ABSTRACT
SANTOS JR., ANAEL ARAUJO. Poultry Intestinal Health through Diet Formulation and Exogenous Enzyme Supplementation. (Under the direction of Dr. Peter R. Ferket)
Intestinal health has a major influence on growth performance of turkeys and broilers
as it affects feed digestion, nutrient absorption, and mortality. Compromised intestinal health
is associated with animal infectious diseases and enteric foodborne pathogen colonization
that may contaminate poultry products for human consumption. Diet can influence enteric
health and disease. Benefits associated with the presence of non-starch polysaccharides
(NSP) in the diet have been identified, including the potential to change the microflora and
promote intestinal health. Therefore, it was hypothesized that manipulation of dietary NSP content and dietary exogenous enzyme supplementation promotes intestinal health and discourages the colonization of Salmonella spp. in turkey intestine, improving growth performance and reducing the presence of potential pathogenic microorganisms in turkeys.
To test this hypothesis, four experiments were performed.
The first research trial evaluated the effect of three different supplemental enzymes
on intestinal size and histomorphometry of turkeys fed wheat-based diets from 0-56 days.
The three enzyme preparations used included 1) an enzyme blend of endoxylanase along
with β-glucanase, hemicellulase, cellulase and protease; 2) an enzyme with predominantly
endoxylanase activity, and 3) an enzyme with predominantly phospholipase activity. Ileum
digesta viscosity, intestinal size and ileum histomorphometry were determined from 56 days
old turkeys. Experiments 2 and 3 were conducted to study the effects of feed formulation and
dietary enzyme supplementation on intestinal Salmonella spp. colonization and performance
of turkeys. In experiment-2, turkeys raised on litter-covered floor were fed wheat/soybean meal- (SBM) and corn/SBM-based diets with and without xylanase blends (XY1 or XY2, respectively) from 0-126 days. In experiment-3, turkeys raised in battery cages were fed a corn/SBM-control diet, and wheat/SBM- and triticale/SBM-based diets with and without
XY1 from 0-28 d. The XY1 contained a pure endoxylanase, whereas XY2 contained endoxylanase, protease and α-amylase blend preparation. Growth performance and intestinal size were measured in both experiments. Additionally, Salmonella spp. fecal prevalence and intestinal accessory gland weights were determined in experiment-2, and Salmonella enterica cecal population, cecal pH, ileum digesta viscosity, and ileum histomorphometry were measured in experiment-3.
The fourth trial utilized cultivation-independent approach using polymerase chain reaction (PCR) denaturing gradient gel electrophoresis (DGGE) to analyze changes in ileum bacterial population of turkeys fed different diets and after infection with Salmonella spp.
The animals used in this trial were from experiment-2. Microbial DNA was extracted from ileum content of the turkeys at 16 weeks of age, and 16S ribosomal-DNA (rDNA) gene was amplified by PCR and analyzed by DGGE. Diversity indexes, including richness (number of species or DGGE bands), evenness (the relative distribution of species), diversity (using
Shannon’s index that include richness and evenness), and Sorenson’s pairwise similarities coefficient (measures the species in common between different habitats) were measured. Diversity indexes were associated with change of Salmonella colonization of turkey intestine determined in experiment-2.
The first study showed that NSP increased intestinal weight and length, likely as an adaptation response to increased intestinal digesta viscosity, compromised nutrient digestibility, and increased intestinal microbial fermentation. The dietary supplementation of
NSP-hydrolyzing enzyme alleviated the adverse effects of NSP and decreased intestinal size.
In addition, endoxylanase supplementation increased crypt depth and decreased villus height:crypt depth ratio, indicating increased enterocyte turnover rate. Experiments 1 and 3 showed that ileum digesta viscosity increased as the NSP content in the diet increased, but xylanase supplementation decreased viscosity of both triticale- and wheat-based diets, such that the triticale diet was equivalent to the wheat diet; and the wheat diet was equivalent to the corn diet. Experiments 1 and 2 demonstrated that the blend of enzymes provided better response on growth performance and intestinal health of turkeys than single enzyme preparations, presumably due to the synergistic activity among the different enzymes. In experiments 2 and 3, Salmonella colonization in turkey intestine was discouraged by the diets high in NSP content (wheat- and triticale-based diets) and NSP-enzyme supplementation, consequently enhancing growth performance. In the fourth study, diets with high levels of
NSP from wheat increased microbial community diversity indexes, especially when the diets were supplemented with dietary exogenous enzyme preparations. Increased microbial diversity appeared to support a stable, resident flora that discouraged Salmonella colonization in turkey intestine. In contrast, turkeys fed the corn-based diets had lower intestinal microbial diversity indexes which was associated with a decreased level of competitive exclusion
against Salmonella colonization.
In conclusion, dietary NSP positively interacted with both the mucosa and the
microflora, demonstrating that it played an important role in maintenance of health, anatomy,
development, and function of the intestine. A more stable and healthy intestinal ecosystem
discourages the colonization of unfavorable microbial communities, leading to improved
growth performance and animal welfare. The data presented in this dissertation supports the following hypothesis: dietary exogenous enzyme supplementation and NSP promotes intestinal health and discourages the colonization of Salmonella spp. in turkey intestine,
thereby, improving growth performance and reducing the presence of potential pathogenic
microorganisms in turkeys.
POULTRY INTESTINAL HEALTH THROUGH DIET FORMULATION AND
EXOGENOUS ENZYME SUPPLEMENTATION
by
ANAEL ARAUJO SANTOS JUNIOR
A dissertation submitted to the Graduate Faculty of North Carolina State University in partial fulfillment of the requirements for the degree of Doctor of Philosophy
NUTRITION
Raleigh
2005
APPROVED BY:
ii
DEDICATION
To
God and my family
iii
BIOGRAPHY
Anael Araujo Santos Jr. was born on November 17, 1975 in Belo-Horizonte, MG,
Brazil. In 1979, Anael and his family moved to Uberlandia, MG, Brazil, where he
received his elementary, secondary, and high school education. In 1993, Anael
participated in the Youth for Understanding International Exchange Program at
Bismarck, Missouri, USA, where he completed his senior year at Bismarck High School and graduated. After returning to Brazil in 1995, Anael began his undergraduate studies
at the Federal University of Uberlandia (Universidade Federal de Uberlandia) with a
major in Veterinary Medicine. During the fall of 1999, he worked as an international
scholar at the Department of Poultry Science at North Carolina State University, Raleigh,
NC.
After receiving his Bachelor of Science degree in December 1999, Anael enrolled
at North Carolina State University in August of 2000 to study Poultry Science with a
concentration in Nutrition under the direction of Dr. P. R. Ferket, and he completed his
Masters Degree in December 2002. Anael continued at North Carolina State University
to earn his Doctor of Philosophy Degree with a concentration in Nutrition and
Biotechnology starting in January 2003.
The author is married to Fernanda Santos. They have a daughter Amanda Santos
and they are expecting their first son at the time when this dissertation was submitted.
iv
ACKNOWLEDGMENTS
I would like to express my sincerest gratitude to my advisor, Dr. Peter R. Ferket, who truly exemplifies a mentor. Appreciation is also extended to the rest of my graduate committee members, Dr. B. W. Sheldon, Dr. J. L. Grimes, and Dr. F. W. Edens for their scientific collaboration, advice and counsel throughout my Ph.D. study and professional development.
I am thankful to Mrs. Annette Israel and the staff of North Carolina State
University for their advice, friendship and excellent assistance. Heartfelt thanks are also extended to my friends for their time, help and advice.
I would like to thanks my parents, Mr. Anael Santos and Mrs. Bernadete Santos, my sisters Karinne and Leana, my grandmother Maria Jose Goncalves, for the love only family could provide. Also, I would like to thank my parents-in-law, Mr. Euripedes
Oliveira and Mrs. Delia Oliveira, for their love, teaching, support and sacrifices during this study.
Most importantly, I wish to express thankfulness, love, and affection to my wife
Fernanda Santos for her love, nurture, faith, encouragement, affection, happiness, and understanding that she provided. And, to my special angel, Amanda Santos, for her unconditional love.
v
TABLE OF CONTENTS
LIST OF TABLES ...... ix
LIST OF FIGURES ...... xi
1. CHAPTER 1: LITERATURE REVIEW ...... 1
1.1 INTRODUCTION ...... 2
1.2 FUNCTION OF THE GASTROINTESTINAL TRACT OF POULTRY ...... 5 1.2.1 Histomorphology of the small intestine ...... 6 1.2.2 Microbial ecology of the digestive tract ...... 10 The crop ...... 11 The proventriculus and ventriculus ...... 12 The duodenum, jejunum, and ileum ...... 12 The ceca ...... 14
1.3 THE INTESTINAL HEALTH CONCEPT ...... 16 1.3.1 The diet ...... 17 Physiological effects of NSP on intestinal health ...... 19 1.3.2 The gut mucosa ...... 24 Effect of antinutritional factors on gut mucosa ...... 24 1.3.3 The intestinal microflora ...... 28 Microbial diversity concept ...... 34 Methods of studying intestinal microbial diversity ...... 35
1.4 BACTERIAL ENTERITIS OF POULTRY ...... 39 1.4.1 Clostridiosis ...... 40 1.4.2 Colibacillosis ...... 40 1.4.3 Pasteurellosis ...... 41 1.4.4 Salmonellosis ...... 42 Salmonella classification ...... 43 Model research pathogen ...... 43
1.5 NUTRITIONAL STRATEGIES TO MODULATE INTESTINAL HEALTH AND PATHOGEN COLONIZATION OF POULTRY ...... 44
1.5.1 Antibiotics ...... 48 Current antibiotic debate ...... 49 Common antibiotics used in poultry feed ...... 53 Alternatives to antibiotics ...... 53 1.5.2 Probiotics ...... 57 1.5.3 Herbs, spices, and essential oils ...... 59 1.5.4 Acidifiers and organic acids ...... 61 1.5.5 Prebiotics ...... 64 Common used and potential prebiotics used in poultry feed ...... 66 1.5.6 Enzymes ...... 70 Common enzymes used in poultry feed ...... 72 Non-starch polysaccharide enzymes ...... 73
vi
1.6 CURRENT STUDY ...... 78
1.7 REFERENCES ...... 81
2. CHAPTER 2: EFFECT OF DIETARY SUPPLEMENTATION OF ENDOXYLANASES AND PHOSPHOLIPASE ON INTESTINAL SIZE AND HISTOMORPHOMETRY OF TURKEYS FED WHEAT-BASED-DIETS ...... 104
2.1 ABSTRACT ...... 105 2.2 INTRODUCTION ...... 106 2.3 MATERIALS AND METHODS ...... 109 Enzymes ...... 109 Diets ...... 110 Bird husbandry ...... 111 Data collection ...... 112 Histology analysis ...... 114 Statistical analysis ...... 115 Animal ethics ...... 116 2.4 RESULTS ...... 116 Intestinal size ...... 116 Ileum digesta viscosity ...... 116 Intestinal morphometry ...... 117 2.5 DISCUSSION ...... 117 2.6 TABLES AND FIGURES ...... 126 2.7 REFERENCES ...... 134
3. CHAPTER 3: EFFECT OF DIETARY ENZYME SUPPLEMENTATION AND NON-STARCH POLYSACCHARIDE CONTENT ON PERFORMANCE, INTESTINAL MORPHOMETRY AND SALMONELLA SPP. COLONIZATION OF TURKEYS ...... 138
3.1 ABSTRACT ...... 139 3.2 INTRODUCTION ...... 140 3.3 MATERIALS AND METHODS ...... 143 Enzymes ...... 143 Diet ...... 144 Bird husbandry ...... 145 Data collection ...... 146 Salmonella spp. prevalence ...... 147 Salmonella spp. population ...... 148 Statistical analysis ...... 149 Animal ethics ...... 149
vii
3.4 RESULTS ...... 150 Performance ...... 150 Intestinal and gastrointestinal tract accessory glands ...... 151 Salmonella spp. prevalence and population ...... 151 3.5 DISCUSSION ...... 152 3.6 TABLES AND FIGURES ...... 168 3.7 REFERENCES ...... 181
4. CHAPTER 4: REDUCTION OF INTESTINAL SALMONELLA ENTERICA COLONIZATION IN TURKEYS BY WHEAT, TRITICALE AND ENZYME SUPPLEMENTATION ...... 188
4.1 ABSTRACT ...... 189 4.2 INTRODUCTION ...... 190 4.3 MATERIALS AND METHODS ...... 194 Enzyme ...... 194 Diet ...... 195 Bird husbandry ...... 196 Data collection ...... 198 Histology analysis ...... 198 Salmonella prevalence procedure ...... 200 Salmonella population analysis ...... 201 Digesta pH procedure ...... 202 Statistical analysis ...... 202 Animal ethics ...... 203 4.4 RESULTS ...... 203 Animal growth performance ...... 203 Intestinal pH and viscosity ...... 203 Intestinal morphometry ...... 204 Salmonella enterica population ...... 205 4.5 DISCUSSION ...... 205 4.6 TABLES AND FIGURES ...... 215 4.7 REFERENCES ...... 224
5. CHAPTER 5: DENATURING GRADIENT GEL ELECTROPHORESIS ANALYSIS OF 16S RIBOSOMAL DNA AMPLICONS TO ANALYZE CHANGES IN ILEUM BACTERIAL POPULATION OF TURKEYS FED DIFFERENT DIETS AND AFTER INFECTION WITH SALMONELLA SPP...... 231
5.1 ABSTRACT ...... 232 5.2 INTRODUCTION ...... 233
viii
5.3 MATERIALS AND METHODS ...... 237 Enzyme ...... 237 Diets ...... 238 Bird husbandry ...... 239 Ileum DNA isolation and PCR-DGGE analysis ...... 240 Examination of the DGGE gels ...... 242 Statistical analysis ...... 245 Animal ethics ...... 246 5.4 RESULTS ...... 246 5.5 DISCUSSION ...... 250 5.6 TABLES AND FIGURES ...... 261 5.7 REFERENCES ...... 269
6. SUMMARY ...... 276
ix
LIST OF TABLES
CHAPTER 1 TABLE 1: Major antibiotic growth promoters used in animal feed and their antibacterial mode of action ...... 53 CHAPTER 2 TABLE 1: Enzyme activity in the products and in the feed, and rate of application used in the experimental diets ...... 126 TABLE 2: Composition and calculated nutrient content of the experimental diets fed to turkey toms from 1 to 56 days of age ...... 127 TABLE 3: Effects of different exogenous enzyme supplementation on relative intestinal weight of 56 days-old turkey toms fed wheat-based diets ...... 128 TABLE 4: Effects of different exogenous enzyme supplementation on relative intestinal length of 56 days-old turkey toms fed wheat-based diets ...... 129 TABLE 5: Effects of different exogenous enzyme supplementation on intestinal muscularis and mucosal weight of 56 days-old turkey toms fed wheat-based diets ...... 130 TABLE 6: Effects of different exogenous enzyme supplementation on the ileum digesta viscosity of 56 days-old turkey toms fed wheat-based diets ...... 131 TABLE 7: Effects of different exogenous enzyme supplementation on histological measurements of ileum of 56 days-old turkey toms fed wheat-based diets ...... 132 TABLE 8: Pearson correlation coefficients of body weight, intestinal size, ileum digesta viscosity , and ileum histological measurements of turkey toms at 56 days subjected to different diet formulations ...... 133 CHAPTER 3 TABLE 1: Enzyme product, dietary inclusion level, and target enzyme activity in the experimental diets ...... 168 TABLE 2: Composition and nutrient content of the wheat-based experimental diets (treatments 1 and 2) fed to turkeys from 1 to 113 days ...... 169 TABLE 3: Composition and nutrient content of the corn-based experimental diets (treatments 3 and 4) fed to turkeys from 1 to 113 days ...... 170 TABLE 4: Effect of different dietary grain base formulation and enzyme supplementation on body weight of turkey toms fed wheat and corn-based diets from 0 to 16 weeks of age ...... 171 TABLE 5: Effect of different dietary grain base formulation and enzyme supplementation on periodic feed consumption of turkey toms fed wheat and corn-based diets from 0 to 16 weeks of age ...... 172 TABLE 6: Effect of different dietary grain base formulation and enzyme supplementation on periodic feed conversion ratio (feed:gain) of turkey toms fed wheat and corn-based diets from 0 to 16 weeks of age ...... 173 TABLE 7: Effect of different dietary grain base formulation and enzyme supplementation on periodic mortality of turkey toms fed wheat and corn-based diets from 0 to 16 weeks of age ...... 174 x
TABLE 8: Effect of different dietary grain base formulation and enzyme supplementation on relative intestinal accessory organs weights (grams of tissue/kg of body weight) of turkey toms at 16 weeks old fed wheat and corn-based diets ...... 175 TABLE 9: Effect of different dietary grain base formulation and enzyme supplementation on relative intestinal weights (grams of tissue/kg of body weight) of turkey toms at 16 weeks old fed wheat and corn-based diets ...... 176 TABLE 10: Effect of different dietary grain base formulation and enzyme supplementation on relative intestinal length (cm of tissue/kg of body weight) of turkey toms at 16 weeks old fed wheat and corn-based diets ...... 177 TABLE 11: Effect of different dietary grain base formulation and enzyme supplementation on cecal Salmonella spp. population of turkey toms at 16 weeks old fed wheat and corn-based diets ...... 178 CHAPTER 4 TABLE 1: Composition and nutrient content of the experimental diets fed to turkey toms from 1 to 28 days of age ...... 215 TABLE 2: Effect of diet formulation and enzyme supplementation on body weight of turkey toms fed corn, wheat, or triticale-based diets from 1 to 28 days of age ...... 216 TABLE 3: Effect of diet formulation and enzyme supplementation on periodic feed consumption of turkey toms fed corn, wheat, or triticale-based diets from 1 to 28 days of age ...... 217 TABLE 4: Effect of diet formulation and enzyme supplementation on cumulative feed conversion ratio (feed:gain) of turkey toms fed corn, wheat, or triticale-based diets from 1 to 28 days of age ...... 218 TABLE 5: Effect of diet formulation and enzyme supplementation on pH of ceca content and ileum digesta viscosity of 28 days-old turkey toms fed corn, wheat, or triticale- based diets ...... 219 TABLE 6: Effect of diet formulation and enzyme supplementation on relative intestinal weight and length of 28 days-old turkey toms fed corn, wheat, or triticale-based diets ..... 220 TABLE 7: Effect of diet formulation and enzyme supplementation on histological measurements of ileum of 28 days-old turkey toms fed corn, wheat, or triticale- based diets ...... 221 TABLE 8: Pearson correlation coefficients of body weight, dietary fiber, cecal pH, cecal Salmonella population, ileum digesta viscosity and ileum histological measurements of turkey toms at 28 days subjected to different diet formulations ...... 222 CHAPTER 5 TABLE 1: Enzyme product, dietary inclusion level, and target enzyme activity in the experimental diets ...... 261 TABLE 2: Composition and nutrient content of the wheat-based diets fed to turkeys from 1 to 113 days ...... 262 TABLE 3: Composition and nutrient content of the corn-based diets fed to turkeys from 1 to 113 days ...... 263
xi
LIST OF FIGURES
CHAPTER 1 FIGURE 1: Anatomy of the avian digestive tract ...... 6 FIGURE 2: Diagram showing the arrangement of the small intestine tunics or layers ...... 8 FIGURE 3: Histomorphology of the small intestine ...... 8 FIGURE 4: Schematic representation of the intestinal ecosystem ...... 17 FIGURE 5: Flowchart of the modes of action of feed additives, non-starch polysaccharides, and enzyme supplementation...... 18 FIGURE 6: Consumption of prescribed antimicrobials and growth promoters in animal production and prescribed antibacterials in humans at Denmark...... 51 CHAPTER 3 FIGURE 1: Mean weekly high, low and average ambient temperature throughout the trial .... 179 FIGURE 2: Effect of different dietary grain base formulation and enzyme supplementation on prevalence of Salmonella spp. in fecal (3, 9, 15 wk) and cecal (18 wk) content of turkey toms fed wheat- and corn-based diets ...... 180 CHAPTER 4 FIGURE 1: Effect of diet formulation and enzyme supplementation on Salmonella spp. population of cecal content of turkey toms fed corn, wheat, or triticale-based diets from 1 to 28 days of age ...... 223 CHAPTER 5 FIGURE 1: Band surface area plots of polymerase chain reaction-denaturing gradient gel electrophoresis bands from ileum content of 16 week-old turkeys fed wheat-based diet with and without enzyme supplementation and corn-based diet with and without enzyme ...... 264 FIGURE 2: Number and frequency distribution of polymerase chain reaction-denaturing gradient gel electrophoresis bands from ileum content of 16 week-old turkeys fed wheat-based diet with and without enzyme supplementation and corn-based diet with and without enzyme supplementation ...... 265 FIGURE 3: Percentage of similarities for polymerase chain reaction-denaturing gradient gel electrophoresis banding patterns from ileum content of 16 week-old turkeys fed wheat-based diet with and without enzyme supplementation and corn-based diet with and without enzyme supplementation ...... 266 FIGURE 4: Diversity and evenness indexes of polymerase chain reaction-denaturing gradient gel electrophoresis bands from ileum contents of 16 week-old turkeys fed wheat- based diet with and without enzyme supplementation and corn-based diet with and without enzyme supplementation ...... 267 FIGURE 5: Dendrogram representing dietary and enzyme supplementation associated correlations of polymerase chain reaction-denaturing gradient gel electrophoresis banding patterns of ileum contents of 16 week-old turkeys fed wheat-based diet with and without enzyme supplementation and corn-based diet with and without enzyme supplementation ...... 268 xii
CHAPTER 6 FIGURE 1: Schematic representation of the experiments used in the present dissertation ..... 287
1
CHAPTER 1
LITERATURE REVIEW
2
1.1 INTRODUCTION
The poultry industry has undergone remarkable changes and growth over the last
30 years and it will likely continue in the next 10-20 years. Poultry production is
expected to expand in the coming years to meet higher demand for low-cost, healthy and
convenient products. Turkey production has more than tripled since 1970 to meet
consumer demand for healthy, lean protein source (ERS-USDA, 2003). The modern
commercial broiler and turkey continues to show increased yearly genetic gains. This
selection for increased growth rate has resulted in changes in gastrointestinal
development during growth of the animal (Tottori et al., 1997). Commercial poultry species are susceptible to enteric health problems (Tottori et al., 1997). Intestinal health
has a major influence on growth performance of poults as it affects feed digestion,
nutrient absorption, and mortality. In addition, poor intestinal health is associated with
animal infectious diseases and enteric foodborne pathogen colonization (Patterson and
Burkholder, 2003). Therefore, poor intestinal health negatively impacts the poultry
industry by reducing animal productivity and welfare, and increasing the potential for
contamination of poultry products for human consumption.
Poultry are susceptible to many enteric pathogens, including parasites, bacteria, and viruses. Colonization and proliferation of one or more of these enteric pathogens may result in infectious diseases that lead to increased mortality. But the greatest concerns are decreased productivity and compromised food safety. The susceptibility to enteric infection is influenced by several stress factors, including management deficiencies,
vaccination, unbalanced nutrients and/or electrolytes in the diet, and high concentration 3
of antinutritional factors in the feed (Ferket and Veldkamp, 1999). These factors cause enteric disturbances either directly by adversely affecting the ecosystem of the gut and
causing irritation in the gut, or indirectly by changing the osmotic balance of the intestine
(Ferket and Middelton, 1998). Furthermore, enteric diseases are often not resolved by
current therapeutic antibiotics, and the evolution of antibiotic-resistant pathogens further
justifies the search for new strategies to control enteric pathogens (Rastall et al., 2005).
The exploitation of new approaches to control enteric diseases is intensified by the
continuous emergence of novel variants of established pathogens (Rastall et al., 2005),
and by the increasing public concern of antibiotic-resistant bacteria (Gustafson and
Bowen, 1997).
The avian intestine is a relatively under-explored ecosystem. A better
understanding of the intestinal ecosystem will result in a greater opportunity to develop
intervention strategies to control the colonization of unfavorable microbes and reduce the
incidence of a variety of gastro-intestinal tract (GIT) diseases (Rastall et al. 2005).
Recently, prebiotics, which are selectively fermented carbohydrates, have received
considerable interest among scientists as a dietary means to modulate colonic microflora
and improve health. Any food or feed ingredient that enters the large intestine is a
potential prebiotic, but it must be fermented by selective types of microorganisms to be
an effective prebiotic (Lan, 2004).
There are several prebiotics on the market around the world, but many of these
have not been rigorously tested and reported in the scientific literature. However, there is
much interest in the potential of novel prebiotics to promote enteric health, especially 4 those prebiotics from plant cell wall polysaccharides (Rastall and Maitin, 2002).
Therefore, feedstuffs that contain high levels of non-starch polysaccharides (NSP) would be potential prebiotic sources. Non-starch polysaccharides include various fiber types, such as lignin, β-glucans, arabinoxylans, and mannose. Each of these carbohydrates, presented separately or in combination, has been shown to affect the intestinal microbial ecosystem and enteric pathogen colonization (Kataoka et al., 2002; Zhang et al., 2004;
Lowry et al., 2005).
Supplemental enzymes have become common additives to poultry and swine feeds as a means to improve nutrient utilization and meat production efficiency. Today, pentosanases (NSP-enzyme) are used in virtually all poultry and swine diets comprised mainly of small grains such as wheat, barley, or oats. In addition to their effect on nutrient digestibility, enzymes have been shown to influence the intestinal microbial ecosystem towards a healthier state (Fischer and Classen, 2000).
In conclusion, birds undergo a dramatic physical development of the gastro- intestinal tract throughout their productive lives. The intestinal colonization of commensal microorganisms is particularly noteworthy. The intestinal microbial growth may be affected by diet formulation and environmental conditions of the birds. Diet components, such as fiber, are potential modulators of the intestinal environment. Also, enzymes have been shown to influence the intestinal microbial ecosystem towards a healthier state. Therefore, it should be possible to manipulate the intestinal microbial community by dietary enzyme supplementation and dietary ingredients, such as feedstuffs rich in non-digestible but fermentable carbohydrates. 5
The following review of the scientific literature will focus on the poultry GIT,
poultry bacterial enteritis, and the concepts required for intestinal health with emphasis
on the nutritional strategies to modulate microbial ecology to discourage the colonization
of unfavorable bacterial communities. Although it is not the purpose of this dissertation
to review the extensive literature on bacterial enteritis and their consequences on
intestinal health of poultry, a general review is necessary to further the understanding of
how NSP and enzyme supplementation may affect the intestinal microbial community of
poultry.
1.2 FUNCTION OF THE GASTROINTESTINAL TRACT OF POULTRY
The major purpose of the digestive system is to assimilate nutrients that supply the requirements for maintenance, growth, and reproduction of the organism. Digestion consists of a number of physical and chemical processes. Feed is ingested, broken down
into smaller particles, macerated, mixed with digestive enzymes, and propelled through
the digestive tract by the muscular activities of the tract. Salivary, gastric, pancreatic,
biliary, and intestinal secretions collectively provide mucus for protection and lubrication
of the tract, enzymes that aid in digestion, watery medium, and optimal pH required for
digestion. Digestive enzymes aid in the hydrolysis of carbohydrates, protein, and lipids
into a limited number of much smaller compounds suitable for absorption.
Microorganisms, indigenous to the digestive tract, can provide additional nutrients by
breaking down structural carbohydrates that are not subject to digestion by endogenous
enzymes, and by synthesizing amino acids and vitamins essential to the host animal. 6
1.2.1. Histomorphology of the small intestine
Quantitatively, most of the digestion and absorption takes place in the small intestine (Turk, 1982). The small intestine is divided into duodenum, jejunum, and ileum
(Figure 1). In birds, the duodenum is the section that extends from the gizzard to the pancreatic and biliary ducts, and encloses the pancreas to form a structure also known as the duodenal loop. The jejunum is the segment extending from the pancreatic ducts to the
Meckel’s Diverticulum or yolk sac diverticulum. The ileum extends from the Meckel’s
Diverticulum to the ileo-caecal junction. The physiology of the intestine varies along the small intestine (Turk, 1982). For instance, the intestinal mucosa decreases in thickness as the villi become shorter and the crypts decrease in depth from the duodenum to the ileum
(Turk, 1982).
Jejunum
Meckel’s Meckel’s
Diverticulum
FIGURE 1: Anatomy of the avian digestive tract. Adapted from Freeman, 1971.
7
The avian intestinal tract is a multilayered tube containing a serosal layer, a longitudinal muscular layer, a circular muscle layer, a submucosal layer, and a mucosal layer (Turk, 1982) (Figure 2). Absorption takes place primarily through the mucosa of the small intestine. Most of the digestion of the bird intestinal tract occurs in the lumen of the intestine under the influence of the digestive enzymes secreted by the pancreas and intestinal wall and the bile secreted by the liver. Digestion of sugars and peptides, however, takes place within the brush board by the enterocytes, facilitated by membrane- bound enzymes (Turk, 1982). The interior surface of the intestine is complexly folded into many structures called villi (Romanoff, 1960), which greatly increase its absorptive surface area (Figure 3). Between the villi are the crypts of Lieberkuhn, in which cells, called Crypt cells, proliferate and then migrate up the villi (Turk, 1982). These cells have a life cycle of 48 to 96 hours under normal conditions (Imondi and Bird, 1966; Cook and
Bird, 1973; Fernando and McCraw, 1973; Turk, 1982; Moran, 1982; Uni et al., 1998). As the Crypt cells move up the villus, they differentiate into principal (absorptive), or goblet
(secretory) cells. The absorptive epithelial cells are most abundant along the length of the villi, and goblet cells are intermittently dispersed.
8
Figure 2: Diagram showing the arrangement of the small intestine tunics or layers (Eisemann, 2004).
(A) (B) Villi
Crypt
Figure 3: Histomorphology of the small intestine. (A) Diagrams showing the arrangement of the small intestine villi and microvilli, including blood vessels. (B) Villi of small intestine, showing crypt of Lieberkuhn (Odle, 2001).
The goblet cells produce mucopolysaccharides that are secreted into a layer covering the villar surface (Moran, 1985). This mucus layer serves as a protective barrier for the delicate absorptive surface from the epithelial luminal contents. It has long been 9
believed that mucin, which is the major component of the mucous layer, has a function
that is largely associated with lubrication of bolus movement (Moran, 1985). However, mucin also serves a protective function by discouraging the translocation of harmful microorganisms, binding chemical irritants, establishing the unstirred water layer, protecting the underlying epithelial cells, providing a medium for the colonization of
favorable microflora, and interact with the intestinal immune system (Ferket et al., 2005;
Thompson and Applegate, 2005). Moreover, protective factors exist in mucin as mucin
layers accumulate bactericidal and bacteriostatic compounds, and secretory
immunoglobulin A, which are compounds capable of neutralizing or killing bacteria
(Thompson and Applegate, 2005). Also, as the loosely adherent mucus layer is sloughed,
it traps and carries the resident or invading bacteria, thus removing the trapped bacteria
from the intestinal tract (Thompson and Applegate, 2005). Therefore, it is generally
agreed that the mucin layer is an important factor in maintaining a strong intestinal barrier against pathogens invasion.
The absorptive cell is a very active columnar epithelial cell with a large basally- located nucleus. The luminal surface of the absorptive cell is covered with extensive
projections toward the lumen of the GI tract called microvilli (Moran, 1985). The
microvilli are cylindrical structures projecting from the cell surface and are bound by a
trilaminar membrane. The microvilli contain fibrous structures, which extend its length
into the terminal web portion of the cell. Occasionally, these fibers may also be observed
to extend into the mucus layer of the glycocalyx, in which water is immobilized because
of the viscosity from accompanying mucin (Moran, 1985). Nimmerfall and Rosenthaler 10
(1980) speculated that the rate at which molecules may move through this mucin water
complex will depend on their charge, hydration, radius, ability to form hydrogen bonds,
and molecular weight. Only the simplest saccharides, peptides, and fatty acids can readily
transfer through this unstirred water layer (Moran, 1985). Borgstrom et al. (1985) described the unstirred water layer as an infinite number of water lamellae arranged in parallel with the enterocyte membrane. They also reported that the closer the water lamellae are situated to the enterocyte membrane, the lower is the relative rate of stirring or movement.
The lamina propria is in the interior of the villi, beneath the epithelial cells. The lamina propria consists of connective tissue, capillaries, smooth muscle, and nerve fibers.
The capillaries bring the blood stream to the base of the epithelial cells so that only one cell layer separates the lumen of the intestine from the blood (Romanoff, 1960). Thus, the absorption of nutrients from the lumen of the intestine and their release into the blood stream is facilitated.
1.2.2. Microbial ecology of the digestive tract
Birds can harbor an extensive and diverse microflora throughout the digestive tract. There are more bacterial cells that reside within the intestinal tract than there are cells of the host organism (Mead, 2000a; Gordon, 2005). Most information on the composition and metabolic activities of the poultry microflora is from studies on the domestic fowl published in the 1970s using cultural techniques, but limitations of this knowledge are recognized. In the last 5 years, application of modern molecular and 11
analytical techniques have given new insight into the microbial community of the GIT of
poultry (Gong et al., 2002a,b). As with most types of birds, chickens and turkeys are
hind-gut fermenters, and they accommodate large numbers of different microbes in the
ceca. The microorganisms in the intestinal tract become attached to mucosal surfaces or
food particles, or they remain free-living in the lumen. The capability of surface
attachment is important in those situations where food passes rapidly through particular regions of the tract and would otherwise flush the organisms out. Not surprisingly, the major sites of microbial activity are those in which conditions are relatively stable and the ingesta is retained long enough for significant microbial growth to occur (Mead, 2000a).
Micro-communities in different parts of the tract develop only after the successive establishment of some types of organisms and a decline of others, which characterize symbioses (Hentschel et al., 2000). In poultry, bacterial populations resembling those of adult small intestine are present within two weeks of hatching, but it takes 30 or more days in the ceca to develop a stable and dynamic population (Ochi et al., 1964; Barnes et al., 1972). The slow rate of development appears to be due to the highly sanitized hatching and rearing conditions and the lack of contact with the mother hen, common in commercial poultry production. Thus, a mature microflora is not acquired as readily under these circumstances as it would be in the wild.
The crop
The crop is a unique feature of birds and usually acts as a food storage organ regulating the supply of food to the gizzard. Among the few types of bacteria that rapidly colonize the crop are Lactobacillus, of which Lactobacillus salivarius is usually 12
predominant (Sarra et al., 1985), coliform bacteria, and Streptococcus/Enterococcus
(Fuller, 1977). Lactobacillus is the principal microorganism that produces lactic acid and
reduces the crop lumen pH to about 5.0 once feeding begins. Lactobacillus have
bacteriostatic and bactericidal properties (Fuller, 1977) that appear to control the numbers
of Escherichia coli in the crop and may even influence microbial populations in the
proximal part of the small intestine. Other microorganisms that may reside in the crop,
but in low numbers, include micrococci, staphylococci, and yeasts, and sometimes
aerotolerant Clostridium perfringens are found. Some bacterial starch degradation occurs
in the chicken crop, but any significant fiber digestion may be limited by the low pH.
The proventriculus and ventriculus
Chemical and physical digestion of food occurs primarily in the proventriculus
and ventriculus, respectively (Duke, 1986a). Both the proventriculus and gizzard appear
to be unfavorable for microbial growth and, with in the range of pH 1 to 4, any surviving
microorganisms must show a degree of acid tolerance. Despite this unfavorable
environment, bacterial populations have been observed in the ventriculus. In a study of
the chicken, Smith (1965) found Lactobacillus at 108 colony forming units per gram of
ventricular contents (cfu/g), with much lower numbers of E. coli,
Streptococcus/Enterococcus and yeasts.
The duodenum, jejunum, and ileum
Large and diverse populations of bacteria have been found in the lumen of the proximal part of the small intestine, including the duodenum. Using culture techniques to evaluate microflora in chicken intestine, Salanitro et al. (1978) showed that the 13
predominant organisms are E. coli and species of Streptococcus/Enterococcus,
Staphylococcus and Lactobacillus at about 109 cfu/g of ingesta. Obligate anaerobes were
also present. These included anaerobic cocci and species of Eubacterium,
Propionibacterium, Clostridium, Gemmiger and Fusobacterium. Anaerobes comprised 9-
39% of the total number of isolates obtained and the greatest diversity of types occurred
in the duodenum. Using new molecular analysis on 16S rRNA amplicons from combined ileal bacterial samples (digesta and mucosal), Gong et al. (2002a) reported that the
bacterial populations in the ileum were largely Gram-positive. Lactobacillus and E.
cecorum represented more than 70% of the ileal mucosal and lumen population, of which
49% were related to Lactobacillus aviaries. Twelve percent of the sequences cloned from
the ileum samples were found to have counterparts of uncultured bacteria in the cecum,
but they were closely related to unidentified butyrate-producing bacteria from humans
and chickens. Butyrate-producing bacteria have been currently studied for their positive
effects because of the benefits of butyrate on enteric health (Duncan et al., 2003).
Butyrate is a short-chain fatty acid and the principal energy source for the cell lining of
the lower intestine (Brouns et al., 2002). Reduced supply of butyrate to colonic cells
causes intestinal atrophy and impairs function, including reduced immune response
(Scheppach and Weiler, 2004). Because it is their preferred energy source, butyrate
controls the growth and overall metabolic activity of colonic cells (colonocytes), resulting
in improved intestinal health and reduced risk of digestive disorders (Brouns et al., 2002).
An additional benefit of butyrate concerns its stimulatory role on commensal intestinal
microflora and the competitive exclusion of pathogens (Brouns et al., 2002). 14
The ceca
The ceca originate at the junction of the small and large intestine and vary considerably in size and form between bird species. The flow of material into the ceca is controlled by valves, which usually allow only fluids and fine particles to enter. In wild galliforms, the ceca are evacuated only about once per 24 hours, thus, provide relatively stable conditions for microbial proliferation (Duke, 1986a). The resultant microbiota tends to be large and diverse, occurring at up to 1011 cfu/g of cecal content. The predominant organisms in the chicken ceca are obligate anaerobes, which are highly sensitive to oxygen, while facultative anaerobes occur in lower numbers and yeasts, molds and protozoa are generally at low levels or absent. Isolation and characterization of cecal anaerobes by culturing techniques require complex growth requirements. The composition of the ceca microflora differ between flocks, between birds within a single flock, and even within an individual bird when examined at different times (Salanitro et al., 1974).
During the development of chickens and turkeys, microbial populations take longer to develop in the ceca than they do in other parts of the GIT. According to Ochi et al. (1964), ceca populations in the chick take up to 30 days to become fully established, although Barnes et al. (1972) found that changes continued to occur for some six weeks after hatching. Using culture techniques, Barnes et al. (1972 and 1979) studied the chicken ceca population and showed that streptococci, peptostreptococci, and
Bacteroidaceae were the predominant types of microorganisms in the ceca. Other organisms found included Gemmiger formicilis, Bifidobacterium gallinarum, and some 15
Clostridium. Barnes and Impey (1970) studied the cecal flora of 13 week-old turkeys and showed that approximately 10.5% of the cecal population was Gram-negative rods, 42% was Gram-positive rods, 31.5% was Gram-positive or variable cocci or coccobacilli, and
16% was spirilla. In comparison with the chicken, the proportion of Gram-negative anaerobes was noticeably smaller in the ceca of turkeys, but whether this reflects differences in diet or bird species is unknown.
New molecular analyses have expanded the knowledge of the culture technique studies on the cecal bacterial population. Using new molecular analysis on 16S rRNA bacterial genes, Gong et al. (2002a,b) observed that butyrate-producing bacteria
(including those related to Fusobacterium prausnitzii), ruminococci, clostridia and
E.cecorum were the predominant groups of bacteria in the cecal mucosa. Twenty-five percent of the sequences cloned from the cecal samples were found to be un-reported species, and closely related to unidentified butyrate-producing bacteria from humans cecum and bovine rumen (Gong et al., 2002b). The population in the ceca was significantly more diverse than that in the ileum, although bacteria of both regions were predominantly Gram-positive. The authors suggested that the difference in bacterial distribution of the ceca and ileum is likely due to their functional and environmental properties. The function of the ileum is mainly nutrient absorption, while the cecum is the site of extensive bacterial fermentation, resulting in further nutrient absorption and detoxification of substances that are harmful to the host (Gong et al., 2002a,b). Since these intestinal sections function differently, they have significantly different micro- environments; therefore, differences in the types of bacteria that would colonize them are 16
expected, and distinctive microbiota would develop. Gong and co-workers (2002a,b)
stated that Lactobacillus, E.cecorum and butyrate-producing bacteria (identified and unidentified species) are the three major groups of bacteria found in ilea and ceca of chicken.
The intestinal microflora is an integral part of the digestive system of all animals.
Like all living organisms, they have nutritional and environmental requirements. Bacteria in the GIT derive most of their energy for reproduction and growth from dietary compounds. These dietary compounds are either resistant to attack by digestive fluids or they are absorbed so slowly by the host that bacteria can successfully compete for them.
Since bacterial species differ from each other in relation to their substrate preferences and growth requirements, the chemical composition and structure of the digesta largely determines the species distribution of the microbial community in the gastrointestinal tract. As a consequence, bacterial community structure is very much dependent upon the diet as the ultimate source of substrates for its metabolism (Savory, 1992; Wagner and
Thomas, 1987).
1.3 THE INTESTINAL HEALTH CONCEPT
The concept of “intestinal health” is complex and its comprehension is dependent on knowledge about different aspects of nutritional science: the diet, the microflora, and the intestinal mucosa (Conway, 1994; Figure 4). Each of these elements interact one with the other in order to maintain a dynamic equilibrium, ensuring proper function of the digestive system and lack of pathology, a state defined as intestinal health. 17
DIET Macro/micro-nutrients Additives Antinutritional factors
GUT MUCOSA MICROFLORA Epithelium Commensal bacteria Mucus layer Transient bacteria* Gut immunity (*including pathogens)
FIGURE 4: Schematic representation of the intestinal ecosystem (modified from Conway, 1994). Each element interact with the other in order to maintain a dynamic equilibrium ensuring functioning of the digestive system and lack of pathology, a state defined as intestinal health.
1.3.1 The diet
The primary role of the diet is to provide sufficient nutrients to meet the
nutritional requirements of an individual. Diet, among other environmental and genetic
factors, is recognized to have an important influence on the state of health and disease in
animals (Monsan and Paul, 1995; Orban et al., 1997; Rastall and Maitin, 2002). Diet has been shown to be the strongest individual determinant of the total microbial community structure and mucosal physiology of the intestinal tract of humans and animals.
Several strategies have been proposed as a means to manage intestinal health through diet (Figure 5). Growth-promoting antibiotics work in part by decreasing the
microbial load in the intestine, resulting in a reduction in energy and protein required to
maintain and nourish the intestinal tissues; thus, more nutrients are partitioned toward
growth and production. In contrast, most natural feed additives do not reduce overall 18
microbial loads. Instead, they alter the intestinal microflora profile by limiting the
colonization of unfavorable bacteria, which promote the activity or growth of more
favorable species. These natural feed additives promote intestinal health by several
possible mechanisms listed as follows: altering intestinal pH; maintaining protective gut
mucins; selection for beneficial intestinal organisms or against pathogens; enhancing
fermentation acids; enhancing nutrient uptake; and increasing the humoral immune
response. The mechanisms of action of feed additives are highlighted with more detail in
section 1.5 of this dissertation.
Feed Additives Enzyme NSP Enzyme
Enzyme
Microflora Digesta Viscosity House Effect
Fat Passage GIT Unstirred GIT Basal Nutrient Immunity Digestion Rate Morphology Water Layer Metabolic Absorption Rate
Gut Health, Nutrient & Energy Utilization, Performance
FIGURE 5: Flowchart of the modes of action of feed additives, non-starch polysaccharides, and enzyme supplementation (modified from Simon et al., 2004).
19
Physiological effects of NSP on intestinal health
Plants and plant products are a major component of human and animal food.
However, nature has provided plants the capacity to synthesize unique chemicals that
serve as defense mechanisms. These naturally occurring antinutrients include protease
inhibitors, goitrogens, alkaloids, oxalates, phytate, urease, lipoxygenases, and others
(Ferket and Middelton, 1998), oligosaccharides (i.e. stachyose and rafinose) and non- starch polysaccharides (cellulose, β-glucans, arabinoxylans, and β-mannans) (Odetallah,
2000).
Non-starch polysaccharides (NSP) are principally non-α-glucan polysaccharides
of plant cell walls. They are a heterogeneous group of polysaccharides with varying
degrees of water solubility, size, and structure. They are classified into water-soluble and
water-insoluble fractions (Sasaki et al., 2000), which delineate their functions and chemical structure (Izydorczyk et al., 1991a,b; Izydorczyk et al., 1998). NSP are the principal components of the plant that is not digested by endogenous secretions of the digestive tract (Lineback and Rasper, 1988). They are usually undesirable in poultry feeds because they reduce growth performance and nutrient digestibility (Hetland and
Svihus, 2001). Non-starch polysaccharides are the main constituents of cell wall material in all parenchymatous and lignified tissues of the wheat plant (Lineback and Rasper,
1988), and comprises about 70-90 % of the plant cell wall (Knudsen, 2001).
Corn-soybean meal diets remain to be one of the most used and efficient diets for poultry. Although soybean meal (SBM) is an excellent protein source, it contains poorly digested carbohydrates that are antinutritional in nature. Approximately 40% of soybean 20
meal is made up of crude fiber and various polysaccharides and oligosaccharides. Among
the antinutritional factors present in SBM are the stachyose and raffinose. In SBM,
soluble sugars account for approximately 10% w/w (Hymowitz et al., 1972), 99% of
which include sucrose, stachyose, and raffinose (Kawamura, 1967) in a ratio of
approximately 8:4:1 (w/w/w), respectively (Hymowitz et al., 1972). The polysaccharide
fraction of SBM is composed of acidic polyssacharides (8-10%), arabinogalactans (5%),
cellulose (1-2%), and resistant starch (0.5%). β-mannans comprise about 1.3% of the
48% crude protein-SBM and 1.5-1.7% of the 44% crude protein-SBM (Dierick, 1989).
The presence of these carbohydrates in SBM might shift the microbial community of the
GIT by providing substrate for microbial proliferation (Odetallah, 2000).
The detrimental effect of soluble NSP is mainly associated with the viscous nature
of these polysaccharides and their physiological effects on the digestive medium.
However, because NSP represent a diversity of compounds possessing different
physicochemical properties, their nutritional effects in poultry are also diverse. Early
work identified the soluble β-glucans and arabinoxylans as being the fractions most
responsible for impeding digestion by causing a viscous intestinal environment (Antoniou
and Marquardt, 1982; White et al., 1981, 1983; Teitge et al., 1991). This high intestinal viscosity is associated with the incapability of the animals to digest cellulose, arabinoxylans, or β-glucans (Bedford, 1995; Steenfeldt et al., 1995). The rate of digestion of a feed and the absorption of the products of digestion relies on the formation of a complex between the digestive enzyme and its substrate and subsequent release of its product, and the diffusion of the product to the enterocyte for absorption to occur 21
(Bedford, 1995). Unimpeded movement of enzymes, substrates and products by diffusion through the intestine is essential for digestion. As the viscosity of the digesta increases by the presence of NSP, the diffusion decreases. Moreover, the NSP gel may act as a physical barrier between substrates, enzymes, and digestion end-products (Petterson and
Aman, 1989), thus limiting the mix of nutrients with pancreatic enzymes and bile acids
(Edwards et al., 1988). NSP complex may reduce the brush border diffusion of nutrients, limiting their exposure to the brush border enzymes and absorption by the enterocytes
(Edwards et al., 1988). Therefore, NSP may reduce the digestion and absorption of nutrients by its physicochemical effect in the intestinal tract.
Non-starch polysaccharides may cause disturbance of intestinal microflora. The combination of the viscous intestinal environment, slower rate of feed passage, and the presence of significant amounts of undigested materials derived from high levels of NSP in the feed, lead to the proliferation of microflora and its migration from the ceca to the small intestine where most of the nutrient absorption takes place (Jaroni et al., 1999;
Preston et al., 2001). As microflora characteristics are changed by high levels of NSP in the diet, there is an increase in the adverse effects of microbial fermentation, including the reduction in fat digestion by the deconjugation of bile salts (Langhout, 1999) and an increased competition between the host and the microflora for available nutrients
(Bedford, 1995; Choct et al., 1996).
Although the effects produced by these carbohydrates may be considered to be undesirable in livestock nutrition, they are considered to be beneficial in many cases.
Consultants commonly recommend the addition of dietary fiber to swine diets to help 22
control enteric diseases, such as postweaning dysentery caused by E. coli (Bertschinger et
al., 1978; Dritz, 2003). This includes using oat products in nursery diets, and wheat bran,
soy hulls or dried distillers grains to control porcine proliferative enteritis (ileitis) and
colitis. Recommendations to add fiber to pig diets for the control of enteric diseases are
also based on widely documented benefits of dietary fiber for humans. These benefits
include the role fiber plays in altering the microbial population to help stimulate growth
of colonic tissue cells and lymphoid tissue (Dritz, 2003). Ishizuka and Tanaka (2002) and
Ishizuka et al. (2004) showed that dietary fiber increases the densities of CD8+ and CD4+ intraepithelial lymphocytes and CD161+ natural killer cells in the cecum of rats.
Intraepithelial lymphocytes CD8+ and CD4+, and natural killer cells CD161+ are cells considered to be involved in the maintenance of epithelial homeostasis. They reported that there was a significant relationship between short-chain fatty acids (SCFA) and the localization of immune cells, implying that the fermentation of the fiber in the lumen is likely to be critical in the modulation of intestinal immunity, and SCFA are likely mediators of this response.
The gut-associated lymphoid tissue (GALT) is the first line of defense by which animals resist invasion of pathogens from the environment. GALT is distributed along the entire intestine of chickens (Lan, 2004). It plays an important role in making specific antibodies for broilers (Befus et al., 1980). Microbial communities that inhabit the intestinal tract can stimulate these immune responses, and thus act to strengthen the host’s defense mechanisms. Also, lactic acid bacteria of the gut elicit immunostimulatory effects by cell wall components (Takahashi et al., 1993; Haller et al., 1999). Lactic acid 23 bacteria are Gram-positive with cell wall components comprised of peptidoglycans, polysaccharide and teichoic acid, which all have been shown to have immunostimulatory properties (Takahashi et al., 1993). Additionally, peptidoglycan and muramyl dipeptide
(MDP), which makes up 30-70% of the lactic acid bacteria cell wall (Rook, 1989), can be released by lysozyme (Peeters and Vantrappen, 1975). Peptidoglycan has adjuvant effects on the immune response (Stewart-Tull, 1980), especially on the intestinal mucosal surface (Link-Amster et al., 1994). Binding sites for peptidoglycans were identified on lymphocytes and macrophages (Dziarski, 1991). Therefore, dietary supplementation of
NSP fibers can enhance the natural immunocompetence of poultry by supplying preferred substrate to enteric lactic acid bacteria (Lan, 2004).
Dietary NSP and oligosaccharides may directly stimulate intestinal immunity of poultry. Arabinoxylan, besides its fermentative properties, has been shown to activate a macrophage cell line in the broiler intestine and thus decrease the enteric pathogen colonization (Zhang et al., 2004). β-glucan has been shown to have an immunomodulatory action by increasing mammalian macrophages and neutrophils in vitro (Kataoka et al., 2002), and protecting broiler chickens against Salmonella by up- regulating heterophils phagocytosis, bactericidal killing and oxidative burst (Lowry et al.,
2005). Additionally, dietary fiber has been recognized in human nutrition to improve colonic health, reduce cholesterol, stabilize blood glucose, improve insulin response, reduce blood lipids, and reduce certain cancers (Cummings and Macfarlane, 1997; Cook and Sellin, 1998; Prosky, 2000).
24
1.3.2 The gut mucosa
The intestinal epithelium encounters unique macroscopic and microscopic structures. The intestinal epithelium contains microbes, both commensal and pathogenic, as well as dietary nutrients, digestive enzymes, and a number of immunological factors.
This complex environment is important to allow absorption of nutrients and to maintain a healthy body.
Effect of antinutritional factors on gut mucosa
Numerous authors have reported that diet, especially dietary fiber content (NSP and lignin), has a marked effect on the anatomy, development, and function of the gut. In general, dietary fiber leads to increased size and length of the digestive organs, including the small intestine, cecum and colon of chickens (Iji et al., 2001), pigs (McDonald,
2001), and rats (Ikegami et al., 1990), and presumably other non-ruminant animals.
These effects are often associated with the modification of the gut epithelium morphology, and consequently affect the hydrolytic and absorptive functions of the epithelium. The effect of the diet on epithelial morphology and cell turnover is variable and is dependent upon the presence of dietary antinutritional factors and the intestinal microflora. Increased epithelial cell proliferation in colon crypts has been shown in humans fed oat bran and oat gum (Malkki and Vertanen, 2001) and in rats fed fermentable fiber (Goodlad et al., 1987). However, as demonstrated by the latter authors using germ-free rats, this effect needed the presence of the resident microflora. Langhout et al. (2000) also observed a significant change in ileal villi morphology from a predominantly zigzag orientation of villi to a more disorderly pattern of ridge-shaped or 25
tongue-shaped villi when broilers were fed a diet containing high NSP content. This
altered villi morphology was associated with a reduction in the effective absorptive
surface area, reducing nutrient absorption. This response to dietary NSP was more pronounced in conventional than in germ-free chicks. These morphological observations
led Langhout and co-workers (2000) to hypothesize that the change observed in intestinal
wall morphology was due to the increased amount of microbial fermentation products
that are toxic to enteric tissues. Similar findings have been reported by Wagner and
Thomas (1978), Campbell et al. (1983), and Choct et al. (1996).
The villus height/crypt depth ratio is a useful criterion for estimating the digestive
capacity of the small intestine. As shown in piglets by Pluske et al. (1997), villus height
correlates positively with empty body-weight gain and dry matter intake. A decrease in
the villus height/crypt depth ratio is considered to be deleterious to digestion and
absorption, and vice versa. Decreased villus height/crypt depth ratio is also associated
with increased rates of crypt-cell proliferation and of the number of cells exhibiting DNA
fragmentation (indicating programmed cell death), both leading to a faster enterocyte
turnover (Pluske et al., 1997).
