M804488200. 677 Langston, L. D., D. Zhang, et al. (2014). "CMG helicase and DNA Polymerase ε form a functional 678 15-subunit holoenzyme for eukaryotic leading-strand replication." Proc Natl Acad sci U 679 S A. pii:201418334. 680 Lee, S. H., T. Eki, et al. (1989). "Synthesis of DNA containing the simian virus 40 origin of 681 replication by the combined action of DNA polymerases alpha and delta." Proc Natl 682 Acad Sci U S A 86(19): 7361-5. 683 Mendez, J. and B. Stillman (2003). "Perpetuating the double helix: molecular machines at 684 eukaryotic DNA replication origins." Bioessays 25(12): 1158-67. 685 Mossi, R., R. C. Keller, et al. (2000). "DNA polymerase switching: II. 686 abrogates primer synthesis by DNA polymerase alpha at a critical length." J Mol Biol 687 295(4): 803-14.

22 688 Moyer, S. E., P. W. Lewis, et al. (2006). "Isolation of the Cdc45/Mcm2-7/GINS (CMG) complex, 689 a candidate for the eukaryotic DNA replication fork helicase." Proc Natl Acad Sci U S A 690 103(27): 10236-41. 691 Nick McElhinny, S. A., D. A. Gordenin, et al. (2008). "Division of labor at the eukaryotic 692 replication fork." Mol Cell 30(2): 137-44. 693 O'Donnell, M., L. D. Langston, et al. (2013). Principles and concepts of DNA replication in 694 bacteria, archaea, and eukarya. New York, Cold Spring Harbor Laboratory Press. 695 O'Donnell, M. E. (1987). "Accessory proteins bind a primed template and mediate rapid 696 cycling of DNA polymerase III holoenzyme from Escherichia coli." J Biol Chem 262(34): 697 16558-65. 698 Pursell, Z. F., I. Isoz, et al. (2007). "Yeast DNA polymerase epsilon participates in leading- 699 strand DNA replication." Science 317(5834): 127-30. 700 Richey, B., D. S. Cayley, et al. (1987). "Variability of the intracellular ionic environment of 701 Escherichia coli. Differences between in vitro and in vivo effects of ion concentrations 702 on protein-DNA interactions and gene expression." J Biol Chem 262(15): 7157-64. 703 Sengupta, S., F. van Deursen, et al. (2013). "Dpb2 integrates the leading-strand DNA 704 polymerase into the eukaryotic replisome." Curr Biol 23(7): 543-52. 705 Simon, A. C., J. C. Zhou, et al. (2014). "A Ctf4 trimer couples the CMG helicase to DNA 706 polymerase alpha in the eukaryotic replisome." Nature 510(7504):293-7. doi: 707 10.1038/nature13234. 708 Smith, D. J. and I. Whitehouse (2012). "Intrinsic coupling of lagging-strand synthesis to 709 assembly." Nature 483(7390): 434-8. 710 Stillman, B. (2008). "DNA polymerases at the replication fork in eukaryotes." Mol Cell 30(3): 711 259-60. 712 Studwell, P. S., P. T. Stukenberg, et al. (1989). Replication of the lagging strand by DNA 713 polymerase III holoenzyme. Molecular Mechanisms in DNA Replication and 714 Recombination. C. C. Richardson and I. R. Lehman. New York, Alan R. Liss, Inc. 127: 715 153-164. 716 Stukenberg, P. T., J. Turner, et al. (1994). "An explanation for lagging strand replication: 717 polymerase hopping among DNA sliding clamps." Cell 78(5): 877-87.

23 718 Tahirov, T. H., K. S. Makarova, et al. (2009). "Evolution of DNA polymerases: an inactivated 719 polymerase-exonuclease module in Pol epsilon and a chimeric origin of eukaryotic 720 polymerases from two classes of archaeal ancestors." Biol Direct 4: 11. 721 Tsurimoto, T., T. Melendy, et al. (1990). "Sequential initiation of lagging and leading strand 722 synthesis by two different polymerase complexes at the SV40 DNA replication origin." 723 Nature 346(6284): 534-9. 724 Tsurimoto, T. and B. Stillman (1991). "Replication factors required for SV40 DNA replication 725 in vitro. II. Switching of DNA polymerase alpha and delta during initiation of leading 726 and lagging strand synthesis." J Biol Chem 266(3): 1961-8. 727 Waga, S. and B. Stillman (1998). "The DNA replication fork in eukaryotic cells." Annu Rev 728 Biochem 67: 721-51. 729 Warren, E. M., H. Huang, et al. (2009). "Physical interactions between Mcm10, DNA, and DNA 730 polymerase alpha." J Biol Chem 284(36): 24662-72. 731 Weinberg, D. H. and T. J. Kelly (1989). "Requirement for two DNA polymerases in the 732 replication of simian virus 40 DNA in vitro." Proc Natl Acad Sci U S A 86(24): 9742-6. 733 Wold, M. S. (1997). "Replication protein A: a heterotrimeric, single-stranded DNA-binding 734 protein required for eukaryotic DNA metabolism." Annu Rev Biochem 66: 61-92. 735 Yao, N., L. Coryell, et al. (2003). "Replication factor C clamp loader subunit arrangement within 736 the circular pentamer and its attachment points to proliferating cell nuclear antigen." J 737 Biol Chem 278(50): 50744-53. 738 739 740