Mucins are the major glycoproteins of the mucus layer that coats and protects the
gut from infection, and from physical, chemical and enzymatic injuries, and it aids the
passage of lumen contents through the tract. An optimal protection against bacterial
infection requires an intact mucus layer at the surface, depending on both its quantitative
(thickness) and qualitative (ability to fix bacteria) parameters (Montagne et al., 2003).
Several studies in rats provided evidence that an increase in dietary fiber and bacterial 26
proliferation in the intestine is counterbalanced by the synthesis and secretion of mucus
by goblet cells. Enss et al. (1994) reported an increased capacity for mucin secretion as
indicated by the number and length of crypts, and number of crypt cells and mature
goblet cells in the proximal and distal colon. In rats fed a diet containing 200 g wheat
bran/kg compared to a fiber-free diet, the relative number of goblet cells in the epithelium
of the small intestine was found to be significantly increased (Schneeman et al., 1982).
The carbohydrate chains of mucins act as specific receptors for the attachment of adhesins of commensal and pathogen bacteria. Depending on their content of monosaccharides, mucins are classified into neutral and acidic subtypes. The latter are further distinguished into sulfated (sulfomucin) or non-sulfated (sialomucin). The state of health of the digestive tract seems to be linked to the degree of mucin maturation
(Montagne et al., 2003). Mature mucins are mainly sulphated (Van Leeuwen and
Versantvoort, 1999). Fixation of pathogenic bacteria in the mucus can be beneficial or detrimental for animals (Forstner and Forstner, 1994). For many pathogens, such fixation restricts their free access to the underlying mucosa, and the mucus acts as an impermeable barrier or retention zone. Conversely, the ability of pathogenic bacteria to interact with mucin can be an important step in facilitating colonization of the gastrointestinal tract. If the bacteria are able to bind strongly to components of the intestinal mucus layer, their clearance by the motile and abrasive forces of digestion may be delayed and colonization of the gastrointestinal tract may be favored. However, dietary fiber that leads to more acidic mucin appears to increase the potential of mucus to 27
resist attack by bacterial enzymes (Rhodes, 1989), which favors the elimination of
pathogens.
Diet affects mucin secretion in the intestinal tract. Dietary fiber (Tanabe et al.,
2005), prebiotics (Fontaine et al., 1996; Ferket, 2003), probiotics and antibiotic growth promoters (Smirnov et al., 2005) have been shown to increase mucin secretion. Ferket
(2003) reported that dietary supplementation of mannan oligosaccharides to turkeys resulted in an increased proliferation of goblet cells on the villus. Similarly, Fontaine et al. (1996) reported that inulin stimulated the production of sulfomucin and a reduction in
sialomucin in heteroxenic rats harboring human colonic flora, which effects has been
associated with a reduced risk of colon cancer (Cassidy et al., 1990; Satchithanandam et
al., 1990). Moreover, Smirnov et al. (2005) studied the effect of dietary prebiotic and an
antibiotic growth promoter in chicken small intestine. They reported that inclusion of
avilamycin as antibiotic growth promoter in the diet affected mucin biosynthesis by
enhancing mucin mRNA expression in the jejunum and ileum. Their results also showed
that the addition of probiotics increased goblet cell mucin storage in all small intestine
segments, and increased mucin mRNA expression. The authors stated that the probiotic
supplement consisted mainly of Lactobacillus and Bifidobacterium species, which have
been previously shown to increase mucin synthesis and secretion (Belley and Chadee,
1999; Mack et al., 1999). An increased amount of luminal mucin might result from an
increased number of goblet cells and/or increased rate at which mucins are synthesized
and secreted (Tanabe et al., 2005). Studies in vitro and in vivo showed that both mucin
biosynthesis and secretion may be changed by the presence of bacteria, bacterial 28
lipopolysaccharide, and products of bacterial fermentation (Smirnov et al., 2005). At present, a precise mechanism for the increased mucin secretion is not clear (Tanabe et al.,
2005); however, several authors proposed that some prebiotic bacterial strains act on mucin secretion and synthesis via prostaglandin production (Belley and Chadee, 1999;
Shibolet et al., 2002; Kunikata et al., 2002).
1.3.3 The intestinal microflora
The animal and human intestine is the natural habitat for a large and dynamic bacterial community, and some of these bacteria are potential pathogens. Research with animals raised under germ-free conditions has provided important information about the effect of the microbial community of the intestine on host physiology and pathology
(Roberfroid et al., 1995; Falk et al., 1998). Evidence obtained through such studies suggests that microflora have important and specific metabolic, trophic and protective functions. The metabolic function of microflora include the fermentation of non- digestible dietary residue and endogenous mucus, which is important for the recovery of metabolizable energy as short-chain fatty acids (SCFA), production of vitamin K, and absorption of ions. The trophic functions of intestinal microflora include the control of epithelial cell proliferation and differentiation (due to the production of SCFA), and development and homoeostasis of the immune system. The protective function of the commensal microflora against pathogens comprise of different mechanisms, such as occupying attachment sights to the brush border epithelial cells and competitive 29
exclusion by competing for nutrient availability and maintaining a habitat unfavorable to
pathogens.
The bacterial composition (quantity and proportion) is species-specific and varies
depending on animal age, physiological state, gut site, and diet composition, especially
the presence and nature of dietary fiber that is the main bacterial substrate. Langhout
(1999) observed that dietary NSP significantly increases intestinal populations of
pathogenic bacteria at the expense of beneficial bacteria. In addition, colonization of
enteric pathogens is dependent upon the degree of resistance afforded by the stability of
the resident microflora and the integrity of the intestinal mucin barrier in the animal
(Ferket, 2003). Older animals are much less susceptible to the colonization of enteric pathogens than young animals because they have a more stable and diverse intestinal microflora that competitively exclude pathogen colonization.
The major products of fermentation of dietary fiber are short chain fatty acids,
(i.e. acetate, propionate, butyrate, lactate and succinate), water, various gases (CO2, H2,
CH4), and bacterial biomass. The SCFA produced are rapidly absorbed from the intestinal lumen (Argenzio and Southworth, 1974), especially when the luminal pH is low or when
there is a high concentration of SCFA in the lumen (Sakata and Inagaki, 2001). Between
95 and 99% of total SCFA produced is absorbed before reaching the terminal part of the
intestinal tract in most non-ruminant species (Cummings, 1981).
Short chain fatty acids have a major role on the intestinal epithelial physiology. It
has been suggested that SCFA can accelerate intestinal epithelial cell proliferation and
thus change mucosal morphology (Lan, 2004) and enlarge the GIT. Increased intestinal 30
epithelial cell proliferation may increase the metabolic costs to maintain the GIT (Hersom
et al., 2004). The metabolic costs to maintain GIT accounts for about 30% of the total
body metabolic rate (Aiello, 1997). Enlargement of the GIT may compromise lean tissue
growth because more metabolizable energy, amino acids and other dietary resources are
partitioned towards maintenance requirements of enteric tissues, resulting in less efficient
growth (Lan, 2004). However, the accelerated intestinal epithelial cell proliferation can
exceed the rate at which attached bacteria proliferate and invade, thus eliminating
attached pathogens from the gut to the benefit of animal health (Hecht, 1999).
Several mechanisms are involved in the growth-stimulating role of SCFA on animal intestines. Luminal and systemic SCFA stimulate mucosal proliferation by increasing plasma glucagon-like peptide (GLP-2) and ileal pro-glucagon mRNA, glucose transporter (GLUT2) expression and protein expression, which are all signals that can mediate SCFA-induced mucosal proliferation (Tappenden and McBurney, 1998). In addition, SCFA play a major role in the recovery of energy from non-digestible feed ingredients (Jozefiak et al., 2004), intestinal development and homeostasis (Lan, 2004), and immunity (Ishizuka et al., 2004).
Short chain fatty acids in the ceca of avian species can provide other benefits. Van der Wielen et al. (2000) demonstrated that high fermentation activity in chicken ceca was correlated with a lower pH, and this may inhibit some pathogenic bacteria by dissipating the proton motive force across the bacterial cell membrane (Russell, 1992). The antibacterial activity of organic acids increases with decreasing pH-value because pH affects the ability of organic acids to dissociate. Organic acids are lipid soluble in the 31
undissociated form, and they easily enter the microbial cell by both passive and carrier-
mediated transport mechanisms. Once in the cell, the organic acid releases the proton H+ in the more alkaline environment, resulting in a decrease of intracellular pH. This influences microbial metabolism, inhibiting the action of important microbial enzymes and forces the bacterial cell to use energy to export the excess of protons H+, ultimately
resulting in death by starvation. In the same matter, the protons H+ can denature bacterial
acid sensitive proteins and DNA. Generally, lactic acid bacteria are able to grow at
relatively low pH, which means that they are more resistant to organic acids than other
bacterial species, such as E. coli and Salmonella. Lactic acid bacteria, like other Gram-
positive bacteria, have a high intracellular potassium concentration, which counteracts
acid anions (Russell & Diez-Gonzalez, 1998).
Since bacterial species differ from each other in relation to their substrate
preferences, the microbial community in the gastrointestinal tract is very much dependent
upon the diet, the source of substrates for microbial metabolism (Savory, 1992; Wagner
and Thomas, 1987). Lactic acid is one of the principal end-products of microbial
fermentation in the ceca, and lactic acid in turn is a major substrate for the growth of
various intestinal bacteria (Prins, 1977). The ability of the predominant anaerobes to
ferment glucose reflects the saccharolytic nature of cecal bacteria. Lactose fermentation
is also a common property across the major bacterial groups. It is of interest because the
bird itself has little lactase activity, allowing lactose to enter the ceca (Mead, 1989). The
ability of most intestinal bacteria to grow on arabinoxylan, the major NSP present in
wheat, is interesting because cereals of one kind or another comprise a substantial 32 proportion of chicken feed (Mead, 1989). Crittenden et al. (2002) demonstrated
Bifidobacterium were able to grow well using arabinoxylan as a substrate, but it was not fermented by Lactobacillus, enterococci, E.coli, Clostridium perfringens and Clostridium difficile. Additionally, Bartelt et al. (2002) observed in piglets considerable digestibility of insoluble arabinoxylans, but not the entire soluble fiber fraction. However, when a xylanase was added to the diet, digestibility of all fractions was significantly increased.
The authors suggested that this improved digestibility of NSP might be a direct effect of the exogenous enzyme, but also of a stimulated degradation by supporting a specialized group of NSP-hydrolyzing bacteria.
Cellulose fermentation is limited in the poultry cecum, but some aminoacids may be used by some groups of microbes. Mead (1989) reported that the majority of chicken bacteria have the inability to degrade cellulose, supporting the contention that little or no cellulose fermentation occurs in the chicken cecum. For most birds, it is suggested that little cellulose enters the ceca (Vispo and Karasov, 1977). With turkeys, the normal low level of cellulolytic activity in the ceca could be increased by supplementing the diet with plant fiber (Bedbury and Duke, 1983; Duke et al., 1984). Additionally, since undigested dietary amino acids may enter the ceca of birds, these are possible growth substrates for some of the cecal bacteria, especially for putrefactive clostridia and probably other anaerobes (Mead, 1989).
The nature of the carbohydrate determines its fermentability. Van Laere et al.
(1997) studied a range of different short-chain carbohydrates with widely different sugar compositions and molecular sizes and tested their breakdown by several strains of 33
Bifidobacterium, Clostridium, Bacteroides, and Lactobacillus. Fructans were extensively fermented, except by clostridia. They also found that xylooligosaccharides were well fermented and bifidobacteria utilized carbohydrates with low-degree of polymerization.
Bifidobacteria’s major product of fermentation is acetic acid and lactic acid, which inhibit intestinal putrefaction (Taki et al., 2005). Linear oligosaccharides were catabolized to a greater degree than were those with branched structures (Van Laere et al., 1997). This difference may explain why microbial fermentation increases in the large intestine and ceca when diets are supplemented with enzyme that hydrolyze branch polysaccharides to linear oligosaccharides. Steenfeldt et al. (1998) observed a decrease in the pH in the cecal content of chickens as a result of enzyme supplementation. The pH decreased as indicated by higher production of SCFA caused by an increased microbial fermentation. They also observed a significant negative correlation between pH and the apparent digestibility of total-NSP (r= -0.73, P<0.0006). They also found a negative correlation between pH and apparent digestibility of xylose (r= -0.72, P<0.001) and arabinose residues (r= -0.69, P<0.001). Therefore, the results observed by Steenfeldt et al. (1998) indicated that degradation of cell wall arabinoxylan in the enzyme- supplemented diets increased the amount of material available for microbial fermentation in the ceca. Likewise, Choct et al. (1996) reported that volatile fatty acids (VFA) concentration in the ceca was not influenced by elevated amounts of soluble NSP, but concentration was significantly increased by enzyme supplementation. In contrast, they reported that ileal VFA was significantly higher in birds fed diets containing soluble NSP 34
as compared to those fed the control (sorghum/soybean meal) or the enzyme-
supplemented diets.
Microbial diversity concept
The term “diversity” has different meaning when it is used to describe a
population of large organisms (“macrobes”) than when it is used to describe populations
of smaller ones (microbes). One difference is that the former group generally consists of
organisms with distinctive anatomical and morphological features visible to the eye that are the objects of the habitat census, and it is these traits that lead to enumeration or identification of different genera and species present. The sustained presence of an organism is taken as evidence of its significance in the habitat. Usually there is little regard to, or indeed knowledge of, the macroorganism’s precise functions in that habitat
(Leadbetter, 2002). By contrast, establishing the diversity of microorganisms present by relying on morphological features alone is not really possible, specific physiological capabilities also need to be understood in order to establish the different types of microbes present. Invariably, this has required the isolation of pure cultures and determination of cell traits.
The specific biochemical and physiological activities of microbial cells are of profound significance for the habitat (Leadbetter, 2002). The high surface-to-volume ratio of these very small cells endows them with high biochemical and physiological activities, and this in turn affords them to have a major impact on the chemical aspects of their habitats. This important nutrient consumption and product formation as a consequence of microbial growth is such that the organisms are properly regarded as 35
determinants of their habit environments. Thus, microbial diversity leads to establishment
of the bases for and maintenance of the chemical as well as many physical features
(including presence or absence of some commensal or pathogenic species) of the habitat.
Microbial diversity can be studied in many different environments, including the
more usual environments (e.g. association with soils and water), as well as microbes associated extracellularly or intracellularly within macrobes (e.g. animals, insects and plants). One of these important associations is the microbial colonization of the alimentary tract of many macrobes. This association has long been considered an important survival phenomenon (Leadbetter, 2002).
Methods of studying intestinal microbial diversity
The intestinal microflora comprises a diverse collection of culturable and unculturable microbial species. Almost all the knowledge about intestinal bacterial species was based on culture techniques (i.e. cultivation of samples in selective media, generation of pure cultures and subsequent taxonomic identification of the unknown bacterium). In the late 19th century, the practical success of this method for the
identification of bacteria has led to the general belief among medical scientist that all
bacteria are cultivatable by existing methods. Microscopic counts of native samples and
subsequent colony counts after cultivation may differ by more than 2 log10 units (Simon
et al., 2004). This shows that cultivation methods have not yet reached their full potential
and may never be able to allow growth of all bacteria within a given sample.
The main limitations of cultivation methods are unknown growth requirements or
environmental conditions that cannot be reproduced outside the intestine (Simon et al., 36
2004). Possible unknown growth conditions include conditions for bacteria living in close proximity to epithelial tissues because they are very specialized in terms of nutrients requirements (Simon et al., 2004). These microorganisms are known to have obligate
interactions with the host and consequently may not grow on artificial cultivation
conditions (Simon et al., 2004). In addition, many intestinal bacteria develop symbiotic
relationships with other bacteria or other microorganisms and their required growth
conditions are currently unknown (Simon et al., 2004). Other limitations of cultivation
include the selectivity of the medium used, the stress imposed by cultivation procedures,
and the necessity of strictly anoxic conditions (Simon et al., 2004). Estimates of
culturability of bacteria in the gastrointestinal tract vary from 10 to 50% (Zoetendal et al.,
1998). Consequently, insight into the interaction between the host and the microbial
community and how environmental factors influence the microflora was limited by the
exclusive use of cultural procedures for the study of microbial diversity (Zoetendal et al.,
1998). Finally, taxonomic arrangement of bacteria into groups, genera and species was most often carried out by biochemical characterization, such as studies on enzyme activity or metabolite production (Simon et al., 2004). Strains within a species sometimes do not follow the biochemical paths of the majority of strains, and thus, give seemingly erroneous results (Simon et al., 2004).
The use of molecular biology methods has greatly enhanced the knowledge of gastrointestinal bacterial communities. One major advantage of molecular techniques is the rapidity and sensitivity of the determination as compared to culture methods.
Ribosomal DNA (rDNA) and ribosomal RNA (rRNA) has been shown to be excellent 37
markers in order to group bacteria according to their phylogenetic origin (Lane et al.,
1985). Comparison of bacterial rDNA sequences has demonstrated similarities that can be categorized into cluster and sub-cluster groups. These phylogenetic trees correlated well with existing taxonomic systems, while also emphasizing relationships that has lead to the generation of new taxa (Simon et al., 2004).
Currently, ribosomal RNA or DNA analysis is the most commonly used measure of environmental diversity. Microbial diversity characterization is based upon the species as a unit (Magurran, 1988). Species diversity consists of two components, species richness and species evenness (distribution). Species richness (or species abundance) is used to describe the number of species present, and species evenness (or species equitability) is used to describe how evenly individuals are distributed among these species (Hill, 1973).
Certain attributes of the rRNAs favor their use as molecular markers. The sequence that code for rRNA is among the most highly conserved (Woese, 1987). The rRNA can be viewed as composed of structural domains in which sequence variation differs with respect to increasing phylogenetic distance. Regional differences in sequence conservation have provided the basis for designing nucleic acid probes of various specificities; group- and species-specific oligonucleotide probes have been used for direct assessment of environmental diversity (Liu and Stahl, 2002). The accuracy of phylogenetic inference is dependent not only upon the number of bases compared, but also upon the particular regions of the molecule compared. The rRNAs of many eukaryotes and some prokaryotes differ significantly in size. The small-subunit rRNA 38
and large-subunit rRNA refer to the 16S and 23S rRNAs, respectively. The small subunit
rRNA (ca. 1,500 nucleotides) provides a large amount of information useful for
phylogenetic inference. The large subunit rRNA (ca. 3,000 nucleotides) contains about
twice as much information as the small subunit rRNA, and therefore should provide
greater accuracy of phylogenetic inference. However, the smaller rRNA subunit has
become the established reference for phylogenetic inference because it is much easier to
sequence. The larger subunit rRNA has been used primarily as a supplement to the small
subunit rRNA data for resolving closely spaced evolutionary branching (Liu and Stahl,
2002).
Molecular fingerprint, otherwise known as community fingerprint or phylogenetic
fingerprint, has been used for rapid surveys using genes that provide for either
phylogenetic or diversity assessment of the populations present in a sample. Denaturing
gradient gel electrophoresis (DGGE) of 16S rDNA amplicons is a quick, economical and
reliable technique for the analysis of microbial community fingerprint (Muyzer et al.,
1993). The DGGE method is based upon the analytical separation of DNA fragments of
identical or near-identical lengths but with varying sequence compositions. Separation is
based on the changing electrophoretic mobilities of DNA fragments migrating in a gel containing a linearly increasing gradient of DNA denaturants (urea and formamide) or temperatures (for the temperature gradient gel electrophoresis, TGGE). Changes in fragment mobility are associated with partial melting or the denaturing DNA sequences in discrete regions, the so-called melting domains. When the DNA enters a region of the gel containing sufficient denaturant, a transition of helical to partially melted molecules 39
occurs, and migration is severely retarded. Sequence variation within such domains alters
the melting behavior, and sequence variants of the different amplification products stop
migrating at different positions in the denaturing gradient (Liu and Stahl, 2002). DNA
can be collected from bands on the DGGE gel, which can be sequenced for phylogenetic analysis (Hoj et al., 2005). This technique has been commonly used to profile the
intestinal microbial community of humans (Liu and Stahl, 2002), pigs (Collier et al.,
2003a, Konstantinov et al., 2003), mouse (MacCracken et al., 2001), broiler chickens
(Collier et al., 2003b; Hume et al., 2003), composting processes (Ishii and Takii, 2003),
and soil (Torsvik et al., 1998; Kirk et al., 2004). However, the DGGE technique has been
shown to select only 90 to 99% of the total microbial population because less dominant
bacteria do not form visible DGGE bands, although most of them can be selected using
other molecular approaches, such as cloning (Zoetendal et al., 1998; Konstantinov et al.,
2003). Therefore, molecular methods are valuable tools for investigating the diversity and
structure of bacterial communities. Combining the different methods that complement
each other is a useful strategy for monitoring changes in microbial communities and
ecosystems (Torsvik et al., 1998). More information can be found in the literature
regarding methods of studying intestinal microbial diversity (McInerney and Stahl, 2002;
Liu and Stahl, 2002).
1.4 BACTERIAL ENTERITIS OF POULTRY
Poultry must have a healthy and functional intestinal tract to maintain the
excellent feed efficiency that is required by modern production standards. Low-grade 40
damage to the intestinal tract by pathogenic bacteria may cause poor feed efficiency and
decreased rate of gain that increase the total production costs. In addition, more severe
enteric damage by bacterial infection will cause disease and high mortality in a poultry
flock. Currently, Clostridium and Salmonella are two important bacteria of concern in the
poultry business. While the main concern of Clostridium infections is performance losses
including increased mortality, salmonellosis is a factor in food safety.
1.4.1 Clostridiosis
Clostridium perfringens is Gram-positive bacilli that produce spores, anaerobic,
opportunistic, nonmotile bacterium of variable size that is capable of causing a broad
spectrum of human and veterinary diseases. The bacterium’s pathogenicity is largely
derived from its prolific ability to express protein toxins that are active in the
gastrointestinal tract (McClane, 2001). These toxins can cause a disease called necrotic
enteritis, which threatens gastrointestinal health and livability of many poultry flocks
(Porter Jr., 1998). Clostridium may cause low-grade damage to the intestinal tract, leading to poor feed efficiency, decreased rate of gain and increased production costs.
1.4.2 Colibacillosis
Colibacillosis, an infectious disease affecting a wide variety of birds, involves
Escherichia coli as the primary or secondary pathogen. E. coli is a Gram-negative rod that is widespread in nature, and it is a normal inhabitant of the intestinal tract of poultry
(Gross, 1994). Feces and dust in the poultry house are important vectors of pathogenic E. 41 coli, which can be either ingested or inhalated (Gross, 1994). The major signs of colibacillosis of poultry are yolk sac infection, respiratory disease complex (airsacculitis, perihepatitis, pericarditis), acute septicemia, salpingitis, peritonitis, synovitis, osteomyelitis, cellulitis, and enteric coligranuloma. Young birds with little resistance to infection usually die from septicemia. Older birds are often resistant and survive, but damage to the intestinal tract by E. coli leads to poor performance and increased production costs.
1.4.3 Pasteurellosis
Pasteurellosis or fowl cholera is a severe systemic bacterial infection that affects chicken, turkeys, ducks, and game birds. Pasteurella multocida is the causative agent of fowl cholera. Pasteurella multocida is a Gram-negative, nonmotile rod or coccobacillus that varies in virulence, depending on the strain (Rhoades et al., 1989). Pasteurellosis is most common in adult birds. Death is usually caused by bacteremia and endotoxemia, especially in acute cases. Birds often die without clinical signs, but may be depressed with cyanosis and diarrhea. Gross lesions are septicemic in character and consist of hemorrhages and small necrotic foci scattered throughout the liver and other viscera, and marked mucus accumulation and congestion of the small intestine may be observed
(Porter Jr., 1998). Necrofibrinous pneumonia is often present in turkeys (Glisson, 1996).
42
1.4.4 Salmonellosis
Salmonella is a Gram-negative, non-sporulating, aerobic, and opportunistic bacterium that can cause enteric lesions in poultry. Salmonella colonization and transmission often occur by the fecal-oral route. Disruption of the normal intestinal microflora by antibiotic therapy or feed deprivation, and concomitant coccidal infection can increase the host’s susceptibility to Salmonella infection (Porter Jr., 1998).
Salmonella infection in poultry has been commonly associated with alimentary toxicosis and severe infection in people who consumed contaminated poultry meat or eggs (Porter
Jr., 1998). Contamination of meat with Salmonella occurs during slaughter and meat processing. Salmonella can be found in the gastrointestinal tract of poultry without the birds necessarily developing pathogenic signs. However, Salmonella infection can cause low-grade damage to the intestinal tract of poultry that causes poor feed efficiency and decreased rate of gain without apparent signs of disease (e.g. mortality) (Porter, 1998).
An important means of preventing human salmonellosis is by preventing infection in poultry (Porter Jr., 1998). Inadequate decontamination of poultry houses can lead to several possible contamination sites, such as litter, air, and feed. Also, raising birds in close proximity to other birds (wild or domestic) increases the likelihood of horizontal transfer. Although hygiene and vaccination may limit Salmonella colonization in chicken, nutrition has been shown to be a complementary element on the presence or control of
Salmonella in the poultry production (Hafez, 1999).
43
Salmonella classification
Members of genera belonging to the Enterobacteriaceae family have earned a
reputation placing them among the most pathogenic and most often encountered
organisms in clinical and veterinary microbiology. The genus Salmonella is one of the
members of this family. Only two species are to be recognized in the genus Salmonella,
such as Salmonella enterica and Salmonella bongori (Tindall et al., 2005). Salmonella bongori appears to be rare worldwide and serotypes of such species have been infrequently isolated in different countries, mainly from cold blooded animals (Pignato et al., 1998). Salmonella enterica is divided into six subspecies, such as Salmonella enterica subsp. (1) enterica, (2) arizonae, (3) diarizonae, (4) houtenae, (5) indica, and (6)
salamae (Tindall et al., 2005).
Both, the species Salmonella bongori and the 6 subspecies of Salmonella enterica
are further divided into over 50 serogroups and 2400 serotypes based on Kauffman-White
classification scheme. The identification of serogroups is based on “O” (somatic/cell
wall) antigen. The “O” antigens consist of the lipopolysaccharide-protein chains exposed
on the cell surface. The serogroups are further divided into over 2400 serotypes based on
flagellar (H) antigen (USDA-ARS, 2004). All Salmonella serotypes are considered
potentially pathogenic. Some serotypes are host specific, but the majority can affect
different hosts (Porter Jr., 1998).
Model research pathogen
Salmonella is not only an ongoing threat to worldwide public health, but also an ideal foodborne pathogen model for research to examine the relative efficacy of 44
antimicrobial compounds (Ricke et al., 2005). Salmonella represents one of the better
understood and studied pathogens for designing effective intervention steps based on
mechanisms that the organism can potentially express (Ricke et al., 2005). Salmonella
Typhimurium has long served as a model organism for genetic studies, and a wide variety
of classical and molecular genetic tools exist for the identification and characterization of
potential Salmonella virulence genes (Ohl and Miller, 2001). The availability of in vitro
tissue culture and small-animal models of infection have facilitated its use in research.
Furthermore, the intricacies of the host pathogen interactions that determine the outcome
of Salmonella infections has been largely studied (Ohl and Miller, 2001). Aspects of
bacterial metabolism, including substrates and products, have been reported (Batzing,
2002; Pommerville, 2004). Finally, a wide variety of techniques of isolation and
identification have been published (Batzing, 2002; Pommerville, 2004). Therefore,
Salmonella, in addition to being one of the more troublesome and resourceful pathogens,
has also served as a fairly useful model of foodborne pathogen for research (Ricke et al.,
2005).
1.5 NUTRITIONAL STRATEGIES TO MODULATE INTESTINAL HEALTH
AND PATHOGEN COLONIZATION OF POULTRY
Several strategies have been proposed as a means to manage intestinal health through diet formulation (Figure 5). Growth-promoting antibiotics work in part by
decreasing the microbial load in the intestinal tract, resulting in a reduction in energy and
protein required to maintain and nourish the intestinal tissues; thus, more nutrients are 45
partitioning toward growth and production. In contrast, most natural feed additives do not
reduce overall microbial loads. Instead, they alter the intestinal microflora profile by
limiting the colonization of unfavorable bacteria and promote the activity or growth of
more favorable species. These natural feed additives promote intestinal health by several
possible mechanisms: altering intestinal pH; maintaining protective intestinal mucins;
selection for beneficial intestinal organisms or against pathogens; enhancing fermentation
acids; enhancing nutrient uptake; and increasing the humoral immune response (Ferket,
2003).
To illustrate that diet composition can greatly influence intestinal health,
Apajalahti et al. (2001) surveyed the microbial community of broilers raised on eight
commercial poultry farms in Finland and fed different commercial wheat-based diets,
some with locally added whole wheat. They surveyed different seasons (spring and fall)
and years (1997, 1998, and 2000). They showed that diet was the strongest individual
determinant of the total microbial community structure in the ceca of broiler chickens,
whereas profiles of individual farms with identical feed regimes hardly differed from
each other. They also did not observe significant seasonal or annual variation of the
colonic microbial community. Therefore, it is possible to shift the microbial community from harmful to non-harmful bacteria by dietary ingredient formulation (Gibson and
Roberfroid, 1995; Gibson, 1998; Collins and Gibson, 1999).
In response to the need for alternatives to feed-additive antibiotics, research and development effort has focused on the quest for effective replacements, as indicated by the plethora of performance enhancers appearing on the world market. Although there is 46
growing scientific support for many of these antibiotic replacements (Rosen, 2003;
Hooge, 2003), the claim of efficacy is in many cases inadequately substantiated (Rosen,
2003).
There are several features that characterize a feed additive product as an effective alternative to growth promoting antibiotics: 1) it should have a significant and sustainable beneficial impact on animal production and health; 2) it must be proven to be safe for both the animal and human population; 3) it should be stable during storage; 4) it should
be easy to handle; 5) it should be easy to apply during the feed manufacturing process;
and 6) it must provide a substantial return on investment (Collett and Dawson, 2001). An
average improvement of 2.26% in feed conversion ratio (FCR) and 1.41% in weight gain
in 74% of the cases has been established as the standard by decades of antibiotic use and
research (Rosen, 2003). These data and years of field use provide the potential antibiotic
user with a certain degree of confidence. Thus, the performance responses and economic
value of using alternative feed additive products should approach those that result from
antibiotic use if they are to be truly considered as alternatives.
Perceived failure of antibiotic replacements to satisfy expectations for
equivalence to antibiotics in the field has increased industry skepticism and reduced the
credibility of research on these alternative products. The search has been for a single
intervention or product to replace antibiotics and this has slowed progress (Collett, 2004).
It has become increasingly clear that a multi-factorial approach is needed. A number of
options are available for enhancing the performance of poultry in the absence of specific
feed-additive antibiotics. An alternative strategy or program must yield comparable 47
economic return, and production efficiency must be sustainable if it is to be accepted for
commercial use.
Many alternative programs are available for enhancing the performance of poultry
in the absence of antibiotic growth promoters. Some of them are further discussed in this
section. One prominent program involves the manipulation of the dietary carbohydrate
composition (altering dietary NSP level) and enzyme supplementation in order to change
microflora and promote intestinal health (Simon et al., 2004; Hogberg and Lindber,
2004). The use of enzymes that hydrolyze NSP is now an established part of the feed
industry, and its effect on the nutrient utilization and improvement of performance has
been widely studied and shown effective (Jensen et al., 1957; Silva and Smithard, 2002;
Engberg et al., 2004). Current research data showed that enzyme supplementation indirectly modifies the enteric microflora ecosystem towards a more healthy state when supplemented to diets high in NSP content. Hogberg and Lindberg (2004) studied the
influence of cereal-NSP and enzyme supplementation on digestion and intestinal
environment and showed that the substrate for the growth of lactic acid bacteria was
released in the diet when enzyme was added. The release of those carbohydrates when
enzyme was added to the diet apparently supported the growth of Lactobacillus. This
observation supports the literature indicating cereal-based diets high in NSP and enzyme
supplementation promote intestinal health and exclude pathogens (Pluske et al., 2001).
48
1.5.1 Antibiotics
Antibiotics are natural metabolites of fungi that inhibit the growth of bacteria by altering certain properties of bacterial cellular metabolism, resulting in impaired growth or death. Some antibiotics interfere with the building and maintenance of the cell wall,
while others interrupt proper protein translation at the ribosomal level (Ferket, 2003).
Antibiotics have been used in agriculture to promote growth and welfare of animals for
about 50 years in the United States and other countries (Dibner and Richards, 2005).
Many of these antibiotics are given at sub-therapeutic dosage and are commonly called
Antibiotic Growth Promoters (AGP). Early indications of beneficial effects on production
efficiency in poultry and swine were reported by Moore et al. (1946) and Jukes et al.
(1950). One of the first reports of resistance in food animals was made by Starr and
Reynolds (1951) after experimental feeding of streptomycin in turkeys. Early concerns
about the development of antibiotic resistance in human pathogens and recommendations
to ban subtherapeutic use in animal feed were discussed by Swann in a report to the
British Parliament (1969). The long term and extensive use of antibiotics in human and
veterinary medicine has resulted in selection of resistant bacterial strains. Genes encoding
for this resistance have been also transferred to other formerly susceptible bacteria, thus
posing a threat to both animal and human health (Montagne et al., 2003).
Antibiotic usage by the food animal industry has come under increasing scrutiny
by some scientists, consumers, and government regulators because of potential
development of antibiotic-resistant bacteria, including pathogenic strains (Roe and Pillai,
2003; Ferket, 2003; Woodward, 2005). Resistance among Gram-negative bacteria, like E. 49
coli and Salmonella spp., has generated the strongest objection to antibiotic use
(Gustafson and Bowen, 1997). As an illustration of many other surveys in the literature
conducted to show antimicrobial resistance, Nayak and Kenney (2002) showed that 25%
of the Salmonella isolates from turkey flocks in West Virginia were resistant to one or
more antibiotics, including gentamicin, spectinomycin, streptomycin, tetracycline,
tobramycin, and trimethoprim/sulfamethoxazole. Consequently, some countries have
banned (Sweden started on January 1986) or limited (European Union started on January
2000 and total withdrawal will start on January 2006) the general use of feed-additive
antibiotics for growth performance enhancement in livestock.
Current antibiotic debate
The European Union (EU) ban on the use of most of the sub-therapeutic
antibiotics in animal feed was based on fears of antibiotic resistance being spread via the
food chain and proposed the precautionary principle since 1997 (Cervantes, 2005). On
January 1st, 2006 the remaining antibiotic feed additives used in food-producing animals
will be banned from use in the EU (Immerseel et al., 2004). Cervantes (2005) reviewed
the impact of the ban of antibiotic in EU based on The Danish Integrated Anti-microbial
Resistance Monitoring and Research Programme (DANMAP). DANMAP is the oldest
and most complete source of data monitoring antibiotic use and antibiotic resistance in
animals and humans; consequently, it is a good source to evaluate the consequences of
antibiotic ban in EU and the importance of antibiotics for animal production and human
health. Cervantes (2005) reported that the ban of antibiotic feed additives has resulted in a significant decrease of antibiotic resistance among bacteria isolated from raw meat 50 products. Cervantes (2005) stated that this decrease in antibiotic resistances was expected because it is a known fact that antibiotic use will create antibiotic resistance, whether in animals or people. However, he demonstrated that the increase of antibiotic resistant- bacteria isolated from raw meats have not translated into lower levels of antibiotic resistance in human patients.
Associated with the ban on feed-additive antibiotic use was a rise in the incidence of colibacillosis and necrotic enteritis in poultry (Truscott and Al-Sheikhly, 1997; Ferket,
2003) and pigs (Casewell et al., 2003; Cervantes, 2005). Also, observed after the ban on
AGP are general decreases in performance, nutrient uptake, intestinal health, and profitability of livestock production (Lovland and Kaldhusdal, 2001; Casewell et al.,
2003; Cervantes, 2005). Thus, one could argue that the ban on AGP has undermined animal welfare (Cervantes, 2005). Casewell et al. (2003) stated that the antibiotic feed additives had an important prophylactic activity that was previously unrecognized. Their withdrawal from the market is now associated with a deterioration in animal health as evidenced by an increased incidence of diarrhea, weight loss, and mortality in post- weaning pigs, and necrotic enteritis in broiler chickens. In the light of the growing body of evidence, Casewell et al. (2003) declared that “the theoretical and political benefit of the widespread ban of growth promoters needs to be more carefully weighed against the increasingly apparent adverse consequences”.
The surge in enteric diseases in livestock production in Denmark was followed by a surge in antibiotic use in those animals for therapeutic or veterinary purposes (Figure 6,
DANMAP, 2004). The veterinary consumption of prescribed antimicrobials increased 51 from 48,000 kg in 1996 to 112,500 kg of active antimicrobial compound in 2004. This represented an approximately 135% increase of antimicrobial compound used for veterinary purposes within 8 years. Moreover, the therapeutic antibiotics used to treat those food-producing animals are among the various classes of antibiotics most frequently used in human medicine (Cervantes, 2005). It is the significant rise in the use of therapeutic antibiotics use that poses a greater risk to the creation of antibiotic resistance of human pathogens than the use of AGP feed additives (Cervantes, 2005).
Consequently, the ban of AGP feed additives has not resulted in any measurable decrease in the incidence of antibiotic resistance of pathogens in human patients or human hospitals (Cervantes, 2005).
FIGURE 6: Consumption of prescribed antimicrobials and growth promoters in animal production and prescribed antibacterials in humans at Denmark. Source: DANMAP, 2004.
52
The human consumption of antimicrobials has been increasing in Denmark
(DANMAP, 2004). The consumption of antibacterials in Danish hospitals has increased
from 38,760 kg in 1997 to 44,131 kg of active antimicrobial compound in 2004
(DANMAP, 2004). This represented an approximately 14% increase of antimicrobial
compounds consumed for systemic use in humans in Denmark. The DANMAP (2004)
report stated that the continued increase in the consumption of broad spectrum
antibacterials for human patients is likely to result in increased resistance in hospitals.
From 1999 to 2004, there was a significant increase of Salmonella Typhimurium resistance to tetracycline (P<0.0001) and ampicillin (P<0.0001) in pigs (DANMAP,
2004). This increased in resistance coincided with increased veterinary use of tetracycline and broad spectrum penicillin for treatment of pigs during the same time period
(DANMAP, 2004). Thus, because of this and the examination of many other published research reports, that a review assessing the results of the EU ban on antibiotic feed additive concluded that there is no concrete evidence that support the claim that the use of antibiotic feed-additives for farm animals results in bacterial resistance to therapeutic antibiotics used in human medicine, and that a ban of growth promoting antibiotics can not be justified on this basis (Cervantes, 2005).
Despite the political and pseudoscientific arguments propagated, it is a scientific fact that rapidly reproducing bacteria, with a few exceptions, will inevitably develop resistance to antibiotic drugs (Cervantes, 2005). Thus, a continuous effort to research and develop new antibiotics, antibiotic alternatives, and combination of strategies are important for treatment of diseases in animals and humans, and to achieve good intestinal 53 health and growth performance of production animals (Avery, 2001). For the poultry industry, the key is to select the most cost-effective approach, which depends on the production requirements of each company and the type of production challenges they face (Ferket, 2003).
Common antibiotics used in poultry feed
Table 1 represents the major antibiotic growth promoters used in animal feed and their antibacterial mode of action (Gaskins et al., 2002). Most growth promoting antibiotics target Gram-positive organisms (Gaskins et al., 2002).
TABLE 1: Major antibiotic growth promoters used in animal feed and their antibacterial mode of action1
Class Generic Name Spectrum Mechanism of Action Diterpene Tiamulin Gram+ Protein synthesis inhibition Glycopeptide Avoparcin Gram+ Cell wall synthesis inhibition Lincosaminides Lincomycin Gram+ Protein synthesis inhibition Macrolide Tylosin/Spiramycin Gram+ Protein synthesis inhibition Oligosaccharide Avilamycin Gram+ Protein synthesis inhibition β-lactam Penicillin Gram+ Cell wall synthesis inhibition Peptides Bacitracin/Bactitractin Gram+ Cell wall synthesis inhibition Streptogramin Virginiamycin Gram+ Protein synthesis inhibition Phosphoglycolipid Bambermycin Gram+ Cell wall synthesis inhibition Polyether Salinomycin/Nerasin Gram+ Membrane alterations Quinoxalines Carbadox/Olaquindox Broad DNA synthesis inhibition Sulfonamides Sulfamethazine/Sulfathiazole Broad Metabolic inhibition Tetracycline Chlortetracycline/Oxytetracyline Broad Protein synthesis inhibition 1 Gaskins et al. (2002).
Alternatives to antibiotics
The most common alternatives to antibiotics for performance enhancement can be divided into two groups. First are the nutritional alternatives, which are composed of 54 prebiotics, probiotics, synbiotics, enzymes, acidifiers and organic acids, and herbs, spices and essential oils. The second group is composed of antibodies, bacteriophage, bacteriocins, and antimicrobial peptides. Each of these nutritional alternatives is further discussed in detail below.
Antibodies are immunoglobulins that are produced by an animal in response to specific antigens, and they counter their specific effects by neutralizing toxins, agglutinating bacteria or cells, and precipitating soluble antigens. The modes of action of antibodies include the promotion of phagocytosis at the site of infection, activation of the complement cascade, followed by an inflammatory response and attraction of phagocytes, and the initiation of antibody-dependent cellular cytotoxicity executed by monocytes, neutrophils, and natural killer cells (Berghman et al., 2005). Mammalian species do not transmit maternal immunity prenatally, but postnatally through colostral antibodies (Berghman et al., 2005). In poultry, maternal antibodies are transmitted to the offspring via the yolk of the eggs (Carlander et al., 2000). As a consequence, colostrum and egg yolk were the first and the best sources of antibodies that are routinely used for prophylaxis and therapy of infectious diseases in an agricultural settings (Berghman et al., 2005). Although the benefits of feed supplementation with pathogen-specific antibodies as colostrum and egg yolk from hyperimmunized animals are undisputed, it is not economically feasible to become a common practice, especially in an agricultural context (Berghman et al., 2005). Production of standardized immune colostrum and egg yolk is labor intensive and production costs are high. Also, treatment with antibodies is common on an individual basis that represents an additional obstacle when an entire flock 55 needs to be treated (Berghman et al., 2005). Finally, there is still a widespread misconception that orally administered antibodies simply get digested and inactivated in the GIT, as with any other protein (Berghman et al., 2005).
Bacteriocins are proteinaceous compounds lethal to bacteria other than the producing strain. Their activity can be narrow or broad and they have a mode of action on membrane disturbance similar to antibiotics. The administration of bacteriocin-producing bacteria rather than the bacteriocins themselves might be a more cost-effective approach.
However, large scale production of bacteriocins or bacteriocin-producing bacteria is currently infeasible (Joerger, 2003).
Antimicrobial peptides are small molecules with a molecular mass of 1 to 5 kDa.
Their structure usually contains elements that facilitate the interaction with negatively charged membranes, and their mode of action involves the cell membranes of target organisms (Hancock and Rozek, 2002). In this respect, these peptides resemble some of the small bacteriocins like Nisin, and the development of resistance to these peptides require changes in the membrane. Development of strains resistant to antimicrobial peptides has been observed (Joerger, 2003). The production of small antimicrobial peptides is not confined to bacteria, but appears to occur in all organisms studied so far
(Joerger, 2003). As an example of many antimicrobial peptides present in different organisms, Harwig et al. (1994) purified three antimicrobial peptides (gallinacins) from chicken leukocytes and showed that they inhibited in-vitro L. monocytogeneses and
E.coli growth. Also, three peptides isolated from turkey heterophil granules inhibited the growth of S. aureus and E. coli (Evans et al., 1994). Such natural peptides, as well as 56
artificial peptides derived by combinatory chemistry or rational design, have attracted
great attention in recent years (Hancock, 1997; Hancock and Lehrer, 1998). The
administration of antimicrobial peptide-producing bacteria, rather than the peptide
themselves, is being studied along with transgenic plants with a high concentration of
these peptides (Joerger, 2003). As with bacteriocins, the proteinaceous nature of
antimicrobial peptides makes them vulnerable to proteolytic enzymes of the gastro-
intestinal tract. Perhaps, these peptides have to be modified chemically to make them
more resistant to proteolysis in animals, which would increase the cost of antimicrobial
peptide treatment (Joerger, 2003). Currently, chemical synthesis appears too costly for
large-scale production of peptides, and biological production with transgenic-
microorganisms have to be attempted (Joerger, 2003).
Bacteriophages are viruses that infect and multiply in bacteria. For many
bacteriophages, release into the environment after replication is accompanied by lysis of
the host bacterium. This event is easily observed in test tubes and on agar plates, and its
exploitation for killing infectious bacteria was suggested almost immediately upon
discovery (Joerger, 2003). However, some phages produce progeny without destroying
their bacterial host, others have means to temporarily integrate their genome into that of
the bacterium where it is replicated along with the bacterial genome and potentially
introduces new traits or modifies the expression of host traits. While part of the bacterial
genome, the phage DNA sequences can participate in recombination events, leading to modifications of the phage genomes. There are now numerous accounts of phage
encoding virulence genes or of phage integrated into bacterial genomes that influence 57
expression of bacterial genes, among them toxin- or antibiotic-resistance genes
(Schicklmaier and Schmieger, 1995; Alisky et al., 1998; Mirold et al., 2001).
Additionally, intestinal tract pH, digestive enzymes and bile are potential adverse factors that may limit the use of bacteriphages orally (Jorger, 2003). However, one feature that makes bacteriophage attractive is their highly discriminatory nature, they are very stable and they survive storage relatively well. Most of the known bacteriophages are specialists
that interact only with a specific set of bacteria that express specific binding sites (Jorger,
2003). Thus, despite the disadvantages, there is some optimism that medical applications
will be pursued in the not too distant future (Pirisi, 2000).
1.5.2 Probiotics
A probiotic (direct-fed microbial) is defined as “a live microbial feed supplement
that beneficially affects the host animal by improving its intestinal balance” (Fuller,
1989). Lactobacillus and Bifidobacterium species have been used most extensively in
humans, whereas species of Bacillus, Enterococcus, and Saccharomyces yeast have been
the most common organisms used in livestock (Salminen et al., 1998). Live yeast is a
probiotic, but yeast cell-wall is prebiotic (discussed later). Probiotics have a similar mode
of action as prebiotics because both increase the colonization of commensal bacteria at
the lower intestinal tract.
Probiotic microorganisms inhibit growth of potentially pathogenic
microorganisms by competitive exclusion (CE) or the so-called “Nurmi concept” (Nurmi
and Rantala, 1973). Competitive exclusion of commensal microflora against pathogens 58
include: 1) lowering the pH through production of lactate, lactic acid and SCFA; 2) competing for gut lining attachment and available nutrients; 3) producing bacteriocins; 4)
stimulating the gut associated immune system through cell wall components (Nousiainen
and Setala, 1998); and 5) increasing the production of SCFA, which have bacteriostatic
and bactericidal properties (Fuller, 1977) and stimulate intraepithelial lymphocytes, and
natural killer cells (Ishizuka and Tanaka, 2002; Ishizuka et al., 2004). Thus, probiotics
have been shown to improve performance, decrease mortality, and improve FCR of poultry.
Most commercial probiotic products are composed of pure defined cultures of one or more micro-organisms. Thus, prebiotic is also known as defined competitive exclusion cultures. Defined competitive exclusion cultures given to broilers have been shown to
decrease Salmonella Typhimurium (Corrier et al., 1995). Also, undefined competitive
exclusion products originating from adult intestinal microbiota are usually inoculated to
1-day-old chicks in order to control of Salmonella contamination (Mead, 2000b).
Combinations of prebiotics and probiotics are known as synbiotics (Patterson and
Burkholder, 2003). Availability of prebiotics specifically targeting specific bacterial
strains would enable the development of a synbiotic product blend. A synbiotic blend is
especially important for strains of probiotic microorganisms with poor survival
properties, and it enhances the effect of the probiotic as a treatment of enteric disease
(Rastall and Maitin, 2002).
Probiotics have some disadvantages in comparison to other modulators of enteric
microflora (Fooks et al., 1999; Patterson and Burkholder, 2003; Isolauri et al., 2004). 59
Relatively few species of microorganisms can be considered for use in probiotics products due to their limited knowledge of culturability and required conditions for application and storage, such as extreme anaerobiosis. Probiotics have a short shelf-life and most are labile to excessive heat and pressure during feed processing. Some probiotic microorganisms may be reduced or eliminated by the low pH in the gizzard, and thus have little effect in the lower intestinal tract where pathogens pose problems. If a probiotic is added to the drinking water, the chlorine sanitizer may adversely affect its survivability. Acidification would be a better sanitizer than chlorine when delivering a probiotic via the drinking water. Coating technology has helped with some of these concerns, but more research is needed.
1.5.3 Herbs, spices, and essential oils
Herbs, spices and essential oils have been used to make human foods more appetizing for centuries, and many of them are recognized for their health benefits. It is difficult to distinguish between them, because an essential oil is a mixture of fragrant and volatile compounds, named after the aromatic characteristics of plant materials from which they are isolated (Oyen and Dung, 1999). The term ‘essential’ was adapted from the theory of ‘quinta essentia’ proposed by Paracelsus, who believed that this quintessence was the effective element in a medical preparation (Oyen and Dung, 1999).
Because the term, ‘essential oil’ is a poorly defined concept from medieval pharmacy, the term ‘volatile oil’ has been proposed by Hay and Waterman, (1993) to be more appropriate. However, the name of ‘essential oil’ is still preferentially used. Essential oils 60 are very complex mixtures of compounds and their chemical compositions and concentrations of individual compounds are variable. For example, the concentrations of two predominant components of thyme essential oils (i.e. thymol and carvacrol) have been reported to range from as low as 3% to as high as 60% of total essential oils
(Lawrence and Reynolds, 1984). Cinnamaldehyde, a main component of cinnamon essential oil, amounts to approximately 60 to 75% of the total oil (Duke, 1986b). Because of the large variation in composition, the biological effects of essential oils may differ
(Schilcher, 1985; Janssen et al., 1987; Deans and Waterman, 1993).
Essential oils have long been recognized for their anti-microbial activity (Lee et al., 2004a), and they have gained much attention for their potential as alternatives to antibiotics. Lee and Ahn (1998) found that cinnamaldehyde, derived from the cinnamon essential oil, strongly inhibits Clostridium perfringens and Bacteroides fragilis in vitro, and moderately inhibits Bifidobacterium longum and Lactobacillus acidophilus isolated from human. Also, a wide range of in-vitro anti-microbial activities of essential oils derived from cinnamon, thyme and oregano have been published (Deans and Ritchie,
1987; Lee et al., 2004a). Although the exact anti-microbial mechanism of essential oils is poorly understood, it may be associated with their lipophilic property and chemical structure (Lee et al., 2004b).
Helander et al. (1998) investigated how two isomeric phenols, carvacrol and thymol, and the phenylpropanoid, cinnamaldehyde, exert their antibacterial effects on E. coli O157 and S. Typhimurium. Both carvacrol and thymol disintegrated the membrane of bacteria, leading to the release of membrane-associated materials from the cells to the 61
external medium. Conversely, cinnamaldehyde exhibited its antibacterial activity due to
its lipophilicity of terpenoids and phenylpropanoids, which can penetrate the membrane
and reach the inner part of the cell and impair bacterial enzyme systems. Therefore, these plant-based phenolic compounds have antimicrobial effects similar to antibiotic
compounds produced by fungi. As with antibiotics, continued use of these plant-based
antimicrobials may result in the development of resistance in some pathogenic bacteria
(Lee et al., 2004a). However, more research is necessary to confirm this risk. To be as
effective as growth promoters, these herbal antimicrobial compounds must be
supplemented to the feed in a more concentrated form than found in their natural state,
which will increase usage costs.
1.5.4 Acidifiers and organic acids
Acidifiers and organic acids have been used for decades in feed preservation, protecting feed from microbial and fungal destruction or to increase the preservation effect of fermented feeds (e.g. silages). Because organic acids have strong bacteriostatic effects, they have been used as Salmonella-control agents in feed and water supplies for livestock and poultry (Ricke, 2003). The most common organic acids in animal nutrition are citric acid, propionic acid, fumaric acid, lactic acid, formic acid and benzoic acid.
Additionally, some other available acidifiers and organic acids have been shown to have some antimicrobial activity (Russell, 1992).
Experiments with pigs have shown that several organic acids, including citric acid, fumaric acid, formic acid, and propionic acid, have a positive influence on growth 62 performance (Partanen and Mroz, 1999). It has been reported that the nutritive effect of organic acids is most pronounced in weaning pigs (Gabert & Sauer, 1994; Roth &
Kirchgessner, 1998), which often suffer from digestive disturbances resulting in diarrhea related to infections with E. coli. Problems at weaning may be triggered by an insufficient production of hydrochloric acid and digestive enzymes, and the feeding of a pre-starter diet with high protein content (Eidelsburger, 1997, Canibe et al., 2001). In addition, dietary acidification increases gastric proteolysis and protein and amino acid digestibility.
The acid anion has been shown to complex with Ca, P, Mg and Zn, which improves the digestibility of these minerals. Furthermore, organic acids serve as substrates in the intermediary metabolism (Canibe et al., 2001).
The use of organic acids has not gained as much attention in poultry production as it has in pig production, partly because limited positive responses in weight gain and feed conversion (Langhout, 2000). However, Vogt et al. (1982) reported a positive influence on either feed conversion ratio or growth performance by dietary supplementation of fumaric acid, propionic acid, sorbic acid and tartaric acid in broiler diets. Organic acids have mainly been used to sanitize the feed and reduce Salmonella colonization in poultry
(Iba and Berchieri, 1995; Thompson and Hinton, 1997). An objective of dietary acidification is to inhibit of intestinal bacteria competing with the host for available nutrients, and reduce toxic bacterial metabolites (e.g. ammonia and amines).
The antibacterial activity of organic acids is related to the reduction of pH, as well as their ability to dissociate, which is determined by the pKa-value of the respective acid, and the pH of the surrounding milieu (Collett, 2004). The dissociation of an organic acid 63
in solution is predictable and in accordance with the Henderson-Hassebach equation. The
extent to which the acid dissociates is dependent on the affinity of the carboxyl group for
+ its proton (H ) and is expressed as its dissociation constant (Ka or pKa = -logKa). The higher the pKa value the stronger the molecules affinity for protons. Organic acids have a
relatively high dissociation constant and are thus relatively reluctant proton donors in aqueous solution and thus weak acids. Dissociation of a weak acid is pH dependent. This is in contrast to strong inorganic acids, which have very low pKa values and consequently very readily donate protons (H+) even at low pH. Thus, the antibacterial activity increases
with decreasing pH-value. Organic acids are lipid soluble in the undissociated form, and
they easily enter the microbial cell by both passive and carrier-mediated transport
mechanisms. Once in the cell, the organic acid releases the proton H+ in the more alkaline
environment, resulting in a decrease of intracellular pH. This influences microbial
metabolism, inhibiting the action of important microbial enzymes and forces the bacterial
cell to use energy to export the excess of protons H+, ultimately resulting death by
starvation. In the same matter, the protons H+ can denature bacterial acid sensitive
proteins and DNA. Generally lactic acid bacteria are able to grow at relatively low pH,
which means that they are more resistant to organic acids than other bacterial species, such as E. coli and Salmonella. Lactic acid bacteria, like other Gram-positive bacteria, have a high intracellular potassium concentration, which counteracts acid anions (Russell
& Diez-Gonzalez, 1998).
As with antibiotics, continued use of acidifiers and organic acids may result in the development of resistance in some pathogenic bacteria. Inducible resistance (adaptation 64
or tolerance) to acidic environments is recognized as an important survival strategy for
many prokaryotic and eukaryotic microorganisms. In addition, different microorganisms
have developed different acid survival strategies. Inducible acid resistance has been
observed in many Gram-negative and Gram-positive microorganisms. Kwon and Ricke
(1998) suggested that SCFA in the gastrointestinal tract of a host animal or in food
materials might contribute to the enhancement of the virulence of S. Typhimurium by
increasing acid resistance. Although bacteria are known to adapt to acids under in vitro
conditions, it is not known whether this also occurs in GIT of animals fed organic acids.
1.5.5 Prebiotics
Prebiotics are dietary components that are not digested by the host, but they benefit the host by selectively stimulating the growth and/or activity of one or a limited number of bacteria in the GIT, predominantly those that produce SCFA. Prebiotics have several advantages over probiotics where culture viability needs to be maintained. Many important commensal bacteria that are present in a “healthy intestine” cannot be cultured, so they cannot be used in commercial probiotic products. However, dietary supplementation of prebiotics has been shown to stimulate these unculturable bacteria in humans (Rastall et al., 2005), and pigs (Konstantinov et al., 2003). Moreover, prebiotics have the advantage of being more stable to the heat and pressure incurred during feed processing. Prebiotics also have an economical advantage because some of the best prebiotics are derived from inexpensive food processing by-products (Playne and
Crittenden, 1996). 65
Prebiotics have great potential to modulate colonic microflora and discourage the
colonization of enteric pathogens. Any food or feed ingredient that enters the large
intestine is a potential prebiotic, but it must be fermented by microorganisms that benefit the host to be an effective prebiotic (Lan, 2004). Most current attention and successes have been derived using non-digestible oligosaccharides, especially those that contain fructose, xylose, galactose, glucose and mannose (Gibson and Roberfroid, 1995; Gibson,
1998). It has been reported that oligosaccharides and polysaccharides are preferentially utilizable by Bifidobacteria (Yazawa et al., 1978). A prebiotic substrate is selectively
utilized by commensal bacteria of the intestine but not potential pathogens, such as toxin-
producing clostridia, proteolytic bacterioides, and toxigenic E. coli. In this manner, a
“healthier” microflora composition is obtained whereby the Bifidobacterium and/or
Lactobacillus become predominant in the intestine and exert possible health-promoting effects.
In humans and animals, prebiotics have been widely studied for their ability to improve resistance to pathogens. A recent study in mice has shown that dietary supplementation of fructooligosaccharides and inulin was protective against enteric and
systemic pathogens and tumor inducers (Buddington et al., 2002). This includes the
verocytotoxin strain of Escherichia coli O157:H7 and Campylobacter. The major effect of selective-fermentation prebiotics is that they increase lactic acid producing bacteria and short chain fatty acids (SCFA) in the ceca, which decrease the gastro-intestinal tract
(GIT) pH. In effect, fermentative-prebiotics indirectly have the antimicrobial effect of an organic acid on susceptible Gram-negative organisms as described above. Swanson 66
(2002) observed that prebiotics affected the immune function of human and dogs by
stimulating lactic acid bacteria. The rise in intestinal lactic acid bacteria stimulated
phagocytic activity (cellular immune response) and/or IgA secretion (humoral immune
response) that may affect the colonization of pathogens, such as Salmonella and rotavirus
(Manning and Gibson, 2004). Therefore, dietary supplementation of prebiotics is a good
approach that may reduce enteric disease in poultry and subsequent contamination of poultry products (Patterson and Burkholder, 2003).
Common used and potential prebiotics used in poultry feed
The dominant prebiotics are fructooligosaccharide products (FOS, oligofructose, and inulin). However, trans-galactooligosaccharides, glucooligosaccharides, glycooligosaccharides, lactulose, lactitol, maltooligosaccharides, xylo-oligosaccharides, stachyose, raffinose, and sucrose thermal oligosaccharides have also been investigated
(Monsan and Paul, 1995; Orban et al., 1997; Patterson et al., 1997; Piva, 1998; Collins and Gibson, 1999). Although mannan-oligosaccharides (MOS) have been used in the same manner as the prebiotics listed above, they do not selectively enrich for beneficial populations. Instead, they act by binding and removing pathogens from the intestinal tract and stimulation of the immune system (Spring et al., 2000).
Mannan oligosaccharides, derived from mannans on yeast cell surfaces, act as high affinity ligands, offering a competitive binding site for a certain class of bacteria
(Ofek et al., 1977). Gram-negative pathogens with the mannose-specific Type-1 fimbrae attach to the MOS instead of attaching to intestinal epithelial cells and they move through the GIT without colonization. Dietary MOS in the intestinal tract removes pathogenic 67
bacteria that could attach to the lumen of the intestine (Newman, 1994). Mannose was shown by Oyofo et al. (1989a) to inhibit the in vitro attachment of S. Typhimuirum to
intestinal cells of day-old chicks. Then Oyofo et al. (1989b) provided evidence that
dietary D-mannose was successful at inhibiting the intestinal colonization of S.
Typhimurium in broilers. The ability of MOS to interfere with the attachment of
pathogenic bacteria in the GIT raises the possibility that it could also inhibit the binding
between bacteria that is required for plasmid transfer via conjugation. This kind of
inhibition of plasmid transfer in the digestive tract of mice colonized with human
microflora has been described using lactose (Duval-lflah, 2001). Lou (1995)
demonstrated that dietary MOS supplementation decreased the proportion of specific
groups of Gram-negative antibiotic-resistant fecal bacteria in pigs.
Mannan oligosaccharides have been shown to have a positive influence on
humoral immunity and immunoglobulin status. Savage et al. (1996) reported an increase
in plasma IgG and bile IgA in poults fed diets supplemented with 0.11% MOS. An
increase in antibody response to MOS is expected because of the ability of the immune
system to react to foreign antigenic material of microbial origin. Portions of the cell wall
structure of the yeast organism, Saccharomyces contained in MOS has been shown to
elicit powerful antigenic properties (Ballou, 1970). However, MOS may also enhance
humoral immunity against specific pathogens by preventing the colonization leading to
disease, yet allowing them to be presented to immune cells as attenuated antigens.
Indeed, as MOS facilitates the secretion of IgA into the intestinal mucosa layer, 68 pathogenic agents become more labile to the phagocytic action of intestinal-associated lymphocytes.
Although there are several prebiotics on the market around the world, many of which have not all been rigorously tested, there is much interest in the potential for development of novel prebiotics. Special attention is focused on the potential of plant cell wall polysaccharides as sources of novel prebiotics (Rastall and Maitin, 2002). Remus
(2003) has recently observed that a high concentration of plant cell wall polysaccharides in wheat-based broiler diets supplemented with carbohydrases shifted the intestinal microflora of chickens to a healthier state and decreased Salmonella spp. population in the broiler intestine. Fermentation of several dietary fibers was investigated using in vitro systems (Karppinen et al., 2000). Karppinen et al. (2000) measured short chain fatty acids (SCFA), gas and carbohydrate utilization, and the bacteriology of fiber breakdown on oat bran, wheat and rye. They showed that dietary fiber would persist through the distal colon, although polysaccharides are not selectively fermented. However, one means to increase the selectively of fermentation is to partially hydrolyze the polysaccharides to oligosaccharides (Rastall and Maitin, 2002). This might explain the observations reported by Remus (2003) that cecal Salmonella spp. population of broilers fed diets high in plant cell wall polysaccharides supplemented with enzyme decreased in comparison to those fed diets not supplemented with enzymes. In agreement with the literature, most of the current generations of prebiotics are rather low molecular weight and they are generally fermented in the proximal colon (Rastall and Maitin, 2002). 69
Some structural carbohydrate components of NSP have been used for many years in poultry diets as fiber of one kind or another, and they have been studied as potential prebiotics. Beta-glucan, besides its effect on microbial fermentation, has been shown to modulate the immunity by increasing mammalian macrophages and neutrophils activity in vitro (Kataoka et al., 2002), and protecting broiler chickens against Salmonella by up- regulating heterophils phagocytosis, bactericidal killing and oxidative burst (Lowry et al.,
2005). Rafinose (galactooligosaccharides) can modify the colonic microflora by lowering some Gram-negative bacteria, such as coliforms, and increasing potentially health- promoting bacteria, such as bifidobacteria and Lactobacillus in human subjects
(Matteuzzi et al., 2004). Galactomannan from partially hydrolyzed guar gum has been reported to reduce diarrhea (Takahashi et al., 1993) and improve intestinal microflora
(Okubo et al., 1994) in humans. Galactomannans also can suppress the colonization of
Salmonella Typhimurium in vitro (Oyofo et al., 1989b) and in vivo in laying hens
(Ishihara et al., 2000). Galactomannan supplementation in laying diets has been shown to increase the Bifidobacterium spp. and Lactobacillus spp. population and decrease colonization of Salmonella Enteritidis (Ishihara et al., 2000). Besides its effect on microbial fermentation, arabinoxylan has also been shown to activate a macrophage cell line in the broiler intestine and thus decrease the enteric pathogen colonization (Zhang et al., 2004).
70
1.5.6 Enzymes
Enzymes are organic catalysts that by their mere presence in trace amounts can initiate or accelerate the speed of reactions occurring in organic matter that would not otherwise proceed at an appreciable rate (Schaible, 1970). Even the simplest living organisms contain multiple copies of nearly a thousand different enzymes (Horton et al.,
1996). Most enzymes are named by adding the suffix “-ase” to the name of the substrate they act on or to a descriptive term for the reactions they catalyze. For example, urease has urea as a substrate; alcohol dehydrogenase catalyzes the removal of hydrogen from alcohols. However, a few enzymes, such as trypsin and chymotripsin, are known by their historic names (Horton et al., 1996). Enzymes are categorized according to the general class of the organic reactions they catalyze. Oxidoreductases catalyze oxidation-reduction reactions. Transferases catalyze group-transfer reactions. Hydrolases, a special class of transferases that water serves as the acceptor of the group transferred, catalyze hydrolysis reactions. Lyases catalyze the lysis of a substrate, generating a double bond. Isomerases catalyze a structural change within one molecule. Ligases catalyze the ligation or joining of two substrates (Horton et al., 1996). All digestive enzymes belong to the class of hydrolases (Odetallah, 2000). Today, isolated enzymes are used for a great variety of commercial purposes, including supplementation of enzymes to improve nutritional value of feed.
The application of enzyme technology to pharmaceutical research, development and manufacturing is a growing field and is the subject of many articles, reviews and books. Since the 1920s, researchers have observed beneficial effects from enzyme 71
supplementation in poultry feeds, particularly feeds that contain grains with a high fiber
component (Hastings, 1946; Moran Jr. and McGinnis, 1968; Petterson and Aman, 1989;
Ritz et al., 1995; Engberg et al., 2004; Hogberg and Lindberg, 2004). Supplemental
enzymes in the feed are used to achieve one or all the following objectives: (a) increase
the animal’s own supply (Schaible, 1970); (b) alleviate the adverse effects of
antinutritional factors, such as arabinoxylans, β-glucans, etc; (c) render certain nutrients
more available for absorption and enhance the energy value of feed ingredients (Classen
and Bedford, 1991; Lyons, 1993; Lyons and Walsh, 1993), and (d) modulate intestinal
microflora to a healthier state (Engberg et al., 2004; Hogberg and Lindberg, 2004).
Several criteria must be met in order for an enzyme to be applicable in animal
feeds. First, adequate substrate (target substance) must be available in the feed for a
specific enzyme being used (Dale, 2002). The animal should be able to utilize the end
product of enzyme action (e.g. fatty acid absorption from lipase supplementation) (Dale,
2002), or benefit from the breakdown of specific substrates in the feed (e.g. fat digestion
improvement from NSP breakdown by arabinoxylanase). The enzyme must be stable in
the animal’s intestine where it should have its greatest effect (Odetallah, 2000). The
enzyme should be stable in the feed until it is consumed by the bird (Odetallah, 2000).
The enzyme should be stable during and after feed processing (Odetallah, 2000). Finally,
the enzyme should interact efficiently with its target substrate (Odetallah, 2000). For
example, xylanase should be used for wheat-based diets because it contains substantial
amounts of xylan. In contrast, xylanase would be of little benefit in corn/soy diets
because it contains a negligible amount of xylan. 72
Common enzymes used in poultry feed
The major enzymes used in animal feeds are protease, amylase, lipase, phytase,
NSP-degrading enzymes, and cellulase. All enzyme preparations recommended for use in
animal husbandry to improve dietary nutrient utilization are hydrolases (Modyanov and
Zel’ner, 1983). Commercial enzymes products are typically a blend of several different enzymes that are effective on a wide variety of substrates. The enzymes with proven efficacies for animal husbandry include xylanase, arabinoxylanase, β-glucanase,
cellulase, and phytase (Choct and Kocher, 2000).
Non-starch polysaccharides-enzymes, as well as, amylase, lipase, phytase,
cellulase, and protease, are important enzymes used in commercial poultry practice.
Amylase and lipase are enzymes commonly used in corn-SBM based diet to supplement endogenous enzymes of the animal, thus improving nutrient digestibility and growth
performance characteristics. Phytate is a universally antinutrient present in all plant
material that irreversibly chelates divalent cations and interferes with amino acid absorption in the gastrointestinal tract of birds as well as other monogastrics. Moreover,
the fecal excretion of phytate phosphorus and chelated minerals is a major source of soil
and water pollution when wastes are applied to farmland. Dietary phytase
supplementation is used to improve utilization of phosphorus and other ionically active
nutrients (i.e. amino acids, minerals), ultimately reducing mineral emissions (Odetallah,
2000). The action of cellulase is complex because cellulose is generally associated with
other polymers, such as lignin and pentosans. Lignin encrustation renders access to
cellulose by the enzyme difficult if not impossible (Sears and Walsh, 1993). 73
Recently, protease supplementation of corn/SBM-based diets has received much
attention. Supplementation of poultry diets with enzyme mixtures, including proteases
and amylases, has produced significant improvements in growth performance
(Greenwood et al., 2002; Burrows et al., 2002). Greenwood et al. (2002) reported that supplementing a corn-SBM broiler starter diet with an enzyme preparation containing a mixture of xylanase, protease, and amylase increased body weight at 14 and 42 days of age. Serine-protease is an experimental fermentation product from Bacillus licheniformis
PWD-1 (Williams et al., 1990; Lin et al., 1992) that contains a high amount of keratinase.
PWD-1 keratinase hydrolyzes a broad range of protein substrates, including casein,
collagen, elastin and keratin, and displays a high proteolytic activity (Shih, 2001).
Odetallah et al. (2003) studied broilers fed corn-SBM based diets at 18% crude protein
(80% NRC 1994), 21% crude protein (93% NRC 1994), and 24% crude protein diet
(100% NRC 1994) with 0.0%, 0.05% or 0.10% PWD-1 keratinase from 1-26 days of age.
They reported that keratinase supplementation to the corn/SBM-based broiler starter diets
improved chick body weight gains and feed conversion rates. Supplementation of
keratinase at 0.10% (w/w) resulted in better growth performance in broiler chicks fed
diets containing low or adequate amounts of protein.
Non-starch polysaccharides enzymes
The enzymes used in the research work reported in this dissertation were mainly
NSP degrading enzymes, especially endoxylanase. The following is a brief description of
these enzymes, and their effect when supplemented to poultry feed. 74
Enzyme use is now very common in cereal-based diets of poultry. It is well
documented that most fungal and bacterial preparations effectively degrade the viscous
polysaccharides (e.g. β-glucan, arabinoxylan) in barley, oats, rye and wheat (Jensen et al.,
1957, Odetallah et al., 2002; Silva and Smithard, 2002). Chickens and turkeys do not produce enzymes that are capable of digesting xylans and β-glucans, which is why exogenous NSP-enzymes are added to the feed (Silversides and Bedford, 1999).
The effect of exogenous xylanases in improving dietary nutrient availability is complex. Endoxylanase degrades the xylan backbone of arabinoxylan into smaller units, which has several beneficial consequences. It renders the xylose units more available to monogastrics (Odetallah, 2000). It disrupts the water holding capacity of the NSP (Scott and Boldaji, 1997), and reduces the viscosity of the digesta in the small intestine
(Bedford and Schulze, 1998; Choct et al., 1999). Reduced digesta viscosity increases the diffusion rates of nutrients and endogenous enzymes enabling the bird to digest and absorb more nutrients (Pawlik et al., 1990). Endoxylanase releases entrapped nutrients for the digestion by the endogenous enzymes of the bird (Chesson, 2000). Endoxylanase inhibits the proliferation of the fermentative microorganisms in the small intestine by increasing the digesta passage rate and nutrient digestion (Choct et al., 1999). Thus, nutrient utilization is improved by reducing the competition between the host and its enteric microflora.
Many authors have observed improved nutrient utilization by dietary enzyme supplementation. Petterson and Aman (1989) examined the effect of enzyme supplementation on the digestibility of nutrients in broilers fed wheat-based diets. 75
Enzyme supplementation increased the digestibility of organic matter, crude protein and
starch in the ileum, and increased the digestibility of organic matter and crude fat in the
excreta. Silva and Smithard (2002) studied the effect of xylanase on rye-based diets and observed that the reduction of small intestinal viscosity by the enzyme improved nutrient digestion and consequently performance. Several researchers have shown increased performance of broiler chickens fed cereal-based diets with enzyme addition (Jensen et
al., 1957; Burnett, 1966; White et al., 1981; Hesselman and Aman, 1986; Annison, 1992;
Van Paridon et al., 1992; Frigard et al., 1994; Silva and Smithard, 2002). Likewise, Ritz
et al. (1995) and Santos Jr. et al. (2004a,b) observed improved body weight gain, feed
consumption, and feed:gain of male turkeys fed xylanase supplementation.
Many authors have shown the interaction between pentosans, microflora, and
enzyme supplementation. Fischer and Classen (2000) reported that bacterial count from
the small intestine of broilers fed wheat-based diets was lower in xylanase-supplemented
birds than the unsupplemented ones. Because enzymes supplementation reduces the
microbial population in the small intestine (Choct et al., 1995; Dunn, 1996), the entire
intestinal ecosystem changes. These conditions in the intestine alter the composition and
activity of intestinal microflora (Vukic-Vranjes and Wenk, 1996). When the microflora
profile changes after enzyme supplementation, there is a decrease in the adverse effects
of microbial fermentation. Some of the adverse effects of active microbial fermentation
include: deconjugation of bile salts reducing fat digestion (Langhout, 1999); competition
between the host and the microflora for nutrients (Bedford, 1995; Choct et al., 1996; 76
Langhout et al., 2000); atrophy of the intestinal villi and enlargement of digestive organs
(Brenes et al., 1993a,b; Viveiros et al., 1994).
Although microflora fermentation in the small intestine decreases when xylanase is supplemented in the diet, microbial fermentation increases in the large intestine and ceca. Steenfeldt et al. (1998) observed a decrease in the pH in the cecal content of
chickens as a result of enzyme supplementation. The pH decreased as indicated by higher
production of SCFA caused by an increased microbial fermentation. They also observed
a significant negative correlation between pH and the apparent digestibility of total-NSP
(r= -0.73, P<0.0006). They also found a negative correlation between pH and apparent
digestibility of xylose (r= -0.72, P<0.001) and arabinose residues (r= -0.69, P<0.001).
Therefore, the results observed by Steenfeldt et al. (1998) indicate that degradation of
cell wall arabinoxylan in the enzyme-supplemented diets increases the amount of
material available for microbial fermentation in the ceca. This increased fermentation in
the large intestine and ceca lead to a higher production of short-chain fatty acids that is
utilized by the bird as energy, thus enhancing the benefits of the enzyme supplementation
(Choct et al., 1996). Likewise, Choct et al. (1996) reported that volatile fatty acids (VFA)
concentration in the ceca was not influenced by elevated amounts of soluble NSP, but it
was significantly increased by enzyme supplementation. In contrast, they reported that ileal VFA was significantly higher in birds fed diets containing soluble NSP as compared to those fed the control (sorghum/soybean meal) or the enzyme-supplemented diets.
The increase in microbial fermentation in the ceca is largely due to the increase in
Bifidobacteria and Lactobacillus growth. Bartelt et al. (2002) measured the prececal 77 digestibility of arabinoxylans in piglets and reported considerable digestibility of insoluble arabinoxylans, but not the entire soluble fiber fraction. However, when a xylanase was added to the diet, digestibility of all fractions was significantly increased.
The authors suggested that the improved digestibility of NSP might be a direct effect of the exogenous enzyme, but also of a stimulated degradation by supporting a specialized group of NSP-hydrolyzing bacteria.
Hogberg and Lindberg (2004) studied the influence of cereal-NSP and enzyme supplementation on digestion and intestinal microbial environment and showed that the substrate for the growth of lactic acid bacteria was released in the diet when enzyme was added. They stated that the release of the carbohydrates when enzyme was added to the diet seems to have supported the growth of Lactobacillus. These findings support the literature that cereal-based diets high in NSP and enzyme supplementation promote intestinal health and exclude pathogens (Pluske et al., 2001). Additionally, Van Laere et al. (1997) studied a range of different short-chain carbohydrates with widely different sugar compositions and molecular sizes and tested their breakdown by several strains of
Bifidobacterium, Clostridium, Bacteroides, and Lactobacillus. They showed that
Bifidobacteria utilized carbohydrates with low-degree of polymerization and that linear oligosaccharides were catabolized to a greater degree than were those with branched structures. (Van Laere et al., 1997). Presumably, microbial fermentation increases in the large intestine and ceca when diets are supplemented with enzymes that hydrolyze branch polysaccharides to smaller carbohydrate units. Lastly, Bifidobacteria’s major product of 78 fermentation is acetic acid and lactic acid, which inhibit intestinal putrefaction (Taki et al., 2005).
In conclusion, supplementation of diets rich in NSP with NSP-enzymes has been shown to improve the performance of poultry by improving the digestion, absorption of nutrients, and modulating intestinal microflora.
1.6 CURRENT STUDY
Poultry must have a healthy and functional intestinal tract to achieve maximum feed efficiency and performance expected in modern poultry production. Intestinal health is important to prevent or reduce pathogen contamination levels of poultry flocks, which affect the number of bacteria on poultry carcass and products, and may decrease foodborne disease outbreaks. Dietary supplementation of antibiotics has been the standard practice to maintain intestinal health; however, their utilization by the food animal industry has come under increasing scrutiny due to the public concern about the proliferation of antibiotic-resistant bacteria that can threaten the health of humans and animals. At the present time, it is well recognized that rapidly reproducing bacteria, with a few exceptions, will inevitably develop resistance to drugs. Thus, a continuous effort to research and develop new antibiotics, antibiotic alternatives, and combination of strategies are important for treatment of diseases in animals and humans, and to achieve good intestinal health and growth performance of production animals.
Diet, among other environmental and genetic factors, is currently recognized to have an important role in health and disease. Diet has been shown to be the strongest 79 individual determinant of the total microbial community structure in the intestine of humans and animals. Therefore, this dissertation addresses the use of exogenous enzyme supplementation and dietary non-starch polysaccharide content to modulate enteric health and discourage colonization of unfavorable bacterial communities in the intestinal tract of turkeys.
In this first chapter, the review of literature focused on the poultry GIT, poultry bacterial enteritis, and the concepts required for intestinal health with emphasis on the nutritional strategies to module microbial ecology to discourage the colonization of unfavorable bacterial communities. The literature review presented evidence about the possible effects of non-starch polysaccharides and enzyme supplementation on microbial communities of poultry intestine.
The objective of the first experiment, described in Chapter 2, was to evaluate the effect of exogenous enzyme preparations on intestinal size and histomorphology of turkeys fed diets high in non-starch polysaccharide content. The enzyme treatments tested an enzyme blend that had the same level of endoxylanase activity in the feed as an enzyme product that contained an exclusive endoxylanase. Therefore a blended enzyme product was compared to a single endoxylanase preparation. Also, an exclusive phospholipase product was used to test the hypothesis that its dietary supplementation could alleviate the adverse effects of NSP by facilitating lipid digestibility.
In order to evaluate the efficacy of two different enzyme mixtures and two common grain-based diet formulations with different dietary NSP contents, an experiment was conducted and the results on growth performance and fecal Salmonella 80
spp. prevalence of turkeys are described in Chapter 3. An additional objective was to
determine the effectiveness of an enzyme blend preparation on the improvement of
performance and cecal Salmonella enterica population of turkeys fed different grain-
based dietary formulation (Chapter 4). These results demonstrated the prebiotic role of
diets high in NSP supplemented with enzymes on the improvement of performance and
discouragement of Salmonella colonization in the GIT of turkey. Finally, to demonstrate that the major effects caused by the exogenous enzyme addition and NSP content to turkey diets on the discouragement of Salmonella is associated with changes on microbial diversity of the turkey GIT, a study was conducted to investigate PCR-DGGE of 16S rDNA amplicons changes of ileum bacterial population of turkeys infected with
Salmonella fed different diets with or without exogenous enzyme supplementation
(Chapter 5). The results of the different experiments are discussed and summarized in the summary part of this dissertation (Chapter 6).
81
1.7 REFERENCES
Aiello, L.C., 1997. Brains and guts in human evolution. The expensive Tissue Hypothesis. Braz. J. Genet. 20 (1) ISSN 0100-8455. Alisky, J., K. Iczkowsi, A. Rapoport, and N. Troitsky, 1998. Bacteriophages show promise as antimicrobial agents. J. Infect. 36:5-15. Annison, G., 1992. Commercial enzyme supplementation of wheat-based diets raised ileal glycanase activities and improves AME, starch and pentosan digestibility in broiler chickens. Anim. Feed Sci. Technol. 38:105-121. Antoniou, T.C., and R.R. Marquardt, 1982. The utilization of rye by growing chicks as influenced by autoclave treatment, water extraction, and water soaking. Poult. Sci. 62: 91-102. Apajalahti, J.H.A., A. Kettunen, M.R. Bedford, and W.E. Holben, 2001. Percent G+C profiling accurately reveals diet-related differences in the gastrointestinal microbial community of broiler chickens. Appl. Environ. Microbiol. 67:5656-5667. Argenzio, R.A., and K. Southworth. 1974. Analysis of starch and other main constituents of cereal grains. Swed. J. Agric. Res. 14:135-139. Avery, D.T., 2001. Use of antibiotics on the farm is no threat to humans. In: Animalnet Sept 1, 2001. University of Guelph, Canada. Ballou, C.E., 1970. A study of the immunochemistry of three yeast mannans. J. Biol. Chem. 245:1197-1203. Barnes, E.M., and C.S. Impey, 1970. The isolation and properties of the predominant anerobic bacteria in the caeca of chickens and turkeys. Br. Poult. Sci. 11:467-481. Barnes, E.M., G.C. Mead, D.A. Barnum, and E.G. Harry, 1972. The intestinal flora of the chicken in the period 2 to 6 weeks of age, with particular reference to the anaerobic bacteria. Br. Poult. Sci. 13:311-326. Barnes, E.M., C.S. Impey, and B.J.H. Stevens, 1979. Factors affecting the incidence and anti-salmonella activity of the anaerobic caecal flora of the young chick. J. Hyg., Cambridge 82:263-283. Bartelt, J., A. Jadamus, F. Wiese, E. Swiech, L. Buraczewska, and O. Simon, 2002. Apparent precaecal digestibility of nutrients and level of endogenous nitrogen in digesta of the small intestine of growing pigs as affected by various digesta viscosities. Arch. Anim. Nutr. 56:93-107. Batzing, B.L., 2002. Growth and Metabolism. Pages 49-167. In: Microbiology: An introduction. Batzing, B.L., ed. Bookscole, Stamford, CT. Bedbury, H.P., and G.E. Duke, 1983. Cecal microflora of turkeys fed low or high fiber diets: enumeration, identification and determination of cellulolytic activity. Poult. Sci. 62:675-682. 82
Bedford, M.R., 1995. Mechanism of action and potential environmental benefits from the use of feed enzymes. Anim. Feed Sci. Technol. 53:145-155. Bedford, M.R., and H. Schulze, 1998. Exogenous enzymes in pigs and poultry. Nutr. Res. Rev. 11:91-114. Befus, A.D., N. Johnston, G.A. Leslin, and J. Bienenstock, 1980. Gut-associated lymphoid tissue in the chicken. I. Morphology, ontogeny, and some functional characteristics of Peyer’s patches. J. Immunol. 125:2626-2632. Belley, A., and K. Chadee, 1999. Prostaglandin E(2) stimulates rats and human colonic mucin exocytosis via the EP(4) receptor. Gastroenterology 117:1352-1362. Berghman, L.R., D. Abi-Ghanem, S.D. Waghela, and S.C. Riche, 2005. Antibodies: an alternative for antibiotics? Poult. Sci. 84:660-666. Bertschinger, H.U., U. Eggenberger, H. Jucker, and H.P. Pfirter, 1978. Evaluation of low nutrient, high fiber diets on the prevention of porcine Escherichia coli enterotoxemia (edema disease). Vet. Microbiol. 3:281-290. Bloom W., and D.W. Fawcett, 1986. Intestines. In: A textbook of histology. Ed. 12, D. W. Fawcett., and E. Raviola. Chapman and Hall, New York, NY. Borgstrom, B., J.A. Barrowman, and M. Lindstrom, 1985. Roles of bile acids in intestinal lipid digestion and absorption. Pages: 405-425. In: Sterols and Bile Acids. H. Danielsson, and J. Sjovall, eds. Elsevier Science Publishers BV, Amsterdam. Brenes, A., M. Smith, W. Guenter, and R.R. Marquardt, 1993a. Effect of enzyme supplementation on the performance and digestive tract size of broiler chickens fed wheat- and barley-based diets. Poult. Sci. 72:1731-1739. Brenes, A., W. Guenter, R.R. Marquardt, and B.A. Rotter, 1993b. Effect of β- glucanase/pentosanase enzyme supplementation on the performance of chickens and laying hens fed wheat, barley, naked oats and rye diets. Can. J. Anim. Sci. 73:941- 951. Brouns, F., J. Gooseens, and T. Draguhn, 2002. Gut benefits: resistant starch offers great potential as a healthy ingredient in dairy drinks. Dairy Industries International. May, 2002. Buddington, K.K., J.B. Danohoo, and R.K. Buddington, 2002. Dietary oligofructose and inulin protect mice from enteric and systemic pathogens and tumor inducers. J. Nutr. 132:472-477. Burnett, G.S., 1966. Studies of viscosity as the probable factor in the improvement of certain barleys for chickens by enzyme supplementation. Br. Poult. Sci. 7:55-75. Burrows, H., M. Hurby, D. Hung, and O. Adeola, 2002. Addition of enzymes to corn-soy diets for ducks: a performance and digestibility study. Poult. Sci. 81(Suppl. 1): 29. (Abstr.). 83
Campbell, G.L., L.D. Campbell, and H.L. Classen, 1983. Utilisation of rye by chickens: Effect of microbial status, diet gamma irradiation and sodium taurocholate supplementation. Br. Poult. Sci. 24:191-203. Canibe, N., R.M. Engberg, and B.B. Jensen, 2001. In: Proceedings of the Workshop on alternatives to feed antibiotics and anticoccidials in the pig and poultry meat production. A Nordic Research Network. Oslo. October 13-16. Carlander, D., H. Kollberg, P.E. Wejaker, and A. Larson, 2000. Peroral immunotherapy with yolk antibodies for the prevention and treatment of enteric infections. Immunol. Res. 21:1-6. Casewell, M., C. Friis, E. Marco, P. McMullin and I. Phillips. 2003. The European ban on growth-promoting antibitocs and emerging consequences for human and animal health. J. Antimicrob. Chemother. 46:1052.
Cassidy M.M., Satchithanandam S., Calvert R.J., Vahouny G.V., Leeds A.R., 1990. Quantitative and qualitative adaptations in gastrointestinal mucin with dietary fiber feeding. Pages 67–88. In: Dietary fiber: chemistry, physiology, and health effects. Kritchevsky D, Binfield C, Anderson JW, eds. Plenum Press, New York. Cervantes, H. 2005. Assessing the results of the European Union ban of antibiotics feed additives. Pages: 38-45. In: Proceedings, Thirty Second Annual Carolina Poultry Nutrition Conference, North Carolina, October, 26-27. Chesson, A., 2000. Non-starch polysaccharides degrading enzymes – Types and methods of action. In: Proceedings, Twenty First World’s Poultry Congress, Montreal, Canada, August 20-24. Choct, M., R.J. Hughes, J. Wang, M.R. Bedford, A.J. Morgan, and G. Annison, 1995. Feed enzymes eliminate the antinutritive effect by non-starch polysaccharides and modify fermentation in broilers. Proceedings Australian Poultry Science Symposium. The University of Sydney, Sidney. 7:121-125. Choct, M., R.J. Hughes, J. Wang, M.R. Bedford, A.J. Morgan, and G. Annison, 1996. Increased small intestinal fermentation is partly responsible for the anti-nutritive activity of non-starch polysaccharides in chickens. Br. Poult. Sci. 37:609-621. Choct, M., R.J. Hughes, and M.R. Bedford, 1999. Effects of a xylanase on individual bird variation, starch digestion throughout the intestine, and ileal and caecal volatile fatty acid production in chickens fed wheat. Br. Poult. Sci. 40:419-422. Choct, M., and A. Kocher, 2000. Use of enzymes in non-cereal grain feedstuffs. In: Proceedings, Twenty First World’s Poultry Congress, Montreal, Canada, August 20- 24. Classen , H.L., and M.R. Bedford, 1991. The use of enzymes to improve the nutritive value of poultry feeds. Pages: 95-116. In: Recent Advances in Animal Nutrition, Butterworth-Heinemann Ltd, Oxford. 84
Collett, S.R., and K.A. Dawson, 2001. Alternatives to subtherapeutic antibiotics: What are the options? How effective are they? In: Proceedings: Poultry beyond 2005. 2nd International Poultry Broiler Nutritionist’s Conference, Sheraton Rotorua, New Zealand. Collett, S.R., 2004. Controlling gastrointestinal disease to improve absorptive membrane integrity and optimize digestion efficiency. Pages 77-91. In: Interfacing immunity, gut health and performance. L.A. Tucker, and J.A. Taylor-Pickard, eds. Nottingham University Press, Nottingham, United Kingdom. Collier, C.T., M.R. Smiricky-Tjardes, D.M. Albin, J.E. Wubben, V.M. Gabert, B. Deplancke, D. Bane, D.B. Anderson, and H.R. Gaskins, 2003a. Molecular ecological analysis of porcine ileal microbiota responses to antimicrobial growth promoters. J. Anim. Sci. 81:3035-3045. Collier, C.T., J.D. van der Klis, B. Deplancke, D.B. Anderson, and H.R. Gaskins, 2003b. Effects of tylosin on bacterial mucolysis, Clostridium perfringens colonization, and intestinal barrier function in a chick model of necrotic enteritis. Antimicrobial Agents Chemother. 47:3311-3317. Collins, M.D., and G.R. Gibson, 1999. Probiotics, prebiotics, and synbiotics: approaches for modulating the microbial ecology of the gut. Am. J. Clin. Nutr. 69:1052S-1057S. Conway, P.L., 1994. Function and regulation of the gastrointestinal microbiota of the pig. In: Souffrant, W.B., H. Hagemeister (Eds.), Proceedings of the VI International Symposium on Digestive Physiology in Pigs. EAAP Publication No. 80. Dummerstoff, pp. 231-240. Cook, R.H., and F.H. Bird, 1973. Duodenal villus area and epithelial cellular migration in conventional and germ-free chicks. Poult. Sci. 52:2276-2280. Cook, S.I., and J.H. Sellin, 1998. Review article: short-chain fatty acids in health and disease. Aliment. Pharmacol. Ther. 12:499-507. Corrier, D.E., D.J. Nisbet, C.M. Scanlan, A.G. Hollister, and J.R. DeLoach, 1995. Control of Salmonella typhimurium colonization in broiler chicks with a continuous- flow characterized mixed culture of cecal bacteria. Poultry Sci. 74:916-924. Crittenden, R., S. Karppinen, S. Ojanen, M. Tenkanen, R. Fagerstrom, J. Matto, M. Saarela, T. Mattila-Sandholm, and K. Poutanen, 2002. In vitro fermentation of cereal dietary fibre carbohydrates by prebiotic and intestinal bacteria. J. Sci. Food Agricult. 82(8):781-789. Cummings, J.H., 1981. Short chain fatty acids in the human colon. Gut 22:763-79. Cummings, J.H., G.T. Macfarlane, 1997. Role of intestinal bacteria in nutrient metabolism. J. Parenter. Enteral. Nutr. 21:357-365. Dale, N., 2002. Enzyme use likely to expand. Poult. Times. 49(10):5-8. 85
DANMAP, 2004. Use of antimicrobial agents and occurrence of antimicrobial resistance in bacteria from food animals, foods and humans in Denmark. 2004 Annual Report. Deans, S.G., and G. Ritchie, 1987. Antibacterial properties of plant essential oils. Int. J. Food Microbiol. 5:165-180. Deans, S.G., and P.G. Waterman, 1993. Biological activity of volatile oils. In: Hay, R.K.M., Waterman, P.G. (Eds.), Volatile oil crops, Longman Scientific and Technical, Essex. Dibner, J.J., and J.D. Richards, 2005. Antibiotic growth promoters in agriculture: history and mode of action. Poult. Sci. 84:634-643. Dierick, N.A., 1989. Biotechnology aids to improve feed and feed digestion: enzymes and fermentation. Arch. Animal Nutrition. Berlin. 3:241-251. Dritz, S.S., 2003. Feeding to enhance swine health. National Hog Farmer. Oct. 15, 2003. Duke, G.E., E. Eccleston, S. Kirkwood, C.F. Louis, and H.J. Bedbury, 1984. Cellulose digestion by domestic turkeys fed low or high fiber diets. J. Nutr. 114:95-102. Duke, G.E., 1986a. Alimentary canal: anatomy, regulation of feeding and motility. Pages 269-288. In: Avian Physiology, Ed. 4. P.D. Sturkie, ed. Springer-Verlag, New York. Duke, J.A., 1986b. CRC handbook of medicinal herbs. CRC press, Florida. Duncan, S.H., K.P. Scott, A.G. Ramsay, H.J.M. Harmsen, G.W. Welling, C.S. Stewart, and H.J. Flint, 2003. Effects of alternative dietary substrates on competition between human colonic bacteria in an anaerobic fermentor system. Appl. Environ. Microbiol. 69(2):1136-1142. Dunn, N., 1996. Combating the pentosans in cereals. World Poult. 12(1):24-25. Duval-lflah, Y.S., 2001. Comparison of yogurt, heat-treated yogurt, milk and lactose effects on plasmid dissemination in gnotobiotic mice. Ant. Van Leeu. Int. J. Gen. And Mol. Microbiol. 79(2):199. Dziarski, R., 1991. Demostration of petidoglycan-binding sites on lymphocytes and macrophages by photoaffinity cross-linking. J. Biol. Chem. 266:4713-4718. Economic Research Service (ERS), United States Department of Agriculture (USDA), 2003. Poultry and Eggs Background. Economic Research Service, United State Department of Agriculture. Edwards, C.A., I.T. Johnson, and N.W. Read, 1988. Do viscous polysaccharides slow absorption by inhibiting diffusion or convection? European J. Clinical Nutr. 42:307- 312. Eidelsburger, U., 1997. Optimierung der Futterqualitat ist ein Teilaspekt. P. 18-21. In: Schweinewelt, Nr. Januar. [Cited in Canibe et al., 2001.]. Eisemann, 2004. A close-up look at the small intestines. In: Amino Acid Metabolism Course - NTR 701-001. North Carolina State University, Raleigh, North Carolina. 86
Engberg, R.M., M.S. Hedemann, S. Steenfeldt, and B.B. Jensen, 2004. Influence of whole wheat and xylanase on broiler performance and microbial composition and activity in the digestive tract. Poult. Sci. 83:925-938. Enss, M.L., U. Scmidtwittig, K. Honer, R. Kownatzki, and K. Gartner, 1994. Mechanical challenge causes alterations of rat colonic mucosa and released mucins – alterations of mucosa and mucins. J. Exp. Anim. Sci. 36:128-140. Evans, E.W., G.G. Beach, J. Wunderlich, and B.G. Harmon, 1994. Isolation of antimicrobial peptides from avian heterophils. J. Leukoc. Biol. 56:661-665. Falk, P.G., L.V. Hooper, T. Midtvedt, and J.I. Gordon, 1998. Creating and maintaining the gastrointestinal ecosystem: what we know and need to know from gnotobiology. Microbiol. Mol. Biol. Rev. 62:1157-1170. Ferket, P.R., and T. Middelton, 1989. Antinutrients in poultry feeds. Pages 43-52. In: Proceedings, of the 1998 World Poultry Science Association. Ferket, P.R., and T. Middelton, 1998. Antinutrients in poultry feeds. In: Proceedings of the 1998 World Poultry Science Association. Pp. 43-52. Ferket, P.R., and T. Veldkamp, 1999. Nutrition and gut health of turkeys and broilers. Pages 5-18. In: Proceedings, Twenty Sixty Annual Carolina Poultry Nutrition Conference and Soybean Meal Symposium, North Carolina, November, 9-10. Ferket, P.R., 2003. Managing gut health in a world without antibiotics. In: Proceedings Altech’s 17th European, Middle Eastern and African Lecture Tour. Alltech Ireland, Ireland. Ferket, P.R., A.A. Santos Jr., E.O.O. Rondon, 2005. Dietary factors that affect gut health and pathogen colonization. Pages 1-22. In: Proceedings, Thirty Second Annual Carolina Poultry Nutrition Conference, North Carolina, October, 26-27. Fernando, A., and B.M. McCraw, 1973. Mucosal morphology and cellular renewal in the intestine of chickens following a single infection of Eimeria acervulina. J. Parasi. 59(3):493-501. Fischer, E.N., and H.L. Classen, 2000. Age and enzyme related changes in bacterial fermentation in the ileum and caecum of wheat-fed broiler chickens. In: Proceedings, Twenty First World’s Poultry Congress, Montreal, Canada, August 20-24.
Fontaine N, Meslin JC, Lory S, Andrieux C., 1996. Intestinal mucin distribution in the germ-free rat and in the heteroxenic rat harbouring a human bacterial flora: effect of inulin in the diet. Br J Nutr 75:881–92. Fooks, L.J., R. Fuller, and G.R. Gibson, 1999. Prebiotics, probiotics and human gut microbiology. Int. Dairy J. 9:53-61. Forstner, J.F., and G.G. Forstner. 1994. Gastrointestinal mucus. Pages: 1255-1283. In: Physiology of the gastrointestinal tract. Johnson, L. R., ed. Raven Press, New York. 87
Freeman, B.M., 1971. Physiology and biochemistry of the domestic fowl. Vol. 1,2 and 3. D.J. Bell, and B.M. Freeman, eds. Academic Press, London. Frigard, T., D. Pettersson, and P. Aman, 1994. Fiber-degrading enzyme increases body weight and total serum cholesterol in broiler chickens fed a rye-based diet. J. Nutr. 124:2422-2430. Fuller, R., 1977. The importance of lactobacilli in maintaining normal microbial balance in the crop. Br. Poult. Sci. 18:85-94. Fuller, R., 1989. Probiotics in man and animals. J. Appl. Bacteriol. 66:365-378. Gabert, V.M, and W.C. Sauer, 1994. The effects of supplementing diets for weanling pigs with organic acids. A review. J. Animal and Feed Science 3:73-87. Gaskins, H.R., C.T. Collier, and D.B. Anderson, 2002. Antibiotics as growth promotants mode of action. Anim. Biotechnol. 13(1):29-42. Gibson, G.R., 1998. Dietary modulation of human gut microflora using prebiotics. Br. J. Nutr. 80:S209-S212. Gibson, G.R., and M.B. Roberfroid, 1995. Dietary modulation of the human colonic microbiota: introducing the concept of prebiotics. J. Nutr. 125:1401-1412. Glisson, J.R., 1996. Fowl cholera in commercial poultry. Pages: 1-4. In: Intervews, Vol. 9, No 1. Intervet, Millsboro, DE. Gong, J., R.J. Forster, H. Yu, J.R. Chambers, R. Wheatcroft, P.M. Sabour, and S. Chen, 2002a. Molecular analysis of bacterial populations in the ileum of broiler chickens and comparison with bacteria in the cecum. FEMS Microbiol. Ecol. 41:171-179. Gong, J., R.J. Forster, H. Yu, J.R. Chambers, P.M. Sabour, R. Wheatcroft, and S. Chen, 2002b. Diversity and phylogenetic analysis of bacteria in the mucosa of chicken ceca and comparison with bacteria in the cecal lumen. FEMS Microbiol. Lett. 208:1-7.
Goodlad, R.A., J.A. Plumb, and N.A. Wright, 1987. The relationship between intestinal crypt cell proliferation and water absorption measured in vitro in the rat. Clin. Sci. 72: 297-304. Gordon, J., 2005. Irritating microbes. In: News Stories and Tip Sheets. Washigton University in St. Louis, MO. July 25, 2005. Greenwood, M.W., C.A. Fritts, and P.W. Waldroup, 2002. Utilization of avizyme 1502 in corn-soybean meal diets with and without antibiotics. Poult. Sci. 81(Suppl. 1): 25. (Abstr.). Gross, W.G., 1994. Diseases due to Escherichia coli in poultry. Pages 237-259. In: Escherichia coli in domestic animals and humans. C.L. Gayles, ed. CAB International, Tucson, AZ. Gustafson, R.H., and R.E. Bowen, 1997. Antibiotic use in animal agriculture. J. App. Micro. 83:531-541. 88
Hafez, H.M., 1999. Poultry meat and food safety: pre- and post-harvest approaches to reduce foodborne pathogens. World Poultry Sci. J. 55:269-280. Haller, D., C. Bode, and W.P. Hammes, 1999. Cytokine secretion by stimulated monocytes depends on the growth phase and heat treatment of bacteria: a comparative study between lactic acid bacteria and invasive pathogens. Microbiol. Immunol. 43:925-935. Hancock, R.E.W., 1997. Peptide antibiotics. Lancet 349:418-422. Hancock, R.E.W., and R. Lehrer, 1998. Cationic peptides: a new source of antibiotics. Trends Biotechnol. 16:82-88. Hancock, R.E.W., and A. Rozek, 2002. Role of membranes in the activities of antimicrobial cationic peptides. FEMS Microbiol. Lectt. 206:143-149. Harwig, S.S.L., K.M. Swiderek, V.N. Kokryakov, L. Tan, T.D. Lee, E.A. Panyutich, G.M. Aleshina, O.V. Shamova, and R.I. Lehrer, 1994. Gallinacins-cysteine-rich antimicrobial peptides of chickens leukocytes. FEBS Lett. 34:281-285. Hastings, W. H., 1946. Enzyme supplements to poultry feeds. Poult. Sci. 25:584-586. Hay, R.K.M., and P.G. Waterman, 1993. Volatile oil crops: their biology, biochemistry and production. Longman Scientific and Technical, Essex. Hecht, G. 1999. Innate mechanisms of ephitelial host defense: spotlight on intestine. Am. J. Physiol. 277:C351-C358. Helander, I.M., H.L. Alakomi, K. Latva-Kala, T. Mattila-Sandholm, I. Pol, E.J. Smid, L.G.M. Gorris, and A. Von Wright, 1998. Characterization of the action of selected essential oil components on Gram-negative bacteria. J. Agri. Food Chem. 46:3590- 3595. Hentschel, U., Steinert M., and J. Hacker, 2000. Common molecular mechanisms of symbiosis and pathogenesis. Trends Microbiol. 8:226-231. Hersom, M.J., C.R. Krehbiel, and G.W. Horn. 2004. Effect of live weight gain of steers during winter grazing: II. Visceral organ mass, cellularity, and oxygen consumption. J. Anim. Sci. 82:184-197. Hesselman, K., and P. Aman, 1986. The effect of β-glucanase on the utilization of starch and nitrogen by broiler chickens fed on barley of low- or high-viscosity. Anim. Feed Sci. Technol. 15:83-93. Hetland, H., and B. Svihus, 2001. Effect of oat hulls on performance, gut capacity and feed passage time in broiler chickens. Br. Poult. Sci. 42:354-361. Hill, M.O., 1973. Diversity and evenness: a unifying notation and its consequences. Ecology. 54:427. 89
Hogberg, A., J.E. Lindberg, 2004. Influence of cereal non-starch polysaccharides and enzyme supplementation on digestion site and gut environment in weaned piglets. Anim. Feed Sci. Technol. 116:113-128. Hoj, L., R.A. Olsen, and V.L. Torsvik, 2005. Archaeal communities in high artic wetlands at Spitsbergen, Norway (79ºN) as characterized by 16S rRNA gene fingerprinting. FEMS Microbiol. Ecol. Article In Press. Hooge, D.M., 2003. Broiler chicken performance may improve with FOS. Feedstuffs. Jan. 6, 2003:11-13. Horton, H.R., L.A. Moran, R.S. Ochs, J.D. Rawn, and K.G. Srimgeour, 1996. Properties of enzymes. Pages: 119-146. In: Principles of Biochemistry. Ed. 2. J. Challice, C. Pratt, T.O. Quin, M. Ryan, D. Kirschner, and P. Corey, eds. Prentice-Hall Inc., Upper Saddle River, New Jersey. Hume, M.E., L.F. Kubena, T.S. Edrington, C.J. Donskey, R.W. Moore, S.C. Ricke, and D.J. Nisbet, 2003. Poultry digestive microflora biodiversity as indicated by denaturing gradient gel electrophoresis. Poult. Sci. 82:1100-1107. Hymowitz, T., Y.M. Walker, F.I. Collins, and J. Panczer, 1972. Stability of sugar content in soybean strains. Commun. Soil Sci. Plant Ala. 3:367-373. Iba, A.M., and A. Berchieri Jr., 1995. Studies on the use of a formic acid-propionic acid mixture (Bio-addtm) to control experimental Salmonella in broiler chickens. Avian Pathology, 24:303-311. Iji, P.A., A. A. Saki, and D. R. Tivey, 2001. Intestinal development and body growth of broiler chicks on diets supplemented with non-starch polysaccharides. Anim. Feed Sci. Technol. 89:175-188.