24 741 Figures 742 743 Figure 1. Pol α primes and extends leading and lagging strands with CMG helicase. A) 744 Scheme of the nucleotide biased 3.2 Kb fork-substrate used in our experiments, explained 745 further in Materials and Methods. B) Left: Scheme of the assay. CMG is assembled onto the 746 linear 3.2 kb forked DNA in the presence of 0.1 mM AMPPNP, 60 μM dATP, followed by Pol α 747 and RPA along with 5mM ATP, 60 μM dTTP and 60 μM dGTP, 200 μM each rCTP, rUTP, rGTP, 748 20 μM dCTP and 10 μCi 32P-dCTP, as described in Materials and Methods. The nucleotide bias 749 of the forked DNA enables labeling either the leading or lagging strand using 32P-dCTP or 32P- 750 dGTP, respectively. Right: Autoradiograph of leading strand products using unprimed (lanes 751 1-3) or primed (lanes 4-6) forked DNA. C) Left: Autoradiograph of leading strand replication 752 products upon titrating Pol α into 20 min reactions. Right: Scans of the gel lanes of leading 753 strand products; the gel lanes were analyzed by Typhoon laser scanner and the lane profiles 754 were normalized to the corresponding molecular weight at each pixel in order to correct for 755 the fact that longer products incorporate more radiolabel (α32P-dCTP) than shorter products. 756 Replication reactions are plotted at the same scale. Each line trace was fit to a multiple 757 Gaussian function, shown as a thin dashed-line in each scan. The vertical dashed grey lines 758 indicate the average rate of replisome progression at each concentration of Pol α examined. 759 The inset graph plots the average replication rate versus the concentration of Pol α; the 760 maximal rate (Vmax) of 4.5 ± 0.4 ntd/s was obtained by fitting of the data with a Michaelis- 761 Menten-type equation. D) Left: Autoradiograph of lagging strand replication products using 762 the indicated amounts of Pol α in 20 min reactions. Right: Scans of the gel lanes of lagging 763 strand Okazaki fragments showed in Fig. 1d. Gel lanes were analyzed as described in (C). The 764 average Okazaki fragment size obtained from the fit to the data is listed as an inset in the 765 figure for each concentration of Pol α used. Omission reactions pertaining to Fig. 1C,D are 766 shown in Figure 1 – Supplement 1. 767 768 Figure 1 – Supplement 1. SDS-PAGE of purified Pol α. Pol α (2 μg) was analyzed in a 8% 769 SDS polyacrylamide gel stained with Coomassie Brilliant Blue. The left lane, labeled ‘MM’ 770 represents the Broad Molecular Weight markers (Bio-Rad). Subunits, labeled at the right,

25 771 were confirmed by mass spectrometry analysis. The mass spectrometry analysis of the gel 772 bands, and regions between bands, showed no trace of Ctf4 or Mcm10. 773 774 Figure 1 – Supplement 2. Pol α activity on the 3kb forked DNA is dependent on CMG. 775 Alkaline gel of omission-assays for the Pol α, CMG, RPA leading strand replication reactions 776 illustrated in Figure 1B,C. Lanes 1-6 show a time course of the complete replication reactions 777 for the leading (lanes 1-3) and lagging strands (lanes 4-6). Lanes 5 – 10 illustrate leading 778 strand products obtained upon omission of the indicated components at the top of the gel. 779 780 Figure 2. Pol α requires CMG for priming activity during unwinding of forked DNA. a) 781 Scheme of assays comparing Pol α activity using either CMG helicase or the strand displacing 782 φ29 polymerase. b) Autoradiograph of DNA products using either 32P-dCTP (leading) or 32P- 783 dGTP (lagging). Use of a DNA primed leading strand fork (PF) or an unprimed fork (UF) is 784 indicated in the figure. Pol α was present at 10nM and reactions were for 20 min. Lanes 1 and 785 2 represent control reactions of φ29 polymerase alone. 786 787 Figure 3. Okazaki Fragments are produced along the entire DNA. a) Restriction enzyme 788 map of the 3.2 kb substrate for Psi I and Ear I. b) Lagging strand reactions were performed as 789 detailed in Materials and Methods using an unprimed forked DNA, CMG, RPA, and either Pol α 790 (lanes 4-6) or Pol α and Pol ε (lanes 7-9), then were either untreated (lanes 4,7), treated with 791 Psi I (lanes 5, 8) or treated with Ear I (lanes 6,9). A control leading strand reaction using only 792 φ29 Pol is shown in lanes 10-12. Pol α without CMG (lanes 1-3) and φ29 alone (lanes 13-15) 793 gave no lagging strand products. The (*) mark incomplete digestion products. The reaction 794 products were analyzed on a native 2% agarose gel. 795 796 Figure 4. Pol ε switches with Pol α on the leading strand, but is not active on the lagging 797 strand. A) Left: scheme of the assay. Middle: Titration of Pol α into leading strand reactions in 798 the absence of Pol ε (lanes 1-4), or in the presence of 20 nM Pol ε (lanes 5-8). The reactions 799 were 20 min and contained unprimed DNA fork template. Right: Histogram illustrating Total 800 DNA synthesis obtained from Typhoon laser scan analysis in Figure 4 – Supplement 1A (the 801 error bars represent Standard Fit Errors obtained from the Gaussian fit analysis). B) Left:

26 802 scheme of the assay. Titration of RFC-PCNA into a primed leading strand assay containing 10 803 nM Pol α with or without 10 nM Pol ε. Right: RFC-PCNA inhibits Pol α (lanes 1-5) probably by 804 competing for the 3’ terminus as illustrated. When present, Pol ε rapidly extends the leading 805 strand and is not inhibited by RFC-PCNA (lanes 6-10). Replication reactions were performed 806 in the presence of 32P-dCTP for 15 min. Right: Histogram illustrating Total DNA synthesis 807 obtained from Typhoon laser scan analysis in Figure 4 – Supplement 1B (the error bars 808 represent Standard Fit Errors obtained from the Gaussian fit analysis). C) Left: Leading and 809 lagging strand synthesis is monitored in the same reaction plus or minus Pol ε. Each reaction 810 was divided to separately monitor either the leading (32P-dCTP) or lagging (32P-dGTP) strand. 811 Pol ε is absent in the reaction of lanes 1 and 2, and Pol ε is present in the reaction of lanes 3 812 and 4. Right: Histogram illustrating Total DNA synthesis obtained from Typhoon laser scan 813 analysis in Figure 4 – Supplement 1C (the error bars represent Standard Fit Errors obtained 814 from the Gaussian fit analysis). Lane analysis of the autoradiographs from panels A, B and C 815 are shown in Figure 4 – Supplement 1. 816 817 Figure 4 – Supplement 1. Analysis of replication products in Pol α and Pol α−ε titrations 818 illustrated in Figure 4A, 4B and 4C. The autoradiographs shown in Figure 4 were analyzed 819 by Typhoon laser scanner, and the lane profiles were normalized to the corresponding 820 molecular weight at each pixel, as previously described (Kurth et al. 2013). This corrects for 821 the fact that longer products incorporate more radiolabel (α32P-dCTP or α32P-dGTP) than 822 shorter products. Each line trace was fit to a single or multiple Gaussian functions, shown as a 823 thin dashed-line in each scan. For ease of understanding, each of the panels A, B and C 824 correspond to the autoradiographs displayed in Figure 4A, 4B and 4C, respectively (a cutout 825 of the gels in Figure 4 are inserted, for ease of identification). 826 827 Figure 4 – Supplement 2. Pol ε excludes Pol α from the leading strand by taking over the 828 primer whether RFC and PCNA are present or not. A) Autoradiogram of CMG mediated Pol 829 α extension of the leading strand on the unprimed 3.2 kb forked DNA, in the presence or 830 absence of Pol ε, as indicated in the figure. Reactions were performed for the indicated times 831 and otherwise performed as described in Materials and Methods. The gel lanes were analyzed 832 by Typhoon laser scanner (as in Figures 1, 4) and the plot on the right side quantitates the