Ikegami, S., F. Tsuchihashi, H. Harada, N. Tsuchihashi, E. Nishide, and S. Innami, 1990. Effect of viscous indigestible polysaccharides on pancreatic-biliary secretion and digestive organs in rats. J. Nutr. 12:353-360. Immerseel, F.V., J. De Buck, F. Pasmans, G. Huyghebaert, F. Haesebrouck, and R. Ducatelle. 2004. Clostridium prefringens in poultry: an emerging threat for animal and public health. Avian Pathol. 33:537-549. Imondi, A.R., and F.H. Bird, 1966. The turnover of intestinal epithelium in the chick. Poult. Sci. 45:142-147. Ishihara, N., D.C. Chu, S. Akachi, and L.R. Juneja, 2000. Preventive effect of partially hydrolyzed guar gum on infection of Salmonella enteritidis in young and laying hens. Pout. Sci. 79:689-697. Ishii, K., and S. Takii, 2003. Comparison of microbial communities in four different composting processes as evaluated by denaturing gradient gel electrophoresis analysis. J. Appl. Microbiol. 95:109-119. 90
Ishizuka, S., and S. Tanaka, 2002. Modulation of CD8+ intraepithelial lymphocyte distribution by dietary fiber in the rat large intestine. Exp. Biol. Med. 227:1017-1021. Ishizuka, S., S. Tanaka, H. Xu, and H. Hara. 2004. Fermentable dietary fiber potentiates the localization of immune cells in the rat large intestinal crypts. Exp. Biol. Med. 229: 876-884. Isolauri, E., S. Salminen, and A.C. Ouwehand, 2004. Probiotics. Best. Pract. Res. Clin. Gastroenterol. 18(2):299-313. Izydorczyk, M.S., C.G. Biliaderis, and W. Bushuk, 1991a. Physical properties of water- soluble pentosans from different wheat varieties. Cereal Chem. 68(2):145-150. Izydorczyk, M.S., C.G. Biliaderis, and W. Bushuk, 1991b. Comparison of the structure and composition of water-soluble pentosans form different wheat varieties. Cereal Chem. 68:139-144. Izydorczyk, M.S., L.J. Macri, and A.W. MacGregor, 1998. Structure and physicochemical properties of barley non-starch polysaccharides. II. Alkali- extrectable β-glucans and arabinoxylans. Carbohydrate Polymers. 35:259-269. Janssen, A.M., J.J.C. Scheffer, and A.B. Svendsen, 1987. Antimicrobial activities of essential oils. Pharmaceutisch Weekblad (Sci), 9:193-197. Jaroni, D., S.E. Scheideler, M.M. Beck, and C. Wyatt, 1999. The effect of dietary wheat middlings and enzyme supplementation II: Apparent nutrient digestibility, digestive tract size, gut viscosity, and gut morphology in two strains of leghorn hens. Poult Sci. 78:1664-1674. Jensen, L.S., R.E. Fry, J.B. Allred, and J. McGinnis, 1957. Improvement in the nutritional value of barley for chicks by enzyme supplementation. Poult. Sci. 36:919-921. Joerger, R.D., 2003. Alternatives to antibiotics: bacteriocins, antimicrobial peptides and bacteriophages. Poult. Sci. 82:640-647. Jozefiak, D., A. Rutkowski, and S.A. Martin, 2004. Carbohydrate fermentation in the avian ceca: a review. Anim. Feed Sci. Technol. 113:1-15. Jukes, T.H., E.L.R. Stokstad, R.R. Taylor, T.J. Combs, H.M. Edwards, and G.B. Meadows, 1950. Growth promoting effect of aureomycin on pigs. Arch. Biochem. 26:324-330. Karppinen, S., K. Liukkonen, A-M Aura, P. Forssell, and K. Poutanen, 2000. In vitro fermentation of polysaccharides of rye, wheat and oat brans and inulin by human faecal bacteria. J. Sci. Food Agric. 80:1469-1476. Kataoka, K., T. Mutta, S. Yamazaki, and K. Takeshige, 2002. Activation of macrophages by linear (1-3)-β-glucans. Implications for the recognition of fungi by innate immunity. J. Biol. Chem. 277:36825-36831. 91
Kawamura, S., 1967. Quantitative paper chromatography of sugars of the cotyledon, hull, and hypocotyls of soybeans of selected varieties. Tech Bull Fac Agric Kagawa University 15:117-131. Kiriyama, S., 1992. The significance of small intestinal transit speed in the antitoxic activity of dietary fiber. Pages 76-91. In: Proceedings of Kellogg International Symposium on Dietary Fiber. S. C. Chen, ed. Center for Academic Publications Japan, Tokyo, Japan. Kirk, J.L., L.A. Beaudette, M. Hart, P. Moutoglis, J.N. Klironomos, H. Lee, and T. Trevors, 2004. Methods of studying soil microbial diversity. J. Microbiol. Methods. 58:169-188. Knudsen, K. E., 2001. The nutritional significance of “dietary fibre” analysis. Anim. Feed Sci. Technol. 90:3-20. Konstantinov, S.R., W.Y. Zhu, B.A. Williams, S. Tamminga, W.M. Vos, and A.D.L. Akkermans, 2003. Effect of fermentable carbohydrates on piglet faecal bacterial communities as revealed by denaturing gradient gel electrophoresis analysis of 16S ribosomal DNA. FEMS Microbiol. Ecol. 43:225-235. Korakli, M., M.G. Ganzle, and R.F. Vogel, 2002. Metabolism by byfidobacteria and lactic acid bacteria of polysaccharides from wheat and rye, and exopolysaccharides produced by Lactobacillus sanfranciscensis. J. Appl. Microbiol. 92:958-965. Kunikata, T., A. Tanaka, T. Miyazawa, S. Kato, and K. Takeuchi, 2002. 16, 16-Dimethyl prostaglandin E2 inhibits indomethacin-induced small intestinal lesions through EP3 and EP4 receptors. Dig. Dis. Sci. 47:894-904. Kwon, Y.M., and S.C. Ricke, 1998. Induction of acid resistance of Salmonella typhimurium by exposure to short-chain fatty acids. Applied and Environmental Microbiology 64:3458-3463. Lan, Y., 2004. Gastrointestinal health benefits of soy water-soluble carbohydrates in young broiler chickens. Ph.D. Thesis, Wageningen University, The Netherlands, 269 pp. Lan, Y., M.W.A. Verstegen, S. Tamminga, and B.A. Williams, 2005. The role of the commensal gut microbial community in broiler chickens. Worlds Poult. Sci. J. 61:95- 104. Lane, D.J., B. Pace, G.J. Olsen, D.A. Stahl, M.L. Sogin, and N.R. Pace, 1985. Rapid determination of 16S ribosomal RNA sequences for phylogenetic analysis. Proceedings of the National Academy of Science USA 82: 6955-6959. Langhout, D. J., 1999. The role of the intestinal flora as affected by NSP in broilers. Pages: 203-212. In: Proceedings, Twelfth European Symposium on Poultry Nutrition. Veldhoven, The Netherlands, August 15-19. 92
Langhout, D.J., J.B. Schutte, J. de Jong, H. Sloetjes, M.W.A. Verstegen, and S. Tamminga, 2000. Effect of viscosity on digestion of nutrients in conventional and germ-free chicks. Br. J. Nutr. 83:533-540. Langhout, P., 2000. New additives for broiler chickens. Feed Mix Special: Alternatives to antibiotics. Pp 24-27. Lawrence, B.M., and R.J. Reynolds, 1984. Progress in essential oils. Perfumer and Flavorist, 9:23-31. Leadbetter, E.R., 2002. Prokaryotic diversity: Form, ecophysiology, and habitat. Pages 19-31. In: Manual of environmental Microbiology. Ed. 2. C.J. Hurst, R.L. Crawford, G.R. Knudsen, M.J. McInerney, and L.D. Stetzenbach, eds. ASM Press, Washigton, DC. Lee, H.S., and Y.J. Ahn, 1998. Growth-inhibiting effects of cinnamomum cassia bark- derived materials on human intestinal bacteria. J. Agri. Food Chem. 46:8-12. Lee, K.W., H. Everts, and A.C. Beynen, 2004a. Essential oils in broiler nutrition. Int. J. Poult. Sci. 3(12):738-752. Lee, K.W., H. Everts, H.J. Kappert, H. Wouterse, M. Frehner, and A.C. Beynem, 2004b. Cinnamanaldehyde, but not thymol, counteracts the carboxymethyl cellulose-induced growth depression in female broiler chickens. Int. J. Poult Sci. 3:608-612. Lin, X., C.G. Lee, E.S. Casale, and J.C.H. Shih, 1992. Purification and characterization of a keratinase from a feather-degrading Bacillus licheniformis. Appl. Environ. Microbiol. 58:3271-3275. Lineback, D.R., and V.F. Rasper, 1988. Wheat carbohydrates. Pages: 277-372. In: Wheat Chemistry and Technology. Y. Pomeranz, ed., American Association of Cereal Chemists, St. Paul, Minnesota. Link-Amstr, H., F. Rochat, K.Y. Saudan, O. Mignot, and J.M. Aeschlimann, 1994. Modulation of a specific humoral immune response and changes in intestinal flora mediated through fermented milk intakes. FEMS Immunol. Med. Microbiol. 10:55- 64. Liu, W.T., and D.A. Stahl, 2002. Molecular approaches for the measurement of density, diversity, and phylogeny. Pages 114-134. In: Manual of environmental Microbiology. Ed. 2. C.J. Hurst, R.L. Crawford, G.R. Knudsen, M.J. McInerney, and L.D. Stetzenbach, eds. ASM Press, Washigton, DC. Lou, R., 1995. Dietary mannan-oligosaccharides as an approach for altering prevalence of antibiotic resistance and distribution of tetracycline resistance determinants. In: Fecal Bacteria From Swine. M.S. thesis. University of Kentucky. Lovland, A., and M. Kaldhusdal. 2001. Severly impaired production performance in broiler flocks with high incidence of Clostridium perfringens-associated hepatitis. Avian Pathol. 30:73-81. 93
Lowry, V.K., M.B. Farnell, P.J. Ferro, C.L. Swaggerty, A. Bahl, and M.H. Kogut, 2005. Purified β-glucan as an abiotic feed additive up-regulates the innate immune response in immature chickens against Salmonella enterica serovar Enteritidis. Int. J. Food Microbiol. 98:309-318. Lyons, T.P., 1993. Biotechnology in feed industry. In: T.P. Lyons. (Ed.), Biotechnology in feed industry: Alltech Technical Publication. Alltech, Inc. Nicholasville, KY. Lyons, T.P., and G.A. Walsh, 1993. Application of enzymes in feed manufacturing. Pages: 241-254. In: Proceedings, First Symposium of Enzymes in Animal Production. C. Wenk and M. Boessinger, Eds., Kartasue Ittingen, Swetzerland. [Cited in Odetallah, 2000.] MacCracken, V.J., J.M. Simpson, R.I. Mackie, and H.R. Gaskins, 2001. Molecular ecological analysis of dietary and antibiotic-induced alterations of the mouse intestinal microbiota. J. Nutr. 131:1862-1870. Mack, D.R., S. Michail, S. Wei, L. McDougall, and M.A. Hollingsworth, 1999. Probiotics inhibit enteropathogenic E. coli adherence in vitro by inducing intestinal mucin gene expression. Am. J. Physiol. 276:G941-G950. Magurran, A.E., 1988. Diversity indices and species abundance models. Pages 7-45. In: Ecological diversity and its measurement. Magurran, A.E., ed. Princeton University Press, Princeton, New Jersey.
Malkki, Y., and E. Vertanen, 2001. Gastrointestinal effects of oat bran and oat gum – a review. J. Food Sci. Technol. 34:337-347. Manning, T.S., and G.R. Gibson, 2004. Prebiotics. Best Pract. Res. Clin. Gastroenterol. 18:287-298. Matteuzzi, D., E. Swennen, M. Rossi, T. Hartman, and V. Lebet, 2004. Prebiotic effects of a wheat germ preparation in human health subjects. Food Microbiol. 21:119-124. McClane, B.A., 2001. Clostridium perfringens. In: Doyle, M.P., Beuchat, L.R., Montville, T.J. (Eds.), Food Microbiology Fundamentals and Frontiers. 2nd rev. ed. ASM Press, Washington, DC. pp: 305-326.
McDonald, D.E., 2001. Dietary fibre for the newly weaned pig: influences on pig performance, intestinal development and expression of experimental post-weaning colibacillosis and intestinal spirochaetosis. PhD Thesis, Murdoch University, Murdoch. McInerney, M.J., and D.A. Stahl, 2002. Overview: General methodology. Pages 35-38. In: Manual of environmental Microbiology. Ed. 2. C.J. Hurst, R.L. Crawford, G.R. Knudsen, M.J. McInerney, and L.D. Stetzenbach, eds. ASM Press, Washigton, DC. Mead, 1989. Microbes of the avian cecum: types present and substrates utilized. J. Exp. Zoology Supplement 3:48-54. 94
Mead, G.C., 2000a. Microbial ecology of the digestive tract. In: Proceedings, Twenty First World’s Poultry Congress, Montreal, Canada, August 20-24. Mead, G.C., 2000b. Prospects for ‘competitive exclusion’ treatment to control salmonellas and other foodborne pathogens in poultry. The Veterinary Journal. 159:111-123. Miller Publishing Company, 2001. Feed Additive Compend. 40:125-436. Mirold, S., W. Rabsch, H. Tschaepe, and W.D. Hardt, 2001. Transfer of the Salmonella Type III effector sopE between unrelated phage families. J. Mol. Biol. 312:7-16. Modyanov, A.V., and V.R. Zel’ner, 1983. Application of enzyme supplements. Pages: 133-146. In: Handbook of nutritional supplements VII. M. Raschcigel, Jr., Ed. [Cited in Odetallah, 2000.] Monsan, P., and F. Paul, 1995. Oligosaccharide feed additives. In: Wallace, R.J., Chesson, A. (Eds.), Biotechnology in Animal Feeds and Animal Feeding. VCH, New York, NY. pp: 233-245. Montagne, L., J.R. Pluske, and D.J. Hampson. 2003. A review of interactions between dietary fibre and the intestinal mucosa, and their consequences on digestive helath in young non-ruminant animals. Anim. Feed Sci. Technol. 108:95-117. Moore, P.R., A. Evenson, T.D. Luckey, E. McCoy, E.A. Elvehjem, and E.B. Hart, 1946. Use of sulphasuccidine, streptothricin and streptomycin in nutrition studies with the chick. J. Biol. Chem. 165:437-441. Moran Jr., E.T., and J. McGinnis, 1968. Growth of chicks and turkey poults fed western barley and corn grain-based rations: effects of autoclaving on supplemental enzyme requirement and asymmetry of antibiotic response between grains. Poult. Sci. 47: 152-158. Moran, E.T., 1985. Digestion and absorption of carbohydrates in fowl and events through perinatal development. J. Nutr. 115:665-674. Muyzer, G., E.C. De Wall, and A.G. Uitterlinden, 1993. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 59:695- 700. Nayak, R., and P.B. Kenney, 2002. Screening of Salmonella isolates from a turkey production facility for antibiotic resistance. Poult. Sci. 81:1496-1500. Newman, K., 1994. Mannan-oligosaccharides: Natural polymers with significant impact on the gastrointestinal microflora and the immune system. In: Lyons, T.A., Jacques, K.A. (Eds.), Biotechnology in the Feed Industry. Proceedings of Alltech’s 10th Annual Symposium. Nottingham University Press, UK. Pp 167-174. 95
Nimmerfall, F., and J. Rosenthaler, 1980. Significance of the goblet-cell mucin layer, the outermost luminal barrier to passage through the gut wall. Biochem. Biophys. Res. Commun. 94:960-966. Nousiainen, J., and J. Setala, 1998. Lactic acid bacteria as animal probiotics. Pages 437- 473. In: Lactic Acid Bacteria: Microbiology and functional aspects. S. Salminen, and A. Wright, Marcel Dekker, NY. Nurmi, E., and M. Ratala, 1973. New aspects of Salmonella infection in broiler production. Nature. 241:210-211. Ochi, Y., T. Mitsuoka, and T. Sega, 1964. Untersuchungen ber die Darmflora des Huhnes III. Mitteilung: Die Entwicklung der Darmflora von K ken bis zum Huh. Zentralbl. Bakteriol. Parasitenkd. Infektionskr. Hyg (I Abt.)193:80-95. [Cited in Mead, 2000a.] Odetallah, N.H., 2000. The use of dietary enzymes to alleviate enteric disorders of turkeys. Ph.D. Thesis, North Carolina State University, 197 pp. Odetallah, N.H., C. W. Parks, and P.R. Ferket, 2002. Effect of wheat enzyme preparation on the performance characteristics of tom turkeys fed wheat-based rations. Poult. Sci. 81:987-994. Odetallah, N.H., J.J. Wang, J.D. Garlich, and J.C.H. Shih, 2003. Keratinase in starter diets improves growth of broiler chicks. Poult. Sci. 82:664-670. Odle, J., 2001. The intestinal tract. In: Special Topics - Regulation of Metabolism Course - BCH 590N-001. North Carolina State University, Raleigh, North Carolina.
Ofek, I., D. Mirelman, and N. Sharon, 1977. Adherence of Escherichia coli to human mucosal cells mediated by mannose receptors. Nature (London) 265:623-625. Ohl, M.E., and S.I. Miller, 2001. Salmonella: A model for bacterial pathogenesis. Annu. Rev. Med. 52:259-274. Okubo, T., N. Ishihara, H. Takahashi, T. Fujisawa, M. Kim, T. Yamamoto, and T. Mitsuoka, 1994. Effects of partially hydrolyzed guar gum intake on human intestinal microflora and its metabolism. Biosci. Biotech. Biochem. 58:1364-1369. Orban, J.I., J.A. Patterson, A.L. Sutton, and G.N. Richards, 1997. Effect of sucrose thermal oligosaccharide caramel, dietary vitamin-mineral level, and brooding temperature on growth and intestinal bacterial populations in broiler chickens. Poult. Sci. 76:482-490. Oyen, L.P.A., and N.X. Dung, 1999. Essential-oil plants. Oyen, L.P.A., and N.X. Dung (Eds.). Backhuys Publishers, Leiden. Oyofo, B.A., J.R. DeLoach, D.E. Corrier, J.O. Norman, R.L. Zirprin, and H.H. Mollenhauer, 1989a. Prevention of Salmonella typhimurium colonization of broilers with D-mannose. Poult. Sci. 68: 1357-1360. 96
Oyofo, B.A., R.E. Droleskey, J.O. Norman, H.H. Hollenhauer, R.L. Ziprin, D.E. Corrier, and J.R. DeLoach, 1989b. Inhibition by mannose of in vitro colonization of chicken small intestine by Salmonella typhimurium. Poult. Sci. 68: 1351-1356. Partanen, K.H., and Z. Mroz, 1999. Organic acids for performance enhancement in pig diets. Nutr. Res. Reviews 12:1-30. Patterson, J.A., J.I. Orban, A.L. Sutton, and G.N. Richards, 1997. Selective enrichment of bifidobacteria in the intestinal tract of broilers by thermally produced kestoses and effect on broiler performance. Poult. Sci. 76:497-500. Patterson, J.A., and K.M. Burkholder, 2003. Application of prebiotics and probiotics in poultry production. Poult. Sci. 82:627-631. Pawlik, J.R., A.I. Fengler, and R.R. Marquardt, 1990. Improvement of the nutritional value of rye by the partial hydrolysis of the viscous water-soluble pentosans following water-soaking or fungal enzyme treatment. Br. Poult. Sci. 31:525-538. Peeters, T., and G. Vantrappen, 1975. The paneth cell: a source of intestinal lysozyme. Gut. 16:553-558. Petterson, D., and P. Aman, 1989. Enzyme supplementation of a poultry diet containing rye and wheat. Br. J. Nutr. 62:139-149. Pignato, S., G. Giammanco, C. Santangelo, and G.M. Giammanco, 1998. Endemic presence of Salmonella bongori 48:z35:- causing enteritis in children in Sicily. Res. Microbiol. 149:429-31. Pirisi, A., 2000. Phage therapy – advantages over antibiotics? Lancet 356:1418. Piva, A., 1998. Non-conventional feed additives. J. Anim. Feed Sci. 7:143-154. Playne, M.J., and R. Crittenden, 1996. Commercially available oligosaccharides. Bull. Int. Dairy Fed. 313:10-22.
Pluske, J.R., D.J. Hampson, and I.H. Williams, 1997. Factors influencing the structure and function of the small intestine in the weaned pig – a review. Livestock Prod. Sci. 51:215-236. Pluske, J.R., J.C. Kim, D.E. McDonald, D.W. Pethick, and D.J. Hampson, 2001. Non- starch polysaccharides in the diets of young weaned piglets. Pages 81-112. In: The weaner pig. Nutrition and Management. M.A. Varley, and J. Wiseman, eds., CABI Publishing, Wallingford. Pommerville, J.C., 2004. The bacteria. Pages 118-229. In: Alcamo’s fundamentals of microbiology. Pommerville, J.C., ed. Jones and Bartlett Publishers, Sudbury, Massachusetts.
Porter Jr., R.E., 1998. Bacterial enteritides of poultry. Poult. Sci. 77:1159-1165. 97
Preston, C.M., K.J. McCracken, and M.R. Bedford, 2001. Effect of wheat content, fat source and enzyme supplementation on diet metabolisability and broiler performance. Br. Poult. Sci. 42:625-632. Prins, R.A., 1977. Biochemical activities of gut micro-organisms. Pages 73-183. In: Microbial ecology of the gut. R.T.J. Clarke and T. Bauchop, eds. Academic Press, London. Prosky, L., 2000. When is dietary fibre considered a functional food? Biofactors. 12:289- 297. Rastall, R.A., and V. Maitin, 2002. Prebiotics and synbiotics: towards the next generation. Curr. Opin. Biotechnol. 13:490-496. Rastall, R.A., G.R. Gibson, H.S. Gill, F. Guarner, T.R. Klaenhammer, B. Pot, G. Reid, I.R. Rowland, and M.E. Sanders, 2005. Modulation of the microbial ecology of the human colon by probiotics, prebiotics and synbiotics to enhance human health: An overview of enabling science and potential applications. FEMS Microbiol. Ecol. 52: 145-152. Remus, J., 2003. Control strategies for salmonella in swine discussed. Dec. 22, 2003: 14- 16. Rhoades, K.R., R.B. Rimler, and T.S. Sandhu, 1989. Pasteurellosis and pseudotuberculosis. Pages 14-15. In: A laboratory manual for the isolation and identification of avian pathogens. H.G. Purchase, L.H. Arp, C.H. Domermuth, and J.E. Pearson, eds., Kendall Hunt Publishing Co. Dubuque, IA. Rhodes, J.M., 1989. Colonic mucus and mucosal rats. J. Nutr. 95:413-419. Ricke, S.C., 2003. Perspectives on the use of organic acids and short chain fatty acids as antimicrobials. Poult. Sci. 82:632-639. Ricke, S.C., M.M. Kundinger, D.R. Miller, and J.T. Keeton, 2005. Alternatives to antibiotics: Chemical and physical antimicrobial interventions and foodborne pathogen response. Poult. Sci. 84:667-675. Ritz, C.W., R.M. Hulet, B.B. Self, and D.M. Denbow, 1995. Growth and intestinal morphology of male turkeys as influenced by dietary supplementation of amylase and xylanase. Poult. Sci. 74:1329-1334. Roberfroid, M.B., F. Bornet, C. Bouley, and J.H. Cummings, 1995. Colonic microflora: nutrition and health: summary and conclusions of an International Life Sciences Institute (ILSI). Workshop held in Barcelona, Spain. Nutr. Rev. 53:127-130. Roe, M.T., and S.D. Pillai, 2003. Monitoring and identifying antibiotic resistance mechanisms in bacteria. Poult. Sci. 82:622-626. Romanoff, A.L., 1960. The avian embryo. Pages 431-531. ed. Macmillan Company, New York, NY. 98
Rook, G., 1989. Immunity to bacteria. In: Immunology. I. Roitt, J. Brostoff, and D. Male, eds. Mosby, St. Louis, MO. Rosen G.D., 2003. Setting and meeting standards for the efficient replacement of pronetrient antibiotics in broiler, turkey and pig nutrition. Personal communication. [Cited in Collet, 2004.] Roth, F.X., and M. Kirchgessner, 1998. Organic acids as feed additives for young pigs: nutritional and gastrointestinal effects. J. Anim. Feed Sci. 7:25-33. Russell, J.B., 1992. Another explanation for the toxicity of fermentation acids at low pH: anion accumulation versus uncoupling. J. Applied Bacteriology, 73:363-370. Russell, J.B., and F. Diez-Gonzales, 1998. The effects of fermentation acids on bacterial growth. Advances in Microbial Physiology 39:205-234. Sakata, T., and A. Inagaki. 2001. Organic acid production in the large intestine: implication for ephitelial cell proliferation and cell death. Pages: 85-94. In: The gut environment of pigs. Piva, A., K. E. Bach Knudsen, J. E. Lindberg, eds. Nottingham University Press, Nottingham. Salanitro, J.P., I.G. Fairchilds, and Y.D. Zgornicki, 1974. Isolation, culture characteristics and identification of anaerobic bacteria from the chicken caecum. Appl. Microbiol. 27:678-687. Salanitro, J.P., I.G. Blake, P.A. Muirhead, M. Maglio, and J.R. Goodman, 1978. Bacteria isolated from the duodenum, ileum and caecum of young chicks. Appl. Environ. Microbiol. 35:782-790. Salminen, S., C. Bouley, M.C. Boutron-Ruault, J.H. Cummings, A. Franck, G.R. Gibson, E. Isolauri, M.C. Moreau, M. Roberfroid, and I. Rowland, 1998. Functional food science and gastrointestinal physiology and function. Br. J. Nutr. 80:147-171. Santos Jr., A.A., P.R. Ferket, J.L. Grime, and F.W. Edens, 2004a. Dietary Pentosanase supplementation of diets containing different qualities of wheat on growth performance and metabolizable energy of turkey poults. Int. J. Poult. Sci 3:33-45. Santos Jr., A.A., P.R. Ferket, J.L. Grime, and F.W. Edens, 2004b. Dietary supplementation of endoxylanase and phospholipase for turkeys fed wheat-based rations. Int. J. Poult. Sci 3:20-32. Sarra, P.G., F. Dellaglio, and V. Bottazzi, 1985. Taxonomy of lactobacilli isolated from the alimentary tract of chickens. Syst. Appl. Microbiol. 6:86-89. Sasaki, T., T. Yasui, and J. Matsuki, 2000. Influence of non-starch polysaccharides isolated from wheat flour on the gelatinization and gelation of wheat starches. Food Hydrocolloids. 14:295-303.
Satchithanandam S., M. Vargofcak-Apker, R.J. Calvert, A.R. Leeds, M.M. Cassidy, 1990. Alteration of gastrointestinal mucin by fiber feeding in the rat. J. Nutr. 120:1179–84. 99
Savage, T.F., P.F. Cotter, and E.I. Zakrzewska, 1996. The effectof feeding a mannan oligosaccharide on immunoglobulins, plasma IgG and IgA of Wrolstad MW male turkeys. Poult. Sci. 75 (Suppl. 1): Abstract S 129. Savory, C.J., 1992. Enzyme supplementation, degradation and metabolism of three U- 14C-labelled cell-wall substrates in the fowl. Br. J. Nutr. 67: 91-102. Schaible, P.J., 1970. Anatomy and physiology. Pages: 71-90. In: Poultry: Feeds and Nutrition. P.J. Schaible, ed. The Avi Publishing Company, Inc., Westport, Connecticut. Scheppach, W., and F. Weiler, 2004. The butyrate story: old wine in new bottles? Curr Opin Clin Nutr Metab Care 7(5):563-567. Schicklmaier, P., and H. Schmieger, 1995. Frequency of generalized transducing phages in natural isolates of the Salmonella typhimurium complex. Appl. Environ. Microbiol. 61:1637-1640. Schilcher, H., 1985. Effects and side-effects of essential oils. In: Proceedings of the 15th International Symposium of Essential Oils. Noordwijkerhout. The Netherlands. pp: 217-231. Schneeman, B.O., B.D. Richter, and L.R. Jacobs, 1982. Response to dietary wheat bran in the exocrine pancreas and intestine of rats. J. Nutr. 112:283-286. Scott, T.A., and F. Boldaji, 1997. Comparison of inert markers [chromic oxide or insoluble ash (CeliteTM)] for determining apparent metabolizable energy of wheat- or barley-based broiler diets with or without enzymes. Poul. Sci. 76:594-598. Sears, A., and G. Walsh, 1993. Industrial enzyme applications: Using these concepts to match animal, enzyme and substrate in feed industry applications. In: Biotechnology in feed industry: Alltech Technical Publication. Ed. 1993. T.P. Lyons. Alltech, Inc. Nicholasville, KY. Shibolet, O., F. Karmeli, R. Eliakim, E. Swennen, P. Brigidi, P. Gionchetti, M. Campieri, S. Morgenstern, and D. Rachmilewitz, 2002. Variable response to probiotics in two models of experimental colitis in rats. Inflamm. Bowel Dis. 8:399-406. Shih, J.C.H., 2001. From waste management to mad cow disease. In: Proceedings International Conference of Agricultural Science and Technology, Beijing, China. pp: 244-247. Silva, S.S.P., and R.R. Smithard, 2002. Effect of enzyme supplementation of a rye-based diet on xylanase activity in the small intestine of broilers, on intestinal crypt cell proliferation and on nutrient digestibility and growth performance of the birds. Br. Poult. Sci. 43:274-282. Silversides, F.G., and M.R. Bedford, 1999. Soluble non-starch polysaccharides, enzymes, and gut viscosity – is there a connection? World Poult. 15(3):17-18. 100
Simon, O., W. Vahjen, and D. Taras, 2004. Interaction of nutrition with intestinal microbial communities. Pages 33-46. In: Interfacing immunity, gut health and performance. L.A. Tucker, and J.A. Taylor-Pickard, eds. Nottingham University Press, Nottingham, United Kingdom. Smirnov, A., R. Perez, E. Amit-Romach, D. Sklan, and Z. Uni, 2005. Mucin dynamics and microbial populations in chickens small intestine are changed by dietary prebiotic and antibiotic growth promoter supplementation. J. Nutr. 135:187-192. Smith, H.W., 1965. The development of the flora of the alimentary tract in young animals. J. Pathol. Bacteriol. 90:495-513. Spring, P., C. Wenk, K.A. Dawson, and K.E. Newman, 2000. The effect of dietary mannanoligosaccharides on cecal parameters and the concentrations of enteric bacteria in the ceca of Salmonella-challenged broiler chicks. Poult. Sci. 79:205-211. Starr, M.P., and D.M. Reynolds, 1951. Streptomycin resistance of coliform bacteria from turkeys fed streptomycin. Pages 15-34. In: Proceedings of the 51st General Meeting, Society of American Bacteriology, Chicago, IL. Steenfeldt, S., K. E. Bach Knudsen, C.F. Borsting, and B.O. Eggum, 1995. The nutritive value of decorticated mill fractions of wheat. 2. Evaluation with raw and enzyme treated fractions using adult cockerels. Anim. Feed Sci. Technol. 54:249-265. Steenfeldt, S., M. Hammershoj, A. Mullertz, and F. Jensen, 1998. Enzyme supplementation of wheat-based diets for broilers. 2. Effect on apparent metabolisable energy content and nutrient digestibility. Anim. Feed Sci. Technol. 75:45-64. Stewart-Tull, D.E.S., 1980. The immunological activities of bacterial peptidoglycans. Annu. Rev. Microbiol. 34:311-340. Swann, M.M., 1969. Report of joint committee on the use of antibiotics in animal husbandry and veterinary medicine. HMSO, London. Swanson, K.S., 2002. Prebiotics and probiotics: impact on gut microbial populations, nutrient digestibilities, fecal protein catabolite concentrations and immune functions of humans and dogs. Diss. Abstr. Int. 63:746. Takahashi, T., T. Oka, H. Iwana, T. Kuwata, and Y. Yamamoto, 1993. Immune response of mice to orally administered lactic acid bacteria. Biosci. Biotechnol. Biochem. 57:1557-1560. Taki, K., F. Takayama, and T.Niwa, 2005. Beneficial effects of Bifidobacteria in a gastroresistant seamless capsule on hyperhomocysteinemia in hemodialysis patients. J. Ren. Nutr. 15(1):77-80. Tanabe, H., K. Sugiyama, T. Matsuda, S. Kiriyama, 2005. Small intestinal mucins are secreted in proportion to the settling volume in water of dietary indigestible components in rats. J. Nutr. 135:2431-2437. 101
Tappenden, K.A., and M.I. McBurney, 1998. Systemic short-chain fatty acids rapidly alter gastrointestinal structure, function, and expression of early response genes. Dig. Dis. Sci. 43(7):1526-1536. Teitge, D.A., G.L. Campbell, H.L. Classen, and P.A. Thacker, 1991. Heat pre-treatment as a means of improving the response to dietary pentosanase in chicks fed rye. Can. J. Anim. Sci. 71:507-513. Thoen, C.O., A.G. Karlson, and E.M. Himes, 1981. Mycobacterial infections in animals. Rev. Infect. Dis. 3:972. Thompson, J.L., and M. Hinton, 1997. Antibacterial activity of formic and propionic acids in the diet of hens on salmonellas in the crop. British Poultry Science 38:59-65. Thompson, K.L., and T.J. Applegate, 2005. Effect of feed withdrawal on mucus and morphology of the small intestine of broilers. In Proceedings, Poultry Science Association Annual Meeting. Auburn University, Auburn, Alabama, July, 31- August, 3. Tindall, B.J., P.A.D. Grimont, G.M. Garrity, and J.P. Euzeby, 2005. Nomenclature and taxonomy of the genus Salmonella. Int. J. Syst. Evol. Microbiol. 55:521-524. Torsvik, V., F.L. Daae, R.A. Sandaa, and L. Ovreas, 1998. Novel techniques for analyzing microbial diversity in natural and perturbed environments. J. Biotechnol. 64:53-62. Tottori, J., R. Yamaguchi, Y. Murakawa, M. Sato, K. Uchida, and S. Tateyama, 1997. The use of feed restriction for mortality control of chickens in broiler farms. Avian Dis. 41:4333-4377. Truscott, R.B., and F. Al-Sheikhly, 1997. The production and treatment of necrotic enteritis in broilers. Am. J. Vet. Res. 38:857-861. Turk, D.E., 1982. Symposium: The avian gastrointestinal tract and digestion. The anatomy of the avian digestive tract as related to feed utilization. Poult. Sci. 61:1225- 1244. Uni, Z., S. Ganot, and D. Sklan, 1998. Posthatch development of mucosal function in the broiler small intestines. Poult. Sci. 77:72-75. United States Department of Agriculture (USDA), Agricultural Research Service (ARS), 2004. Bacterial epidemiology and antimicrobial resistance. In: http://www.ars.usda.gov/research/projects/projects.htm. 2004 Annual Report. October, 2005. Van der Wielen, P.W., S. Biesterveld, S. Notermans, H. Hofstra, B.A.P. Urlings, and F. van Knapen, 2000. Role of volatile fatty acids in development of the cecal microflora in broiler chickens during growth. Appl. Environ. Microbiol. 66:2536-2540.
102
Van Laere, K.M.J., M. Bosveld, H.A. Schols, G. Beldman, and A.G.J. Voragen. 1997. Fermentative degradation of plant cell wall derived oligosaccharides by intestinal bacteria. Pages: 37-46. In: Proceedings, International Symposium Non-digestable oligosaccharides: healthy food for the colon? Hartemink, R., ed. Wageningen Graduate School VLAG, Wageningen. Van Leeuwen, P., and C.H.M. Versantvoort. 1999. Functional histology of small intestinal mucosa in livestock production animals. Pages: 9-21. In: Nutritional and gastrointestinal physiology – today and tomorrow. Jansman, A.J.M., and J. Huisman, eds. TNO, Wageningen. Van Paridon, P.A., J.C.P. Boonman, G.C.M. Selten, C. Geerse, D. Barug, P.H.M. de Bot, and G. Hemke, 1992. The application of fungal endoxylanase in poultry diets. Pages: 371-378. In: Xylans and Xylanases, Progress in Biotechnology. Vol. 7. J. Visser, G. Beldman, M.H. Kusters-Van-Someren, and A.G.J. Voragen, eds., Elsevier Science Publishers B. V., Amsterdam. Vispo, C., and W.H. Karasov, 1997. The interaction of avian gut microbes and their host: an elusive symbiosis. Pages 116-155. In: Gastrointestinal microbiology Vol. 1. R.I. Mackie and B.A. White, eds. Chapman & Hall, New York, NY. Viveiros, A., A. Brenes, M. Pizarro, and M. Castano, 1994. Effect of enzyme supplementation of a diet based on barley, and autoclave treatment, on apparent digestibility, growth performance and gut morphology of broilers. Anim. Feed Sci. Technol. 48:237-251. Vogt, H., S. Matthes, and S. Harnisch, 1982. Der Einfluss organischer sauren auf die leistungen von broilern. 2. Mitteilung. Archiv fur Geflugelkunde, 46:223-227. Vukic-Vranjes, M., and C. Wenk, 1996. Influence of Trichoderma viride enzyme complex on nutrient utilization and performance of laying hens in diets with and without antibiotic supplementation. Poult. Sci. 75:551-555. Wagner, D.D., and O.P. Thomas, 1978. Influence of diets containing rye or pectin on the intestinal flora of chicks. Poult. Sci. 57:971-975. Wagner, D.D., and O.P. Thomas, 1987. Influence of diets containing rye or pectin on the intestinal flora of chicks. Poult. Sci. 57:971-975. White, W.B., H.R. Bird, M.L. Sunde, and J.A. Marlett, 1983. Viscosity of β-glucan as a factor in the improvement of barley for chicks. Poult. Sci. 62:853-858. White, W.B., H.R. Bird, M.L. Sunde, N. Prentice, W.C. Burger, and J.A. Marlett, 1981. The viscosity interaction of barley beta-glucan with Trichoderma viride cellulase in the chick intestine. Poult. Sci. 60:1043-1048. Williams, C.M., C.S. Richter, J.M. Mackenzier Jr., and J.C.H. Shih, 1990. Isolation and characterization of a feather-degrating bacterium. Appl. Environ. Microbiol. 56: 1509-1515. Woese, C.R., 1987. Bacterial evolution. Microbiol. Rev. 51: 221-271. 103
Woodward, P. 2005. Impact of a ban on animal by-products and antibiotic growth promoters – European experience. Pages: 46-57. In: Proceedings, Thirty Second Annual Carolina Poultry Nutrition Conference, North Carolina, October, 26-27. World Heath Organization (WHO), Global Salm-Surv (GSS), 2005. Country Databank. In: http://www.who.int/salmsurv/en/ , Top 15 Salmonella Serotypes list. November, 2005. Yazawa, K., K. Imai, and Z. Tamura, 1978. Oligosaccharides and polysaccharides specifically utilizable by bifidobacteria. Chem. Pharm. Bull. (Tokyo). 26:3306-3311. Zhang, P., J.S. Wampler, A.K. Bhunia, K.M.Burkholder, J.A. Patterson, and R.L. Whistler, 2004. Effects of arabinoxylans on activation of murine macrophages and growth performance of broiler chicks. Cereal Chem. 81:511-514. Zhang, P., J.S. Wampler, A.K. Bhunia, K.M.Burkholder, J.A. Patterson, and R.L. Whistler, 2004. Effects of arabinoxylans on activation of murine macrophages and growth performance of broiler chicks. Cereal Chem. 81:511-514. Zoetendal, E.G., A.D.L. Akkermans, and W.M. De Vos, 1998. Temperature gradient gel electrophoresis analysis of 16S rRNA from human fecal samples reveals stable and host-specific communities of active bacteria. . Appl. Environ. Microbiol. 64:3854- 3859.
104
CHAPTER 2
EFFECT OF DIETARY SUPPLEMENTATION OF ENDOXYLANASES AND PHOSPHOLIPASE ON INTESTINAL SIZE AND HISTOMORPHOMETRY OF TURKEYS FED WHEAT-BASED DIETS1
______1The use of trade names in this publication does not imply endorsement by the North Carolina Agriculture Research Service or the North Carolina Cooperative Extension Service of the products mentioned nor criticism of similar products not mentioned. 105
2.1 ABSTRACT
Dietary non-starch polysaccharides (NSP) and appropriate enzyme supplementation may
influence growth performance of birds by affecting the morphology and size of the intestinal
tract. Day-old Large White BUTA toms were fed wheat-based diets containing one of 4
enzyme treatments: unsupplemented control (CC), enzyme blend (BL), exclusive
endoxylanase (EE), and phospholipase (PL) (BASF, Germany). The enzyme activities (U/kg
feed) were 5,500 EXU of BL and EE, and 500 U of PL. Each treatment group was assigned
to 2 pens with 12 birds each. At 56 d, 8 birds/treatment were sampled for the following
measurements: body weight, ileum histomorphometry analysis, ileum digesta fluid
viscosities, and weights and lengths of each intestinal section. Intestine weights and lengths
were calculated relative to BW. In comparison to CC and PL, the endoxylanase treatments
(BL and EE) decreased relative duodenum, jejunum and ileum lengths (9.6 vs 8.7, 18.1 vs
16.3, 22.6 vs 19.4 cm/kg, respectively; P<.05) and weights (8.8 vs 7.9, 11.3 vs 10.3, 8.6 vs
6.7 g/kg, respectively; P<.05). Enzyme addition decreased villus surface area (0.38 vs 0.29
mm2, P<.05). BL had the greatest crypt depth (214 vs 176 µm, P<.05). Digesta viscosity was
significantly higher for PL than the other treatments (13.6 vs 7.1 cP, P<.001). There was a
positive correlation between total relative intestinal weight and length with viscosity (both r=
0.3, P<0.05), but a negative correlation with BW (r= -0.5, P<.001). Enlargement of the
digestive organs may compromise lean tissue growth because more metabolizable energy,
amino acids and other dietary resources are partitioned towards maintenance requirements of
enteric tissues. Dietary endoxylanase supplementation to wheat-based diets decreased
intestinal viscosity and intestinal size and consequently improved performance of turkeys.
(Key words: wheat, enzyme, intestinal size, intestinal histology, performance, turkey) 106
2.2 INTRODUCTION
Small grain cereals (i.e. wheat, barley, and oats) are important foodstuffs for humans,
and livestock throughout the world. However, cereal use in poultry diets is dependent upon
local availability (Veldman and Vahl, 1994; Brum et al., 2000) and cost relative to other feed
ingredients. Cereal grains are predominantly composed of starch. In addition, cereals contain
non-starch polysaccharides (NSP), which are composed of glucose (β-glucan), fructose
(poly-fructan), xylose and arabinose (arabinoxylan) (Belitz and Grosch, 1999). Most of the carbohydrate fraction (i.e. starch) of cereals is well digested, but some are not digested by endogenous enzymes and they are considered as dietary fiber. These dietary fibers play an
important nutritional role in animal and human intestine. On one hand, excessive amounts of
dietary fiber adversely affects nutrient digestibility and reduces growth performance of
broilers and turkeys (Langhout et al., 2000; Santos Jr. et al., 2004a,b). On the other hand,
dietary fiber is beneficial to the intestinal microbial ecology and may suppress the
colonization of enteric pathogens that adversely affect health and welfare of the animals
(Persia et al., 2002; Remus, 2003; Lan, 2004).
Numerous authors have reported that dietary fiber content (NSP and lignin) has a
marked effect on the anatomy, development and function of the intestine. In general, dietary
fiber leads to increased size and length of the small intestine, cecum and colon of chickens
(Iji et al., 2001), pigs (McDonald, 2001), and rats (Ikegami et al., 1990). These effects are
often associated with changes of the intestinal epithelium morphology, and its hydrolytic and
absorptive functions. The effect of the dietary fiber on epithelial morphology and cell
turnover is variable, and it depends on the status of intestinal microflora. Increased epithelial
cell proliferation in colon crypts has been observed in humans fed oat bran and oat gum 107
(Malkki and Vertanen, 2001) and in rats fed fermentable fiber (Goodlad et al., 1987).
However, as demonstrated in germ-free rats by the latter authors, the effect on epithelial cell proliferation requires the presence of the resident microflora. Langhout et al. (2000) also
observed a significant change in ileal villi morphology from predominantly zigzag pattern
villi orientation to a more disorderly pattern of ridge-shaped or tongue-shaped villi when
broilers were fed a diet containing high NSP content. This altered villi morphology was
associated with a reduction in the effective absorptive surface area and decreased nutrient
absorption. This change in villi morphology was observed more in conventional chicks than
in germ-free ones. Langhout and co-workers (2000) concluded that these morphological
observations were due to the increased amount of toxic microbial fermentation products, such as amines and ammonia. Similar findings have been reported by other authors (Wagner and Thomas, 1978; Campbell et al., 1983, Choct et al., 1996).
Dietary enzyme supplementation has been shown to alleviate the adverse effects of
NSP as mentioned above, including histological alterations and enlargement of digestive
organs of broilers (Brenes et al., 1993a; Silva and Smithard, 2002) and laying hens (Brenes et
al., 1993b). However, there are inconsistencies in the results reported in the literature on the
effect of dietary enzyme supplementation and NSP level on changes of intestinal
characteristics.
Endoxylanase and enzyme complex products decrease intestinal viscosity and
improve fat digestability by preserving the integrity and function of bile salts, thus allowing
the formation of fat micelles. Another approach to alleviate the adverse effect of NSP on fat
digestion in diets with high inclusion levels of wheat could be by increasing endogenous
intestinal phospholipase A2, which catalyzes the hydrolysis of glycerophospholipids (GPL) to 108
yield fatty acids and lysophospholipids (e.g. Lyso-phosphatidylcholine or Lyso-PC). The
fatty acids are then absorbed from the lumen as part of the fat micelle. Lyso-PC, the
predominant GPL product in the luminal content, is essential for the emulsification of water-
insoluble lipids (Homan and Jain, 2001). Thus, dietary supplementation of exogenous phospholipase could alleviate the adverse effects of NSP by facilitating the formation of micelles of triglyceride, cholesterol, and other nonpolar dietary lipids. However, the effect of supplementation of exogenous phospholipase in wheat-based diets for poultry on intestinal size and histomorphometry has not been investigated.
The objective of this study was to evaluate the effect of exogenous enzymes preparations on intestinal size and histomorphometry of turkeys fed diets high in non-starch polysaccharide content. The enzyme treatments tested were an enzyme blend that included significant endoxylanase activity, and an enzyme preparation that contained endoxylanase
exclusively. The quantitative supplementations of each of these enzyme products were such
that both dietary treatments included the same activity of endoxylanase; therefore we could test the effect of a blended product compared to a single endoxylanase preparation. Another dietary treatment included the supplementation of an enzyme product that contained phospholipase exclusively to test the hypothesis that its dietary supplementation could alleviate the adverse effects of NSP by facilitating lipid digestibility.
109
2.3 MATERIALS AND METHODS
Enzymes
The enzyme activity in the product and feed, and application rate used in the experimental diets are shown in Table 1. Natugrain Blend® 66% is a commercial liquid enzyme preparation obtained from fungal fermentation of Trichoderma longibrachiatum. It contained standardized activities of at least 9,000 β-glucanase activity (BGU) per gram of product and at least 36,600 endoxylanase units (EXU) per gram of product (BASF, 2001).
One BGU is defined as the activity required to liberate 0.278 µmol of reducing sugar
(measured as glucose equivalents) per minute at pH 3.5 and 40°C, at a substrate concentration of 0.5% β-glucan from barley. One EXU is defined as the enzyme activity required to liberate 1 µmol of reducing sugar (measured as glucose equivalents) per minute from a 1% xylan solution at pH 3.5 and 40°C. Natugrain Blend® also contained some hemicellulase (e.g. pectinase), cellulase and protease activities (BASF, 1997). Lyxasan
Forte® is a commercial liquid preparation obtained from a genetically modified Aspergillus niger that produces endoxylanase exclusively. Lyxasan Forte® had an endoxylanase activity of at least 56,000 EXU/g of product. Phospholipase is an experimental liquid enzyme preparation obtained from a microbial source and it contained activities of at least 5,000 units of phospholipase A2 per gram of product (BASF, 2001). All the enzyme preparations were supplied by BASF1.
1BASF AG, 67059 Ludwigshafen, Germany. 110
The Natugrain Blend® was supplemented to the diet to achieve the same level of
endoxylanase activity in the feed as provided by Lyxasan Forte®. This treatment design
allowed the evaluation of the effect of endoxylanase as a single enzyme preparation or along with several other enzymes. Phospholipase was used to test the hypothesis that its dietary supplementation could alleviate the adverse effects of NSP by facilitating lipid digestibility.
Diets
The experimental diets are presented in Table 2. Two feed phases were used during the course of the experiment. All feeds were formulated using least-cost linear programming software, such that the diets contained about 95% of the NRC (1994) recommendations for amino acids and energy. The diets were formulated slightly below requirements so that any improvement in nutrient availability due to enzyme supplementation could be observed as an improvement in growth performance. All experimental diets consisted of the same wheat-
SBM basal diet with different supplemental enzyme treatments using an inclusion level of
0.1%. The unsupplemented control diet was supplemented with 0.1% of nonnutritive dietary filler, washed builders sand. All feed was pellet-processed and fed in crumble form up to 4 weeks of age, and subsequently as a whole 8 millimeter pellet form. Composite feed samples from each diet were taken immediately after manufacture and subjected for analysis for crude protein, fat, ash, Ca, and P.
The enzymes were applied to the feed in a 500 kg capacity horizontal double ribbon mixer and then bagged into 20kg bags. The three enzymes (Natugrain Blend®, Lyxasan
Forte®, and Phospholipase) were applied as a fine spray onto the pelleted feed during mixing
using a plant mister. The enzymes were added to the diet in amounts recommended by the 111
supplier (BASF, 2001). The enzymes were diluted in water to a volume of 1 litter, such that
the dosages per tonne of feed were 150g of Natugrain Blend®, 100g of Lyxasan Forte®, and
100g of Phospholipase. The wheat sample used in this experiment was previously determined to be a low-AME wheat (2,216 kcal/kg) (Santos Jr. et al., 2004a) because wheat samples assaying less than 2,850 kcal/kg are arbitrarily classified as low-AME wheat (Mollah et al.,
1983). This wheat, from Western Canada, had been exposed to a damaging frost event during grain filling stage (mid-milk to early-dough stage).
Bird husbandry
The facility used in this study was a curtain-sided house containing ninety-six 9.3 square meter pens, however only 8 pens were used in this trial. Each pen was top-dressed with 4 cm of soft pine shavings at the start of the experiment. Ventilation was provided by natural air movement through appropriately adjusted curtain sides and air mixing fans located on the ceiling throughout the house. High and low ambient temperatures within the house were recorded at two places twice daily throughout the duration of the trial. The house temperature was kept at 29-31ºC during the first week (wk), and then gradually stepped down to the ambient outside temperature, which ranged from a low of 6ºC to a high of 34ºC. The house was illuminated with incandescent lights for 23 hours per day during the first week and subsequently by natural daylight. A heat lamp unit2 with a 125-watt bulb3 provided
supplemental heat for each pen. Feed and water were provided ad libitum throughout the
duration of the study. Visual heath inspection of all birds within the study was performed
2Heat Lamp, Model # 54411-Heave Gauge Aluminium Base, Hog Slats, Inc., Newton Grove, NC, 28366. 3125-watt bulb, SLI, China; Distributor: Hog Slats, Inc., Newton Grove, NC, 28366. 112
daily and weights of culled birds and reasons they were removed were recorded. Crippled or
dead birds were removed and recorded throughout the experiment.
The purpose of the experiment was to evaluate the effect of exogenous enzyme
preparations on intestinal size and histomorphometry of turkeys fed diets high in non-starch
polysaccharide content. To achieve this objective, eight pens of the experimental house were
assigned to this trial. Four dietary treatments were randomly assigned to pens using the Proc-
Plan procedure of SAS® (SAS, 1996). One-day-old commercial Large White BUTA4 male turkeys were obtained from a commercial hatchery5 and randomly assigned to the pens. Each
pen of 10 turkeys, the experimental unit, were subjected to one of 4 dietary enzyme
treatments from 1 to 56 (0-8 wk) days of age, as follows: (1) unsuplemented control, (2)
enzyme blend (Natugrain Blend®) supplementation, (3) endoxylanase (Lyxasan Forte®) supplementation, and (4) phospholipase supplementation. Each treatment combination was replicated by 2 pens.
Data collection
Wing bands were applied to 8 birds per pen at 7 weeks of age to identify their treatment assignment during tissue sampling. At 8 weeks of age, the birds were fasted over night (8 h) and then given ad libitum access to feed for 3 h before sampling. The eight wing- banded birds from each pen were weighed and euthanized by asphyxiation with carbon dioxide gas. Intestinal segments were dissected from each bird and lengths were measured.
The intestinal segments were duodenum (from the gizzard to pancreatic and bile duct), jejunum (from the bile duct to Meckel’s diverticulum), ileum (from the Meckel’s 113
diverticulum to ileo-cecal-colonic junction), and ceca (Samanya and Yamauchi, 2002).
About 2 grams of digesta were gently expressed from the terminal part of ileum, placed into
micro-centrifuge tubes, centrifuged at 3,000 rpm for 2 min, and approximately 500 µl of the supernatant was collected, and immediately the viscosity of the supernatant was determined using Brookfield Digital Viscometer LVDVII+CP6 at 18ºC according to the method
described by the Brookfield Digital Viscometer Operating Instructions Manual7. Each bird
was considered an experimental unit for the statistical analysis of the digesta fluid viscosity.
After expressing the digesta from each segment, the tissue weights of each intestinal section
were recorded. Intestinal weight and length were calculated relative to bird live body weight
(Brenes et al., 2002).
Subsequently, 3 cm section from the middle part of the ileum was sampled. Its lumen
content was washed by injecting a solution of 10% formalin fixative buffer (Salgado et al.,
2001, 2002; Samanya and Yamauchi, 2002). Immediately, the 3 cm section was placed into
clean 10% fixative formalin buffer solution for 24 hours, which was used for histology
analysis.
The remaining fresh duodenum, jejunum, ileum, and ceca segments were placed in
bags, and frozen. In the laboratory, the segments were thawed overnight. Then, 10 cm
sections from each intestinal segment were dissected. The sections were cut horizontally to
expose the mucosa. The mucosa of the whole 10 cm section was removed by gently scraping
4British United Turkeys of America. 5Goldsboro Milling Co., Goldsboro, NC, USA. 6Brookfield Engineering Laboratories Inc., Stoughton, MA. 7Brookfield Digital Viscosimeter, Model DV-II+ Version 2.0, Operating Instructions Manual No. M/92-161- F1193, Brookfield Engineering Laboratories Inc., Stoughton, MA. 114
it with a clean histological slide. Then, the mucosa and muscularis were weighed.
Subsequently, the 10 cm sections of muscularis and mucosal were placed in a 120ºC oven
and dried overnight for dry matter weight analysis. Statistical analysis on the muscularis and mucosal weight were performed on the wet- and dry-matter basis. Wet-basis analysis did not differ statistically from the dry-matter basis, and therefore, all values are presented on a wet- basis.
Histology analysis
The 3 cm ileum segment placed in the 10% fixative formalin buffer solution for 24 hours was processed in the laboratory according to a modification of the methods described by Iji et al. (2001) and Samanya and Yamauchi (2002). Briefly, four sections of approximately 2 to 3 mm were taken from the fixed ileum segment of each bird. The sections were enclosed in tissue cassettes and embedded in 10% formalin buffer solution until processed by the Histology Laboratory8. The fixed ileum sections were embedded in paraffin
wax within 72 h to avoid artifacts. Transverse sections of 5-µm thick were cut with a rotary
microtome and stained with Lilee Meyer haematoxylin and counter-stained with eosin yellow.
The transverse section slides were viewed by a Leica-DMR light-microscope9 (optical lens No 4), digitized using a Spot-RTCR digital camera10, and the images were analyzed
using Image Tool software11. Images were viewed to measure villus height, villus apical
width at the villus tip, villus basal width at the crypt-villus junction, crypt depth, and
8 Histopathology Laboratory, College of Veterinary Medicine, NCSU, Raleigh, NC. 9 LEICA-DMR light-microscope, Leica Camera AG, Solms, Germany. 10 Spot-RTCR digital camera, Diagnostic Instruments, Inc., Sterling Heights, MI. 115
muscularis depth as described on the footnotes of Table 7 and by Iji et al. (2001). Apparent villus surface area was estimated from the trigonometric relationship between villus height, villus basal width and villus apical width (Iji et al., 2001). Mucosal heights were calculated from crypt depth plus villi height measurements. In addition, villus height/crypt depth ratio was calculated.