27 833 progression of DNA product length at the times indicated in the gel. The numbers in the plots 834 represent the rate of the Pol α (blue) or Pol α−ε (red) obtained from the linear fit of the data 835 points. B) Autoradiogram of reactions performed as described in panel A, except 20 nM each 836 of RFC and PCNA were present in all reactions. The plot on the right quantitates the data as 837 described for panel A. 838 839 Figure 4 – Supplement 3. CMG and Pol ε form a stable CMGE complex. A) Scheme of the 840 bead assay to detect protein interactions. CMG-Pol ε complex was bound to Strep-Tactin 841 magnetic beads via a strep-Pol ε, then washed and eluted with biotin; products were analyzed 842 by 8% SDS-PAGE. Mixtures of proteins were as described in Materials and Methods, and 843 included 80 pmol strep-Pol ε and 120 pmol CMG. B) SDS-Coomassie blue stained PAGE of 844 eluted protein complexes. The left lane, labeled ‘BMW markers’ represent the Broad Molecular 845 Weight markers (Bio-Rad); lanes 1 and 2 show the protein preps used in the analysis. The 846 location of each subunit is indicated. Cdc45 and Dpb2 co-migrate. The ‘ * ’ marks an impurity 847 present in the strep-Pol ε prep. Lane 3 illustrates the biotin elution of the CMGE complex. 848 Lane 4 represents the negative control in which the same amounts of CMG was mixed, in the 849 absence of strep-Pol ε, then incubated with the beads, washed and eluted with biotin. The 850 clear spaces between the last two lanes indicate these two lanes were taken from the same gel, 851 but were not adjacent to one another. Lanes 5 and 6 are a higher contrast of the lanes 3 and 4, 852 to more clearly show the Sld5 and Psf1 subunits. 853 854 Figure 5. Pol δ functions on the “Pol ε suppressed” lagging strand. A) Titration of Pol ε 855 into lagging strand reactions containing Pol α/CMG results in inhibition of the lagging strand 856 in the absence of RFC-PCNA. Similar reactions containing RFC-PCNA give even more inhibition 857 on the lagging strand (Supplementary Figure 3). Reactions were for 20 min. B) Pol δ is 858 titrated into lagging strand reactions containing Pol α, Pol ε, RFC-PCNA and CMG under 859 conditions in which Pol ε and RFC-PCNA inhibit lagging strand synthesis. Lagging strand 860 reactions (32P-dGTP) contain 10nM each Pol α and Pol ε (lanes 1-4), or 20 nM each Pol α and 861 Pol ε (lanes 5-8); RFC–PCNA are at 20 nM each. CMG concentration was 24 nM in all reactions. 862 Lanes 9 and 10 are controls with no CMG, but contain 20nM each of Pol α, Pol ε, RFC, PCNA 863 and either no Pol δ (lane 9) or 20 nM Pol δ (lane 10). Reactions were for 20 min. The plots on

28 864 the right of panels A and B represent quantifications of lagging strand replication reactions 865 (using α−32P-dGTP) as described in the legend of Figure 4. 866 867 Figure 5 – Supplement 1. Pol ε and RFC/PCNA inhibit Pol α DNA polymerase on the 868 lagging strand; but Pol ε cannot extend primed sites with or without RFC/PCNA. A) 869 Autoradiograph of lagging strand replication reactions using α32P-dGTP. CMG is pre- 870 incubated and loaded on unprimed forked DNA, as described in Methods, then either 10 nM 871 Pol α (lane 1), 10 nM each Pol α and Pol ε (lane 2) or only 10 nM Pol ε (lane 3) are added 872 along with RPA, dNTPs and rNTPs; RFC–PCNA are absent. The Pol ε / CMG control shows no 873 product synthesis on the lagging strand, as expected. The analysis of DNA products in lane 1 874 and 2 show a 2.1 fold decrease in total DNA synthesis for the Pol α / Pol ε reaction relative to 875 Pol α alone. Next, RFC–PCNA was titrated into reactions containing 10 nM Pol α with no Pol ε 876 (lanes 4-7), or 10 nM each of Pol α and Pol ε (lanes 8-11). Reactions were 20 min. B) 877 Histogram illustrating Total DNA synthesis obtained from Typhoon laser scan analysis of the 878 autoradiograph in panel A (the error bars represent Standard Fit Errors obtained from the 879 Gaussian fit analysis). 880 881 Figure 5 – Supplement 2. RFC and PCNA inhibit Pol α DNA polymerase activity on ssDNA 882 model templates. Top: Scheme of the assay. Primer extension assays utilized RPA coated 883 singly primed 5.4 kb φX174 ssDNA. RFC-PCNA is titrated into singly primed ssDNA replication 884 assays containing 10 nM Pol α as described in Materials and Methods. Concentrations of RFC, 885 PCNA and reaction times are indicated in the figure. 886 887 Figure 6. Polymerases switch with Pol α on the leading strand. A) Alkaline agarose gel 888 following the time course of leading strand extension using the indicated DNA polymerases. 889 Reactions were assembled on unprimed forked DNA in presence of 24 nM CMG for 10 min 890 before adding 15 nM Pol α (lanes 1-5), 15 nM each Pol α and Pol ε (lanes 6-10), and 15 nM 891 each Pol α and Pol δ (lanes 11-15); all reactions contained 6 nM RFC and 20 nM PCNA. 892 Reactions were initiated upon adding RPA and nucleotides as described in Materials and 893 Methods. The rates of Pol α reactions are high in this experiment because the amount of Pol α 894 used here promotes relatively rapid fork progression as documented in Figure 1 and

29 895 Supplementary Figure 1. Still, the addition of Pol ε gives slightly faster forks due to the 896 intrinsically faster rate of CMG-Pol ε over the rate of the distributive Pol α with CMG. B) 897 Autoradiograph quantification as described in the legend to Figure 4. C) The analysis of DNA 898 products at the end-point reaction (25 min) reveals a 1.8 fold increase in total DNA synthesis 899 for the Pol α / Pol ε reaction relative to Pol α alone (lane 10 versus lane 5); the same 900 comparison of total DNA synthesis in Pol α versus the Pol α / Pol δ reaction reveals a 3.2 fold 901 decrease in total DNA synthesis (lane 15 versus 5). 902 903 Figure 6 – Supplement 1. Pol δ does not inhibit the leading strand replication activity of 904 Pol ε when all three polymerases are present. A) Autoradiographs of leading strand 905 replication reactions using α32P-dCTP (left) or 32P-5’ labeled primed fork (right). CMG is pre- 906 incubated and loaded on DNA, as described in Methods, then the different polymerases are 907 added into the reaction at the specified concentrations along with RFC–PCNA, RPA, dNTPs and 908 rNTPs. There is a slight end-labeling product observed in the 32P-dCTP experiment (20’ 909 control time points) and therefore we repeated these reactions using the 32P-5’ labeled 910 primed fork. At high CMG concentration and in the presence of all three polymerases, there is 911 a very efficient replication of the forked DNA template. a, b and c mark the location of 32P- 912 primers that are not extended, location of 32P-primers extended up to the fork junction, and 913 location of a minority of 32P-primer extension by strand displacement activity of Pol δ in 20 914 min control reactions, respectively. B) Pol ε functions on the “Pol δ suppressed” leading strand. 915 Left: Scheme of the reaction. Right: Pol ε is titrated into leading strand reactions containing Pol 916 α, Pol δ, RFC-PCNA and CMG and under these conditions the Pol δ and RFC-PCNA inhibit 917 leading strand synthesis by Pol α. The leading strand reactions contain 10 nM RFC, 20 nM 918 PCNA and the specified amounts of polymerases and CMG. 919 920 Figure 7. The leading and lagging strands are replicated at similar rates. A) Time course 921 of leading-lagging strand replication reactions with all three polymerases at 10 nM each using 922 either a pre-primed fork (Left panel) or unprimed fork (Right panel). Experiments were 923 performed in triplicate, using either 32Pα-dCTP or 32Pα-dGTP for leading-lagging replication 924 reactions, respectively (for experimental details see Methods Section). The numbers shown 925 represent the rate of incorporation (fmol dNTPs/s) and the SE obtained from the linear fit. (B) 926 Left: Comparative histogram depicting total DNA synthesis at the 20min time point; Right:

30 927 Comparative histogram of the rate of incorporation of leading-lagging strand replication 928 reactions on pre-primed and unprimed forked DNA substrates. 929 930 Figure 8. Exclusion reactions specify polymerase action at the eukaryotic fork. a) Pol α 931 interacts with CMG to prime the leading and lagging strands. Pol α can extend DNA on both 932 strands with CMG in vitro, but it lacks high fidelity and does not replicate bulk DNA in vivo. b) 933 Pol ε can switch with Pol α on both strands, in the presence or absence of RFC/PCNA, but Pol ε 934 is not active on the lagging strand. c) Pol δ/RFC/PCNA can switch with Pol α on both strands, 935 but Pol δ is inactive with CMG on the leading strand. d) Presence of all three polymerases, Pols 936 α, δ and ε, provides active leading/lagging strand synthesis. 937

31