Fifteen individual villi were assessed per section. An average of the 15 measurements assessed per section was calculated and expressed as a mean for the corresponding section. A total of four sections were counted from each intestinal segment of each sampled bird. Then, an average of these four sections per bird was express as a mean of the desired measurement
(e.g. mean villus height) for each bird. Each bird served as an experimental unit for the purpose of statistical analysis.
Statistical analysis
All data were analyzed using the general linear models procedure for analysis of variance (ANOVA) of SAS® (1996), with treatment included in the experimental model. Bird
means served as the experimental unit for statistical analysis. Variables having a significant
F-test were compared using the least-squares-means function of SAS (SAS, 1996), and the
treatment effects were considered to be significant at P<0.05. Correlation analyses between
the measurements were performed using correlation procedure of SAS (1996).
11 UTHSCSA Image Tool Software, Version 3.0, The University of Texas, San Antonio, TX. 116
Animal ethics
The experiment reported herein was conducted according to the guidelines of the
Institutional Animal Care and Use Committee (IACUC) at North Carolina State University.
All husbandry practices and euthanasia were done with full consideration of animal welfare.
2.4 RESULTS
Intestinal size
In comparison to the control and phospholipase treatments, endoxylanase supplementation decreased relative duodenum, jejunum and ileum weights (8.8 vs 7.9, 11.3 vs 10.3, 8.6 vs 6.7 g/kg, respectively; P<0.05; Table 3) and lengths (9.6 vs 8.7, 18.1 vs 16.3,
22.6 vs 19.4 cm/kg, respectively; P<0.05; Table 4). However, there were no significant treatment effects on cecal weights and lengths (P<0.05), nor were there significant (P<0.05) treatment effects observed on relative intestinal muscularis and mucosal weights (Table 5).
Total relative intestinal weight and length were positively correlated with viscosity (r= 0.3,
P<0.05), but they were negatively correlated with body weight (r= -0.5, P<0.001) (Table 8).
Furthermore, the endoxylanase treatments resulted in the lowest relative intestinal length and weight along with the lowest viscosities, and highest body weight.
Ileum digesta viscosity
The ileum digesta viscosities of turkeys fed the wheat-based diets supplemented with phospholipase were 48% higher (P< 0.001) than those fed the other dietary treatments (Table
6). There was no difference on ileum digesta viscosity at 56 days of age between the control 117
birds and those fed diets supplemented with enzyme preparations containing endoxylanase
(blend and endoxylanase treatments).
Intestinal morphometry
Although there was no significant (P>0.05) difference observed in villus height
between treatment groups, enzyme supplementation significantly (P<0.05) decreased villus apical and basal width, and consequently villus surface area in comparison to the control treatment (Table 7). Turkeys fed wheat-based diets supplemented with the blended enzyme preparation had the highest (P<0.05) crypt depth and consequently the lowest villus height:crypt depth ratio in comparison to the other treatment groups. Overall, mucosal and muscularis depth were not significantly (P>0.05) influenced by enzyme supplementation. In addition, ileum histological measurements were not statistically (P>0.05) correlated with bird body weight (Table 8).
2.5 DISCUSSION
This research evaluated the effect of different sources of supplemental enzymes on intestinal size and histomorphometry of turkeys fed wheat-based diet. As hypothesized, endoxylanase supplementation decreased intestinal weight and length, along with the decreased viscosity. However, phospholipase fed birds had the highest ileum digesta viscosity and intestinal size. In addition, birds supplemented with the blended enzyme preparation had the highest crypt depth and the lowest villus height:crypt depth ratio.
The wheat source used in this experiment was previously determined in our laboratory to be low-AME wheat (2,216 kg/kg) when fed to turkeys (Santos Jr. et al., 2004a). 118
This wheat was frost-damaged during the grain filling (mid-milk to early-dough) stage of seed development. Frost damaged during grain filling reduced nutrient utilization of wheat presumably by increased relative content of NSP to starch (Santos Jr. et al., 2004a). This wheat was chosen because there is evidence that responses to enzymes are greatest with low-
AME wheat because of its higher NSP content (Choct et al., 1994).
Dietary endoxylanase supplementation decreased intestinal weight and length as ileal digesta viscosity decreased. There were no significant differences in the relative mass of intestinal muscularis and mucosal among treatments, indicating that the observed increase in intestinal weight was associated with an increase in intestinal length. One way birds adjust to changes in diet is by altering intestinal surface area (Moran, 1985). Petterson and Aman
(1989) observed that the small intestine of birds fed a wheat-based diet was 3% longer than those fed the same diets supplemented with an endoxylanase. Other authors have also observed that dietary fiber ingestion leads to increased size and length of the digestive organs in pigs (Jin et al., 1994; McDonald, 2001), chickens (Van der Klis and Van Voorst, 1993; Iji et al., 2001), and rats (Ikegami et al., 1990). No information about specific physiological mechanisms exists in the literature that explains increased intestinal size in response to dietary enzyme supplementation. However, it is generally accepted that the viscous properties of water-soluble NSP are mainly responsible for the anti-nutritive effects in poultry (Langhout et al., 2000). It is speculated that the significant improvement in the intestinal size of birds fed wheat-based diets supplemented with pentosanase might be a consequence of the break down of polysaccharides into smaller polymers (De Silva et al.,
1983), thereby reducing their viscosity. However, in the experiment reported herein, the control fed birds and endoxylanase supplemented toms had similar intestinal viscosity. 119
Similar results have been described by other investigators who observed no decrease in digesta viscosity, but an increase in performance and nutrient utilization from endoxylanase supplementation as compared to birds fed a NSP-rich diet without enzyme supplementation
(Veldman and Vahl, 1994; Silva and Smithard, 2002).
The increased intestinal size of the turkeys fed diets without enzyme addition may be associated with the reduced absorptive capacity as compared to birds fed endoxylanase- supplemented feed. The rate of digestion and absorption of the nutrients depends upon a complex formed between the digestive enzymes and their substrates, subsequent release of nutrient products, and the diffusion of these nutrients across the unstirred water layer to the enterocyte for absorption (Bedford, 1995). Thus, viscosity may play a significant role in the digestion and absorption process as it affects diffusion rate. However, in this experiment viscosity per se was not an issue in the birds receiving endoxylanase and control feed because viscosity was similar among these treatments. Rather than improving viscosity, the dietary xylanase supplementation may have beneficially affected the adaptation of the intestinal tract size of the animals by improving nutrient digestibility (Cowieson, 2005). This response is presumably mediated through the hydrolysis of structural arabinoxylans, which may release encapsulated nutrients (Cowieson, 2005).
In addition, enzyme supplementation may have increased retention time of digesta in the lumen of the intestinal tract, which might have increased the time that nutrients are available for digestion and absorption. Almirall and Esteve-Garcia (1994) measured the rate of passage through the digestive tract of chicks fed diets containing 60% barley with and without dietary β-glucanase supplementation. They observed that digesta retention time was significantly reduced by the addition of enzyme to the diet. Furthermore, Fraga et al. (1991) 120 evaluated the effect of fiber on the rate of passage and its contribution to nutrient intake of finishing rabbits. They reported that low fiber levels in rabbit diets promote a longer retention time of the digesta in the GIT which help meet the nutrient requirements of the rabbits. Similarly, Bartelt et al. (2002) measured the prececal digestibility of arabinoxylans in piglets and reported considerable digestibility of insoluble arabinoxylans. Interestingly, these researchers observed that the soluble fraction had a negative effect on digestibility. When xylanase was added to the diet, digestibility of all fractions was increased. Therefore, endoxylanase may have improved nutrient digestibility by increasing their accessibility for absorption and available time in the GIT.
Although viscosity alone does not appear to be the major factor affecting intestinal size, it is still considered to be an important factor. Ileum digesta viscosity was positively correlated with intestinal size, although the correlation coefficient was very low (r= +0.3,
P<0.05). The birds fed the phospholipase-supplemented diet had the greatest intestinal weight and length as well as the highest digesta viscosity. The ileal digesta viscosity observed in the phospholipase-fed group was 92% higher than the other treatment groups.
Phospholipase increases the stability of the emulsion, which is positively correlated to the viscosity of the oil (Jumaa and Muller, 1998; Jumaa et al., 1998, Chung et al., 2001). High intestinal viscosity may impair the diffusion and convective transport of enzymes within the gastrointestinal contents (Smits and Annison, 1996), which in turn interferes with nutrient digestion and diffusion during absorption. Edwards et al. (1988) demonstrated in vitro that the convective transport of glucose and sodium was impaired in a viscous environment.
Moreover, Smits and Annison (1996) reported that viscosity may reduce the degree of contact between dietary constituents (e.g. starch) and the digestive secretions, and it impairs 121
the transport of nutrients to the epithelial surface. Therefore, digesta viscosity may influence the adaptation of the gastrointestinal tract towards increased intestinal surface area.
Apparently, enlargement of the GIT may compromise lean tissue growth because more metabolizable energy, amino acids and other dietary resources are partitioned towards maintenance requirements of enteric tissues, resulting in less efficient growth. Endoxylanase supplementation resulted in the lowest relative intestinal length and weight along with the lowest viscosities, but highest body weight (performance data previously published, Santos et al. 2004b). There was a negative correlation between bird body weight and relative total intestinal weight and length (r= -0.3 and -0.5, P<0.05, respectively). The metabolic costs to maintain GIT accounts for about 30% of the total body metabolic rate (Aiello, 1997). Thus, enlargement of the digestive organs may compromise lean tissue growth because more protein synthesis and energy could be directed toward organ growth. In agreement, the performance data previously published (Santos et al., 2004b) showed that enzyme supplementation reduced feed/gain ratio, which is likely associated with a reduction in relative GIT mass as observed in this reported study.
An increase in intestinal surface area could be accomplished by a corresponding increase in villus surface area or total number of villus. An increase in villus surface area can be achieved by increasing villus height and/or villus width. In this experiment, there was no significant difference in villus height among treatments, but the control birds had the greatest villus surface area because of increased villus width. This response was correlated with the increase in intestinal length to compensate for the restricted nutrient absorption when high-
NSP diets were fed without enzyme supplementation. 122
Contrarily of the control birds, toms fed diets supplemented with phospholipase had an increased intestinal size, but they did not exhibit any increase in villus width or villus height. The phospholipase-fed birds had the higher ileal digesta viscosity, lower 0-16 weeks body weight gain, and the lower apparent metabolizable energy than any of the other treatment groups (Santos et al., 2004b). Apparently, the high ileal digesta viscosity (92% higher than the other treatment groups) may have compromised intestinal anatomy and intestinal function. Similarly, Iji et al. (2001) reported that high digesta fluid viscosity in the intestine increased the weight of the small intestine and decreased broiler body weight and efficiency of feed utilization. In addition, Johnson et al. (1984) observed an increase in the intestinal length of rats when fed diets that were supplemented with guar gum, and they related this effect to an increase in mitotic activity within the mucosa. In accordance with the current experimental results, birds supplemented with phospholipase and the blended enzyme preparation had the lowest villus height:crypt depth ratio, indicating increased enterocyte turnover rate (Pluske et al., 1997).
Although there was no definite trend in the effects of the viscous NSP content of the diet and dietary enzyme supplementation on the enteric histological measurements, the decrease in villus height:crypt depth ratio by the endoxylanase blend supplementation group might be associated with increase hindgut fermentation described in the literature (Goodlad et al., 1987; Pluske et al., 1997; Langhout et al., 2000). However, no specific analyses of microbial fermentation were completed in this experiment. The enzyme blend preparation significantly increased crypt depth of toms by about 22% relative to other treatment groups, and as a result, decreased villus height:crypt depth ratio, suggesting an increased enterocyte turnover rate (Pluske et al., 1997; Iji et al., 2001; Samanya and Yamauchi, 2002). Pluske et 123
al. (1997) reported that villus height/crypt depth ratio was coupled with an increase in the
rate of crypt-cell proliferation and of the number of cells exhibiting DNA fragmentation
(indicating programmed cell death), both leading to a faster enterocyte turnover and
decreased animal performance. However, no significant correlation between intestinal
histological measurements and body weight of the bird were observed.
Enterocyte turnover rate is associated with short-chain fatty acid (SCFA)
concentrations in the digesta. Short chain fatty acids are the major end products of hindgut
microbial fermentation. Lan (2004) suggested that SCFA can accelerate intestinal epithelial
cell proliferation, which can result in changes of mucosal morphology and enlargement of the
GIT. Microbial fermentation increases because dietary fiber, mainly NSP, is the main
substrate for bacterial fermentation, partially in the large intestine (Montagne et al., 2003), and enzyme seems to increase the NSP substrate for the microbial use (Steenfeldt et al.,
1998). Steenfeldt et al. (1998) observed a decrease in the pH in the cecal contents of chickens as a result of enzyme supplementation. The pH decreased as SCFA production increased by increased fermentation of microbes, especially Lactobacillus and Bifidobacterium. Although microflora fermentation in the small intestine decreases when xylanase is supplemented to
the diet, microbial fermentation increases in the large intestine and ceca. Nevertheless, the
enzyme preparation containing only endoxylanase did not influence any crypt depth relative
to control, which suggested that the blended enzyme preparation might have promoted higher
hindgut fermentation. Odetallah et al. (2002) reported that an enzyme blend containing high
endoxylanase activity resulted in better results in turkeys fed wheat-based diets than single
enzyme preparations. Ravindran et al. (1999) stated that there is considerable synergy in
activities among enzymes when they are supplemented as a blended preparation. 124
Immaturity of the cecal microbial community might be the reason for the absence of treatment effect on ceca weight and length. Cecal size is not much affected by the physical action of viscous material. Cecal size is mostly influenced by microbial fermentation products such as SCFA because the flow of material into the ceca is controlled by valves that usually allow only fluids and fine particles to enter (Duke, 1986). However, an active and established cecal microflora is needed to produce sufficient SCFA to promote a significant effect on cecal size, which may take a period longer than tested in this current study.
According to Ochi et al. (1964), ceca populations in the chick takes up to 30 days to become fully established, although Barnes et al. (1972) found that changes continued to occur for some six weeks or more after hatching.
In conclusion, diets high in NSP content and dietary exogenous enzyme supplementation exerted a major influence on the intestinal tract size and histomorphometry as the body attempts to adapt to alterations in intestinal digesta viscosity, compromised nutrient digestibility, and adverse physicochemical effects of NSP. Intestinal adaptation to the diet is a complex process that is poorly understood and thus difficult to characterize. As dietary NSP interacts both with the mucosa and the microflora, it plays an important role in the control of intestinal health, anatomy, development and function, all which can alter the performance of birds. Intestinal size and histomorphology can be significantly influenced by endoxylanase supplementation, especially when supplemented in combination with other
enzymes such as β-glucanase, protease, amylase, and cellulase.
125
ACKNOWLEDGMENTS
This work was supported by BASF12, the North Carolina Agricultural Foundation,
and the United States Department of Agriculture. The authors wish to thank Annette Israel,
Carol Morris, Scott Crow, Chris Parks, Daniel Moore, Renee Plunske, Yuwares
Sungwarapon, Ondulla Foye, Mike Mann, Robert Neely, Pam Jenkins, and the Poultry
Educational Unit employees at North Carolina State University for their technical assistance during this trial.
12BASF AG, 67059 Ludwigshafen, Germany 126
2.6 TABLES AND FIGURES
TABLE 1: Enzyme activity in the products and in the feed, and rate of application used in the experimental diets1
Activity Application rate Enzyme activity Treatment Enzyme (units/g DM)2 (g/tonne feed) (units/kg feed) Natugrain Blend® > 36,600 EXU/g > 5,500 EXU/kg Blend 150 (66%) > 9,000 BGU/g > 1,350 BGU/kg
Endoxylanase Lyxasan Forte® > 56,000 EXU/g 100 > 5,500 EXU/kg
Phospholipase Phospholipase 5,000 PLU/g 100 500 PLU/kg 1Products supplied by BASF (BASF AG, 67059 Ludwigshafen, Germany). Data from BASF, 2001. 2EXU= endoxylanase units, BGU= β-glucanase units, PLU= phospholipase units.
127
TABLE 2: Composition and calculated nutrient content of the experimental diets fed to turkey toms from 1 to 56 days of age
Starter Feed Grower Feed Ingredients (1 to 28 d) (29 to 56 d)
(%) Wheat 46.82 61.18 Soybean meal (48% CP) 42.83 23.25 Poultry meal (60% CP) 0.00 5.00 Poultry Fat 3.85 4.62 Dicalcium phosphate (18.5% P) 2.42 3.13 Limestone 1.66 0.17 Crude soy oil 1.00 1.00 Salt 0.35 0.19 Mineral premix1 0.20 0.20 Choline Cl (60%) 0.18 0.11 DL-Methionine 0.16 0.16 L-Threonine 0.00 0.14 L-Lysine HCL 0.08 0.41 Vitamin premix2 0.20 0.20 Sand or enzyme3 0.10 0.10 Selenium premix4 0.15 0.15 Calculated analysis ME, kcal/kg 2,700 2,800 Crude protein, % 27.0 23.0 Lysine, % 1.55 1.40 Methionine + Cysteine, % 1.00 0.90 Threonine, % 0.97 0.90 Calcium, % 1.25 1.00 Non-phytate phosphorus, % 0.60 0.85 Sodium, % 0.18 0.15 1 . . Supplied the following per kilogram of feed: 120 mg Zn as ZnSO4 H2O; 120 mg MN as MnSO4 H2O; 80 mg Fe . as FeSO4 H2O; 10 mg Cu as CuSO4; 2.5 mg I as Ca(IO3)2; 1.0 mg Co as CoSO4. 2Supplied the following per kilogram of feed: vitamin A, 26,400 IU; cholecalciferol, 8,000 IU; niacin, 220 mg; pantothenic acid, 44 mg; riboflavin, 26.4 mg; pyridoxine, 15.8 mg; menadione, 8 mg; folic acid, 4.4 mg; thiamin, 8 mg; biotin, 0.506 mg; vitamin B12, 0.08 mg; ethoxyquin, 200 mg. The vitamin E premix provided the necessary amount of vitamin E as DL-α-tocopheryl acetate. 3Enzyme treatments were supplemented with enzyme products that accounted as a dry ingredient (0.1%) and an equivalent amount of sand was applied to the unsuplemented control treatment. 4Selenium premix provided 0.3 ppm Se from sodium selenate.
128
TABLE 3: Effects of different exogenous enzyme supplementation on relative intestinal weight8 of 56 days-old turkey toms fed wheat-based diets
9 Treatment Duodenum Jejunum Ileum Ceca Total Intestine
(g/kg) Control1 8.27b 10.84a 8.788a 6.19 34.10a Blend2 7.96b 9.73b 6.723b 6.35 30.76b Endoxylanase3 7.81b 10.80a 6.684b 6.14 31.43b Phospholipase4 9.22a 11.69a 8.318a 6.32 35.55a SEM(59)5 0.289 0.375 0.331 0.212 0.774 P-value 0.0044 0.0059 0.0001 0.8782 0.0001 a,bMeans with different superscripts within a column differ significantly (P< 0.05). 1Control treatment = Unsupplemented wheat/SBM basal diet. 2Blend treatment = 150g of Natugrain Blend/tonne of basal diet provided at least 5,500 EXU/kg feed and 1,350 BGU/kg feed. 3Endoxylanase treatment = 100g of Lyxasan Forte/tonne of basal diet provided at least 5,500 EXU/kg feed. 4Phospholipase treatment = 100g of Phospholipase/tonne of basal diet provided 500 PLU/kg feed. 5SEM(59)= Standard Error of the mean with 59 degrees of freedom. 6Enzyme= Mean value of the treatments supplemented with Natugrain Blend, Lyxasan Forte and Phospholipase. 7Xylanase: Mean value of the treatment supplemented with Natugrain Blend and Lyxasan Forte. 8Relative intestinal weight = Bird intestinal segment weight/Bird Body weight 9Total relative intestinal weight = sum of the duodenum, jejunum, ileum and ceca weight, divided by body weight.
129
TABLE 4: Effects of different exogenous enzyme supplementation on relative intestinal length8 of 56 days-old turkey toms fed wheat-based diets
9 Treatment Duodenum Jejunum Ileum Ceca Total Intestine
(cm/kg) Control1 9.33ab 17.84ab 22.65a 13.91 63.73a Blend2 8.76b 16.19c 19.05b 13.07 57.06b Endoxylanase3 8.80b 16.48bc 19.65b 12.94 57.87b Phospholipase4 9.79a 18.38a 22.61a 14.30 65.08a SEM(59)5 0.269 0.502 0.545 0.439 1.340 P-value 0.0261 0.0070 0.0001 0.0925 0.0001 a-cMeans with different superscripts within a column differ significantly (P< 0.05). 1Control treatment = Unsupplemented wheat/SBM basal diet. 2Blend treatment = 150g of Natugrain Blend/tonne of basal diet provided at least 5,500 EXU/kg feed and 1,350 BGU/kg feed. 3Endoxylanase treatment = 100g of Lyxasan Forte/tonne of basal diet provided at least 5,500 EXU/kg feed. 4Phospholipase treatment = 100g of Phospholipase/tonne of basal diet provided 500 PLU/kg feed. 5SEM(59)= Standard Error of the mean with 59 degrees of freedom. 6Enzyme= Mean value of the treatments supplemented with Natugrain Blend, Lyxasan Forte and Phospholipase. 7Xylanase: Mean value of the treatment supplemented with Natugrain Blend and Lyxasan Forte. 8Relative intestinal length = Bird intestinal segment length/Bird body weight. 9Total relative intestinal length = sum of the duodenum, jejunum, ileum and ceca length, divided by body weight.
130
TABLE 5: Effects of different exogenous enzyme supplementation on intestinal muscularis and mucosal weight6 of 56 days-old turkey toms fed wheat-based diets
Muscularis Mucosal Treatment Duodenum Jejunum Ileum Duodenum Jejunum Ileum
(g) Control1 4.20 2.47 1.73 5.00 2.88 1.82 Blend2 4.07 2.61 1.81 5.40 3.13 1.51 Endoxylanase3 3.92 2.59 1.74 5.05 3.74 1.67 Phospholipase4 3.84 2.39 1.83 5.70 3.46 1.89 SEM(59)5 0.276 0.119 0.107 0.270 0.254 0.140 P-value 0.7901 0.5499 0.9005 0.2356 0.0980 0.2331 1Control treatment = Unsupplemented wheat/SBM basal diet. 2Blend treatment = 150g of Natugrain Blend/tonne of basal diet provided at least 5,500 EXU/kg feed and 1,350 BGU/kg feed. 3Endoxylanase treatment = 100g of Lyxasan Forte/tonne of basal diet provided at least 5,500 EXU/kg feed. 4Phospholipase treatment = 100g of Phospholipase/tonne of basal diet provided 500 PLU/kg feed. 5SEM(59)= Standard Error of the mean with 59 degrees of freedom. 6Weight obtained from 10 cm section of the intestinal segments.
131
TABLE 6: Effects of different exogenous enzyme supplementation on the ileum digesta viscosity of 56 days- old turkey toms fed wheat-based diets
Treatment Mean viscosity 6 (Centipoise, cP) Control1 7.118b Blend2 6.705b Endoxylanase3 7.389b Phospholipase4 13.551a SEM(59)5 1.2892 P-value 0.0009 a,bMeans with different superscripts within a column differ significantly (P< 0.05). 1Control treatment = Unsupplemented wheat/SBM basal diet. 2Blend treatment = 150g of Natugrain Blend/tonne of basal diet provided at least 5,500 EXU/kg feed and 1,350 BGU/kg feed. 3Endoxylanase treatment = 100g of Lyxasan Forte/tonne of basal diet provided at least 5,500 EXU/kg feed. 4Phospholipase treatment = 100g of Phospholipase/tonne of basal diet provided 500 PLU/kg feed. 5SEM(59)= Standard Error of the mean with 59 degrees of freedom. 6Centipoise (cP). A centimeter-gram-second unit of dynamic viscosity equal to one dyne-second per square centimeter.
132
TABLE 7: Effects of different exogenous enzyme supplementation on histological measurements8 of ileum of 56 days-old turkey toms fed wheat-based diets
Villus Crypt Villus:Crypt Mucosal Muscularis Apical Basal Depth Ratio Depth Depth Height Area Treatment Width Width 2 (µm) (mm ) (µm) (µm/µm) (µm) Control1 1585 179a 306a 0.384a 175b 9.1a 1760 298 Blend2 1502 140b 246b 0.290b 214a 7.1b 1716 309 Endoxylanase3 1538 132b 263ab 0.305b 171b 9.0a 1710 290 Phospholipase4 1449 129b 239b 0.270b 182b 8.2ab 1631 302 SEM(59)5 49.24 6.23 15.69 0.017 8.33 0.44 49.89 17.20 P-value 0.2797 0.0001 0.0244 0.0003 0.0044 0.0087 0.3472 0.8890 a,bMeans with different superscripts within a column differ significantly (P< 0.05). 1Control treatment = Unsupplemented wheat/SBM basal diet. 2Blend treatment = 150g of Natugrain Blend/tonne of basal diet provided at least 5,500 EXU/kg feed and 1,350 BGU/kg feed. 3Endoxylanase treatment = 100g of Lyxasan Forte/tonne of basal diet provided at least 5,500 EXU/kg feed. 4Phospholipase treatment = 100g of Phospholipase/tonne of basal diet provided 500 PLU/kg feed. 5SEM(59)= Standard Error of the mean with 59 degrees of freedom. 6Enzyme= Mean value of the treatments supplemented with Natugrain Blend, Lyxasan Forte and Phospholipase. 7Xylanase: Mean value of the treatment supplemented with Natugrain Blend and Lyxasan Forte. 8Histological measurements: Villus height = Measured from the villus tip to the villus base, not including the intestinal crypt; Villus apical width = Measurement of the width of the villus tip; Villus basal width = Measurement of the width of the villus at the crypt-villus junction; Villus surface area =[ (villus apical width + villus basal width) / 2] * villus height; Crypt depth = Measured from the villus base to the muscularis, not including intestinal musculares; Villus:crypt ratio = Villus height divided by crypt depth; Mucosal depth = Villus height + crypt depth; Muscularis depth = Measured from the crypt to serosa layer, not including intestinal serosa.
133
TABLE 8: Pearson correlation coefficients (r) of body weight (BW), intestinal size1, ileum digesta viscosity , and ileum histological measurements2 of turkey toms at 56 days subjected to different diet formulations.
Correlation variables Correlation coefficient (r) P-Value Viscosity vs Relative intestinal weight +0.3 0.032 Viscosity vs Relative intestinal length +0.3 0.044 BW vs Relative intestinal weight -0.3 0.038 BW vs Relative intestinal length -0.5 0.001 BW vs Villus Height/Crypt Depth ratio +0.2 0.447 BW vs Crypt Depth -0.2 0.201 BW vs Villus surface area -0.2 0.341 18Relative intestinal weight or length = Bird intestinal segment weight or length/Bird body weight 2Histological measurements: Villus:crypt ratio = Villus height (from villus tip to villus base) divided by crypt depth (from villus base to muscularis); Villus surface area =[ (villus apical width + villus basal width) / 2] * villus height.
134
2.7 REFERENCES
Aiello, L.C., 1997. Brains and guts in human evolution. The expensive Tissue Hypothesis. Braz. J. Genet. 20 (1) ISSN 0100-8455. Almirall, M., and E. Esteve-Garcia, 1994. Rate of passage of barley diets with chromium oxide. Poult. Sci. 73:1433-1440. Barnes, E.M., G.C. Mead, D.A. Barnum, and E.G. Harry, 1972. The intestinal flora of the chicken in the period 2 to 6 weeks of age, with particular reference to the anaerobic bacteria. Br. Poult. Sci. 13:311-326. Bartelt, J., A. Jadamus, F. Wiese, E. Swiech, L. Buraczewska, and O. Simon, 2002. Apparent precaecal digestibility of nutrients and level of endogenous nitrogen in digesta of the small intestine of growing pigs as affected by various digesta viscosities. Arch. Anim. Nutr. 56:93-107. BASF, 1997. On feed additives: Technical information ‘97/98. BASF Aktiengesellschaft, Ludwigshafen, Germany. BASF, 2001. Technical information from BASF. Aktiengesellschaft, 67056 Ludwigshafen, Germany. Personal communication. Bedford, M.R., 1995. Mechanism of action and potential environmental benefits from the use of feed enzymes. Anim. Feed Sci. Technol. 53:145-155. Belitz, H.D., and W. Grosch, 1999. Food Chemistry. Berlin: Springer-Verlag. Brenes, A., M. Smith, W. Guenter, and R.R. Marquardt, 1993a. Effect of enzyme supplementation on the performance and digestive tract size of broiler chickens fed wheat- and barley-based diets. Poult. Sci. 72:1731-1739. Brenes, A., W. Guenter, R.R. Marquardt, and B.A. Rotter, 1993b. Effect of β- glucanase/pentosanase enzyme supplementation on the performance of chickens and laying hens fed wheat, barley, naked oats and rye diets. Can. J. Anim. Sci. 73:941-951. Brenes, A., R.R. Marquardt, W. Guenter, and A. Viveiros, 2002. Effect of enzyme addition on the performance and gastrointestinal tract size of chicks fed lupin seed and their fractions. Poult. Sci. 81:670-678. Brum, P.A.R., D.L. Zanotto, A.L. Guidoni, P.S. Rosa, G.J.M.M. Lima, and E.S. Viola, 2000. Triticale em dietas para frangos de corte. Pesq. Agropec. Bras. 35(2):229-239. Campbell, G.L., L.D. Campbell, and H.L. Classen, 1983. Utilisation of rye by chickens: Effect of microbial status, diet gamma irradiation and sodium taurocholate supplementation. Br. Poult. Sci. 24:191-203. Choct, M., R.J. Hughes, R.P. Trimble, and G. Annison, 1994. The use of enzymes in low-ME wheat broiler diets: effects on bird performance and gut viscosity. In: Proceedings Australian Poultry Science Symposium. The University of Sydney, Sidney. 6:83-87. 135
Choct, M., R.J. Hughes, J. Wang, M.R. Bedford, A.J. Morgan, and G. Annison, 1996. Increased small intestinal fermentation is partly responsible for the anti-nutritive activity of non-starch polysaccharides in chickens. Br. Poult. Sci. 37:609-621. Chung, H., T.W. Kim, M. Kwon, I.C. Kwon, and S.Y. Jeong, 2001. Oil components modulate physical characteristics and function of the natural oil emulsions as drug or gene delivery system. J. Controlled Release. 71(3):339-350. Cowieson, A.J., 2005. Factors that affect the nutritional value of maize for broilers. Anim. Feed Sci. Technol. 119:293-305. De Silva, S., K. Hesselman, and P. Aman, 1983. Effect of water and β-glucanase treatment on non-starch polysaccharides in endosperm of low and high viscous barley. Swedish Journal of Agriculturer. 13:211-219. Duke, G.E., 1986. Alimentary canal: anatomy, regulation of feeding and motility. Pages 269- 288. In: Avian Physiology, Ed. 4. P.D. Sturkie, ed. Springer-Verlag, New York. Edwards, C.A., I.T. Johnson, and N.W. Read, 1988. Do viscous polysaccharides slow absorption by inhibiting diffusion or convection? European J. Clinical Nutr. 42:307-312. Fraga, M.J., P.P. Ayala, R. Carabano, and J.C. Blas, 1991. Effect of type of fiber on the rate of passage and on the contribution of soft feces to nutrient intake of finishing rabbits. J. Anim. Sci. 69:1566-1574. Goodlad, R.A., J.A. Plumb, and N.A. Wright, 1987. The relationship between intestinal crypt cell proliferation and water absorption measured in vitro in the rat. Clin. Sci. 72:297-304. Homan, R., and M.K. Jain, 2001. Biology, pathology, and interfacial enzymology of pancreatic phospholipase A2. Pages 81-104. In: Intestinal Lipid Metabolism. C. M. Mansbach II, P. Tso, A. Kuksis, eds. Kluwer Academic/Plenum Publishers. New York, NY. Iji, P.A., A. A. Saki, and D. R. Tivey, 2001. Intestinal development and body growth of broiler chicks on diets supplemented with non-starch polysaccharides. Anim. Feed Sci. Technol. 89: 175-188. Ikegami, S., F. Tsuchihashi, H. Harada, N. Tsuchihashi, E. Nishide, and S. Innami, 1990. Effect of viscous indigestible polysaccharides on pancreatic-biliary secretion and digestive organs in rats. J. Nutr. 12:353-360. Johnson, I.T., J.M. Gee, and R.R. Mahoney, 1984. Effect of dietary supplements of guar gum and cellulose on intestinal cell proliferation, enzyme levels and sugar transport in the rat. Br. J. Nutr. 52:477-487. Jumaa, M., and B.W. Muller, 1998. The effect of oil components and homogenization conditions on the physicochemical properties and stability of parenteral fat emulsions. Int. J. Pharm. 163:81-89. Jumaa, M., P. Kleinebudde, and B.W. Muller, 1998. Mixture experiments with the oil phase of parenteral emulsions. Eur. J. Pharm. Biopharm. 46:161-167. 136
Lan, Y., 2004. Gastrointestinal health benefits of soy water-soluble carbohydrates in young broiler chickens. Ph.D. Thesis, Wageningen University, The Netherlands, 269 pp. Langhout, D.J., J.B. Schutte, J. de Jong, H. Sloetjes, M.W.A. Verstegen, and S. Tamminga, 2000. Effect of viscosity on digestion of nutrients in conventional and germ-free chicks. Br. J. Nutr. 83:533-540. Malkki, Y., and E. Vertanen, 2001. Gastrointestinal effects of oat bran and oat gum – a review. J. Food Sci. Technol. 34:337-347. McDonald, D.E., 2001. Dietary fibre for the newly weaned pig: influences on pig performance, intestinal development and expression of experimental post-weaning colibacillosis and intestinal spirochaetosis. PhD Thesis, Murdoch University, Murdoch. Mollah, Y., W.L. Bryden, I.E. Wallis, D. Balnaue, and E.F. Annison, 1983. Studies on low metabolisable energy wheats for poultry using conventional and rapid assay procedures and the effects of processing. Br. Poult. Sci. 24:81-89. Montagne, L., J.R. Pluske, and D.J. Hampson. 2003. A review of interactions between dietary fibre and the intestinal mucosa, and their consequences on digestive helath in young non-ruminant animals. Anim. Feed Sci. Technol. 108:95-117. Moran, E.T., 1985. Digestion and absorption of carbohydrates in fowl and events through perinatal development. J. Nutr. 115:665-674. National Research Council (NRC), 1994. Nutrient Requirements of Poultry. 9th Rev. Ed. National Academy Press, Washington, DC. Ochi, Y., T. Mitsuoka, and T. Sega, 1964. Untersuchungen ber die Darmflora des Huhnes III. Mitteilung: Die Entwicklung der Darmflora von K ken bis zum Huh. Zentralbl. Bakteriol. Parasitenkd. Infektionskr. Hyg (I Abt.)193:80-95. [Cited in Mead, 2000a.] Odetallah, N.H., C.W. Parks, and P.R. Ferket, 2002. Effect of wheat enzyme preparation on the performance characteristics of tom turkeys fed wheat-based rations. Poult. Sci. 81: 987-994. Persia, M.E., B.A. Dehority, and M.S. Liburn, 2002. The effects of enzyme supplementation of corn- and wheat-based diets on nutrient digestion and cecal microbial populations in turkeys. J. Appl. Poult. Res. 11:134-145. Petterson, D., and P. Aman, 1989. Enzyme supplementation of a poultry diet containing rye and wheat. Br. J. Nutr. 62:139-149. Pluske, J.R., D.J. Hampson, and I.H. Williams, 1997. Factors influencing the structure and function of the small intestine in the weaned pig – a review. Livestock Prod. Sci. 51:215- 236. Ravindran, V., S. Cabahug, G. Ravindran, and W.L. Bryden, 1999. Effects of phytase supplementation, individually and in combination, with glycanase, on the nutritive value of wheat and barley. Poult. Sci. 78:1588-1595. Remus, J., 2003. Control strategies for salmonella in swine discussed. Dec. 22, 2003: 14-16. 137
Salgado, P., J.P. Lalles, R. Toullec, M. Mourato, F. Cabral, and J.P.B. Freire, 2001. Nutrient digestibility of chickpea (Cicer arietinum L.) seeds and effects on the small intestine of weaned piglets. Anim. Feed Sci. Technol. 91:197-212. Salgado, P., J.P.B. Freire , M. Mourato , F. Cabral , R. Toullec, and J.P. Lalles, 2002. Comparative effects of different legume protein sources in weaned piglets: nutrient digestibility, intestinal morphology and digestive enzymes. Livestock Prod. Sci. 74:191- 202. Samanya, M., and K. Yamauchi, 2002. Histological alterations of intestinal villi in chickens fed dried Bacillus subtilis var. natto. Comparative Biochemistry and Physiology Part A. 133:95-104. Santos Jr., A.A., P.R. Ferket, J.L. Grime, and F.W. Edens, 2004a. Dietary Pentosanase supplementation of diets containing different qualities of wheat on growth performance and metabolizable energy of turkey poults. Int. J. Poult. Sci 3:33-45. Santos Jr., A.A., P.R. Ferket, J.L. Grime, and F.W. Edens, 2004b. Dietary supplementation of endoxylanase and phospholipase for turkeys fed wheat-based rations. Int. J. Poult. Sci 3: 20-32. SAS Institute Inc., 1996. SAS/STAT User’s Guide, Version 6, Fourth Edition, Vol. 2. SAS Proprietary Software Release 6.12. SAS Institute, Inc., Cary, NC. Silva, S.S.P., and R.R. Smithard, 2002. Effect of enzyme supplementation of a rye-based diet on xylanase activity in the small intestine of broilers, on intestinal crypt cell proliferation and on nutrient digestibility and growth performance of the birds. Br. Poult. Sci. 43:274- 282. Smits, C. H. M., and G. Annison, 1996. Non-starch plant polysaccharides in broiler nutrition – towards a physiologically valid approach to their determination. World’s Poult. Sci. J. 52:204-221. Steenfeldt, S., M. Hammershoj, A. Mullertz, and F. Jensen, 1998. Enzyme supplementation of wheat-based diets for broilers. 2. Effect on apparent metabolisable energy content and nutrient digestibility. Anim. Feed Sci. Technol. 75:45-64. Veldman, A., and H.A. Vahl, 1994. Xylanase in broiler diets with differences in characteristics and content of wheat. Br. Poult. Sci. 35:537-550. Wagner, D.D., and O.P. Thomas, 1978. Influence of diets containing rye or pectin on the intestinal flora of chicks. Poult. Sci. 57:971-975.
138
CHAPTER 3
EFFECT OF DIETARY ENZYME SUPPLEMENTATION AND NON-STARCH POLYSACCHARIDE CONTENT ON PERFORMANCE, INTESTINAL MORPHOMETRY AND SALMONELLA SPP. COLONIZATION OF TURKEYS1
______1The use of trade names in this publication does not imply endorsement by the North Carolina Agriculture Research Service or the North Carolina Cooperative Extension Service of the products mentioned nor criticism of similar products not mentioned. 139
3.1 ABSTRACT
Salmonella colonization in poultry may be influenced by the degree of competitive exclusion from enteric microflora as affected by diet formulation. An experiment was conducted to study the effect of grain-base formulation and dietary enzyme supplementation on intestinal Salmonella spp. colonization and performance of turkeys. Turkeys raised on litter floor were fed wheat/SBM- and corn/SBM-based diets with and without enzyme preparations (XY1 & XY2, respectively) from 0-126 d. XY1 is a pure endoxylanase, whereas
XY2 is endoxylanase, protease and α-amylase blend preparation (Danisco, UK). The dietary enzymes supplementation levels were 2500 and 325 EXU/kg feed of XY1 and XY2, respectively. In addition to growth performance, prevalence of Salmonella spp. in excreta was determined. At 16 wk, weights and lengths of intestinal segments, and weights of the gizzard, liver, and pancreas were determined relative to body weights on 16 birds/treatment.
XY2 supplementation improved 16-wk BW (14.6 vs 14.2 kg, P<.05), and FCR (2.6 vs 2.8 g/g, P<.05) as compared to corn-control treatment. However, XY1 supplementation did not affect growth performance. There was no enzyme supplementation effect on Salmonella spp. prevalence at 3, 9, or 18 wk. Salmonella spp. were not recovered from pens receiving wheat- based diets, but 38% of the pens receiving corn-based diets were positive at 15 wk. XY2 supplementation to corn-diets reduced (P<.05) Salmonella presence, such that it was equivalent to the wheat-based diets. The wheat-fed birds had heavier (P<.05) ceca (4.2 vs 3.8 g/kg), and smaller (P<.05) pancreas (0.9 vs 1.0 g/kg) than the corn-fed birds. Salmonella colonization was discouraged by diets containing high non-starch polysaccharide content 140 from wheat. Enzyme supplementation reduced Salmonella colonization in addition to improving growth performance in turkeys.
(Key words: wheat, enzyme, growth performance, Salmonella, turkey)
3.2 INTRODUCTION
Bacteria residing in the intestinal tract of birds constitute an extremely complex and metabolically active ecosystem (Macfarlane et al., 1998). These bacteria interact and coexist in a finely balanced relationship with the host (Conway, 1995). Since the colonic microbiota is mainly supported by dietary substrates that have escaped absorption or were slowly digested, such materials have a major influence upon this complex ecosystem and, consequently, can exert a role in host health and disease. To demonstrate that diet has a strong effect on intestinal health, Apajalahti et al. (2001) surveyed the microbial community of broilers raised at eight commercial poultry farms in Finland and fed different commercial wheat-based diets, some with locally added whole wheat. They conducted their survey during different seasons (spring and fall) and years (1997, 1998, and 2000). They observed that diet was the strongest individual determinant of the total microbial community structure in the ceca of broiler chickens, whereas microbial profiles from individual farms with identical feed regimes hardly differed from each other. They also did not observe any significant seasonal or annual variations in the colonic microbial community. The effect of dietary ingredient formulation on intestinal health and microbial ecosystem has been also observed in several other studies (Gibson and Roberfroid, 1995; Gibson, 1998; Collins and Gibson, 1999). 141
Regional differences in poultry diet formulation occur because of variation in
ingredient costs and availability. The use of wheat-based diets for poultry is relatively
common in the European Union, but corn-based diet is most common in the United States.
Wheat has approximately 2.5% soluble non-starch polysaccharides (NSP), whereas corn has
only 0.9% (Knudsen, 2001). Dietary fiber is the main substrate for bacterial fermentation,
particularly in the large intestine of non-ruminant animals (Montagne et al., 2003). Dietary fiber has an important role in the control of intestinal health because it interacts with both the mucosa and the microflora. Because wheat- and corn-based diets differ in dietary fiber content, differences in the microbial communities among animals consuming these diets are expected.
Dietary supplementation of enzymes that hydrolyze NSP is now a common practice in the poultry feed industry. Supplemental feed enzymes have been used primarily to improve nutrient utilization and growth performance characteristics of animals (Jensen et al.,
1957; Silva and Smithard, 2002; Engberg et al., 2004). Additionally, more current research has shown that enzyme supplementation to diets high in NSP content can indirectly modify the enteric microflora ecosystem to a more healthy state. Steenfeldt et al. (1998) observed that dietary enzyme supplementation decreased the pH in the cecal content of chickens. This decrease in cecal pH was caused by higher production of SCFA resulting from increased microbial fermentation. These researchers also observed a significant negative correlation between pH and the apparent digestibility of total-NSP, xylose and arabinose. The degradation of cell wall arabinoxylan in the enzyme-supplemented diets increased the amount of material available for microbial fermentation in the ceca. Similarly, Hogberg and 142
Lindberg (2004) studied the influence of cereal-NSP and enzyme supplementation on
intestinal microflora and showed that the substrate for the growth of lactic acid bacteria was released in the diet when enzyme was added. The release of these carbohydrates, after dietary enzyme supplementation, apparently supported the growth of Lactobacillus and
Bifidobacterium. Therefore, there has been a growing interest in the use of feed enzymes to manipulate GIT microflora in addition to its ability to improve animal performance and nutrient utilization.
The growth of commensal bacteria in the GIT has an important influence on the colonization of pathogenic species. The main products of fermentation of Lactobacillus and
Bifidobacterium are acetic acid and lactic acid (Taki et al., 2005). These short chain fatty acids (SCFA) play a major role in the recovery of energy from non-digestible feed ingredients (Jozefiak et al., 2004), as well as intestinal development (Lan, 2004) and immunity (Ishizuka et al., 2004). Wielen et al. (2000) demonstrated that high fermentation activity in chicken ceca was correlated with a reduced pH, which may inhibit some pathogenic bacteria by dissipating the proton motive force across the bacterial cell membrane
(Russell, 1992). Finally, the growth of commensal intestinal microflora may provide competitive exclusion activities against pathogenic bacteria by competing for nutrient availability and maintaining their habitat by altering or consuming resources of the intestine.
The hypothesis tested in this study was that manipulation of the dietary NSP level and
NSP-hydrolyzing enzyme supplementation could promote intestinal health and growth performance of turkeys by 1) discouraging Salmonella colonization as affected by the degree of competitive exclusion from enteric microflora, and 2) altering intestinal development. To 143
test this hypothesis this research evaluated the efficacy of two different enzyme mixtures and
two common grain-based diet formulations (corn- and wheat-based diets) on growth
performance and fecal Salmonella spp. prevalence of turkeys. In addition, the effect of feed
formulation and dietary enzyme supplementation on intestinal development was determined
by measuring the weight and length of the intestinal tract and weight of its accessory glands.
3.3 MATERIALS AND METHODS
Enzymes
The enzyme activity of the experimental enzyme products (Avizyme® 1302 and
Avizyme® 1500), its activity in the feed, and application rate used in the experimental diets are shown in Table 1. Avizyme® 1302, referred in this article as XY1, is a commercial fine
granular enzyme preparation obtained from fermentation of Bacillus subtilis and genetically
modified Trichoderma longibrachiatum. It contained standardized activities of at least 5,000
endo-1,4-beta-xylanase units (EXU, EC 3.2.1.8) per gram of product (Danisco, 2003). One
EXU is defined as the enzyme activity required to liberate 1 µmol of reducing sugar
(measured as glucose equivalents) per minute from a 1% xylan solution at pH 3.5 and 40°C.
Avizyme® 1302 also contained some protease (subtilisin, EC 3.2.1.8) activities (Danisco,
2003). Avizyme® 1500, referred in this article as XY2, is a commercial fine granular
preparation obtained from fermentation of Bacillus subtilis, Bacillus amyloliquifaciens and
genetically modified Trichoderma longibrachiatum. Avizyme® 1500 contained standardized
activities of at least 600 EXU (EC 3.2.1.8), 8000 units of subtilisin (EC 3.2.1.8) and 800 units of alpha amylase (EC 3.4.21.62) per gram of product. The genetically modified 144
Trichoderma longibrachiatum produced a heat stable endoxylanase. All enzyme preparations
were supplied by Danisco Animal Nutrition1.
Diet
The experimental diets are presented in Table 2 and 3. Four feed phases were used
during the course of the experiment. All diets were formulated using least-cost linear
programming software, such that the diets met or exceeded the NRC (1994)
recommendations for essential nutrients. Diets of treatment 1 and 2 consisted of the same
wheat/soybean meal (SBM)-basal diet without or with Avizyme® 1302 supplementation, respectively. Diets of treatment 3 and 4 consisted of the same corn/SBM-basal diet without or with Avizyme® 1500 supplementation, respectively. All feed was pellet-processed and fed in crumble form up to 4 weeks of age, and subsequently as a whole 8 millimeter pellet form.
Composite feed samples from each diet were taken immediately after manufacture and analyzed for crude protein, fat, ash, Ca, and P. The chemical analyses were performed as described in the footnote of Table 2 and 3. Additionally, soluble and insoluble fiber content
of the pooled feed samples was determined using the Megazyme Total Dietary Fiber Assay
kit2. Pooled samples from the corn-based diets were independently sampled from the wheat- based diets prior to fiber analysis. The pooled samples consisted of five hundred grams of
feed sampled from each feed phase that were blended together.
All feed used in this study were manufactured at the North Carolina State University
poultry feed mill3. The enzyme mixture was applied during feed mixing in a 500 kg capacity
horizontal double ribbon mixer. All enzymes mixtures were added to the diets in amounts
1Danisco Animal Nutrition, Wiltshire, UK. 2 Total Dietary Fiber Assay Kit, Megazyme International Ireland Ltd., Co. Wicklow, Ireland. 3 NCSU Poultry Feed Mill, Chicken Unit, Lake Wheeler Rd, Raleigh, NC. 145
recommended by the supplier (Table 1, Danisco, 2003), such that Avizyme® 1302 provided
at least 2500 EXU/kg feed, and Avizyme® 1302 provided at least 325 EXU/kg feed. For
optimum bioefficacy of the enzymes, conditioning and pelleting of feed did not exceed a temperature of 82ºC.
Bird husbandry
The facility used in this study was a curtain-sided house containing forty-eight 9.3 square meter pens. Each pen was top-dressed with 4 cm of soft pine shavings before the day- old poults were placed in the pens. The ventilation of the housing facility was provided by natural air movement through appropriately adjusted curtain sides and air mixing fans located on the aisle ceiling throughout the house. High and low ambient temperatures within the house were recorded at four strategically-placed thermometers twice daily throughout the duration of the trial. The recorded temperatures are reported in Figure 1. The house temperatures was maintained between 29-31ºC during the first week (wk), and then gradually stepped down to the ambient outside temperature. Briefly, the temperature in the house was decreased approximately 3ºC per week for the first 5 weeks. After the fifth week, the birds were maintained on the ambient outside temperature. Throughout the trial the temperature in the house ranged from 2ºC to 28ºC. The house was illuminated with incandescent lights for
23 hours per day during the first week and subsequently by natural daylight. Heat lamp units4 with 125-watt bulb5 provided supplemental heat for each pen. Feed and water were provided
ad libitum throughout the duration of the study. Visual inspection of the birds health was
performed daily and weights of culled birds and reasons they were removed were recorded.
4Heat Lamp, Model # 54411-Heave Gauge Aluminium Base, Hog Slats, Inc., Newton Grove, NC, 28366. 5125-watt bulb, SLI, China; Distributor: Hog Slats, Inc., Newton Grove, NC, 28366. 146
Crippled or dead birds were removed and recorded. All mortality were weighed soon after
death and recorded so that an appropriate adjustment to feed conversion could be made.
The purpose of this experiment was to study the efficacy of two different enzyme
mixtures and two-common grain-based diet formulation on growth performance, intestinal
size and fecal Salmonella spp. prevalence of turkeys. Thirty-two pens were assigned to this
trial. The experimental turkey house was divided such that each side of the house contained 2 blocks of 8 pens each. Four dietary treatments were randomly assigned within each of the four blocks so that variability due to position within the turkey house could be statistically removed. The dietary treatments were randomly assigned to pens using the Proc-Plan procedure of SAS® (SAS, 1996). Each pen of 30 turkeys, the experimental unit, were
subjected to one of four dietary treatments from 1 to 113 (0-16 wk) days of age as follows:
(1) wheat control, (2) wheat with Avizyme® 1302 at 2500 EXU/kg, (3) corn control, and (4)
corn with Avizyme® 1500 at 325 EXU/kg. Each treatment combination was replicated in 8
pens (2 pens per block).
Data collection
Feed consumption and body weights (by pen and by individual bird, respectively)
were recorded at 0, 2, 4, 8, 12, and 16 weeks of age.
At sixteen weeks, 16 birds per treatment (2 birds/pen) were wing-banded, weighed,
and euthanized by asphyxiation with carbon dioxide gas. Then, intestinal segments
(duodenum, jejunum, ileum and ceca) and GIT accessory glands (gizzard, liver and pancreas) were dissected from each bird. The intestinal segments were: a) the duodenum from the gizzard to pancreatic and bile duct; b) the jejunum from the bile duct to Meckel’s 147
diverticulum; c) the ileum from the Meckel’s diverticulum to ileo-cecal-colonic junction; and
d) the ceca (Samanya and Yamauchi, 2002). After the lengths of the intestinal segments were
determined, measurements of full weight of each intestinal section were recorded before and
after milking out the digesta by hand. Intestinal accessory glands, intestinal weights and
lengths were calculated relative to bird live body weight (Brenes et al., 2002).
Salmonella spp. prevalence
In the present study, poults were naturally infected with Salmonella spp. from an
unknown source. The poults were not tested for Salmonella colonization when they were
received from the hatchery, so it cannot be confirmed that the Salmonella came from the
hatchery. Also, the turkey experimental house was not tested before receiving the birds, so it
cannot be confirmed that the birds were colonized by Salmonella present at the house
environment. However, all feed was tested for Salmonella presence, and it was always
negative. Nonetheless, Salmonella colonization was detected when the flock was first tested
at 3 weeks of age, which nearly all pens were Salmonella positive, and it was not
significantly influenced by grain type (corn or wheat) or enzyme supplementation.
At 3, 9 and 15 weeks of age, a composite sample of fresh fecal droppings from each
pen was collected throughout the entire pen. Briefly, approximately 50 g and 150 g of fresh
fecal droppings were collected from each pen housing younger or older birds, respectively.
An attempt was made to collect all available fresh fecal samples scattered in each pen. The
samples were then aseptically placed in sterile Whirl-Pak6 bags, and stored on ice in a transport cooler, and processed in the laboratory within 2 hours. At 18-weeks of age, two birds per pen were euthanized with carbon-dioxide and cecal samples were collected by
6 Whril Pak sterile bags, Cat. No. 01-812, Fisher Scientific International, Bohemia, NY. 148
cutting the ceca vertically to expose the content and mucosa. These cecal samples were then
placed into Whirl Pack® bags6 and stored on ice in a transport cooler, and processed in the
laboratory within 2 hours. Samples collected at 3, 9, 15 and 18 weeks of age were used to
determine Salmonella spp. prevalence among the treatments.
Sample collections and dilution schemes were based on the method described by
Midura and Bryant (2001). When the samples arrived in the laboratory, 25 g of each fecal
sample or 5 g of each cecal sample were placed in a sterile filtered stomacher bag8 and diluted at 1:10 dilution using buffer peptone water7 (BPW). The samples were each
homogenized in a stomacher bags8 for two minutes (Beli et al., 2001; Andrews et al., 2001)
and then incubated for approximately 24 hours at 37°C. The selective enrichment step was
performed by transferring 1 ml from each bag to a bottle containing 100 ml of Rappaport-
Vassiliadis (RV) broth9 (Andrews and Hammack. 2003). Bottles were then incubated at 42°C
for 24 h. Following incubation, one loopful from each bottle was streaked for isolation onto
modified lysine iron agar (MLIA)10 and incubated at 37°C for 24 h. Suspect colonies were
picked, stabbed, and streaked onto triple sugar iron (TSI)11 agar slants and incubated at 37° C for 24 h. Positive results were confirmed by agglutination using poly-O antiserum12.
Salmonella spp. population (16-wk age)
Two birds per cage were weighed and euthanized by cervical dislocation at 16 weeks
of age. Cecal contents from each bird were used for Salmonella population analysis. Ceca
7 Oxoid Ltd., Basingstoke, Hampshire, England. 8 Classic Mastigator, IUL Instruments, S.A., Serial No. 0790/94, Cat. No. 0400, Barcelona, Spain. 9 Oxoid Ltd., Cat. No. CM0669, Basingstoke, Hampshire, England. 10 Oxoid Ltd., Cat. No. CM509, Basingstoke, Hampshire, England. 11 Difco/BBL, Cat. No. 211749, Becton Dickinson and Company, Sparks, Maryland. 12 Difco/BBL, Cat. No. 222641, Becton Dickinson and Company, Sparks, Maryland. 149
were weighed and cut vertically to expose the contents and mucosa. Then, ceca from each
bird was placed into Whirl Pack® bag6 containing BPW (1:10 dilution). This was considered
the first dilution. Most probable number (MPN) technique was used for Salmonella
enumeration as described by Santos et al. (2005).
Statistical analysis
Except for the microbiological data, all data were analyzed using the general linear
models procedure for analysis of variance (ANOVA) of SAS® (1996), with block and treatment included in the experimental model. Pen means served as the experimental unit for statistical analysis, unless otherwise stated. Treatment means having a significant F-test were separated using the least-squares-means (lsmeans) function of SAS® (SAS, 1996), and were
considered to be significant at P < 0.05. All percentage data were transformed to arc-sine
square root before analysis. Correlation analyses between intestinal measurements and growth performance characteristics were analyzed using the correlation procedure of SAS®
(SAS, 1996).
The microbiology data were examined using the following procedures. Pen means served as the experimental unit for statistical analysis. The results of the Salmonella prevalence were examined using the frequency analysis procedure of SAS® (Chi-Square
Test) (SAS, 1996). The results were considered to be significant at P<0.05.
Animal ethics
The experiments reported herein were conducted according to the guidelines of the
Institutional Animal Care and Use Committee (IACUC) at North Carolina State University.
All husbandry practices and euthanasia were done with full consideration of animal welfare. 150
3.4 RESULTS
Performance
Enzyme (XY2) supplementation to the corn/SBM-basal diet had a greater effect on
performance during the finishing phase (12-16 wk) than during the starting-growing phase
(0-12 wk). Toms supplemented with XY2 had significantly greater body weights at 16 wk
(14.6 vs 14.2 kg, P<0.05, BW) than those fed corn-control diet (Table 4), so dietary XY2 supplementation improved 0-16 wk body gain by about 2.5%. Although there was no significant difference observed in feed consumption (FC) between the XY2 treatment group and the corn-negative control (Table 5), the turkeys fed the corn-based diet supplemented with XY2 clearly had better 0-16 wk feed conversion ratio (feed:gain, FCR) than those fed the corn control diet (2.67 vs 2.80 g/g, P<0.01) (Table 6). However, XY1 supplementation had no significant effect on the growth performance of toms fed the wheat-based diet throughout the experiment. Overall mortality rate was within industry standards, which averaged 7.3% for the entire experiment and was not significantly influenced by grain type
(corn or wheat) or enzyme supplementation (Table 7).
Dietary grain type (corn or wheat) significantly affected growth performance characteristics of the birds throughout the trial. Turkeys fed wheat-based diets weighed about
5% more (P<0.05) throughout the trial than those fed the corn-based diets (Table 4). Also, feed:gain of toms fed the wheat-based diets was 6% lower (P<0.05) than those fed the corn- based diets (Table 6). Feed consumption was about 5% lower (P<0.05) for toms fed the corn- based diets during the starting-phase (0-4 wk) than those fed the wheat-based diets (Table 5).
However, FC of birds fed the corn-based diets was approximately 2% higher than those fed 151
the wheat-based diets during the growing-finishing phase (P<0.15). Consequently, overall FC
(0-16 wk) of the toms fed the wheat-based diets was only marginally higher that those fed the
corn-based diets (P<0.10).
Intestinal and gastrointestinal tract accessory glands
In general, comparative statistical analysis between the 4 treatment groups did not
show any differences in relative intestinal tissue weight and length (Table 8, 9 and 10).
However, contrast analysis showed a significant (P<0.05) increase in relative ceca weight by
about 10% among turkeys fed the wheat-based diets in comparison to toms fed the corn-basal
diets (Table 9). Conversely, toms fed the wheat-based diet had smaller (P<0.05) pancreas weights by approximately 2.5% in comparison to birds fed the corn-based diets (Table 8).
Salmonella spp. prevalence and population
A decreasing trend in the prevalence of Salmonella spp. was observed throughout the
trial. Approximately 70% to 75% of the pens were found to be positive for Salmonella spp.
presence at 3 and 9 weeks, and there were no statistical differences (P>0.05) among
treatment groups (Figure 2). At 15 weeks, Salmonella spp. was not recovered from the fecal
samples from turkeys fed the wheat-based diets, which was statistically lower (P<0.05) than pens receiving corn-based diets: 32% of the pens fed the corn-based diets were positive for
Salmonella presence. Enzyme supplementation to the corn-based diets significantly reduced
Salmonella spp. presence in fecal contents of turkeys at 15 weeks of age, such that it was statistically equivalent to those fed the wheat-based diets. At 18 weeks, Salmonella spp. prevalence in the cecal content of turkeys was not statistically different among treatment groups. However, Salmonella spp. from cecal content was not recovered from any toms fed 152
the wheat-based diets or those fed the enzyme-supplemented corn-based diets, whereas about
13% of the toms receiving corn-based without enzyme supplementation were positive for
Salmonella spp.
Table 11 shows cecal Salmonella spp. population of 16 weeks old turkey toms.
Salmonella spp. was not recovered from the toms fed the wheat-based diets and enzyme
supplemented corn-based diet, but birds fed the corn-based diet without enzyme
supplementation had 5.8 log of Salmonella per gram of cecal content at 16 weeks of age.
3.5 DISCUSSION
The study herein evaluated the effect of two different enzyme mixtures (XY1 and
XY2) and two common grain-based diet formulations on growth performance characteristics,
GIT size, and Salmonella spp. prevalence in turkeys. The turkeys were fed corn/SBM- and wheat/SBM-based diets, which are diets common in most parts of the world. As hypothesized, Salmonella colonization in turkey intestine was discouraged by diets high in
NSP content and enzyme supplementation. In addition, enzyme supplementation significantly improved growth performance of toms fed corn-based diets. However, supplementation of XY1 to wheat/SBM-based diet did not show any effect on performance throughout the trial.
The enzyme (XY2) supplemented to the corn-based diets was a commercial enzyme blend product containing xylanase, amylase, and protease, and it is specifically designed for corn/soybean meal diets (Cowieson, 2005a). The product was dosed to provide at least 325 U xylanase /kg, 425 U amylase /kg and 4250 U protease /kg. The xylanase present in XY2 is a 153
xylanase thermostable to at least 82ºC (Cowieson, 2005a). XY2 contained xylanase from a
genetically modified microorganism that produces a more heat resistant xylanase than normal
commercial xylanases, which allowing the enzyme product to be added in the mixer prior to
pelleting (Cowieson, 2005a). The enzyme (XY1) supplemented to the wheat-based diets is a commercial product with pure xylanase (no amylase and few protease-subtilisin activity).
XY1 contains the same thermostable xylanase as was used in XY2. XY1 contain high
xylanase activity and little or no activity of other enzymes present in XY2, because this product was designed primarily for rations high in wheat, rye, or triticale (Cowieson, 2005a).
XY1 was dosed to provide at least 2500 U xylanase /kg diet and consequently 800 U protease
/kg diet. Therefore, XY1 and XY2 were different products intended for different base ingredient formulations. XY1 is a pure xylanase, whereas XY2 is a blend preparation. The purpose of XY1 supplementation was to counter the adverse effects of arabinoxylan, rich in the wheat diet, while the purpose of the XY2 supplementation was to counter the indigestible
carbohydrates and protein in the corn/soybean meal diets.
Amylase and protease contributes the main effect of XY2. Evidently, hydrolysis of
starch and peptide bonds by amylase and protease, respectively, is one of the main reasons for the better performance of the birds fed corn-based diet supplemented with enzyme in comparison to the unsupplemented corn/SBM treatment group. Starches are the major storage polysaccharides in plants. Starch contributes approximately 60% of the apparent metabolizable energy content of poultry feeds (Weurding et al., 2001), and thus, improvement of the digestibility of starch by α-amylase has a significant impact on growth performance (Cowieson, 2005b). Starch is linear (amylose) or branched (amylopectin) 154
homopolymers of glucose with α-glycosidic bonds (α-D-glucans). Amylose is α-1,4-D-
glucans, while amylopectin is α-1,4-D-glucans with α-1,6-D-glucan branch points. Although
starch is digested directly by the animal (Svihus, 2001), some is fermented in the distal GIT by the microflora, yielding energy to the animal indirectly as volatile fatty acids, or lost in the
feces. Therefore, amylase present in XY2 improved starch digestibility and performance
characteristics.
Amylase present in XY2 improved starch digestibility and its effect was enhanced by
the presence of xylanase in the blended-enzyme preparation. Three main enzyme activities,
α-amylase, maltase and isomaltase, are involved in the digestion of starch (Carre, 2004;
Tester et al., 2004). The products of hydrolysis of starch by α-amylase include maltose and dextrins moieties that cannot be absorbed from the small intestine and thus must be depolymerised further by the brush-border enzymes maltase and isomaltase (Tester et al.,
2004). Maltase and isomaltase are not secreted directly into the lumen but are associated with the micro-villi membranes (Vonk and Western, 1984; Tester et al., 2004). This restricted locality of endogenous maltase and isomaltase limits the absorption of some carbohydrate units of starch (Noy and Sklan, 1995; Batal and Parsons, 2002; Sklan et al., 2003), particularly where mixing of the GIT contents is physically restricted (Takahashi et al., 2004) or passage rate of feed is increased (Carre, 2004) by high NSP content in the diet (Socorro et al., 1989, Cowieson, 2005b). Socorro et al. (1989) demonstrated that NSP negatively affected the digestion of corn starch. Therefore, the blend use of carbohydrases, such as endoxylanase with α-amylase on corn-soy diets was justified. 155
An important function of the endoxylanase is to hydrolyze NSP, thereby reducing
viscosity of the digesta fluids and improving the nutritive value of the diet (Bedford and
Schulze, 1998; Adeola and Bedford, 2004). This mechanism is unlikely to be of significance
in a corn-diet because the concentration of NSP is low (Choct, 1997). Nevertheless, improvements in growth performance of broilers fed corn-soy diets supplemented with
endoxylanase have been reported in the literature. Cowieson (2005b) observed that FCR of
broilers fed corn/SBM-based diets decreased when supplemented with xylanases. Although
digesta fluid viscosity per se was probably not a major problem in the corn treatment groups,
dietary xylanase supplementation may have improved the growth performance of the animals
by enhancing nutrient digestibility (Cowieson, 2005b). This response was presumably
mediated through the hydrolysis of structural arabinoxylans, resulting in the release of
encapsulated nutrients (Cowieson, 2005b). However, dietary supplementation of xylanases
independent of other exogenous enzymes, such as protease and/or amylase, would likely not
yield a response similar to when a combination of these enzymes are supplemented to a corn/SBM-based diet.
The inclusion of protease in the XY2 blend preparation was important to improve the performance of birds receiving corn-based diets supplemented with enzyme. Dietary protease
supplementation apparently complemented the endogenous peptidase activity, thereby
affecting the requirement for amino acid and energy of the birds (Cowieson, 2005b).
Additionally, proteases hydrolyze protein-based antinutrients, such as lectins or trypsin
inhibitors (Marsman et al., 1997; Ghazi et al., 2002), thus improving the efficiency of dietary
amino acids utilization and reducing protein turnover. Douglas et al. (2000) showed that 156
supplementation of corn/SBM-based diets with a commercial carbohydrase/protease preparation improved the energy value of the diets. Therefore, XY2, a blended preparation of
amylase, protease and xylanases, improved the growth performance of the turkeys fed
corn/SBM-based diets.
The minimal effect of XY1 supplementation to the wheat-based diet on growth
performance might be associated with its enzyme activity. XY1 was a single enzyme formulation, and its dietary activity level may not have been sufficient to elicit a positive effect. In a previous study completed in our laboratory, Santos Jr. et al. (2004) showed that
turkeys fed wheat-based diets had a significant better performance when the diets were
supplemented with a blend enzyme preparation containing endoxylanase, hemicellulase,
cellulase and protease than when these diets were supplemented with an enzyme product
exclusively composed of endoxylanase. Similar results have been reported by Odetallah et al.
(2002), who observed that an enzyme blend preparation with high endoxylanase activity
resulted in the best growth performance in turkeys fed wheat-based diets. Ravindran et al.
(1999) stated that there is considerable synergy in activities among enzymes when they are
supplemented as a blended preparation. Additionally, the effect of dietary enzyme
supplementation on the growth performance of turkeys appears to be dependent upon the
dose of endoxylanase. It is possible that the level of endoxylanase in the XY1 (2,500 EXU/kg
feed) was insufficient to completely breakdown the high level of xylan backbone present in
the high inclusion level of wheat. Recently, Santos Jr. et al. (2004) reported that
supplementation of endoxylanase to wheat-based diets at 5,500 EXU/kg feed yielded
significantly better turkey performance response than at 2,250 EXU/kg feed. In agreement, 157
several investigations have shown dose-dependent responses for dietary supplementation of
NSP enzymes (Hesselman et al., 1982; Petterson and Aman, 1989; Bedford and Classen,
1992). Crouch et al. (1997) stated that one possible reason for the general lack of response with some enzymes might be the presence of a higher content of water-soluble pentosans
(arabinoxylan) in some cultivars of wheat. Other authors attribute this lack of response to the low level of enzyme supplementation (Odetallah, 2000), and/or not an appropriate enzyme for the type of grain (Friesen et al., 1992).
Dietary supplementation of exogenous enzymes has been demonstrated to alter the number of bacteria in the distal intestinal tract (Apajalahti and Bedford, 1999; Fernandez et al., 2000) and to shift the microflora to a healthier state by increasing the number of commensal microorganisms (Hogberg and Lindberg, 2004) and decreasing the number of unfavorable ones (Rumes, 2003; Engberg et al., 2004). In the present study, Salmonella prevalence had a decreasing trend throughout the trial. Enzyme supplementation to the corn- based diets significantly reduced Salmonella presence in feces of turkeys at 15 weeks of age, such that it was statistically equivalent to the wheat-based diet. Additionally, Salmonella spp. was neither recovered from the cecal samples of 18 week-old toms fed the corn-based diet supplemented with XY2, nor those fed the wheat-based diets. However, 13% of the pens of toms fed the corn-based control diet were still positive for Salmonella at 18 weeks of age.
Therefore, these data suggests that Salmonella colonization was discouraged in turkeys fed diets rich in wheat or supplemented with enzymes.
To confirm the hypothesis that dietary wheat and supplemental enzymes discourages
Salmonella colonization, cecal Salmonella spp. population was measured at 16 weeks of age. 158
The results showed that Salmonella spp. was not recovered from the animals fed the wheat- based diets and the enzyme-supplemented corn-based diet, but birds fed the corn-based diet without enzyme supplementation had 5.8 log of Salmonella population per gram of cecal samples. In agreement, Remus (2003) observed that a wheat-based diet, containing a high concentration of plant cell wall polysaccharides, supplemented with carbohydrases shifted the intestinal microflora of chickens to a healthier state by decreasing Salmonella spp. population in the intestine of broilers.
The effect of enzyme on modulating the intestinal microflora is presumably due to its influence on nutrient digestibility. Dietary enzyme supplementation improves nutrient absorption in the proximal intestine, thus reducing the quantity of nutrients available as a fermentation substrate for bacterial growth in the ileum (Cowieson, 2005b). Enzyme supplementation has been shown to enhance the digestibility of dietary protein (Bedford,
1995; Huyghebaert, 2000), fat (Friesen et al., 1992), starch (Cowieson, 2005b) and minerals
(Jaroni et al., 1999), and increase energy uptake (Annison and Choct, 1991; Santos Jr. et al.,
2004).
Besides modulating the intestinal microflora by altering nutrient digestibility, enzyme supplementation may alter the microbial profile of the GIT of the birds by increasing cecal fermentation. Although microflora fermentation in the small intestine has been shown to decrease when xylanase is supplemented to the diet (Choct et al., 1995; Dunn, 1996), microbial fermentation increases in the large intestine and ceca. Steenfeldt et al. (1998) observed a decrease in the pH in the cecal content of chickens as a result of enzyme supplementation. The decrease in pH indicated a higher production of SCFA caused by 159 increased microbial fermentation. Steenfeldt et al. (1998) also observed a significant negative correlation between pH and the apparent digestibility of total-NSP (r= -0.73, P<0.0006).
They found a negative correlation between pH and apparent digestibility of xylose (r= -0.72,
P<0.001) and arabinose residues (r= -0.69, P<0.001). Evidently, the degradation of cell wall arabinoxylan by enzyme supplementation increases the amount of xylooligosaccharides available for microbial fermentation in the ceca, leading to increased production of SCFA, which discourages the colonization of competitive pathogens like Salmonella and it can be used by the bird as an energy source. Likewise, Choct et al. (1996) reported that volatile fatty acids (VFA) concentration in the ceca was not influenced by increasing soluble NSP in the diet, but it was significantly increased by enzyme supplementation. In contrast, they reported that ileal VFA content was significantly higher in birds fed diets containing soluble NSP as compared to those fed the control (sorghum/soybean meal) or the enzyme-supplemented diets. Therefore, enzyme supplementation has a profound effect on microbial fermentation of the GIT, but the level of dietary NSP also has an important influence.
The level of NSP in the diet has a marked effect on the microbial community of the intestinal tract, and this effect is enhanced with the use of dietary enzyme supplementation.
Generally, the foremost contrasts observed in this study were with respect to differences between birds fed the corn-based diets and those fed the wheat-based diets. The wheat-based diets had a more pronounced effect on Salmonella colonization in the gastro-intestinal tract
(GIT) of turkeys than the corn-based diet. Salmonella was not recovered from feces sampled from the wheat-treatment groups after 15 wk, but Salmonella was recovered from 32% of fecal samples from the corn-treatment groups. However, the groups receiving the enzyme- 160
supplemented corn-based diet had Salmonella prevalence levels similar to birds in pens receiving the wheat-based diets at 15 and 18 weeks of age. In this experiment, the corn-based diets had in average 1.6% soluble dietary fiber (SDF) and 14.5% insoluble dietary fiber (IDF) on a dry matter basis (DM) (Table 3), whereas the wheat-based diets contained 2.0% DM-
SDF and 17.9% DM-IDF (Table 2). Thus, the difference in total NSP between these two diets averaged 37.2g/kg. A change in growth performance, intestinal viscosity, nutrient digestibility and microbial community structure has been shown to be affected by NSP from as low as 2 g NSP/kg diet to as high as 40g NSP/kg diet (Choct and Annison, 1992; Annison,
1993; Langhout et al., 2000; Svihus, 2001; Lan, 2004).
Non-starch polysaccharides are primary substrates for Lactobacillus and
Bifidobacterium, which are important commensal bacteria in the GIT. However, NSP
become better utilized as a microbial fermentation source when they are hydrolyzed to smaller carbohydrate units by dietary exogenous enzymes. Bartelt et al. (2002) measured the
prececal digestibility of arabinoxylans in piglets and reported considerable digestibility of
insoluble arabinoxylans, but not the entire soluble fiber fraction. They reported that the
digestibility of soluble and insoluble NSP increased with dietary xylanase supplementation.
The authors suggested that this improved digestibility of NSP might be a direct effect of the
exogenous enzyme, but also of a stimulated degradation by supporting a specialized group of
NSP-hydrolyzing bacteria. Hogberg and Lindberg (2004) studied the influence of cereal-NSP
and enzyme supplementation on digestion and intestinal ecosystem and showed that the
substrates for the growth of lactic acid bacteria were released in the diet when enzyme was
added, thus supporting the growth of Lactobacillus. Van Laere et al. (1997) studied a range 161 of different short-chain carbohydrates with widely different sugar compositions and molecular sizes and tested their decomposition by different bacteria. They showed that
Bifidobacteria utilized carbohydrates with low-degree of polymerization and linear oligosaccharides were catabolized to a greater degree than were those with branched structures, and xylooligosaccharides were well fermented (Van Laere et al., 1997).
Oligosaccharides of intermediate length, especially xylobiose, xylotriose and xylopentaose, are products of the hydrolysis by endoxylanase (Uchino and Nakane, 1981; Akiba and
Horikoshi, 1988; Bataillon et al., 2000) as used in the research reported herein. Therefore, microbial fermentation probable increased in the large intestine and ceca in the wheat-based diets high in NSP content, and the addition of enzymes that hydrolyzed branch polysaccharides to smaller carbohydrate units may have enhanced higher cecal fermentation.
The possible increase in microbial fermentation in the ceca may have affected
Salmonella colonization due to the degree of competitive exclusion from the enteric microflora and by the metabolic effects of SCFA on the GIT. The increase in commensal bacteria in the GIT is proposed to inhibit the growth of pathogenic microorganisms by several means. Commensal bacteria compete for attachment sites in the intestinal tract and for available nutrients, as well as, producing bacteriocins and antimicrobial peptides (Simon et al., 2004). In addition, commensal bacteria produce SCFA and lactic acids that lower the ceca pH, creating an inadequate environment for the growth of some microorganisms, including pathogenic microbes like Salmonella. The major products of fermentation of dietary fiber are SCFA, predominantly acetate, propionate, butyrate, lactate and succinate.
Generally, lactic acid bacteria are able to grow at relatively low pH and they are more 162
resistant to high concentrations of SCFA than other bacterial species, such as E. coli and
Salmonella. Lactic acid bacteria, like other Gram-positive bacteria, have a high intracellular
potassium concentration that counteracts acid anions (Russell & Diez-Gonzalez, 1998).
Furthermore, SCFA produced by the increased microbial fermentation in the lower intestinal tract have important metabolic functions that control microbial populations in the GIT. These
SCFA stimulate intraepithelial lymphocytes and natural killer cells (Ishizuka and Tanaka,
2002; Ishizuka et al., 2004), thus enhancing the natural immunocompetence of the host animal (Lan, 2004) and suppressing the colonization of pathogens (Bertschinger et al., 1978;
Oyofo et al., 1989; Kataoka et al., 2002; Lowry et al., 2005).
Short chain fatty acids present in the ceca of avian species can have bactericidal properties. Wielen et al. (2000) demonstrated that high fermentation activity in chicken ceca was correlated with a lower pH and this may inhibit some pathogenic bacteria by dissipating the proton motive force across the bacterial cell membrane (Russell, 1992). The antibacterial activity of organic acids increases with decreasing pH-value because pH affects the ability of organic acids to dissociate. Organic acids are lipid soluble in the undissociated form and they easily enter the microbial cell by both passive and carrier-mediated transport mechanisms.
Once in the cell, the organic acid releases the proton H+ in the more alkaline environment,
resulting in a decrease of intracellular pH. This change in pH influences microbial metabolism, inhibiting the action of important microbial enzymes and forces the bacterial cell to use energy to export the excess of protons H+, ultimately resulting in death by
starvation. In the same manner, the protons H+ can denature bacterial acid sensitive proteins
and DNA. 163
Short-chain fatty acids, the product of microbial fermentation, can accelerate
intestinal epithelial cell proliferation, which can result in changes of mucosal morphology
and enlargement of the GIT (Lan, 2004). In this study, ceca weight of toms fed the wheat-
based diets were about 10% greater than toms fed corn-based diets. In addition, the toms fed
wheat-based diets had about 5% greater total intestinal weight than those fed the corn-based diets. These observations may be caused by increased microbial fermentation in the lower
GIT as the level of dietary fiber increased. However, enlargement of the GIT may compromise lean tissue growth because more metabolizable energy, amino acids and other dietary resources are partitioned towards maintenance requirements of enteric tissues, resulting in less efficient growth (Lan, 2004). However, in this reported study no significant correlation analyses were found between intestinal weight, intestinal length and its accessory glands with body weight. This increased epithelial proliferation can affect the colonization of bacteria, including pathogenic strains, because the accelerated intestinal epithelial cell proliferation can exceed the rate at which attached bacteria proliferate and invade, thus eliminating attached pathogens from the intestine and benefiting the animal’s health
(Buddington et al., 1997; Lan, 2004).
The turkeys fed the enzyme-supplemented corn-based diets had improved body weight and feed conversion ratio as compared to unsupplemented corn-based diets, but this effect was age-dependent. Enzyme supplementation had no significant effect on performance at the starting-growing phases of the trial; however supplementation of XY2 increased BW and BG by 2.5%, and decreased FCR by approximately 6% by the end of the trial as compared to toms fed corn-control treatment. These age differences could be attributed to 164
differences in gut maturity between young and older birds. Older birds have a more mature and stable intestinal microbial ecosystem with greater fermentation capacity than younger birds (Choct and Annison, 1992; Veldman and Vahl, 1994). The stability of the microflora in older birds may come from acclimatization of the digestive system to the diet through changes in the type and number of microorganism (Petersen et al., 1999). A greater
variability among birds is found in the numbers and types of microorganisms in younger
birds than in older birds (Annison, 1989).
The age-dependent effect of enzyme supplementation to corn-based diets may also be
attributed to the energy requirement of the birds. The experimental diets supported the
nutrient requirements for full growth of the young toms. However, as energy requirement
increased as the birds got older, the effect of dietary enzyme supplementation on nutrient
digestibility and growth became more evident. Exogenous enzymes have a greater effect on
growth performance when it is supplemented to low protein and energy diets. Santos Jr. et al.
(2004) stated that the value of dietary enzyme supplementation on improved nutrient
availability (as measured by growth performance and apparent metabolizable energy) can be
better observed when diets are formulated slightly below requirements for amino acids and energy. Odetallah et al. (2003) studied broilers fed corn-SBM based diets at 18% crude
protein (80% NRC 1994), 21% crude protein (93% NRC 1994), and 24% crude protein diet
(100% NRC 1994) with a protease supplementation from 1-26 days of age. The protease
supplementation to the corn-SBM based broiler starter diets improved chick body weight
gains and feed conversion rates, especially in the low protein diets. 165
The lower performance observed in the corn-fed toms than the wheat-fed ones may be attributed to the degree of the Salmonella infection and its adverse effects on intestinal health (intestinal gastroenteritis caused by Salmonella). Enteric bacterial infection leads to activation of the physiologic stress response systems of the body (Dhabhar and McEwen,
1996). These physiological stress responses involve specific regulatory mechanisms that are designed to maintain homeostasis (Dhabhar and McEwen, 1996). These responses partition metabolic energy toward protection and support of the animal body function instead of animal growth (Olsen et al., 2005). Additionally, the low-grade damage to the intestinal tract caused by Salmonella enteritis may lead to poor feed efficiency and decreased rate of gain
(Porter, 1998) because of limited nutrient absorption (MacRae, 1993). Compromised nutrient absorption and stressful conditions increase amylase secretion by the pancreas as an adaptation to meet energy requirements (Routman et al., 2003). Reduced nutrient absorption and increase pancreatic amylase associated with pancreas hypertrophy and hyperplasia has been observed in animals subjected to various stress conditions, such as bacterial gastroenteritis (Tositti et al., 2001), heat stress (Routman et al., 2003), and proteinaceous and amylase inhibitors (Moran, 1982). Tositti et al. (2001) evaluated the incidence and the clinical significance of hyperamylasemia in 507 adult patients with acute gastroenteritis.
They reported that Salmonella spp. was the microorganism most frequently associated with hyperamylasemia. They also reported that hyperamylasemia correlated directly with the severity of the disease. In this experiment, relative pancreas weight of the corn-fed birds was
12.2% greater (P<0.05) than those fed the wheat-based diet. This may indicate that the birds 166 fed the corn-based diets were more affected by salmonellosis than those fed the wheat-based diets.
Salmonella-infected turkeys may have compromised performance due to different reasons. There could be an increase in metabolic cost on the proportion of diet energy and amino acid partitioned towards the increase in pancreatic enzyme production among birds afflicted by salmonellosis. The nutritional demand of Salmonella-infected birds may be particularly high for the amino acids found in relatively high concentrations in α-amylase, such as aspartic acid, glycine, glutamic acid, serine, valine and arginine (Vonk and Western,
1984). Therefore, the disadvantage in growth performance observed among birds fed the corn-based diet in comparison to those fed the wheat-based diets may be attributed to the stress of Salmonella gastroenteritis infection, compromised nutrient absorption due to injury of intestinal tract by Salmonella, and associated increase in energy and protein requirements for the production of pancreatic enzymes.
In conclusion, cereal-based diets high in NSP and enzyme supplementation can discourage the colonization of Salmonella spp. in turkeys. Moreover, dietary exogenous endoxylanase, protease and α-amylase blend preparation to corn-soy diets can significantly enhance growth performance of turkeys. The experimental results reported herein support the hypothesis that dietary non-starch polysaccharides and exogenous enzyme supplementation modulate intestinal microflora and promote intestinal health.
167
ACKNOWLEDGMENTS
This work was supported by Danisco Animal Nutrition13, the North Carolina
Agricultural Foundation, and the United States Department of Agriculture. The authors wish
to thank Annette Israel, Jamie Warner, Jean de Oliveira, Yuwares Sungwarapon, Ondulla
Foye, Renee Plunske, Mike Mann, Robert Neely and the North Carolina State University
Poultry Educational Unit farm employees, Raleigh, NC, for their technical assistance during
this trial.
13Danisco Animal Nutrition, Wiltshire, UK. 168
3.6 TABLES AND FIGURES
TABLE 1: Enzyme product, dietary inclusion level, and target enzyme activity in the experimental diets1.
Inclusion rate Activity in feed Enzyme Product (kg enzyme/tonne feed) (EXU/kg feed)2 XY13 0.5 2500 XY24 0.1 325 1Products supplied by Danisco Animal Nutrition, Witshire, UK. Data from Danisco, 2003. 2Endo-xylanase Unit (EXU) = One endo-xylanase unit is defined as the enzyme activity required to liberate 1 µmol reducing sugar (measured as glucose equivalents) per minute from a 1% xylan solution at pH 3.5 and 40ºC. 3 XY1 = Avizyme 1302 supplemented to the wheat-based diet (treatment 2). 4XY2 = Avizyme 1500 supplemented to the corn-based diet (treatment 4).
169
TABLE 2: Composition and nutrient content of the wheat-based experimental diets (treatments 1 and 2) fed to turkeys from 1 to 113 days
Prestarter Starter Grower Developer Ingredients 1-28 d 29-56 d 57-84 d 85-113 d
(%) Wheat 36.25 37.10 46.12 52.00 SBM-48 35.82 38.01 30.58 20.86 Wheat middlings 8.00 8.00 8.00 10.00 Triticale 9.00 8.00 8.00 10.00 Corn Gluten Meal 5.00 1.86 0.00 0.00 Dical Phosphate (18.5%) 2.19 1.68 1.28 1.08 Limestone 1.46 1.24 1.14 1.05 Soy Oil 1.00 3.00 3.86 4.00 Salt 0.35 0.30 0.22 0.22 Mineral Premix (TM-90)1 0.20 0.20 0.20 0.20 D,L-Methionine 0.13 0.13 0.10 0.04 L-Threonine 0.00 0.00 0.00 0.08 L-Lysine HCl 0.30 0.18 0.20 0.17 Vitamin Premix (NCSU-90)2 0.20 0.20 0.20 0.20 Selenium Premix3 0.8 0.8 0.8 0.8 Calculated Analysis Crude Protein, % 26.70 25.73 22.00 18.50 ME, kcal/kg 2694.6 2800.0 2900.0 2951.9 Calcium, % 1.2 1.0 0.85 0.75 Phosphorus, % 0.93 0.83 0.72 0.67 Avail. P, % 0.60 0.50 0.42 0.38 Fat, % 2.63 4.49 5.35 5.58 Fiber, % 3.06 3.07 3.01 3.03 Metionine, % 0.54 0.52 0.42 0.31 Cysteine, % 0.45 0.43 0.38 0.34 Met+Cys, % 1.00 0.95 0.80 0.65 Lysine, % 1.56 1.50 1.30 1.02 Sodium, % 0.17 0.15 0.12 0.12 Chemical Analysis (dry matter basis)4 Dry Matter, % 92.3 89.3 92.3 92.2 Crude Protein, % 28.60 27.70 24.10 20.04 Gross Energy, kcal/kg 4239.7 4352.3 4345.7 4320.2 Fat (Ether extraction), % 2.80 4.68 6.06 6.10 Ash, % 7.45 6.99 6.16 5.63 Fiber Total, % 19.86 Insoluble, % 17.89 Soluble, % 1.98 1 . . Supplied the following per kilogram of feed: 120 mg Zn as ZnSO4 H2O; 120 mg MN as MnSO4 H2O; 80 mg Fe as . FeSO4 H2O; 10 mg Cu as CuSO4; 2.5 mg I as Ca(IO3)2; 1.0 mg Co as CoSO4. 2Supplied the following per kilogram of feed: vitamin A, 26,400 IU; cholecalciferol, 8,000 IU; niacin, 220 mg; pantothenic acid, 44 mg; riboflavin, 26.4 mg; pyridoxine, 15.8 mg; menadione, 8 mg; folic acid, 4.4 mg; thiamin, 8 mg; biotin, 0.506 mg; vitamin B12, 0.08 mg; ethoxyquin, 200 mg. The vitamin E premix provided the necessary amount of vitamin E as DL-α- tocopheryl acetate. 3Selenium premix provided 0.3 ppm Se from sodium selenate. 4Chemical analysis: (1) Crude protein used Kjeldahl automatic analyzer (Kjeltec Auto 1030 Analyser, Tecator, Sweden), (2) Gross Energy used Bomb Calorimeter (IKA Calorimeter System C5000 control, IKA® Werke Labortechnik, Staufen, Germany), (3) Fat used Ether Extract method, and (4) Ash used Muffle Oven method. 5Dietary Fiber analyses were performed on a pool sample. 500 g samples of feed from each feed phase of wheat-based diet were blended together to form the pool sample prior to analysis. The fiber analyses were performed using the Megazyme Total Dietary Fiber Assay Kit (Megazyme International Ireland Ltd., Co. Wicklow, Ireland). 170
TABLE 3: Composition and nutrient content of the corn-based experimental diets (treatments 3 and 4) fed to turkeys from 1 to 113 days
Prestarter Starter Grower Developer Ingredients 1-28 d 29-56 d 57-84 d 85-113 d
(%) Corn 34.76 38.19 43.66 52.00 SBM-48 36.15 35.43 30.11 23.07 Triticale 10.00 8.00 10.00 10.00 Wheat Middlings 10.00 10.00 10.00 10.00 Corn gluten 3.00 3.00 0.00 0.00 Dical Phosphate (18.5%) 2.38 2.13 1.92 1.68 Limestone 0.84 1.00 0.77 0.68 Soy Oil 1.60 1.00 2.32 1.60 Salt 0.39 0.37 0.37 0.37 Mineral Premix (TM-90)1 0.20 0.20 0.20 0.20 D,L-Methionine 0.13 0.13 0.11 0.10 L-Threonine 0.00 0.00 0.00 0.00 L-Lysine HCl 0.25 0.25 0.24 0.00 Vitamin Premix (NCSU-90)2 0.20 0.20 0.20 0.20 Selenium Premix3 0.80 0.80 0.80 0.80 Calculated Analysis Crude Protein, % 25.18 24.90 21.22 19.00 ME, kcal/kg 2800.0 2783.8 2900.0 3017.87 Calcium, % 1.0 1.0 0.85 0.75 Phosphorus, % 0.95 0.90 0.83 0.77 Avail. P, % 0.60 0.55 0.50 0.45 Fat, % 3.98 3.50 4.88 4.51 Fiber, % 3.16 3.15 3.12 3.15 Metionine, % 0.53 0.52 0.44 0.41 Cysteine, % 0.42 0.42 0.36 0.34 Met+Cys, % 0.95 0.94 0.80 0.75 Lysine, % 1.50 1.48 1.30 0.96 Sodium, % 0.18 0.17 0.17 0.17 Chemical Analysis (dry matter basis)4 Dry Matter, % 89.2 89.3 91.5 91.1 Crude Protein, % 27.7 26.21 22.90 18.92 Gross Energy, kcal/kg 4325.4 4251.7 4241.0 4216.5 Fat (Ether extraction), % 4.12 3.83 5.50 4.77 Ash, % 6.53 6.97 6.29 5.72 Fiber Total5, % 16.14 Insoluble, % 14.51 Soluble, % 1.63 1 . . Supplied the following per kilogram of feed: 120 mg Zn as ZnSO4 H2O; 120 mg MN as MnSO4 H2O; 80 mg Fe as . FeSO4 H2O; 10 mg Cu as CuSO4; 2.5 mg I as Ca(IO3)2; 1.0 mg Co as CoSO4. 2Supplied the following per kilogram of feed: vitamin A, 26,400 IU; cholecalciferol, 8,000 IU; niacin, 220 mg; pantothenic acid, 44 mg; riboflavin, 26.4 mg; pyridoxine, 15.8 mg; menadione, 8 mg; folic acid, 4.4 mg; thiamin, 8 mg; biotin, 0.506 mg; vitamin B12, 0.08 mg; ethoxyquin, 200 mg. The vitamin E premix provided the necessary amount of vitamin E as DL-α- tocopheryl acetate. 3Selenium premix provided 0.3 ppm Se from sodium selenate. 4Chemical analysis: (1) Crude protein used Kjeldahl automatic analyzer (Kjeltec Auto 1030 Analyser, Tecator, Sweden), (2) Gross Energy used Bomb Calorimeter (IKA Calorimeter System C5000 control, IKA® Werke Labortechnik, Staufen, Germany), (3) Fat used Ether Extract method, and (4) Ash used Muffle Oven method. 5Dietary Fiber analyses were performed on a pool sample. 500 g samples of feed from each feed phase of corn-based diet were blended together to form the pool sample prior to analysis. The fiber analyses were performed using the Megazyme Total Dietary Fiber Assay Kit (Megazyme International Ireland Ltd., Co. Wicklow, Ireland). 171
TABLE 4: Effect of different dietary grain base formulation and enzyme supplementation on body weight of turkey toms fed wheat and corn-based diets from 0 to 16 weeks of age
Dietary Treatment 2 wk 4 wk 8 wk 12 wk 16 wk
(kg) Wheat-based control1 0.325ab 1.074a 4.173a 9.660a 14.881ab Wheat-based + XY12 0.329a 1.083a 4.196a 9.691a 15.051a Corn-based control3 0.314bc 1.016b 3.964b 9.241b 14.228c Corn-based + XY24 0.307c 1.008b 4.036b 9.324b 14.586b SEM(25)5 0.004 0.008 0.035 0.065 0.115 P-value 0.0061 0.0001 0.0002 0.0001 0.0002 (P-Value) Source of variation among treatments Grain type6 0.0009 0.0001 0.0001 0.0001 0.0001 Enzyme7 0.8063 1.0000 0.1838 0.3890 0.0296 Grain X enzyme8 0.2279 0.3204 0.4950 0.6962 0.4180 a-cMeans with different superscripts within a column differ significantly (P < 0.05). There were no significant differences in poults starting weights at 1 d of age (53g). 1Unsupplemented wheat/SBM-basal diet. 20.5 kg of Avizyme® 1302/tonne of wheat/SBM-basal diet that provided at least 2,500 EXU/kg feed. 3Unsupplemented corn/SBM-basal diet. 40.1 kg of Avizyme® 1500/tonne of corn/SBM-basal diet that provided at least 325 EXU/kg feed. 5SEM(25)= Standard Error of the mean with 25 degrees of freedom. 6Contrast analysis of wheat-treatments versus corn-treatments. 7Contrast analysis of enzyme supplemented treatments versus unsupplemented treatments. 8Contrast analysis of the interaction between grain and enzyme supplementation.
172
TABLE 5: Effect of different dietary grain base formulation and enzyme supplementation on periodic feed consumption of turkey toms fed wheat and corn-based diets from 0 to 16 weeks of age
Dietary Treatment 0 to 2 wk 3 to 4 wk 5 to 8 wk 9 to 12 wk 13 to 16 wk 0 to 16 wk
(kg) Wheat-based control1 0.518a 1.246a 5.893 13.189 17.995 38.839 Wheat-based + XY12 0.515a 1.237a 5.743 13.185 17.355 38.034 Corn-based control3 0.464b 1.193b 5.936 13.710 18.250 39.556 Corn-based + XY24 0.469b 1.179b 5.895 13.419 17.929 38.893 SEM(25)5 0.007 0.014 0.075 0.164 0.280 0.432 P-value 0.0001 0.0060 0.2958 0.1023 0.1685 0.1288 (P-Value) Source of variation among treatments Grain type6 0.0001 0.0007 0.2003 0.0298 0.1509 0.0804 Enzyme7 0.8731 0.4152 0.2116 0.3767 0.0981 0.1019 Grain X enzyme8 0.6325 0.8970 0.4728 0.3888 0.5739 0.8716 a,bMeans with different superscripts within a column differ significantly (P < 0.05). 1Unsupplemented wheat/SBM-basal diet. 20.5 kg of Avizyme® 1302/tonne of wheat/SBM-basal diet that provided at least 2,500 EXU/kg feed. 3Unsupplemented corn/SBM-basal diet. 40.1 kg of Avizyme® 1500/tonne of corn/SBM-basal diet that provided at least 325 EXU/kg feed. 5SEM(25)= Standard Error of the mean with 25 degrees of freedom. 6Contrast analysis of wheat-treatments versus corn-treatments. 7Contrast analysis of enzyme supplemented treatments versus unsupplemented treatments. 8Contrast analysis of the interaction between grain and enzyme supplementation.
173
TABLE 6: Effect of different dietary grain base formulation and enzyme supplementation on periodic feed conversion ratio (feed:gain) of turkey toms fed wheat and corn-based diets from 0 to 16 weeks of age
Dietary Treatment 0 to 2 wk 3 to 4 wk 5 to 8 wk 9 to 12 wk 13 to 16 wk 0 to 16 wk
(kg/kg) Wheat-based control1 1.931a 1.664ab 1.907bc 2.412b 3.474b 2.615bc Wheat-based + XY12 1.875a 1.640b 1.851c 2.409b 3.324b 2.553c Corn-based control3 1.791b 1.706a 2.020a 2.605a 3.719a 2.800a Corn-based + XY24 1.864ab 1.691a 1.955b 2.533a 3.420b 2.674b SEM(25)5 0.028 0.015 0.022 0.032 0.078 0.030 P-value 0.0140 0.0233 0.0001 0.0004 0.0102 0.0001 (P-Value) Source of variation among treatments Grain type6 0.0119 0.0051 0.0001 0.0001 0.0381 0.0001 Enzyme7 0.7589 0.1911 0.0103 0.2586 0.0081 0.0041 Grain X enzyme8 0.0277 0.7576 0.8255 0.2960 0.3493 0.2980 a-cMeans with different superscripts within a column differ significantly (P < 0.05). 1Unsupplemented wheat/SBM-basal diet. 20.5 kg of Avizyme® 1302/tonne of wheat/SBM-basal diet that provided at least 2,500 EXU/kg feed. 3Unsupplemented corn/SBM-basal diet. 40.1 kg of Avizyme® 1500/tonne of corn/SBM-basal diet that provided at least 325 EXU/kg feed. 5SEM(25)= Standard Error of the mean with 25 degrees of freedom. 6Contrast analysis of wheat-treatments versus corn-treatments. 7Contrast analysis of enzyme supplemented treatments versus unsupplemented treatments. 8Contrast analysis of the interaction between grain and enzyme supplementation.
174
TABLE 7: Effect of different dietary grain base formulation and enzyme supplementation on periodic mortality of turkey toms fed wheat and corn-based diets from 0 to 16 weeks of age
Dietary Treatment 0 to 2 wk 3 to 4 wk 5 to 8 wk 9 to 12 wk 13 to 16 wk 0 to 16 wk
(%) Wheat-based control1 2.08 0.00 1.67 3.33 1.25 8.33 Wheat-based + XY12 0.00 0.00 1.25 2.50 4.17 7.92 Corn-based control3 1.67 0.42 0.42 0.83 2.50 5.83 Corn-based + XY24 3.33 0.84 0.83 1.25 0.83 7.08 SEM(25)5 0.030 0.019 0.032 0.038 0.041 0.042 P-value 0.0819 0.3109 0.4796 0.3075 0.2569 0.4659 (P-Value) Source of variation among treatments Grain type6 0.0655 0.0914 0.1655 0.0815 0.3879 0.2943 Enzyme7 0.5529 0.5637 1.0000 0.9215 0.7477 0.5734 Grain X enzyme8 0.0553 0.5637 0.4817 0.4888 0.0763 0.2917 a,bMeans with different superscripts within a column differ significantly (P < 0.05). 1Unsupplemented wheat/SBM-basal diet. 20.5 kg of Avizyme® 1302/tonne of wheat/SBM-basal diet that provided at least 2,500 EXU/kg feed. 3Unsupplemented corn/SBM-basal diet. 40.1 kg of Avizyme® 1500/tonne of corn/SBM-basal diet that provided at least 325 EXU/kg feed. 5SEM(25)= Standard Error of the mean with 25 degrees of freedom. 6Contrast analysis of wheat-treatments versus corn-treatments. 7Contrast analysis of enzyme supplemented treatments versus unsupplemented treatments. 8Contrast analysis of the interaction between grain and enzyme supplementation.
175
TABLE 8: Effect of different dietary grain base formulation and enzyme supplementation on relative intestinal accessory organs weights (grams of tissue/kg of body weight) of turkey toms at 16 weeks old fed wheat and corn-based diets
Dietary Treatment Gizzard Liver Pancreas
(g/kg) Wheat-based control1 11.641 11.269 0.916 Wheat-based + XY12 11.228 10.709 0.936 Corn-based control3 11.970 11.102 1.016 Corn-based + XY24 11.933 11.516 1.061 SEM(57)5 0.364 0.536 0.046 P-value 0.4515 0.7535 0.1055 (P-Value) Source of variation among treatments Grain type6 0.1605 0.5526 0.0188 Enzyme7 0.5380 0.8924 0.4866 Grain X enzyme8 0.6074 0.3676 0.7956 a,bMeans with different superscripts within a column differ significantly (P < 0.05). 1Unsupplemented wheat/SBM-basal diet. 20.5 kg of Avizyme® 1302/tonne of wheat/SBM-basal diet that provided at least 2,500 EXU/kg feed. 3Unsupplemented corn/SBM-basal diet. 40.1 kg of Avizyme® 1500/tonne of corn/SBM-basal diet that provided at least 325 EXU/kg feed. 5SEM(57)= Standard Error of the mean with 57 degrees of freedom. 6Contrast analysis of wheat-treatments versus corn-treatments. 7Contrast analysis of enzyme supplemented treatments versus unsupplemented treatments. 8Contrast analysis of the interaction between grain and enzyme supplementation.
176
TABLE 9: Effect of different dietary grain base formulation and enzyme supplementation on relative intestinal weights (grams of tissue/kg of body weight) of turkey toms at 16 weeks old fed wheat and corn-based diets
Dietary Treatment Duodenum Jejunum Ileum Ceca Total GIT9
(g/kg) Wheat-based control1 3.794 7.020 6.042 4.076 20.932 Wheat-based + XY12 3.430 6.406 6.502 4.282 20.620 Corn-based control3 3.451 6.501 5.957 3.849 19.759 Corn-based + XY24 3.427 6.491 6.136 3.784 19.839 SEM(57)5 0.138 0.220 0.213 0.137 0.522 P-value 0.1810 0.1961 0.2919 0.0523 0.3057 (P-Value) Source of variation among treatments Grain type6 0.2157 0.3294 0.2935 0.0108 0.0660 Enzyme7 0.1657 0.1629 0.1381 0.6119 0.8252 Grain X enzyme8 0.2246 0.1761 0.5117 0.3285 0.7089 a,bMeans with different superscripts within a column differ significantly (P < 0.05). 1Unsupplemented wheat/SBM-basal diet. 20.5 kg of Avizyme® 1302/tonne of wheat/SBM-basal diet that provided at least 2,500 EXU/kg feed. 3Unsupplemented corn/SBM-basal diet. 40.1 kg of Avizyme® 1500/tonne of corn/SBM-basal diet that provided at least 325 EXU/kg feed. 5SEM(57)= Standard Error of the mean with 57 degrees of freedom. 6Contrast analysis of wheat-treatments versus corn-treatments. 7Contrast analysis of enzyme supplemented treatments versus unsupplemented treatments. 8Contrast analysis of the interaction between grain and enzyme supplementation. 9Total relative intestinal weight = sum of duodenum, jejunum, ileum and ceca weight, divided by body weight.
177
TABLE 10: Effect of different dietary grain base formulation and enzyme supplementation on relative intestinal length (cm of tissue/kg of body weight) of turkey toms at 16 weeks old fed wheat and corn-based diets
Dietary Treatment Duodenum Jejunum Ileum Ceca Total GIT9
(cm/kg) Wheat-based control1 3.427 7.796 9.401 5.683 26.306 Wheat-based + XY12 3.268 7.078 9.217 5.738 25.301 Corn-based control3 3.197 7.290 9.062 5.566 25.115 Corn-based + XY24 3.245 7.502 8.956 5.767 25.470 SEM(57)5 0.101 0.232 0.224 0.147 0.534 P-value 0.4117 0.1687 0.5285 0.7761 0.4145 (P-Value) Source of variation among treatments Grain type6 0.2158 0.8613 0.1856 0.7669 0.3434 Enzyme7 0.5823 0.2807 0.5213 0.3854 0.5456 Grain X enzyme8 0.3104 0.0500 0.8633 0.6182 0.2083 a-cMeans with different superscripts within a column differ significantly (P < 0.05). 1Unsupplemented wheat/SBM-basal diet. 20.5 kg of Avizyme® 1302/tonne of wheat/SBM-basal diet that provided at least 2,500 EXU/kg feed. 3Unsupplemented corn/SBM-basal diet. 40.1 kg of Avizyme® 1500/tonne of corn/SBM-basal diet that provided at least 325 EXU/kg feed. 5SEM(57)= Standard Error of the mean with 57 degrees of freedom. 6Contrast analysis of wheat-treatments versus corn-treatments. 7Contrast analysis of enzyme supplemented treatments versus unsupplemented treatments. 8Contrast analysis of the interaction between grain and enzyme supplementation. 9Total relative intestinal length = sum of duodenum, jejunum, ileum and cecum length, divided by body weight.
178
TABLE 11: Effect of different dietary grain base formulation and enzyme supplementation on cecal Salmonella spp. population of turkey toms at 16 weeks old fed wheat and corn-based diets
Dietary Treatment Cecal Salmonella population
(log/g) Wheat-based control1 -*b Wheat-based + XY12 -b Corn-based control3 5.8a Corn-based + XY24 -b SEM(57)5 3.6 P-value 0.0001 a,bMeans with different superscripts within a column differ significantly (P < 0.05). *Salmonella spp. not recovered from samples. 1Unsupplemented wheat/SBM-basal diet. 20.5 kg of Avizyme® 1302/tonne of wheat/SBM-basal diet that provided at least 2,500 EXU/kg feed. 3Unsupplemented corn/SBM-basal diet. 40.1 kg of Avizyme® 1500/tonne of corn/SBM-basal diet that provided at least 325 EXU/kg feed. 5SEM(57)= Standard Error of the mean with 57 degrees of freedom.
179
35 32 31 31 30 30 28 28 29 28 27 26 26 25 25 27 26 24 24 22 24 21 21 21 21 21 21 19 20 18 18 20 17 15 13 15 12 14 12 12 14 14 14 Temperature (ºC) 11 10
9 6 5 6 6 6 6 6 3 2 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Week
High Temperature Average Temperature Low Temperature
FIGURE 1: Mean weekly high, low and average ambient temperature throughout the trial. The ambient temperature was recorded twice daily from four different points within the experimental house.
180
100 Wheat Wheat + XY1 90 88 88 Corn Corn + XY2 80 75 70 63 63 60 50* 50 50 spp. Prevalence (%) 40
30
20 Salmonella 13** 13 10
0 0 0 3 9 15 18
Age (Weeks)
FIGURE 2: Effect of different dietary grain base formulation and enzyme supplementation on prevalence of Salmonella spp. in fecal (3, 9, 15 wk) and cecal (18 wk) content of turkey toms fed wheat- and corn-based diets. Values represent a mean of 8 pens per treatment analyzed for Salmonella spp. prevalence. Fecal values were from a composite of fresh droppings collected from different locations from each pen. Cecal values were cecal content from 2 birds per pen. The treatments were: unsupplemented wheat/SBM basal diet (Wheat); wheat/SBM supplemented with 2500 EXU/kg feed from Avizyme® 1302 (Wheat + XY1); unsupplemented corn/SBM basal diet (Corn); corn/SBM supplemented with 325 EXU/kg feed from Avizyme® 1500 (Corn + XY2). Both enzymes were provided by Danisco Animal nutrition (Wiltshire, UK). Statistical difference were examined using the frequency analysis procedure of SAS (1996), and variable were compared using the Chi-Square test (X2 –test) and differences between the variables within each week are shown as follow: *significantly different (P<0.05) from wheat fed groups. **no difference (P>0.05) from the other treatment groups.
181
3.7 REFERENCES
Adeola, O., M.R. Bedford, 2004. Exogenous dietary xylanase ameliorates viscosity-induced anti-nutritional effects in wheat-based diets for White Pekin ducks (Anas platyrinchos domesticus). Br. J. Nutr. 92:87-94. Akiba, T., and K. Horikoshi, 1988. Xylanases of alkalophilic thermophilic Bacillus. Methods Enzymol. 160:655-659. Andrews, W.H., and T.S. Hammack. 2003. Salmonella. Bacteriological Analytical Manual Online, Chapter 5. [Internet, WWW], ADDRESS: http://cfsan.fda.gov/ ~ebam?bam- 5.html. HYPERTEXT SOURCE: Bacteriological Analytical Manual, 8th Edition, Revision A, Chapter 5, 1998. Andrews, W.H., R.S. Flowers, J. Silliker, and J.S. Bailey, 2001. Salmonella. In: Downes, F., Ito, K. (Eds.), Microbiological Examination of Foods. 4th rev. ed. American Public Health Association, Washington, DC. pp: 357-380. Annison, G., 1989. Determination of the AME of wheat using gnotobiotic chickens. Page: 2A. In: Recent Advances in Animal Nutrition in Australia. University of New England, Armidale, Australia. Annison, G., 1993. Corrigendum – The role of wheat non-starch polysaccharides in broiler nutrition. Aust. J. Agric. Res. 44(3):405-422. Apajalahti, J., and M.R. Bedford, 1999. Improve bird performance by feeding its microflora. Word’s Poult. Sci. 15:20-23. Apajalahti, J.H.A., A. Kettunen, M.R. Bedford, and W.E. Holben, 2001. Percent G+C profiling accurately reveals diet-related differences in the gastrointestinal microbial community of broiler chickens. Appl. Environ. Microbiol. 67: 5656-5667. Bartelt, J., A. Jadamus, F. Wiese, E. Swiech, L. Buraczewska, and O. Simon, 2002. Apparent precaecal digestibility of nutrients and level of endogenous nitrogen in digesta of the small intestine of growing pigs as affected by various digesta viscosities. Arch. Anim. Nutr. 56:93-107. Bataillon, M., A.P.N. Cardinali, N. Castillon, and F. Duchiron, 2000. Purification and characterization of a moderately thermostable xylanase from Bacillus sp. Strain SPS-0. Microb. Technol. 26:187-192. Batal, A.B., C.M. Parsons, 2002. Effects of age on nutrient digestibility in chicks fed different diets. Poult. Sci. 81: 400-407. Bedford, M.R., 1995. Mechanism of action and potential environmental benefits from the use of feed enzymes. Anim. Feed Sci. Technol. 53: 145-155. Bedford, M.R., and H.L. Classen, 1992. Reduction of intestinal viscosity through manipulation of dietary rye and pentosanase concentration is effected through changes in the carbohydrate composition of the intestinal aqueous phase and results in improved growth rate and food conversion efficiency in broiler chicks. J. Nutr. 12: 560-569. 182
Bedford, M.R., and H. Schulze, 1998. Exogenous enzymes in pigs and poultry. Nutr. Res. Rev. 11: 91-114. Beli, E., A. Telo, and E. Duraku. 2001. Salmonella serotypes isolated from turkey meat in Albania. International Journal of Food Microbiology 63:165-167. Bertschinger, H.U., U. Eggenberger, H. Jucker, and H.P. Pfirter, 1978. Evaluation of low nutrient, high fiber diets on the prevention of porcine Escherichia coli enterotoxemia (edema disease). Vet. Microbiol. 3:281-290. Brenes, A., R.R. Marquardt, W. Guenter, and A. Viveiros, 2002. Effect of enzyme addition on the performance and gastrointestinal tract size of chicks fed lupin seed and their fractions. Poult. Sci. 81:670-678. Buddington, R.K., A. Krogdhal, and A.M. Bakke-McKellep, 1997. The intestines of carnivorous fish: structure and functions and the relations with diet. Acta Physiol. Scand. 161:67-80. Care, B., 2004. Causes for variation in digestibility of starch among feedstuffs. Word’s Poult. Sci. J. 60:76-89. Choct, M., 1997. Feed non-starch polysaccharides: chemical structures and nutritional significance. Feed Milling Int.: 13-26. Choct, M., and G. Annison, 1992. Anti-nutritive effect of wheat pentosans in broiler: roles of viscosity and gut microflora. Br. Poult. Sci. 33: 821-834. Choct, M., R.J. Hughes, J. Wang, M.R. Bedford, A.J. Morgan, and G. Annison, 1995. Feed enzymes eliminate the antinutritive effect by non-starch polysaccharides and modify fermentation in broilers. Proceedings Australian Poultry Science Symposium. The University of Sydney, Sidney. 7: 121-125. Choct, M., R.J. Hughes, J. Wang, M.R. Bedford, A.J. Morgan, and G. Annison, 1996. Increased small intestinal fermentation is partly responsible for the anti-nutritive activity of non-starch polysaccharides in chickens. Br. Poult. Sci. 37: 609-621. Collins, M.D., and G.R. Gibson, 1999. Probiotics, prebiotics, and synbiotics: approaches for modulating the microbial ecology of the gut. Am. J. Clin. Nutr. 69: 1052S-1057S. Conway, P.L., 1995. Microbial ecology of the human large intestine. Pages 1-24. In: Human Colonic Bacteria – Role in Nutrition, Physiology and Pathology. G.R. Gibson, and G.T. Macfarlane. CRC Press, London. Cowieson, A.J., 2005a. Enzyme information: technical information from Danisco Animal Nutrition, Witshire, UK. Personal communication. Cowieson, A.J., 2005b. Factors that affect the nutritional value of maize for broilers. Anim. Feed Sci. Technol. 119:293-305. Crouch, A.N., J.L. Grimes, P.R. Ferket, and L.N. Thomas, 1997. Enzyme supplementation to enhance wheat utilization in starter diets for broilers and turkeys. J. Appl. Poult. Res. 6: 147-154. 183
Danisco, 2003. Technical information from Danisco Animal Nutrition. Witshire, UK. Personal communication. Dhabhar, F.S., and B.S. McEwen, 1996. Stress-induced enhancement of antigen-specific cell- mediated immunity. J. Immunol. 156:2608-2615. Douglas, M.W., C.M. Parsons, and M.R. Bedford, 2000. Effect of various soybean meal sources and Avizyme on chick growth and ileal digestible energy. J. Appl. Poult. Res. 9:74-80. Dunn, N., 1996. Combating the pentosans in cereals. World Poult. 12(1): 24-25. Engberg, R.M., M.S. Hedemann, S. Steenfeldt, and B.B. Jensen, 2004. Influence of whole wheat and xylanase on broiler performance and microbial composition and activity in the digestive tract. Poult. Sci. 83: 925-938. Fernandez, F., F. Sharma, M.H. Hinton, and M.R. Bedford, 2000. Diet influences the colonization of Campylobacter jejuni and distribution of mucin carbohydrates in chick intestinal tract. Cell. Mol. Life Sci. 57:1793-1801. Friesen, O.D., W. Guenter, R.R. Marquardt, and B.A. Roter, 1992. The effect of enzyme supplementation on the apparent metabolizable energy and nutrient digestibilities of wheat, barley, oats, and rye for the young broiler chick. Poult. Sci. 71: 1710-1721. Ghazi, S., J.A. Rooke, H. Galbraith, and M.R. Bedford, 2002. The potential for the improvement of the nutritive value of soye-bean meal by different proteases in broiler chicks and broiler cockerels. Br. Poult Sci. 43:70-77. Gibson, G.R., 1998. Dietary modulation of human gut microflora using prebiotics. Br. J. Nutr. 80: S209-S212. Gibson, G.R., and M.B. Roberfroid, 1995. Dietary modulation of the human colonic microbiota: introducing the concept of prebiotics. J. Nutr. 125: 1401-1412. Hesselman, K., K. Elwinger, and S. Thomke, 1982. Influence of increasing levels of β- glucanase on the productive value of barley diets for broiler chickens. Anim. Feed Sci. Technol. 7: 351-358. Hogberg, A., J.E. Lindberg, 2004. Influence of cereal non-starch polysaccharides and enzyme supplementation on digestion site and gut environment in weaned piglets. Anim. Feed Sci. Technol. 116: 113-128. Huyghebaert, G., 2000. The efficacy of NSP-enzymes in wheat-based diets for broiler chickens and turkey poults. In: Proceedings, Twenty First World’s Poultry Congress, Montreal, Canada, August 20-24. Ishizuka, S., and S. Tanaka, 2002. Modulation of CD8+ intraepithelial lymphocyte distribution by dietary fiber in the rat large intestine. Exp. Biol. Med. 227: 1017-1021. Ishizuka, S., S. Tanaka, H. Xu, and H. Hara. 2004. Fermentable dietary fiber potentiates the localization of immune cells in the rat large intestinal crypts. Exp. Biol. Med. 229: 876- 884. 184
Jaroni, D., S.E. Scheideler, M.M. Beck, and C. Wyatt, 1999. The effect of dietary wheat middlings and enzyme supplementation II: Apparent nutrient digestibility, digestive tract size, gut viscosity, and gut morphology in two strains of leghorn hens. Poult Sci. 78: 1664-1674. Jensen, L.S., R.E. Fry, J.B. Allred, and J. McGinnis, 1957. Improvement in the nutritional value of barley for chicks by enzyme supplementation. Poult. Sci. 36: 919-921. Jozefiak, D., A. Rutkowski, and S.A. Martin, 2004. Carbohydrate fermentation in the avian ceca: a review. Anim. Feed Sci. Technol. 113: 1-15. Kataoka, K., T. Mutta, S. Yamazaki, and K. Takeshige, 2002. Activation of macrophages by linear (1-3)-β-glucans. Implications for the recognition of fungi by innate immunity. J. Biol. Chem. 277: 36825-36831. Knudsen, K.E., 2001. The nutritional significance of “dietary fibre” analysis. Anim. Feed Sci. Technol. 90: 3-20. Lan, Y., 2004. Gastrointestinal health benefits of soy water-soluble carbohydrates in young broiler chickens. Ph.D. Thesis, Wageningen University, The Netherlands, 269 pp. Langhout, D.J., J.B. Schutte, J. de Jong, H. Sloetjes, M.W.A. Verstegen, and S. Tamminga, 2000. Effect of viscosity on digestion of nutrients in conventional and germ-free chicks. Br. J. Nutr. 83: 533-540. Lowry, V.K., M.B. Farnell, P.J. Ferro, C.L. Swaggerty, A. Bahl, and M.H. Kogut, 2005. Purified β-glucan as an abiotic feed additive up-regulates the innate immune response in immature chickens against Salmonella enterica serovar Enteritidis. Int. J. Food Microbiol. 98: 309-318. Macfarlane, G.T., S. Macfarlane, and G.R. Gibson, 1998. Validation of a three-stage compound continuous culture system for investigating the effect of retention time on the ecology and metabolism of bacteria in the human colon. Microbial. Ecology 35:180-187. MacRae, J.C., 1993. Metabolic consequences of intestinal parasitism. Proc. Nutr. Soc. 52:121-130. Marsman, G.J., H. Gruppen, A.F. van der Poel, R.P. Kwakkel, M.W. Verstegen, and A.G. Voragen, 1997. The effect of thermal processing and enzyme treatments of soybean meal on growth performance, ileal nutrient digestibilities, and chime characteristics in broiler chickens. Poult. Sci. 76:864-872. Midura, T.F., and R. Bryant, 2001. Sampling plans, sample collection, shipment, and preparation for analysis. In: Downes, F., Ito, K. (Eds.), Microbiological Examination of Foods. 4th rev. ed. American Public Health Association, Washington, DC. pp: 13-23. Montagne, L., J.R. Pluske, and D.J. Hampson. 2003. A review of interactions between dietary fibre and the intestinal mucosa, and their consequences on digestive helath in young non-ruminant animals. Anim. Feed Sci. Technol. 108: 95-117. Moran, E.T., 1982. Starch digestion in fowl. Poult. Sci. 61:1257-1267. 185
National Research Council (NRC), 1994. Nutrient Requirements of Poultry. 9th Rev. Ed. National Academy Press, Washington, DC. Noy, Y., and D. Sklan, 1995. Digestion and absorption in young chicks. Poult. Sci. 74:366- 373. Odetallah, N.H., 2000. The use of dietary enzymes to alleviate enteric disorders of turkeys. Ph.D. Thesis, North Carolina State University, 197 pp. Odetallah, N.H., C. W. Parks, and P.R. Ferket, 2002. Effect of wheat enzyme preparation on the performance characteristics of tom turkeys fed wheat-based rations. Poult. Sci. 81: 987-994. Odetallah, N.H., J.J. Wang, J.D. Garlich, and J.C.H. Shih, 2003. Keratinase in starter diets improves growth of broiler chicks. Poult. Sci. 82: 664-670. Olsen, R.E., K. Sundell, T.M. Mayhew, R. Myklebust, and E. Ringo, 2005. Acute stress alters intestinal function of rainbow trout, Oncorhynchus mykiss (Walbaum). Aquaculture 250:480-495. Oyofo, B.A., J.R. DeLoach, D.E. Corrier, J.O. Norman, R.L. Zirprin, and H.H. Mollenhauer, 1989. Prevention of Salmonella typhimurium colonization of broilers with D-mannose. Poult. Sci. 68: 1357-1360. Petersen, S.T., J. Wiseman, and M.R. Bedford, 1999. Effects of age and diet on the viscosity of intestinal contents in broiler chicks. Br. Poult. Sci. 40: 364-370. Petterson, D., and P. Aman, 1989. Enzyme supplementation of a poultry diet containing rye and wheat. Br. J. Nutr. 62: 139-149. Porter Jr., R.E., 1998. Bacterial enteritides of poultry. Poult. Sci. 77: 1159-1165. Remus, J., 2003. Control strategies for salmonella in swine discussed. Dec. 22, 2003: 14-16. Routman, K.S., L. Yoshida, A.C. Frizzas, M. Macari, and J.M. Pizauro Jr., 2003. Intestinal and pancreas enzyme activity of broilers exposed to thermal stress. Brazilian Journal of Poultry Science 5(1):23-27. Russell, J.B., 1992. Another explanation for the toxicity of fermentation acids at low pH: anion accumulation versus uncoupling. J. Applied Bacteriology, 73: 363-370. Russell, J.B., and F. Diez-Gonzales, 1998. The effects of fermentation acids on bacterial growth. Advances in Microbial Physiology 39: 205-234. Samanya, M., and K. Yamauchi, 2002. Histological alterations of intestinal villi in chickens fed dried Bacillus subtilis var. natto. Comparative Biochemistry and Physiology Part A. 133:95-104. Santos Jr., A.A., P.R. Ferket, J.L. Grime, and F.W. Edens, 2004. Dietary supplementation of endoxylanase and phospholipase for turkeys fed wheat-based rations. Int. J. Poult. Sci 3: 20-32. 186
Santos, F.B.O., X. Li, J.B. Payne, and B.W. Sheldon, 2005. Estimation of most probable number Salmonella populations on commercial North Carolina turkey farms. J. App. Poult. Res. 14:700-708. SAS Institute Inc., 1996. SAS/STAT User’s Guide, Version 6, Fourth Edition, Vol. 2. SAS Proprietary Software Release 6.12. SAS Institute, Inc., Cary, NC. Silva, S.S.P., and R.R. Smithard, 2002. Effect of enzyme supplementation of a rye-based diet on xylanase activity in the small intestine of broilers, on intestinal crypt cell proliferation and on nutrient digestibility and growth performance of the birds. Br. Poult. Sci. 43: 274- 282. Simon, O., W. Vahjen, and D. Taras, 2004. Interaction of nutrition with intestinal microbial communities. Pages 33-46. In: Interfacing immunity, gut health and performance. L.A. Tucker, and J.A. Taylor-Pickard, eds. Nottingham University Press, Nottingham, United Kingdom. Sklan, D., A. Geyra, E. Tako, O. Gal-gerber, and Z. Uni, 2003. Ontogeny of brush border carbohydrate digestion in the chick. Br. J. Nutr. 89:747-753. Socorro, M., A. Levy-Benshimol, and J. Tovar, 1989. In vitro digestibility of cereal and legume (Phaseolus vulgaris) starches by bovine, porcine and human pancreatic α- amylase. Starch 2:69-71. Steenfeldt, S., M. Hammershoj, A. Mullertz, and F. Jensen, 1998. Enzyme supplementation of wheat-based diets for broilers. 2. Effect on apparent metabolisable energy content and nutrient digestibility. Anim. Feed Sci. Technol. 75: 45-64. Svihus, B., 2001. Research note: a consistent low starch digestibility observed in pelleted broiler chicken diets containing high levels of different wheat varieties. Anim. Feed Sci. Technol. 92:45-49. Takahashi, T., M. Goto, and T. Sakata, 2004. Viscoelastic properties of the small intestine and caecal contenet of the chicken. Br. J. Nutr. 91:867-872. Taki, K., F. Takayama, and T.Niwa, 2005. Beneficial effects of Bifidobacteria in a gastroresistant seamless capsule on hyperhomocysteinemia in hemodialysis patients. J. Ren. Nutr. 15(1): 77-80. Tester, R.F., I. Karkalas, and X. Qi, 2004. Starch structure and digestibility enzyme-substrate relationship. World’s Poult. Sci. J. 60:186-195. Tositti, G., P. Fabris, E. Barnes, F. Furlan, M. Franzetti, C. Stecca, E. Pignattari, V. Pesavento, and F. Lalla, 2001. Pancreatic hyperamylasemia during acute gastroenteritis: incidence and clinical relevance. BMC Infect. Dis. 1:18. Uchino, F., and T. Nakane, 1981. A thermostable xylanase from a thermophilic acidophilic Bacillus sp. Agric. Biol. Chem. 45:1121-1127.
187
Van Laere, K.M.J., M. Bosveld, H.A. Schols, G. Beldman, and A.G.J. Voragen. 1997. Fermentative degradation of plant cell wall derived oligosaccharides by intestinal bacteria. Pages: 37-46. In: Proceedings, International Symposium Non-digestable oligosaccharides: healthy food for the colon? Hartemink, R., ed. Wageningen Graduate School VLAG, Wageningen. Veldman, A., and H.A. Vahl, 1994. Xylanase in broiler diets with differences in characteristics and content of wheat. Br. Poult. Sci. 35:537-550. Vonk, H.J., and I.R.H. Western, 1984. Comparative biochemistry and physiology of enzymatic digestion. Academic Press Inc., London, UK. Weurding, R.E., A. Veldman, W.A. Veen, P.J. van der Aar, and M.W. Verstegen, 2001. In vitro starch digestion correlates well with the rate and extent of starch digestion in broiler chickens. J. Nutr. 131:2336-2342. Wielen, P.W., S. Biesterveld, S. Notermans, H. Hofstra, B.A.P. Urlings, and F. van Knapen, 2000. Role of volatile fatty acids in development of the cecal microflora in broiler chickens during growth. Appl. Environ. Microbiol. 66, 2536-2540.
188
CHAPTER 4
REDUCTION OF INTESTINAL SALMONELLA ENTERICA COLONIZATION IN TURKEYS BY WHEAT, TRITICALE AND ENZYME SUPPLEMENTATION1
______1The use of trade names in this publication does not imply endorsement by the North Carolina Agriculture Research Service or the North Carolina Cooperative Extension Service of the products mentioned nor criticism of similar products not mentioned. 189
4.1 ABSTRACT Non-starch polysaccharides (NSP) and dietary exogenous enzyme supplementation
may modulate enteric microflora and discourage Salmonella enterica (SE) colonization. A
study was conducted to determine the effect of wheat, triticale and xylanase (XY) in
comparison to a corn-based control diet on growth performance and cecal SE population of
turkeys. Turkeys raised in battery cages were fed either a corn-based control diet or wheat- or
triticale-based diets with and without XY at 5,500 EXU/kg feed from 0-28 d. Growth
performance, cecal SE population, cecal pH, ileum digesta viscosity, intestinal size (weight
and length), and ileum histomorphometry were measured. Intestinal size was calculated relative to BW. Performance was not affected by XY, but toms fed wheat and triticale had better (P<.05) BW (300 vs 274 g) and FCR (1.29 vs 1.40 g/g) during the starting phase (0-14
d) than corn-based diet. All treatments had similar cecal SE population at 7d. Salmonella populations were lower (P<.05) in treatments receiving wheat and triticale than corn-control at 14 (6 vs 8 Log/g), 21 (4 vs 5 Log/g) and 28 (4 vs 7 Log/g) d. XY treatments had lower
(P<.05) SE population as compared to unsupplemented treatments at 14 (6 vs 7 Log/g) and
21 (4 vs 6 Log/g) d. There was a negative correlation between SE population and BW at 21
and 28 d (r= -0.9, P<.05). Cecal pH decreased (P<0.05) among turkeys fed the triticale-based
diets (pH=6.1) in comparison to toms fed the wheat- and corn-basal diets (pH=6.4). Viscosity
was higher in the triticale-treatment groups than the other treatments (1.2 vs 0.7 cP, P<.05).
XY decreased (P<.05) viscosity of both triticale- and wheat-based diets, such that triticale-
based diet was equivalent to the wheat-based diet, and wheat-based diet was equivalent to corn-based diet. Crypt and muscularis depth increased, and villus height:crypt depth ratio decreased as dietary NSP content increased, especially upon XY supplementation. Dietary 190 exogenous enzyme supplementation and NSP reduces enteric colonization of Salmonella in turkey intestinal tract, thus improving growth performance and reducing the presence of
Salmonella at the pre-harvest level in turkeys.
(Key words: fiber, enzyme, growth performance, Salmonella, turkey)
4.2 INTRODUCTION
Salmonella enterica subspecies enterica is a common pathogen of many species of mammals and birds (Watarai and Tana, 2005). It is one of the most common causes of bacterial gastroenteritis in human, and it is usually associated with the ingestion of contaminated chicken eggs, egg products, or poultry meat (Rodrique et al., 1990; Telzak et al. 1990). Much effort has been made to control Salmonella infection in poultry (Ishihara et al., 2000; Naughton et al., 2001). However, the prevention of Salmonella colonization of poultry intestine is still a current concern (Watarai and Tana, 2005). Methods that could control Salmonella at the pre-harvest level could help to reduce contamination levels at the processing plant. When contamination levels of poultry are reduced prior to arrival at the slaughter house, cross-contamination of carcasses and the final product may be reduced or eliminated during processing (Keefe, et al., 2004).
Non-starch polysaccharides (NSP) are components of the cereal grain kernel that have been considered by many researchers as undesirable in poultry feeds because of their adverse effects on nutrient digestibility and growth performance (Hetland and Svihus, 2001).
Although a typical poultry diet may contain ten times less NSP than starch, NSP has a much greater effect on lipid, carbohydrate and protein absorption because of its physical properties 191
(Cummings and Englyst, 1992). The detrimental effect of soluble NSP is mainly associated with their viscous nature and their accumulation in the posterior gastro-intestinal tract (GIT) where they exert their effects on osmotic balance and microbial fermentation. Consequently, many researchers have attributed the poor growth of animals fed diets composed of a high proportion of small grains (wheat, barley, oats, and triticale) to excessive dietary NSP content
(Iji et al., 2001a, Remus, 2003).
Recently, benefits associated with the presence of NSP in the diet have been identified. In human nutrition, NSP are considered as prebiotics, which are defined as non- digestible food ingredients that affect the host beneficially by selectively stimulating the growth and/or activity of beneficial microbial population species, such as Bifidobacterium spp. and Lactobacillus spp. (Iji et al., 2001b; Hogberg and Lindberg, 2004). In humans, NSP has been shown to reduce fat and cholesterol absorption, alter the rate of glucose uptake, and
enhance volatile fatty acid (VFA) production in the large intestine, which increase tolerance
to insulin deficiency (diabetes mellitus), and reduce incidence of cancer and arteriosclerosis
(Vahouny and Kritchvsky, 1982). Dietary NSP may also improves human health by
preventing constipation (Cummings and Englyst, 1992), diverticulitis (Cummings and
Englyst, 1992; Johnson, 1993), hemorrhoids (Johnson, 1993), and colorectal cancer (Stevens and Hume, 1995). In animal nutrition, NSP and oligosaccharides have been shown to reduce the risk of enteric disease, possibly by reducing the proliferation of pathogenic species
(Bailey et al., 1991; Choi et al., 1994; Remus, 2003). It has been reported that some dietary carbohydrates, including cereal NSP, may help control the level of Salmonella spp. colonization in the gastro-intestinal tract (GIT) of birds at the farm (Oyofo et al., 1989; 192
Remus, 2003). Several other benefits associated with dietary non-starch polysaccharides in
poultry have been also reported (Lan, 2004; Lowry et al., 2005). Lowry et al. (2005) showed
that β-glucan protected broiler chickens against Salmonella by up-regulating heterophils phagocytosis, bactericidal activity and oxidative burst. Lan (2004) stated that NSP increased lactic acid producing bacteria in broiler chickens, which can enhance the animal immune competence. Cell wall components of lactic acid bacteria have been shown to have immunostimulatory properties (Takahashi et al., 1993). Therefore, the beneficial effects of dietary NSP has been observed in both humans and animals.
The adverse effects of dietary NSP on animal growth performance are significantly alleviated by dietary supplementation of appropriate exogenous enzymes. The use of enzymes in animal feeds has received much attention in academic and industry research since
early 1980s. Recently, exogenous enzyme supplementation to NSP-rich diets has been shown
to be a potential tool to modulate the microbial ecosystem and pathogen colonization of the
intestinal tract of animals (Apajalahti and Bedford, 1999; Fernandez et al., 2000). Interest in
this technology is particularly great when the use of antibiotic growth promotors is restricted.
In a study on the influence of cereal-NSP and enzyme supplementation on digestion and
intestinal environment, Hogberg and Lindberg (2004) observed that the substrate for the
growth of lactic acid bacteria was released from the diet when NSP-enzyme was added.
Apparently, the release of oligosaccharides by dietary enzyme supplementation supported the
growth of Lactobacillus and Bifidobacterium. Similarly, Bartelt et al. (2002) observed
considerable digestibility of insoluble arabinoxylans in piglets, but not the entire soluble fiber
fraction. However, when a xylanase was added to the diet, digestibility of all fractions was 193
significantly increased. The authors suggested that the improved digestibility of NSP might be a direct effect of the exogenous enzyme, but also due to enhanced degradation by
supporting a specialized group of NSP-hydrolyzing bacteria. Similarly, Steenfeldt et al.
(1998) reported that exogenous enzyme supplementation in high NSP diets improved
intestinal health by increasing the fermentation of commensal bacteria in the lower intestine.
Non-starch polysaccharides and exogenous enzyme supplementation may control
Salmonella colonization through modulation of intestinal microflora. The intestinal tract of
animals is a natural habitat for a large and dynamic bacterial community. The enteric
bacterial community characteristics depend upon the host age, physiological state, intestinal
morphology, and diet. The amount and nature of the dietary fiber influences the enteric
bacterial community as it is the main substrate for bacterial fermentation in the lower
intestine (Savory, 1992; Wagner and Thomas, 1987). Increased growth of commensal
bacteria in the lower GIT could inhibit the growth of potentially pathogenic microorganisms
by: 1) lowering the pH through production of lactic acid and short chain fatty acids (SCFA);
2) competing for intestinal lining attachment sites and available nutrients; 3) producing
bacteriocins; 4) stimulating the gut associated immune system through cell wall components
(Nousiainen and Setala, 1998); 5) and increasing the production of SCFA that, besides
having bacteriostatic and bactericidal properties (Fuller, 1977), stimulates intraepithelial
lymphocytes and natural killer cells (Ishizuka and Tanaka, 2002; Ishizuka et al., 2004).
Therefore, modulation of the dynamic microbial population of the intestinal tract via dietary
NSP may help control the enteric colonization of pathogens, such as Salmonella. 194
Dietary NSP and some products of microbial fermentation have a great impact on
intestinal structure and function and consequently intestinal health. Viscous NSP were shown
to increase intestinal weight and mucosal cell proliferation rate (Johnson and Gee, 1986;
Brunsgaard et al., 1995). In addition, the products of NSP fermentation, such as SCFA, can accelerate intestinal epithelial cell proliferation, which can result in changes of mucosal morphology (Lan, 2004) and enlargement of the GIT. Increased intestinal epithelial cell proliferation may increase the metabolic costs to maintain the GIT which may compromise growth performance (Hersom et al., 2004).
The hypothesis tested in this study was that inclusion of dietary NSP, especially when the diets are supplemented with exogenous endoxylanase, can improve intestinal health and discourage enteric colonization of Salmonella in turkeys. To test this hypothesis, experimental diets were formulated with grains of different NSP content and supplemented with and without dietary exogenous endoxylanase supplementation. These experimental diets allowed test the effect of dietary NSP level and enzyme supplementation on cecal Salmonella enterica population of turkey intestine. Additionally, the shift of Salmonella enterica population by the dietary treatments were associated with changes on growth performance, intestinal weight and length, ileum histomorphometry, cecal pH, and intestinal viscosity.
4.3 MATERIALS AND METHODS
Enzymes
The enzyme used in this research was Avizyme® 1302, which is a commercial fine
granular enzyme preparation obtained from fermentation of Bacillus subtilis and genetically 195
modified Trichoderma longibrachiatum. It contained standardized activities of at least 5,000
endo-1,4-beta-xylanase units (EXU, EC 3.2.1.8) per gram of product (Danisco, 2003). One
EXU is defined as the enzyme activity required to liberate 1 µmol of reducing sugar
(measured as glucose equivalents) per minute from a 1% xylan solution at pH 3.5 and 40°C.
Avizyme® 1302 also contains some protease (subtilisin, EC 3.2.1.8) activities (Danisco,
2003) and a heat stable endoxylanase produced by the genetically modified Trichoderma
longibrachiatum. The enzyme preparation was supplied by Danisco Animal Nutrition1.
Diet
The experimental diets are presented in Table 1. All diets were formulated using least-cost linear programming software, such that the diets met or exceeded the NRC (1994) recommendations for nutrients. The diets were formulated to be isocaloric and isonitrogenous. Treatment 1 consisted of a corn/soy-bean meal (SBM)-based negative control diet without enzyme. Diets of treatments 2 and 3 consisted of the same wheat/SBM basal diet with and without Avizyme® 1302 supplementation. Diets of treatments 4 and 5 consisted of
the same triticale/SBM basal diet with and without Avizyme® 1302 supplementation. All
feed was pelleted and fed as crumbles. Composite feed samples from each diet were taken immediately after manufacture and were then analyzed for crude protein, fat, ash, Ca, and P.
The chemical analyses were performed as described in the footnote of Table 1. Also, all feed samples were analyzed for total, soluble and insoluble dietary fiber using the Megazyme
Total Dietary Fiber Assay kit2.
1Danisco Animal Nutrition, Wiltshire, UK. 2 Total Dietary Fiber Assay Kit, Megazyme International Ireland Ltd., Co. Wicklow, Ireland. 196
All feed used in this study were manufactured at the North Carolina State University
poultry feed mill3. The enzymes were applied during feed mixing in a 500 kg capacity
horizontal double ribbon mixer, such that Avizyme® 1302 provided at least 5,500 EXU/kg
feed, as recommended by the supplier (Danisco, 2003). For optimum bioefficacy of the enzyme, conditioning and pelleting temperature of feed did not exceed 82ºC (180ºF).
The experimental diets were formulated with grains of different levels of NSP, in order to test the effect of NSP level on Salmonella enterica colonization of turkey intestine.
Corn had the lowest total- and soluble-NSP content (Table 3). Wheat and triticale had similar total-NSP content, but triticale had the highest soluble-NSP content (Table 3). Trititicale is developed from crosses between wheat and rye. It is more resistant to drought, diseases, and pests than wheat, and it has the advantage of lower input costs, higher crop yields and shorter growing season (Hackett and Burke, 2004). Although triticale has some of the agronomic benefits of rye, it also contains more NSP than wheat, which may reduce its nutritional value
(Hackett and Burke, 2004). The main NSP constituent in the endosperm cell walls of triticale is pentosans (Petterson and Aman, 1988; Flores et al., 1994) with some β-glucan.
Bird husbandry
Seven-hundred 1-d-old commercial Nicholas4 male turkeys obtained from a
commercial hatchery5 were weighed and randomly assigned to 45 cages into two Alternative
Design batteries6. Each cage was 55 cm wide, 66 cm long and 45 cm high. At day of
placement, birds were weighed, neck-tagged, and orally gavaged with 1 ml of a cocktail of
3 NCSU Poultry Feed Mill, Chicken Unit, Lake Wheeler Rd, Raleigh, NC. 4 Nicholas, AviagenTM, Huntsville, AL. 5Goldsboro Milling Co., Goldsboro, NC, USA. 6 Alternative Design batteries, Wilveco, Billerica, MA. 197
Salmonella enterica subspecies enterica serotypes Hadar, Heidelberg, and Kentucky. The
cocktail consisted of approximately 108 colony forming units/ml of Salmonella. The
Salmonella strains used were field isolated by our laboratory from commercial turkey farms located in North Carolina. These Salmonella strains were serotyped by the NVSL-APHIS-
USDA7. The birds were housed in a room with controlled temperature, ventilation, and incandescent lighting (24h/d). All the birds had ad libitum access to feed and water (nipple
drinkers) throughout the experiment. Visual heath inspection of all birds within the study was
performed daily and weights of culled or dead birds were recorded so that an appropriate adjustment to feed conversion could be made.
Birds were subjected to the experimental treatments from 1 to 28 days of age. Each
treatment was replicated by 9 treatment cages with 15 poults per cage. The five dietary
treatments were randomly assigned within 4 blocks (each side of the battery unit consisted of a block) of 12 cages each (2-3 replicates/block). Although an unbalanced experimental design was used by including 9 replicate cages per treatment instead of 8 replicate cages when divided within 4 blocks, having a higher number of replicates per treatment was preferred to be incorporated in the research design. During statistical analysis the general linear model procedure (SAS, 1996) accounted for this unbalanced experimental design
(Jenkins, 2005). Even though block was statistically insignificant, the statistical model of this study included block and treatment, so that position effects within the room could be removed statistically.
7 National Veterinary Service Laboratories, Animal and Plant Health Inspection Services, United States Department of Agriculture, Ames, IO. 198
Data collection
Feed consumption by cage, and individual bird body weight were recorded at 1, 7, 14,
21, and 28 days of age. At 28 days of age, one bird per cage was weighed and euthanized by
cervical dislocation. Each bird was used for intestinal size measurement (weight and length),
ileum digesta viscosity, ileum histology, and cecal pH measurement as following. The birds’
intestinal segments were dissected and their lengths were measured. The intestinal segments were duodenum (from the gizzard to pancreatic and bile duct), jejunum (from the bile duct to
Meckel’s diverticulum), ileum (from the Meckel’s diverticulum to ileo-cecal-colonic
junction), and ceca (Samanya and Yamauchi, 2002). About 2 grams of digesta was gently
expressed from the terminal end of ileum, placed into micro-centrifuge tubes, centrifuged at
3,000 rpm for 2 min, and approximately 500 µl of the supernatant was collected, and immediately the viscosity of the supernatant was determined using Brookfield Digital
Viscometer LVDVII+CP8 at 18ºC according to the method described by the Brookfield
Digital Viscometer Operating Instructions Manual9. Each bird was considered an
experimental unit for the statistical analysis of the ileum digesta fluid viscosity. After
expressing the digesta from each intestinal segment, the tissue weights of each intestinal
section were recorded. Intestinal weight and length were calculated relative to bird live body
weight (g of tissue/kg BW) (Brenes et al., 2002).
Histology analysis
Approximately 3 cm of tissue was sampled from the middle part of the ileum from
each bird sampled for intestinal size measurement at 28 days of age (Salgado et al., 2001,
8Brookfield Engineering Laboratories Inc., Stoughton, MA. 9Brookfield Digital Viscosimeter, Model DV-II+ Version 2.0, Operating Instructions Manual No. M/92-161- F1193, Brookfield Engineering Laboratories Inc., Stoughton, MA. 199
2002; Samanya and Yamauchi, 2002). The lumen content of each 3 cm ileum section was
washed by injecting a solution of 10% formalin fixative buffer (Salgado et al., 2001, 2002;
Samanya and Yamauchi, 2002). Immediately, the ileum section was placed into clean 10%
fixative formalin buffer solution for 24 hours. The fixed ileum segment was then processed
according to a modification of the methods described by Iji et al. (2001a), and Samanya and
Yamauchi (2002). Briefly, two sections of approximately 2 to 3 mm were taken from each
ileum segment of each bird. The sections were enclosed in tissue cassettes and embedded in
10% formalin buffer solution until processed by the Histology Laboratory10. The fixed ileum
sections enclosed in the tissue cassettes were embedded in paraffin wax within 72 h to avoid
artifacts. Transverse sections of 5-µm thick were cut with rotary microtome and stained with
Lilee Meyer haematoxylin and counter-stained with eosin yellow.
The transverse section slides were viewed by a Leica-DMR light-microscope11
(optical lens No 4), digitized using a Spot-RTCR digital camera12, and the images were
analyzed using Image Tool software13. Images were viewed to measure villus height, villus
apical width at the villus tip, villus basal width at the crypt-villus junction, crypt depth, and
muscularis depth as described on the footnotes of the Table 7 and by Iji et al. (2001a).
Apparent villus surface area was estimated from the trigonometric relationship between
villus height, villus basal width and villus apical width (Iji et al., 2001a). Mucosal height
were calculated from crypt depth plus villi height measurements. Also villus height/crypt
depth ratio was calculated.
10 Histopathology Laboratory, College of Veterinary Medicine, NCSU, Raleigh, NC. 11 LEICA-DMR light-microscope, Leica Camera AG, Solms, Germany. 12 Spot-RTCR digital camera, Diagnostic Instruments, Inc., Sterling Heights, MI. 13 UTHSCSA Image Tool Software, Version 3.0, The University of Texas, San Antonio, TX. 200
Fifteen individual villi were assessed per section. An average of the 15 measurements
assessed per section was expressed as a mean for the correspondent section. A total of two
sections were counted from each intestinal segment of each sampled bird. Then, an average
of these two sections per bird was express as a mean of the desired measurement (e.g. mean
villus height) for each bird. Each bird was the experimental unit for statistical analysis. Some
samples did not yielded good-quality histological slides; therefore, only seven samples from
each treatment group were used for the examination of the histology measurements.
Salmonella prevalence procedure (day of placement)
A pooled sample of meconium of 15 poults of each cage was tested for Salmonella
spp. prevalence on day of placement. All pooled samples were kept on ice for less than 4
hours until further processed in the laboratory. Sample collections and dilutions schemes
were done as described by Midura and Bryant (2001). Upon laboratory arrival, the pooled
meconium samples were placed in a sterile filtered stomacher bag and diluted at 1:10 dilution
using buffer peptone water14 (BPW). The samples were homogenized in the stomacher15 for
two minutes (Beli et al., 2001; Andrews et al., 2001) and then the bags were incubated for
approximately 24 hours at 37°C. The selective enrichment step was performed by
transferring 1 ml from each bag to a bottle containing 100 ml of Rappaport-Vassiliadis (RV) broth14 (Andrews and Hammack. 2003). Bottles were then incubated at 42°C for 24 h.
Following incubation, one loopful from each bottle was streaked for isolation onto modified
lysine iron agar14 (MLIA) and incubated at 37°C for 24 h. No suspect colonies were found on the MLIA plates from meconium of 1-day old poults.
14 Oxoid Ltd., Basingstoke, Hampshire, England. 15 Classic Mastigator, IUL Instruments, S.A., Serial No. 0790/94, Cat. No. 0400, Barcelona, Spain. 201
Salmonella population analysis
Two birds per cage were weighed and euthanized by cervical dislocation at 7, 14, 21,
and 28 days of age. A pooled sample of cecal contents from 2 birds per cage was used for
Salmonella population analysis. Ceca were weighed and cut vertically to expose the contents
and mucosa. Then, both ceca from the 2 birds of the same cage were placed into Whirl Pack® bags16 containing BPW (1:10 dilution). This was considered the first dilution. The samples
were homogenized in the stomacher15 for 2 minutes (Midura and Bryant, 2001).
Most probable number (MPN) technique was used for Salmonella enumeration (Cox
et al., 2000; Santos et al., 2005). One ml of the first dilution was then serially diluted as
needed into 9 ml dilution BPW tubes. BPW was the pre-enrichment broth for the MPN
procedure. Diluted tubes from each sample were then incubated at 37°C for about 24h before
transferring 0.1 ml of the appropriate dilutions to triplicate 10 ml tubes of RV broth for
selective enrichment. All RV broth tubes were incubated at 42°C for 24 h and then one
loopful from each tube was streaked for isolation onto MLIA plates and incubated at 37°C
for 24 h. Suspect colonies were picked, streaked, and stabbed onto triple sugar iron (TSI)17 agar slants and incubated at 37°C for 24 h. Positive results were confirmed by agglutination using poly-O antiserum17. Salmonella spp. population for each sample was determined using
the Thomas’ approximation method (Swanson et al., 2001). Negative controls were used for
all plating procedures to ensure that the media had been properly sterilized.
16 Fisher Scientific, Pittsburgh, PA. 17 Difco/BBL, Becton Dickinson and Company, Sparks, Maryland. 202
Digesta pH procedure
Birds sampled at 28 days of age for intestinal size measurements and histology were also used to determine cecal digesta pH. Approximately 5 to 10 grams of digesta was gently expressed from the ceca of each bird and placed into 50 ml centrifuge tubes18. The samples were diluted to 1:5 with distilled water, homogenized and pH from the homogenate was measured with a temperature-corrected pH-meter19 (Medel et al., 1999).
Statistical analysis
All data were analyzed using the general linear models procedure for analysis of variance (ANOVA) (SAS, 1996), with block and treatment included in the experimental model. Additionally, the data from the treatments receiving small grains (wheat and triticale) was also analyzed as a factorial arrangement of 2 types of grains (wheat and triticale) and 2 enzyme supplementation levels (with and without enzyme supplementation). Cage means served as the experimental units for statistical analysis, unless otherwise stated. Treatment means having a significant F-test were compared using the least-squares-means (lsmeans) function of SAS (SAS, 1996), and they were considered to be significant at P<0.05. All percentage data were transformed to arc sine of the square root before analysis. All MPN data were transformed to log10 before analysis. Correlation analyses between intestinal size measurements, histomorphometry, viscosity, pH and growth performance were analyzed using the correlation procedure of SAS® (SAS, 1996).
18 50ml FisherBrand Disposable Sterile Centrifuge Tubes, Fisher Scientific, Pittsburgh, PA. 19 Corning Chek-Mite pH 20 Tester, Fisher Scientific, Pittsburgh, PA. 203
Animal ethics
The experiments reported herein were conducted according to the guidelines of the
Institutional Animal Care and Use Committee (IACUC) at North Carolina State University.
All husbandry practices and euthanasia were done with full consideration of animal welfare.
4.4 RESULTS
Animal growth performance
Overall growth performance was significantly affected by the type of grain in the diet, but it was not significantly affected by dietary enzyme supplementation. The birds fed the wheat- and triticale-based diets had better performance than birds receiving corn-soy diet during the experiment. Birds fed the small grains (wheat and triticale) had 10% greater 1-14 d body weight (BW) than birds fed the corn-control treatment (300 vs. 274 g, P<0.05; Table
2). Although significant (P<0.05) differences in 1-28 d feed consumption (FC) were not observed among the treatment groups (Table 3), the turkeys fed the wheat- and triticale-based diets had better 1-14 days feed conversion ratio (feed:gain, FCR) in comparison to the corn fed birds (1.3 vs 1.4 g/g, P<0.01) (Table 4).
Intestinal pH and viscosity
The results on the effect of diet formulation and enzyme supplementation on cecal pH and ileum digesta viscosity of 28 days-old turkey toms are presented in Table 5. Comparative statistical analysis between the 5 treatment groups did not show any differences in cecal pH.
However, contrast analysis revealed a significant (P<0.05) decrease in cecal pH among 204
turkeys fed the triticale-based diets (pH=6.1) in comparison to toms fed the wheat- and corn-
basal diets (pH=6.4).
Ileum digesta viscosity increased (P<0.05) as the total- and soluble-NSP content of
the diet increased (Table 5). Ileum digesta viscosity of birds fed the triticale-based diet
without enzyme supplementation was significantly (P<0.05) higher than the other treatments.
Enzyme supplementation significantly (P<0.05) reduced ileum digesta viscosity from birds
consuming wheat-based diet, such that it was statistically equivalent to the birds consuming
the corn-based diet. Similarly, enzyme supplementation reduced (P<0.05) ileum digesta viscosity from birds fed the triticale-based diet, such that it was statistically equivalent to those fed the wheat-based diet. Cecal pH was negatively correlated with soluble dietary fiber
(r= -0.9, P<0.05; Table 8).
Intestinal morphometry
In general, relative intestinal weight and intestinal length was not significantly
(P<0.05) affected by grain type or enzyme supplementation (Table 6). There was no significant influence (P<0.05) of grain type or enzyme supplementation on villus height, villus surface area and mucosal depth (Table 7). However, crypt depth increased as total- and soluble-dietary fiber increased, especially when supplemented with enzyme. The corn-fed birds had the least crypt depth, while the birds fed the enzyme-supplemented triticale diet had the greatest crypt depth among all the treatments. In contrast, villus-height:crypt-depth ratio of birds fed triticale diet was significantly (P<0.05) lower than birds fed the corn- or wheat- based diets. Enzyme supplementation of the triticale-based diet reduced (P<0.05) muscularis depth, such that triticale diet was statistically equivalent to the wheat-based diet without 205
enzyme. There was no difference in muscularis depth between the corn-control birds and
those fed the wheat-based diets. There was a significant negative correlation between villus
height:crypt depth ratio with cecal pH (r= -0.9, P<0.05) and soluble dietary fiber (r= -0.9,
P<0.05) (Table 8). Moreover, muscularis depth was positively correlated with soluble dietary
fiber (r= +0.9, P<0.05) and ileum digesta viscosity (r= +0.9, P<0.05).
Salmonella enterica population
Salmonella spp. was not detected from meconium samples of 1-day old poults. All
treatment groups had similar (P<0.05) Salmonella enterica population at 7 days (Figure 1).
Salmonella enterica populations were significantly higher (p<0.05) in treatments receiving corn than other treatments at 14 (8 vs 6 Log/g), 21 (6 vs 5 Log/g) and 28 (7 vs 4 Log/g) days.
Enzyme treatments had significantly lower (p<0.05) Salmonella enterica populations as compared to unsupplemented treatments at 14 (6 vs 7 Log/g), and 21 (4 vs 6 Log/g) days. In addition, there was a negative correlation (P<0.05) between Salmonella enterica population
(log/g) and body weight at 21 (r= -0.9, P<0.05) and 28 (r= -0.9, P<0.05) days (Table 8).
4.5 DISCUSSION
The experimental diets were formulated as a practical means to test different levels of dietary NSP: corn being the lowest total- and soluble-NSP content, wheat and triticale had similar total-NSP, but triticale had the highest soluble-NSP content (Table 3). This experimental design allowed the test of the hypothesis that Salmonella enterica colonization decreases as dietary NSP level increases, especially soluble-NSP content, and this effect can be enhanced by endoxylanase supplementation. As hypothesized, Salmonella enterica 206
colonization in turkey intestine was discouraged by a diet high in NSP content, especially as
increased soluble-NSP content, and by enzyme supplementation. Turkeys fed the wheat- and
triticale-based diets had lower Salmonella enterica populations by about 1 to 3 Log/g cecal
content as compared to birds fed the corn-based diet. The corn-based diet had 6.2 g/kg dry
matter (DM) of soluble dietary fiber (SDF) and 142.0 g/kg DM of insoluble dietary fiber
(IDF) as compared to 6.6 and 20.3 g/kg DM-SDF, and 171.1 and 147.7 g/kg DM-IDF in the
wheat- and triticale-based diets, respectively (Table 1). Thus, the difference in total NSP
between the corn-based diets from wheat and triticale-based diets was on average 25.1 g/kg.
Also, triticale-based diet had about 14 g/kg more soluble-NSP than the other dietary
treatments. Growth performance, intestinal viscosity, nutrient digestibility and microbial
community structure has been shown to be affected by NSP from as low as 2 g NSP/kg diet
to as high as 40g NSP/kg diet (Choct and Annison, 1992; Annison, 1993; Langhout et al.,
2000; Svihus, 2001; Lan, 2004). Dietary fiber is defined as non-starch plant polysaccharides
(NSP) and lignin that are resistant to hydrolysis by the digestive enzymes (Trowell et al.,
1976). Non-starch polysaccharides are primary substrates for important commensal bacteria of the GIT, such as Lactobacillus and Bifidobacterium, and an increase in available substrate increases microbial fermentation (Lan, 2004). Additionally, soluble-NSP has been indicated as an often completely degraded, easily digestible and available fiber composition and better fermented than insoluble NSP (Hogberg, 2003). In this study, soluble dietary fiber (SDF) was negatively correlated with cecal pH, which indicates that microbial fermentation increased as soluble dietary fiber increased. Additionally, birds fed triticale-based diets had significant lower (P<0.05) cecal pH in comparison to toms fed the wheat- and corn-based diets. 207
The possible increase of commensal bacteria in the ceca by dietary NSP may have
created unfavorable conditions for Salmonella enterica colonization, otherwise known as
competitive exclusion. Competitive exclusion against potential pathogenic bacteria by the
commensal microflora of the intestinal tract is a complex mechanism. Competitive exclusion
occurs when beneficial microflora overwhelmingly compete with pathogens for available
nutrients and they control their habitat by consuming resources of the intestine and secreting products of fermentation (Roberfroid et al., 1995; Falk et al., 1998), including bacteriocins
and antimicrobial peptides. Bacteriocins and antimicrobial peptides are proteinaceous
compounds lethal to bacteria other than the producing strain, and several of those has been
shown to inhibit the growth of many pathogenic bacteria (Hancock and Rozek, 2002;
Joerger, 2003). Attachment of commensal bacteria to the brush border of intestinal epithelial
cells can prevent attachment and translocation of pathogens (Roberfroid et al., 1995; Falk et
al., 1998). Furthermore, increased colonization of lactic acid bacteria can enhance
immunocompetence of the animals, thus strengthening the host’s defense mechanisms
against disease-causing pathogens (Lan, 2004). Lactic acid bacteria are Gram-positive with
cell wall components (e.g. peptidoglycans, polysaccharide and teichoic acid) that have
immunostimulatory properties (Takahashi et al., 1993). Peptidoglycan and muramyl
dipeptide (MDP), which makes up 30-70% of the lactic acid bacteria cell wall (Rook, 1989),
can be released by lysozyme (Peeters and Vantrappen, 1975). Peptidoglycan has adjuvant
effects on the immune response (Stewart-Tull, 1980), especially on the intestinal mucosal
surface (Link-Amster et al., 1994). Binding sites for peptidoglycans were identified on
lymphocytes and macrophages (Dziarski, 1991). 208
Competitive exclusion may also be dependent upon microbial end-products of
fermentation. The major products of fermentation of dietary fiber are short chain fatty acids
(SCFA), predominantly acetate, propionate, butyrate, lactate and succinate, as well as water, various gases (CO2, H2, CH4), and bacterial biomass (Sakata and Inagaki, 2001). SCFA have
a direct antimicrobial property. Van der Wielen et al. (2000) demonstrated that high
fermentation activity in chicken ceca was correlated with a lower pH and this may inhibit
some pathogenic bacteria by dissipating the proton motive force across the bacterial cell
membrane (Russell, 1992). The antibacterial activity of organic acids increases as pH decreases because pH affects the ability of organic acids to dissociate. Organic acids are lipid
soluble in the undissociated form, and they easily enter the microbial cell by both passive and
carrier-mediated transport mechanisms. Once in the cell, the organic acid releases the proton
H+ in the more alkaline environment, resulting in a decrease of intracellular pH. This
influences microbial metabolism, inhibiting the action of important microbial enzymes and
forces the bacterial cell to use energy to export the excess of protons H+, ultimately resulting
death by starvation. In the same matter, the protons H+ can denature bacterial acid sensitive
proteins and DNA.
Generally lactic acid bacteria are able to grow at relatively low pH, which means that
they are more resistant to organic acids than other bacterial species, such as E. coli and
Salmonella. Lactic acid bacteria, like other Gram-positive bacteria, have a high intracellular
potassium concentration, which counteracts acid anions (Russell & Diez-Gonzalez, 1998).
Thus, an increase of microbial fermentation in the GIT of animals that consume dietary fiber would decrease the pH of the medium and exert bactericidal properties. This is why cecal pH 209 was measured to estimate the degree of microbial fermentation. However, a correlation between pH and Salmonella population was not significant (r= +0.5, P=0.4, Table 8), most likely because wheat with enzyme treatment had higher pH, but lower Salmonella population than triticale-control treatment. Presumably, competitive exclusion against Salmonella colonization is not only dependent upon SCFA-producing bacteria, but also on other factors as discussed in this paper.
Birds fed high NSP-diets with dietary enzyme supplementation had significant lower
Salmonella populations. The endoxylanase may have enhanced the competitive exclusion against the colonization of Salmonella. Possibly the enzyme supplementation increased the spectrum of fermentable substrates NSP and thereby enhanced microfloral diversity which symbiotically helped maintain a more stable intestinal ecosystem. Commensal gut microflora diversity is important to the overall GIT environment because the symbiotic interactions of the microflora and host are to the benefit of all. These symbiotic relationships within an enteric niche can facilitate or impede the colonization of a particular organism (Hentschel et al., 2000). Ferket (1991) hypothesized that the stability of the overall microbial population and its ability to cope with minor changes in the intestinal environment increases as the number of species of microorganisms increases. This hypothesis was tested in our laboratory and the results showed that dietary treatments yielding greater richness (number of different bacterial species), diversity (proportional abundances of species in a community) and evenness (the distribution of individual species in the ecosystem) had lower Salmonella prevalence (Chapter 5). Similarly, Bartelt et al. (2002) measured the prececal digestibility of arabinoxylans in piglets and reported considerable digestibility of insoluble arabinoxylans, 210
but not the entire soluble fiber fraction. However, when a xylanase was added to the diet, digestibility of all fractions was significantly increased. The authors suggested that this improved digestibility of NSP might be a direct effect of the exogenous enzyme, but also of a stimulated degradation by supporting a specialized group of NSP-hydrolyzing bacteria.
Therefore, the competitive exclusion against Salmonella colonization was enhanced by increasing the number and type of microorganism in the lumen of the GIT which was possible through high dietary NSP diets, especially when supplemented with dietary exogenous enzyme.
Turkeys fed the wheat- and triticale-basal diets were afflicted less by Salmonella infection than those fed the corn-based diet. The Salmonella enterica population was 20%
higher in toms fed corn-soy diets than in the other treatments by 14 days, but by 28 days
Salmonella enterica population was 60% higher in corn-fed birds than among the other
treatment groups. In contrast to the corn-fed controls, Salmonella enterica population among
the wheat- and triticale-fed birds decreased over time, indicating they were more able to
recover from Salmonella infection. Although all treatments had similar Salmonella enterica
population at 7 days, Salmonella increased 20% from 7 to 14 days in corn-fed birds, but increased only 8% in the other treatments. Evidently, the NSP in wheat- and triticale-based diets discouraged Salmonella enterica colonization. Similarly, previous research completed in our laboratory demonstrated that birds fed corn-soy diets had significantly (p<0.05) higher
Salmonella spp. population, 12.2% heavier pancreas, and poorer growth performance than toms fed wheat-based diets (Chapter 3). Pancreatic hyperplasia and increased secretion of pancreatic amylase have been correlated with limited nutrient absorption as the GIT adapt to 211 meet energy requirements (Routman et al., 2003) due to damage of the GIT by bacterial infection. Tositti et al. (2001) evaluated the incidence and the clinical significance of hyperamylasemia in 507 adult patients with acute gastroenteritis. They reported that
Salmonella spp. was the microorganism most frequently associated with patients with hyperamylasemia. They also reported that hyperamylasemia was directly correlated with the severity of the disease. In this current experiment, possibly the birds fed corn-soy diets had more severe Salmonella infection than birds fed wheat-based diets. Similarly, Montagne et al. (2003) stated that moderate levels of dietary fiber in diets of non-ruminant animals seem to be beneficial the intestinal health.
The inferior growth performance observed among birds fed the corn-based diets may be attributed to the degree of Salmonella infection and their low ability to recover from the intestinal gastroenteritis caused by Salmonella. Body weights of these birds were negatively correlated with Salmonella enterica population at 21 and 28 days. Salmonella infection can damage the bird intestinal tract and reduces feed efficiency and weight gain (Porter, 1998) because it limits the absorption of nutrients (MacRae, 1993). Additionally, enteric bacterial infection activates physiological stress response systems of the body (Dhabhar and McEwen,
1996) as an adaptive mechanism to maintain the internal equilibrium of the body that is essential to life (Dhabhar and McEwen, 1996). These responses can partition metabolizable energy toward protection and support of the animal body function instead of animal growth
(Olsen et al., 2005). Therefore, the inferior growth performance observed among the toms fed corn-based diets in comparison to those fed the wheat-based diets may be attributed to 212
the degree of Salmonella infection and compromised nutrient absorption, as well as a
possible shift of energy towards a stimulated immune response in Salmonella-infected toms.
The effect of enzyme and grain type on relative intestinal weight was age-dependent.
Relative intestinal weight and length were not significantly affected by grain type or enzyme
supplementation at 28 days of age. Intestinal adaptation is complex and it involves different
mechanisms at different sites (Bristol and Williamson, 1988), including biochemical and
metabolic pathway activity with gene expression (Rubin et al., 1996). Up-regulation of genes
and activation of molecular pathways require time, and a response may only be observed
among older animals. Previous research in our laboratory (Chapter 2) observed a significant
dietary treatment effect on the relative intestinal weight of toms at 56 days of age, but
another experiment (Chapter 3) did not show a significant dietary treatment effect at 112
days. This age-dependent response to dietary treatment may occur by a gradual intestinal adaptation to the diet as the birds grew older. Salih et al. (1991) showed that negative effects
of diets containing high levels of barley decreased as broilers grew older. Similarly, Brenes
(1992) explained that young birds are more sensitive to the negative effects of antinutritional
factors in cereals and other raw materials than older birds because their digestive tract is less
mature.
The diet and the products of microbial fermentation have a great impact on intestinal
structure and function and consequently intestinal health. Non-starch polysaccharides,
especially insoluble NSP, increase intestinal peristalsis and decrease retention time (Preston
et al., 2001). In contrast, soluble NSP increase digesta viscosity, which prolongs intestinal
emptying and causes additional peristalsis (Knudsen, 2001). Thus, enlargement in the 213
intestinal tunica muscularis has been observed following dietary fiber supplementation. In
this study, there was a positive correlation between soluble dietary fiber and digesta viscosity
with intestinal muscularis depth. Similarly, Stark et al. (1995) observed increased intestinal
tunica muscularis volume following dietary fiber feeding in rats.
Viscous NSP has been shown to enlarge the GIT by increase intestinal mucosal cell proliferation rate (Johnson and Gee, 1986; Brunsgaard et al., 1995; Lan, 2004). Short-chain fatty acid concentration of digesta has been shown to be a critical mediator of this increased intestinal mucosal cell proliferation rate (Lan, 2004). In agreement, the results of this current experiment showed an increased crypt depth (an indicator of increase epithelial cell proliferation, Pluske et al., 1997) as dietary fiber content increased, especially when the diets were supplemented with endoxylanase. The lowest crypt depth measurements were among the birds fed the corn-based diets, while those fed the enzyme-supplemented triticale diet had the greatest crypt depth. Also there were a negative correlation between pH (an indicator of increased SCFA) and soluble dietary fiber with villus height/crypt depth ratio (an indicator of increase epithelial cell proliferation, Pluske et al., 1997). Increased intestinal epithelial cell proliferation may increase the metabolic costs to maintain GIT, which may compromise growth performance (Hersom et al., 2004). However, no significant correlation was found between intestinal histological measurements and body weight.
In conclusion, NSP and dietary exogenous enzyme supplementation can have a significant effect on Salmonella colonization and intestinal health of turkeys. This study demonstrated that inclusion of high dietary NSP content, especially when the diets were supplemented with exogenous endoxylanase, discouraged Salmonella enterica colonization 214
of turkey intestine. Non-starch polysaccharides from wheat and triticale provide fermentation
substrate to commensal microorganisms that competitively exclude Salmonella, and
endoxylanase supplementation increased the spectrum of oligosaccharides available to
different microbial niches, which resulted in a more diverse and stable cecal microflora.
ACKNOWLEDGMENTS
This work was supported by Danisco Animal Nutrition20, the North Carolina
Agricultural Foundation, and the United States Department of Agriculture. The authors wish
to thank Annette Israel, Jamie Warner, Jean de Oliveira, Yuwares Sungwarapon, Ondulla
Foye, Renee Plunske, Mike Mann, Robert Neely, Pam Jenkins and the North Carolina State
University Poultry Educational Unit farm employees, Raleigh, NC, for their technical assistance during this trial. Appreciation is also extended to Dr. Paul Mozdziak from Poultry
Science Department, NCSU, Raleigh, NC for support with the microscopic evaluation.
20Danisco Animal Nutrition, Wiltshire, UK. 215
4.6 TABLES AND FIGURES
TABLE 1: Composition and nutrient content of the experimental diets fed to turkey toms from 1 to 28 days of age
Ingredients Corn/SBM Wheat/SBM Triticale/SBM
(%) Corn 35.82 0.00 0.00 Wheat 0.00 34.67 0.00 Triticale 0.00 0.00 36.67 Soybean meal (48% CP) 50.96 44.33 47.18 Poultry meal (60%CP) 3.40 5.00 5.00 Wheat middlings 0.00 5.00 0.00 Gluten meal 4.00 4.00 4.00 Soybean oil 0.00 1.18 1.34 Limestone 1.69 1.67 1.66 Dicalcium Phosphate (18.5% 3.00 3.00 3.00 Salt 0.40 0.40 0.40 Vitamin premix1 0.20 0.20 0.20 Mineral premix2 0.20 0.20 0.20 DL-Methionine 0.03 0.05 0.05 L-Lysine HCL 0.20 0.20 0.20 Selenium premix3 0.10 0.10 0.10
Calculated analysis ME, kcal/kg 2.720 2.727 2.724 Crude protein, % 30.000 30.489 30.287 Calcium, % 1.528 1.568 1.565 Non-phytate phosphorus, % 0.764 0.784 0.783 Sodium, % 0.196 0.212 0.208 Lysine, % 1.885 1.788 1.837 Methionine + Cysteine, % 1.1 1.1 1.1
Chemical analysis (dry matter basis) 4 Dry Matter, % 91.5 91.1 91.1 Crude Protein, % 30.20 31.95 32.20 Gross Energy, kcal/kg 4131.0 4157.0 4127.0 Fat (Ether extraction), % 2.06 3.00 2.54 Ash, % 10.60 10.70 11.40 Fiber Total, % 14.82 17.77 16.80 Insoluble, % 14.20 17.11 14.77 Soluble, % 0.62 0.66 2.03 1Supplied the following per kilogram of feed: vitamin A, 26,400 IU; cholecalciferol, 8,000 IU; niacin, 220 mg; pantothenic acid, 44 mg; riboflavin, 26.4 mg; pyridoxine, 15.8 mg; menadione, 8 mg; folic acid, 4.4 mg; thiamin, 8 mg; biotin, 0.506 mg; vitamin B12, 0.08 mg; ethoxyquin, 200 mg. The vitamin E premix provided the necessary amount of vitamin E as DL-α-tocopheryl acetate. 2 . . Supplied the following per kilogram of feed: 120 mg Zn as ZnSO4 H2O; 120 mg MN as MnSO4 H2O; 80 mg Fe . as FeSO4 H2O; 10 mg Cu as CuSO4; 2.5 mg I as Ca(IO3)2; 1.0 mg Co as CoSO4. 3Selenium premix provided 0.3 ppm Se from sodium selenate. 4Chemical analysis: (1) Crude protein used Kjeldahl automatic analyzer (Kjeltec Auto 1030 Analyser, Tecator, Sweden), (2) Gross Energy used Bomb Calorimeter (IKA Calorimeter System C5000 control, IKA® Werke Labortechnik, Staufen, Germany), (3) Fat used Ether Extract method, and (4) Ash used Muffle Oven method. Dietary Fiber analyses were performed using the Megazyme Total Dietary Fiber Assay Kit (Megazyme International Ireland Ltd., Co. Wicklow, Ireland).
216
TABLE 2: Effect of diet formulation and enzyme supplementation on body weight of turkey toms fed corn, wheat, or triticale-based diets from 1 to 28 days of age
Treatment 7 d 14 d 21d 28 d
(g) Corn1 110.71b 273.64b 547.40 820.64 Wheat2 121.72a 301.89a 563.38 844.87 Wheat + Enzyme3 119.56a 301.55a 572.33 884.18 Triticale4 118.37a 297.31a 559.21 850.39 Triticale + Enzyme5 121.22a 298.98a 567.98 886.90 SEM(37)6 2.736 5.876 13.99 33.39 P-value 0.0477 0.0074 0.7591 0.5917 (P-Value) Source of variation among treatments Corn vs Others7 0.0036 0.0003 0.2485 0.2259 Corn vs Wheat8 0.0053 0.0004 0.2407 0.2908 Corn vs Triticale9 0.0099 0.0016 0.3497 0.2471 Corn vs Enzyme10 0.0063 0.0007 0.1914 0.1204
11 (P-Value) Factorial analysis among small grains Small grain type 0.7597 0.5475 0.7627 0.9026 Enzyme 0.9008 0.9103 0.5310 0.2642 Grain X enzyme 0.3656 0.8647 0.9951 0.9669 a,bMeans with different superscripts within a column differ significantly (P < 0.05). There were no significant differences in poults starting weights at 1 d of age (60g). 1Unsupplemented corn/SBM-basal diet. 2Unsupplemented wheat/SBM-basal diet. 31.1 kg of Avyzyme® 1302/tonne of wheat/SBM-basal diet that provided at least 5,500 EXU/kg feed. 4Unsupplemented triticale/SBM-basal diet. 51.1 kg of Avyzyme® 1302/tonne of triticale/SBM-basal diet that provided at least 5,500 EXU/kg feed. 6SEM(37)= Standard Error of the mean with 37 degrees of freedom. 7-10Contrast analysis of corn-control treatments versus (7) all other treatments, (8) wheat with and without enzyme supplementation treatment, (9) triticale with and without enzyme supplementation treatment, (10) enzyme supplementation wheat- and triticale-based dietary treatment. 11Factorial analysis of 2 types of grains (wheat and triticale) and 2 enzyme supplementation levels (with or without enzyme supplementation).
217
TABLE 3: Effect of diet formulation and enzyme supplementation on periodic feed consumption of turkey toms fed corn, wheat, or triticale-based diets from 1 to 28 days of age
Treatment 1 to 7 d 7 to 14 d 14 to 21 d 21 to 28 d 1 to 28 d
(g) Corn1 71.28 195.36 364.07 549.18 1179.88 Wheat2 73.38 216.92 376.47 577.30 1244.07 Wheat + Enzyme3 77.66 215.39 375.38 571.02 1239.44 Triticale4 72.32 208.04 358.16 553.98 1192.50 Triticale + Enzyme5 74.31 208.99 371.62 558.43 1213.36 SEM(37)6 2.022 5.360 11.49 23.04 34.73 P-value 0.2337 0.0574 0.7623 0.9009 0.6257 (P-Value) Source of variation among treatments Corn vs Others7 0.1726 0.0074 0.6244 0.5378 0.2809 Corn vs Wheat8 0.0952 0.0031 0.4055 0.3822 0.1547 Corn vs Triticale9 0.4150 0.0520 0.9536 0.8042 0.5904 Corn vs Enzyme10 0.0645 0.0144 0.5061 0.5841 0.2802 11 (P-Value) Factorial analysis among small grains Small grain type 0.2825 0.1632 0.3439 0.4414 0.2714 Enzyme 0.1299 0.9574 0.5942 0.9685 0.8167 Grain X enzyme 0.5734 0.8182 0.5310 0.8173 0.7162 1Unsupplemented corn/SBM-basal diet. 2Unsupplemented wheat/SBM-basal diet. 31.1 kg of Avyzyme® 1302/tonne of wheat/SBM-basal diet that provided at least 5,500 EXU/kg feed. 4Unsupplemented triticale/SBM-basal diet. 51.1 kg of Avyzyme® 1302/tonne of triticale/SBM-basal diet provided at least 5,500 EXU/kg feed. 6SEM(37)= Standard Error of the mean with 37 degrees of freedom. 7-10Contrast analysis of corn-control treatments versus (7) all other treatments, (8) wheat with and without enzyme supplementation treatment, (9) triticale with and without enzyme supplementation treatment, (10) enzyme supplementation wheat- and triticale-based dietary treatment. 11Factorial analysis of 2 types of grains (wheat and triticale) and 2 enzyme supplementation levels (with or without enzyme supplementation).
218
TABLE 4: Effect of diet formulation and enzyme supplementation on cumulative feed conversion ratio (feed:gain) of turkey toms fed corn, wheat, or triticale-based diets from 1 to 28 days of age
Treatment 1 to 7 d 1 to 14 d 1 to 21 d 1 to 28 d
(g/g) Corn1 1.690a 1.404a 1.425 1.560 Wheat2 1.430b 1.312b 1.398 1.537 Wheat + Enzyme3 1.428b 1.311b 1.388 1.532 Triticale4 1.426b 1.299b 1.355 1.471 Triticale + Enzyme5 1.332b 1.274b 1.361 1.475 SEM(37)6 0.072 0.023 0.024 0.024 P-value 0.0177 0.0059 0.2590 0.1404 (P-Value) Source of variation among treatments Corn vs Others7 0.0012 0.0003 0.0741 0.3329 Corn vs Wheat8 0.0059 0.0031 0.2808 0.8917 Corn vs Triticale9 0.0013 0.0003 0.0297 0.0612 Corn vs Enzyme10 0.0013 0.0005 0.0944 0.3681
11 (P-Value) Factorial analysis among small grains Small grain type 0.5001 0.3052 0.1639 0.0160 Enzyme 0.5140 0.5918 0.9288 0.9721 Grain X enzyme 0.5353 0.6361 0.7455 0.8565 a,bMeans with different superscripts within a column differ significantly (P < 0.05). 1Unsupplemented corn/SBM-basal diet. 2Unsupplemented wheat/SBM-basal diet. 31.1 kg of Avyzyme® 1302/tonne of wheat/SBM-basal diet that provided at least 5,500 EXU/kg feed. 4Unsupplemented triticale/SBM-basal diet. 51.1 kg of Avyzyme® 1302/tonne of triticale/SBM-basal diet provided at least 5,500 EXU/kg feed. 6SEM(37)= Standard Error of the mean with 37 degrees of freedom. 7-10Contrast analysis of corn-control treatments versus (7) all other treatments, (8) wheat with and without enzyme supplementation treatment, (9) triticale with and without enzyme supplementation treatment, (10) enzyme supplementation wheat- and triticale-based dietary treatment. 11Factorial analysis of 2 types of grains (wheat and triticale) and 2 enzyme supplementation levels (with or without enzyme supplementation).
219
TABLE 5: Effect of diet formulation and enzyme supplementation on pH of ceca content and ileum digesta viscosity of 28 days-old turkey toms fed corn, wheat, or triticale-based diets
Treatment Cecal pH Ileum Viscosity
(cP) Corn1 6.44 0.476c Wheat2 6.42 0.951b Wheat + Enzyme3 6.37 0.580c Triticale4 6.12 1.258a Triticale + Enzyme5 6.09 0.926b SEM(37)6 0.12 0.0923 P-value 0.1301 < 0.0001 (P-Value) Source of variation among treatments Corn vs Others7 0.1834 0.0001 Corn vs Wheat8 0.7910 0.0128 Corn vs Triticale9 0.3333 < 0.0001 Corn vs Enzyme10 0.1755 0.0187
11 (P-Value) Factorial analysis among small grains Small grain type 0.0230 0.0007 Enzyme 0.7305 0.0003 Grain X enzyme 0.9238 0.8224 a-cMeans with different superscripts within a column differ significantly (P < 0.05). 1Unsupplemented corn/SBM-basal diet. 2Unsupplemented wheat/SBM-basal diet. 31.1 kg of Avyzyme® 1302/tonne of wheat/SBM-basal diet that provided at least 5,500 EXU/kg feed. 4Unsupplemented triticale/SBM-basal diet. 51.1 kg of Avyzyme® 1302/tonne of triticale/SBM-basal diet provided at least 5,500 EXU/kg feed. 6SEM(37)= Standard Error of the mean with 37 degrees of freedom. 7-10Contrast analysis of corn-control treatments versus (7) all other treatments, (8) wheat with and without enzyme supplementation treatment, (9) triticale with and without enzyme supplementation treatment, (10) enzyme supplementation wheat- and triticale-based dietary treatment. 11Factorial analysis of 2 types of grains (wheat and triticale) and 2 enzyme supplementation levels (with or without enzyme supplementation).
220
TABLE 6: Effect of diet formulation and enzyme supplementation on relative intestinal weight (RIW)12 and length (RIL)13 of 28 days-old turkey toms fed corn, wheat, or triticale-based diets
RIW RIL Treatment Duodenum Jejunum Ileum Ceca Duodenum Jejunum Ileum
(g/kg) (cm/kg) Corn1 11.2 22.0 19.9 15.4 27.2 57.5 61.8 Wheat2 11.0 23.5 18.0 14.1 25.5 52.0 57.7 Wheat + Enzyme3 11.0 23.1 21.1 16.3 23.7 52.4 56.4 Triticale4 10.7 24.9 22.3 13.1 24.4 55.9 59.4 Triticale + Enzyme5 11.0 21.8 19.3 15.5 27.2 58.6 62.3 SEM(37)6 0.53 1.57 1.34 1.14 1.47 3.31 3.17 P-value 0.9869 0.6469 0.2143 0.3245 0.3214 0.4999 0.6021 (P-Value) Source of variation among treatments Corn vs Others7 0.6731 0.4620 0.8450 0.6073 0.2393 0.4548 0.4130 Corn vs Wheat8 0.7767 0.5012 0.8492 0.8854 0.1559 0.1922 0.2152 Corn vs Triticale9 0.6265 0.5025 0.5843 0.4277 0.4581 0.9497 0.7941 Corn vs Enzyme10 0.7685 0.8243 0.8438 0.7382 0.3524 0.6242 0.5201
11 (P-Value) Factorial analysis among small grains Small grain type 0.8046 0.9959 0.3697 0.4280 0.3915 0.1221 0.2203 Enzyme 0.8232 0.2731 0.9642 0.0553 0.7048 0.6231 0.7883 Grain X enzyme 0.8392 0.3996 0.0278 0.9451 0.1181 0.7248 0.4939 a,bMeans with different superscripts within a column differ significantly (P < 0.05). 1Unsupplemented corn/SBM-basal diet. 2Unsupplemented wheat/SBM-basal diet. 31.1 kg of Avyzyme® 1302/tonne of wheat/SBM-basal diet that provided at least 5,500 EXU/kg feed. 4Unsupplemented triticale/SBM-basal diet. 51.1 kg of Avyzyme® 1302/tonne of triticale/SBM-basal diet provided at least 5,500 EXU/kg feed. 6SEM(37)= Standard Error of the mean with 37 degrees of freedom. 7-10Contrast analysis of corn-control treatments versus (7) all other treatments, (8) wheat with and without enzyme supplementation treatment, (9) triticale with and without enzyme supplementation treatment, (10) enzyme supplementation wheat- and triticale-based dietary treatment. 11Factorial analysis of 2 types of grains (wheat and triticale) and 2 enzyme supplementation levels (with or without enzyme supplementation). 12Relative intestinal weight = Bird intestinal segment weight/Bird body weight. 13Relative intestinal length = Bird intestinal segment length/Bird body weight.
221
TABLE 7: Effect of diet formulation and enzyme supplementation on histological measurements12 of ileum of 28 days-old turkey toms fed corn, wheat, or triticale-based diets
Villus Crypt Villus:Crypt Mucosal Muscularis
Height Area Depth Ratio Depth Height Treatment (µm) (µm 2) (µm) (µm/µm) (g)
Corn1 684 94,168 123b 5.6ab 807 176c Wheat2 753 108,423 127b 5.9a 880 198bc Wheat + Enzyme3 748 107,114 132b 5.7ab 879 191c Triticale4 632 85,809 135b 4.7c 766 250a Triticale + Enzyme5 731 99,658 150a 4.9bc 881 238ab SEM(29)6 41.57 8,208 4.45 0.28 44.03 16.26 P-value 0.2198 0.2884 0.0027 0.0146 0.2370 0.0135 (P-Value) Source of variation among treatments Corn vs Others7 0.4931 0.5117 0.0145 0.3551 0.3661 0.0263 Corn vs Wheat8 0.2004 0.1856 0.2308 0.5349 0.1841 0.3794 Corn vs Triticale9 0.9661 0.8873 0.0014 0.0262 0.7546 0.0021 Corn vs Enzyme10 0.2817 0.3657 0.0028 0.3639 0.1826 0.0678
11 (P-Value) Factorial analysis among small grains Small grain type 0.1083 0.0767 0.0087 0.0011 0.2107 0.0049 Enzyme 0.2657 0.4501 0.0374 0.8752 0.2066 0.5603 Grain X enzyme 0.2159 0.3624 0.2439 0.3990 0.1990 0.8994 a-cMeans with different superscripts within a column differ significantly (P< 0.05). 1Unsupplemented corn/SBM-basal diet. 2Unsupplemented wheat/SBM-basal diet. 31.1 kg of Avyzyme® 1302/tonne of wheat/SBM-basal diet that provided at least 5,500 EXU/kg feed. 4Unsupplemented triticale/SBM-basal diet. 51.1 kg of Avyzyme® 1302/tonne of triticale/SBM-basal diet provided at least 5,500 EXU/kg feed. 6SEM(29)= Standard Error of the mean with 29 degrees of freedom. 7-10Contrast analysis of corn-control treatments versus (7) all other treatments, (8) wheat with and without enzyme supplementation treatment, (9) triticale with and without enzyme supplementation treatment, (10) enzyme supplementation wheat- and triticale-based dietary treatment. 11Factorial analysis of 2 types of grains (wheat and triticale) and 2 enzyme supplementation levels (with or without enzyme supplementation). 12Histological measurements: Villus height = Measured from the villus tip to the villus base, not including the intestinal crypt; Villus apical width = Measurement of the width of the villus tip; Villus basal width = Measurement of the width of the villus base; Villus surface area =[ (villus apical width + villus basal width) / 2] * villus height; Crypt depth = Measured from the villus base to the muscularis, not including intestinal musculares; Villus:crypt ratio = Villus height divided by crypt depth; Mucosal depth = Villus height + crypt depth; Muscularis depth = Measured from the crypt to serosa layer, not including intestinal serosa.
222
TABLE 8: Pearson correlation coefficients (r) of body weight (BW), dietary fiber (DF), cecal pH, cecal Salmonella population, ileum digesta viscosity and ileum histological measurements1 of turkey toms at 28 days and BW with Salmonella population at 21 days subjected to different diet formulations
Correlation variable Correlation coefficient (r) P-Value pH vs Salmonella (log/g) +0.5 0.415 BW vs Salmonella (log/g) at 21 d -0.9 0.035 BW vs Salmonella (log/g) at 28 d -0.9 0.028 Soluble DF vs pH -0.9 0.001 Muscularis Depth vs Soluble DF +0.9 0.008 Muscularis Depth vs Viscosity +0.9 0.037 Villus Height/Crypt Depth ratio vs Soluble DF -0.9 0.011 Villus Height/Crypt Depth ratio vs pH -0.9 0.008 1Histological measurements: Villus:crypt ratio = Villus height (from villus tip to villus base) divided by crypt depth (from villus base to muscularis); Muscularis depth = Measured from the crypt to serosa layer, not including intestinal serosa.
223
8 Corn a 7.7 Wheat 7.5 Wheat + Enzyme Triticale ab 7 6.9 Triticale + Enzyme a ab a 6.7 6.5 6.8 6.3 6b 6 b 5.9 6 5.7ab population (Log/g) population 5.5 5.5abc 5 4.7bc 4.7b 4.5 4.5b 4.2c 4 b
Salmonella enterica enterica Salmonella 3.9 b 3.5 3.6
3 7142128 Age (Days)
FIGURE 1: Effect of diet formulation and enzyme supplementation on Salmonella spp. population of cecal content of turkey toms fed corn, wheat, or triticale-based diets from 1 to 28 days of age. Different letters on each line-point within each day, signify a significant (P<0.05) difference between mean values of Salmonella enterica (log/g sample). Mean values represent a mean of 9 cages per treatment analyzed for Salmonella enterica population. In each cage, cecal content from 2 birds per cage were collected and analyzed as a pooled cage sample. The treatments were: Unsupplemented corn/SBM-basal diet (Corn); unsupplemented wheat/SBM- basal diet (Wheat); 1.1 kg of Avyzyme® 1302/tonne of wheat/SBM-basal diet that provided at least 5,500 EXU/kg feed (Wheat + enzyme); unsupplemented triticale/SBM-basal diet (Triticale); 1.1 kg of Avyzyme® 1302/tonne of triticale/SBM-basal diet provided at least 5,500 EXU/kg feed (Triticale + enzyme). Enzyme was provided by Danisco Animal nutrition (Wiltshire, UK).
224
4.7 REFERENCES
Andrews, W.H., R.S. Flowers, J. Silliker, and J.S. Bailey, 2001. Salmonella. In: Downes, F., Ito, K. (Eds.), Microbiological Examination of Foods. 4th rev. ed. American Public Health Association, Washington, DC. pp: 357-380. Andrews, W.H., and T.S. Hammack. 2003. Salmonella. Bacteriological Analytical Manual Online, Chapter 5. [Internet, WWW], ADDRESS: http://cfsan.fda.gov/ ~ebam?bam- 5.html. HYPERTEXT SOURCE: Bacteriological Analytical Manual, 8th Edition, Revision A, Chapter 5, 1998. Annison, G., 1993. Corrigendum – The role of wheat non-starch polysaccharides in broiler nutrition. Aust. J. Agric. Res. 44(3):405-422. Apajalahti, J., and M.R. Bedford, 1999. Improve bird performance by feeding its microflora. Word’s Poult. Sci. 15:20-23. Bailey, J.S., L.C. Blankenship, and N.A. Cox, 1991. Effect of fructooligosaccharide on Salmonella colonization of the chicken intestine. Poult. Sci. 70:2433-2438. Bartelt, J., A. Jadamus, F. Wiese, E. Swiech, L. Buraczewska, and O. Simon, 2002. Apparent precaecal digestibility of nutrients and level of endogenous nitrogen in digesta of the small intestine of growing pigs as affected by various digesta viscosities. Arch. Anim. Nutr. 56:93-107. Beli, E., A. Telo, and E. Duraku. 2001. Salmonella serotypes isolated from turkey meat in Albania. International Journal of Food Microbiology 63:165-167. Brenes, A., 1992. Influencia de la adicion de enzimas sobre el valor nutritivo de las raciones en la alimentacion aviar. Pages: 139-148. In: Proceedings, XXIX Symposium de la Seccion Espanola de la World’s Poultry Science Association, Salamanca, Spain (in Spanish). Brenes, A., R.R. Marquardt, W. Guenter, and A. Viveiros, 2002. Effect of enzyme addition on the performance and gastrointestinal tract size of chicks fed lupin seed and their fractions. Poult. Sci. 81:670-678. Bristol, J.B., and R.C.N. Williamson, 1988. Mechanisms of intestinal adaptation. Pediatr. Surg. Int. 3(4):233-241. Brunsgaard, G., K.E.B. Knudsen, and B.O. Eggum, 1995. The influence of period of adaptation on the digestibility of diets containing different types of indigestible polysaccharides in rats. Br. J. Nutr. 74:833-848. Choct, M., and G. Annison, 1992. Anti-nutritive effect of wheat pentosans in broiler: roles of viscosity and gut microflora. Br. Poult. Sci. 33:821-834. Choi, K.H., H. Namkung, I.K. Paik, 1994. Effects of dietary fructooligosaccharides on the suppression of intestinal colonization of Salmonella typhimurium in broiler chickens. Kor. J. Anim. Sci. 36:271-284. 225
Cox, N.A., N.J. Stern, S.E. Craven, M.E. Berrang, and M.T. Musgrove, 2000. Prevalence of Campylobacter and Salmonella in the cecal droppings of turkeys during production. J. Appl. Poultry Res. 9:542-545. Cummings, J.H., and H.N. Englyst, 1992. Complex carbohydrates. Pages 125-138. In: The contribution of nutrition to human and animal heath. E.M. Widdowson, and J. C. Mathers, ed. Cambridge University Press, Cambridge; New York. Danisco, 2003. Technical information from Danisco Animal Nutrition. Witshire, UK. Personal communication. Dhabhar, F.S., and B.S. McEwen, 1996. Stress-induced enhancement of antigen-specific cell- mediated immunity. J. Immunol. 156:2608-2615. Dziarski, R., 1991. Demostration of petidoglycan-binding sites on lymphocytes and macrophages by photoaffinity cross-linking. J. Biol. Chem. 266:4713-4718. Falk, P.G., L.V. Hooper, T. Midtvedt, and J.I. Gordon, 1998. Creating and maintaining the gastrointestinal ecosystem: what we know and need to know from gnotobiology. Microbiol. Mol. Biol. Rev. 62:1157-1170. Ferket, P.R., 1991. Effect of diet on gut microflora of poultry. Zootecnica International. July/August: 44-49. Fernandez, F., F. Sharma, M.H. Hinton, and M.R. Bedford, 2000. Diet influences the colonization of Campylobacter jejuni and distribution of mucin carbohydrates in chick intestinal tract. Cell. Mol. Life Sci. 57:1793-1801. Flores, M.P., J.I.R. Castanon, J.M. McNab, 1994. Effects of enzyme supplementation of wheat and triticale based diets for broilers. Anim. Feed Sci. Technol. 49:237-243. Fuller, R., 1977. The importance of lactobacilli in maintaining normal microbial balance in the crop. Br. Poult. Sci. 18:85-94. Hackett, R., and J.I. Burke, 2004. Potential for triticale in low cost production systems. In: Proceedings of the 2004 National Tillage Conference by Crops Research Centre, Oak Park, Carlow. January, 28. Hancock, R.E.W., and A. Rozek, 2002. Role of membranes in the activities of antimicrobial cationic peptides. FEMS Microbiol. Lectt. 206:143-149. Hentschel, U., Steinert M., and J. Hacker, 2000. Common molecular mechanisms of symbiosis and pathogenesis. Trends Microbiol. 8:226-231. Hersom, M.J., C.R. Krehbiel, and G.W. Horn, 2004. Effect of live weight gain of steers during winter grazing: II. Visceral organ mass, cellularity, and oxygen consumption. J. Anim. Sci. 82:184-197. Hetland, H., and B. Svihus, 2001. Effect of oat hulls on performance, gut capacity and feed passage time in broiler chickens. Br. Poult. Sci. 42:354-361. 226
Hogberg, A., 2003. Cereal non-starch polysaccharides in pig diets: influence on digestion site, gut environment and microbial populations. Ph.D. Thesis, Swedish University of Agricultural Science, Uppsala. Hogberg, A., J.E. Lindberg, 2004. Influence of cereal non-starch polysaccharides and enzyme supplementation on digestion site and gut environment in weaned piglets. Anim. Feed Sci. Technol. 116:113-128. Iji, P.A., A. A. Saki, and D. R. Tivey, 2001a. Intestinal development and body growth of broiler chicks on diets supplemented with non-starch polysaccharides. Anim. Feed Sci. Technol. 89:175-188. Iji, P.A., A.A. Saki, and D.R. Tivey, 2001b. Intestinal structure and function of broiler chickens on diets supplemented with a mannan oligosaccharide. J. Sci. Food Agric. 81:1186-1192. Ishihara, N., D.C. Chu, S. Akachi, and L.R. Juneja, 2000. Preventive effect of partially hydrolyzed guar gum on infection of Salmonella enteritidis in young and laying hens. Pout. Sci. 79:689-697. Ishizuka, S., and S. Tanaka, 2002. Modulation of CD8+ intraepithelial lymphocyte distribution by dietary fiber in the rat large intestine. Exp. Biol. Med. 227: 1017-1021. Ishizuka, S., S. Tanaka, H. Xu, and H. Hara. 2004. Fermentable dietary fiber potentiates the localization of immune cells in the rat large intestinal crypts. Exp. Biol. Med. 229:876- 884. Jenkins, P., 2005. Information on SAS analysis. Statistical Research Assistant, Poultry Science Department, North Carolina State University, Raleigh, NC. November, 2005. Personal communication. Joerger, R.D., 2003. Alternatives to antibiotics: bacteriocins, antimicrobial peptides and bacteriophages. Poult. Sci. 82:640-647. Johnson I.T., J.M. Gee, 1986. Gastrointestinal adaptation in response to soluble non-available polysaccharides in the rat. Br. J. Nutr. 55:497-505. Johnson, I.T., 1993. Soluble dietary fibre – A useful concept? Pages: 147-153. In: Plant Polymeric Carbohydrates. F. Meuser, D.J. Manners, and W. Seibel, eds., The Royal Scociety of Chemistry, Cambridge. Keefe, T.O., 2004. Road to pathogen – pre-harvest food safety. WATT Poultry USA. October, 2004: 26-34. Knudsen, K.E., 2001. The nutritional significance of “dietary fibre” analysis. Anim. Feed Sci. Technol. 90:3-20. Lan, Y., 2004. Gastrointestinal health benefits of soy water-soluble carbohydrates in young broiler chickens. Ph.D. Thesis, Wageningen University, The Netherlands, 269 pp. 227
Langhout, D.J., J.B. Schutte, J. de Jong, H. Sloetjes, M.W.A. Verstegen, and S. Tamminga, 2000. Effect of viscosity on digestion of nutrients in conventional and germ-free chicks. Br. J. Nutr. 83:533-540. Link-Amstr, H., F. Rochat, K.Y. Saudan, O. Mignot, and J.M. Aeschlimann, 1994. Modulation of a specific humoral immune response and changes in intestinal flora mediated through fermented milk intakes. FEMS Immunol. Med. Microbiol. 10:55-64. Lowry, V.K., M.B. Farnell, P.J. Ferro, C.L. Swaggerty, A. Bahl, and M.H. Kogut, 2005. Purified β-glucan as an abiotic feed additive up-regulates the innate immune response in immature chickens against Salmonella enterica serovar Enteritidis. Int. J. Food Microbiol. 98:309-318. MacRae, J.C., 1993. Metabolic consequences of intestinal parasitism. Proc. Nutr. Soc. 52:121-130. Medel, P., S. Salgado, J.C. Blas, and G.G. Mateos, 1999. Processed cereals in diets for early- weaned piglets. Anim. Feed Sci. Technol. 82:145-156. Midura, T.F., and R. Bryant, 2001. Sampling plans, sample collection, shipment, and preparation for analysis. In: Downes, F., Ito, K. (Eds.), Microbiological Examination of Foods. 4th rev. ed. American Public Health Association, Washington, DC. pp: 13-23. Montagne, L., J.R. Pluske, and D.J. Hampson. 2003. A review of interactions between dietary fibre and the intestinal mucosa, and their consequences on digestive helath in young non-ruminant animals. Anim. Feed Sci. Technol. 108:95-117. National Research Council (NRC), 1994. Nutrient Requirements of Poultry. 9th Rev. Ed. National Academy Press, Washington, DC. Naughton, P.J., L.L. Mikkelsen, and B.B. Jensen, 2001. Effects of nondigestible oligosaccharides on Salmonella enterica serovar Typhimurium and nonpathogenic Escherichia coli in the pig small intestine in vitro. Appl. Environ. Microbiol. 69(8):3391- 3395. Nousiainen, J., and J. Setala, 1998. Lactic acid bacteria as animal probiotics. Pages 437-473. In: Lactic Acid Bacteria: Microbiology and functional aspects. S. Salminen, and A. Wright, Marcel Dekker, NY. Olsen, R.E., K. Sundell, T.M. Mayhew, R. Myklebust, and E. Ringo, 2005. Acute stress alters intestinal function of rainbow trout, Oncorhynchus mykiss (Walbaum). Aquaculture 250:480-495. Oyofo, B.A., R.E. Droleskey, J.O. Norman, H.H. Hollenhauer, R.L. Ziprin, D.E. Corrier, and J.R. DeLoach, 1989. Inhibition by mannose of in vitro colonization of chicken small intestine by Salmonella typhimurium. Poult. Sci. 68:1351-1356. Peeters, T., and G. Vantrappen, 1975. The paneth cell: a source of intestinal lysozyme. Gut. 16:553-558. 228
Petterson, D., and P. Aman, 1988. Effects of enzyme supplementation of diets based on wheat, rye or triticaleon their productive value for broiler chickens. Anim. Feed Sci. Technol. 20:313-324. Pluske, J.R., D.J. Hampson, and I.H. Williams, 1997. Factors influencing the structure and function of the small intestine in the weaned pig – a review. Livestock Prod. Sci. 51:215- 236. Porter Jr., R.E., 1998. Bacterial enteritides of poultry. Poult. Sci. 77:1159-1165. Preston, C.M., K.J. McCracken, and M.R. Bedford, 2001. Effect of wheat content, fat source and enzyme supplementation on diet metabolisability and broiler performance. Br. Poult. Sci. 42:625-632. Remus, J., 2003. Control strategies for salmonella in swine discussed. Dec. 22, 2003: 14-16. Roberfroid, M.B., F. Bornet, C. Bouley, and J.H. Cummings, 1995. Colonic microflora: nutrition and health: summary and conclusions of an International Life Sciences Institute (ILSI). Workshop held in Barcelona, Spain. Nutr. Rev. 53:127-130. Rodrique, D.C., R.W. Tauxe, and B. Rowe, 1990. International increase in Salmonella enteritidis: a new pandemic? Epidemiol. Infect. 105:21-27. Rook, G., 1989. Immunity to bacteria. In: Immunology. I. Roitt, J. Brostoff, and D. Male, eds. Mosby, St. Louis, MO. Routman, K.S., L. Yoshida, A.C. Frizzas, M. Macari, and J.M. Pizauro Jr., 2003. Intestinal and pancreas enzyme activity of broilers exposed to thermal stress. Brazilian Journal of Poultry Science 5(1):23-27. Rubin, D.C., E.A. Swietlicki, J.L. Wang, B.D. Dodson, and M.S. Levin, 1996. Enterocytic gene expression in intestinal adaptation: evidence for a specific cellular response. Am. J. Physiol. 270(3):G143-G152. Russell, J.B., 1992. Another explanation for the toxicity of fermentation acids at low pH: anion accumulation versus uncoupling. J. Applied Bacteriology, 73:363-370. Russell, J.B., and F. Diez-Gonzales, 1998. The effects of fermentation acids on bacterial growth. Advances in Microbial Physiology 39:205-234. Sakata, T., and A. Inagaki. 2001. Organic acid production in the large intestine: implication for ephitelial cell proliferation and cell death. Pages: 85-94. In: The gut environment of pigs. Piva, A., K. E. Bach Knudsen, J. E. Lindberg, eds. Nottingham University Press, Nottingham. Salgado, P., J.P. Lalles, R. Toullec, M. Mourato, F. Cabral, and J.P.B. Freire, 2001. Nutrient digestibility of chickpea (Cicer arietinum L.) seeds and effects on the small intestine of weaned piglets. Anim. Feed Sci. Technol. 91:197-212.
229
Salgado, P., J.P.B. Freire , M. Mourato , F. Cabral , R. Toullec, and J.P. Lalles, 2002. Comparative effects of different legume protein sources in weaned piglets: nutrient digestibility, intestinal morphology and digestive enzymes. Livestock Prod. Sci. 74:191- 202. Salih, M. E., H.L. Classen, and G.L. Campbell, 1991. Response of chickens fed on hull-less barley to dietary β-glucanase at different ages. Anim. Feed Sci. Technol. 33:139-149. Samanya, M., and K. Yamauchi, 2002. Histological alterations of intestinal villi in chickens fed dried Bacillus subtilis var. natto. Comparative Biochemistry and Physiology Part A. 133:95-104. Santos, F.B.O., X. Li, J.B. Payne, and B.W. Sheldon, 2005. Estimation of most probable number Salmonella populations on commercial North Carolina turkey farms. J. App. Poult. Res. 14:700-708. SAS Institute Inc., 1996. SAS/STAT User’s Guide, Version 6, Fourth Edition, Vol. 2. SAS Proprietary Software Release 6.12. SAS Institute, Inc., Cary, NC. Savory, C.J., 1992. Enzyme supplementation, degradation and metabolism of three U-14C- labelled cell-wall substrates in the fowl. Br. J. Nutr. 67:91-102. Stark, A., A. Nyska, A. Zuckerman, and Z. Madar, 1995. Changes in intestinal tunica muscularis following dietary fiber feeding in rats. A morphometric study using image analysis. 40(5):960-966. Steenfeldt, S., M. Hammershoj, A. Mullertz, and F. Jensen, 1998. Enzyme supplementation of wheat-based diets for broilers. 2. Effect on apparent metabolisable energy content and nutrient digestibility. Anim. Feed Sci. Technol. 75:45-64. Stevens, C.E., and I.D. Hume, 1995. Microbial fermentation and synthesis of nutrients and the absorption of end products. Pages 188-228. In: Comparative Physiology of the Vertebrate Digestive System. C. E. Stevens, and I. D. Hume, eds. Cambridge University Press. Cambridge. Stewart-Tull, D.E.S., 1980. The immunological activities of bacterial peptidoglycans. Annu. Rev. Microbiol. 34:311-340. Svihus, B., 2001. Research note: a consistent low starch digestibility observed in pelleted broiler chicken diets containing high levels of different wheat varieties. Anim. Feed Sci. Technol. 92:45-49. Swanson, K.M.J., R.L. Petran, and J.H. Hanlin, 2001. Culture methods for enumeration of microorganisms. In: Downes, F.P., and Ito, K. (Eds.), Compendium of Methods for the Microbiological Examination of Foods, 4th rev ed. American Public Health Association, Washington, DC. pp: 53-62. Takahashi, T., T. Oka, H. Iwana, T. Kuwata, and Y. Yamamoto, 1993. Immune response of mice to orally administered lactic acid bacteria. Biosci. Biotechnol. Biochem. 57:1557- 1560. 230
Telzak, E.E., L.D. Budnik, M.S. Greenberg, S. Blum, M. Shayegani, C.E. Benson, and S. Schultz, 1990. A nosocomial outbreak of Salmonella enteritidis infection due to the consumption of raw eggs. N. Eng. J. Med. 323:394-397. Tositti, G., P. Fabris, E. Barnes, F. Furlan, M. Franzetti, C. Stecca, E. Pignattari, V. Pesavento, and F. Lalla, 2001. Pancreatic hyperamylasemia during acute gastroenteritis: incidence and clinical relevance. BMC Infect. Dis. 1:18. Trowell, H., D.A.T. Southgate, T.M.S. Wolever, A.R. Leeds, M.A. Gussell, and D.J.A. Jenkins, 1976. Dietary fiber redefined. Lancet. 1: 967. Vahouny, G.V., and D. Kritchevsky, 1982. Dietary fibre in health and disease. Plenum Press, New York, NY. Van der Wielen, P.W., S. Biesterveld, S. Notermans, H. Hofstra, B.A.P. Urlings, and F. van Knapen, 2000. Role of volatile fatty acids in development of the cecal microflora in broiler chickens during growth. Appl. Environ. Microbiol. 66, 2536-2540. Wagner, D.D., and O.P. Thomas, 1978. Influence of diets containing rye or pectin on the intestinal flora of chicks. Poult. Sci. 57:971-975. Watarai, S., and Tana, 2005. Eliminating the carriage of Salmonella enterica serovar Enteritidis in domestic fowls by feeding activated charcoal from bark containing wood vinegar liquid (Nekka-rich). Poult. Sci. 84:515-521.
231
CHAPTER 5
DENATURING GRADIENT GEL ELECTROPHORESIS ANALYSIS OF 16S RIBOSOMAL DNA AMPLICONS TO ANALYZE CHANGES IN ILEUM BACTERIAL POPULATION OF TURKEYS FED DIFFERENT DIETS AND AFTER INFECTION WITH SALMONELLA SPP.1
______1The use of trade names in this publication does not imply endorsement by the North Carolina Agriculture Research Service or the North Carolina Cooperative Extension Service of the products mentioned nor criticism of similar products not mentioned. 232
5.1 ABSTRACT
Changes in ileum bacterial populations of turkeys fed different diets and after infection with Salmonella spp. were analyzed using polymerase chain reaction (PCR) denaturing gradient gel electrophoresis (DGGE). Turkeys raised on litter floor were fed wheat/SBM- and corn/SBM-based diets with and without enzyme preparations (XY1 &
XY2, respectively) from 0-126 d. XY1 is a pure endoxylanase, whereas XY2 is endoxylanase, protease and α-amylase blend preparation (Danisco, UK). The dietary XY1 and XY2 activity levels were 2500 and 650 EXU/kg feed, respectively. Microbial DNA was extracted from the ileum content of 16 wk-old turkeys, and 16S rDNA gene was amplified by
PCR and analyzed by DGGE. Diversity indexes, including richness (number of species or
DGGE bands), evenness (the relative distribution of species), diversity (using Shannon’s index that include richness and evenness), and Sorenson’s pairwise similarities coefficient
(measures the species in common between different habitats) were calculated. Diversity indexes were associated with changes of Salmonella colonization of turkey intestine characterized in a simultaneous research carried out on the flock (Chapter 3). The wheat- based diets resulted in higher microbial diversity indexes than corn-based diets. Likewise, enzyme supplementation stimulated the growth of the overall microflora and increased the diversity indexes in comparison to unsupplemented treatments. The corn-control treatment had lower diversity but higher Salmonella prevalence than corn-enzyme and wheat-based dietary treatments. In contrast, birds fed the wheat-based diets had higher diversity but lower
Salmonella prevalence. Evidently, high dietary fiber content from wheat, and dietary 233 exogenous enzyme supplementation stimulated microbial community diversity and discouraged Salmonella colonization through competitive exclusion.
(Key words: non-starch polysaccharides, enzymes, PCR-DGGE, microbial ecology, turkey)
5.2 INTRODUCTION
Gastrointestinal tract (GIT) microbiology of production animals has long been of interest concerning food safety, animal nutrition, and health. The composition and activity of the GIT microflora has a significant impact on the health of the host because it influences nutrition, intestinal physiology, immunity, and consequently resistance to pathogen colonization (Montagne et al., 2003; Yan et al., 2004; Simon et al., 2004; Andrew et al.,
2004; Denise et al., 2004). Attempts have being made to bolster host defenses by using feed ingredients that favor the growth of bacteria generally regarded as beneficial (Apajalahti et al., 1998). Numerous modulators of the GIT ecology have been proposed (Ferket and Santos
Jr., 2005), and many are available for enhancing the performance and intestinal health of poultry. Manipulation of the dietary carbohydrate composition, predominantly NSP level, and enzyme supplementation has been suggested to change microflora and promote intestinal health (Remus, 2003). Hogberg and Lindberg (2004) studied the influence of cereal-NSP on digestion and gut environment and showed that the substrate for the growth of lactic acid bacteria was released in the diet when exogenous enzyme was supplemented to the diet. The release of various oligosaccharides upon dietary enzyme supplementation supported the growth of Lactobacillus spp. These observations support a growing body of research on the importance of cereal-based diets high in NSP and enzyme supplementation to promote 234
intestinal health and exclude pathogen colonization (Hogberg and Lindberg, 2004). Remus
(2003) reported that supplementation of an enzyme blend to wheat- and corn-based diets
decreased intestinal Salmonella of broiler chickens by approximately 60% at 14 and 17 days
of age. However, a better understanding of the microbial ecology of chicken intestinal
microbiota is necessary to determine how dietary NSP and enzyme supplementation affect
the composition of the microbial community and inhibit the colonization of pathogens.
The intestinal microflora comprises a diverse collection of cultivable and
uncultivable microbial species. Most of the knowledge concerning intestinal bacterial species was determined by cultural methods (i.e. cultivation of samples in selective media, generation of pure cultures and subsequent taxonomic identification of the unknown bacterium). Although cultivation-based techniques have been useful for analysis of specific groups of bacteria, it has several limitations for surveying the intestinal ecosystem
(McCracken et al., 2001). In addition to being time- and labor-intensive, the use of selective media specific for different types of bacteria dictates of the types of bacteria that can be enumerated (MacCracken et al., 2001). Furthermore, estimation of culturability of bacteria in the GIT varies from 20 to 50% (Zoetendal et al., 1998). Thus, up to 80% of intestinal bacterial species may not be detected using cultivation-based techniques (Suau et al., 1999;
Vaughan et al., 2000).
The use of molecular biology methods has greatly enhanced the knowledge of gastrointestinal bacterial communities. One major advantage is the rapidity and sensitivity of the determination as compared to culture methods. Ribosomal DNA (rDNA) and ribosomal
RNA (rRNA) has been shown to be excellent markers to group bacteria according to their 235
phylogenetic origin (Lane et al., 1985). Comparison of bacterial rDNA sequences has
demonstrated similarities that can be categorized into cluster and sub-cluster groups (Simon
et al., 2004). These phylogenetic trees correlate well with existing taxonomic systems, while
also emphasizing relationships that has lead to the generation of new taxa (Simon et al.,
2004).
Currently, ribosomal RNAs or DNAs analysis is the most commonly used measure of
environmental diversity (Liu and Stahl, 2002). The most important advance has been the use
of 16S rRNA or rDNA as a molecular fingerprint to identify and classify organisms, allowing
for the development of cultivation-independent techniques for analyzing community
diversity (Amann et al., 1995; Raskin et al., 1997). Molecular fingerprint, otherwise known
as community fingerprint or phylogenetic fingerprint, has been used for rapid surveys using genes that provide for either phylogenetic or diversity assessment of the populations present in a sample (Liu and Stahl, 2002). Denaturing gradient gel electrophoresis (DGGE) of 16S rDNA amplicons is a quick, economical, and reliable technique for the analysis of microbial community fingerprint (Muyzer et al., 1993). In addition, this cultivation-independent technique is less labor-intensive than traditional microbiological approaches, and it can be applied to evaluate dietary-, drug-, or disease-associated alterations of intestinal microbial population (McCracken et al., 2001). The DGGE method is based on the analytical separation of DNA fragments of identical or near-identical lengths, but with varying sequence compositions. Separation is based on the changing electrophoretic mobilities of
DNA fragments migrating in a gel containing a linearly increasing gradient of DNA denaturants (urea and formamide) or temperatures (for the temperature gradient gel 236
electrophoresis, TGGE). Changes in fragment mobility are associated with partial melting or
the denaturing of DNA sequences in discrete regions, the so-called melting domains. When
the DNA enters a region of the gel containing sufficient denaturant, a transition of helical to
partially melted molecules occurs, and migration is severely retarded. Sequence variation
within such domains alters the melting behavior, and sequence variants of the different
amplification products stop migrating at different positions in the denaturing gradient (Liu
and Stahl, 2002). Furthermore, DNA can be collected from bands on the DGGE gel, which
can be sequenced for phylogenetic analysis (Hoj et al., 2005). This technique has been
commonly used for community profile and analysis of shifts in GIT microflora of human
(Liu and Stahl, 2002), pigs (Collier et al., 2003a, Konstantinov et al., 2003), mouse
(McCracken et al., 2001), broiler chickens (Collier et al., 2003b; Hume et al., 2003), turkeys
(Waters et al., 2005), composting processes (Ishii and Takii, 2003), and soil (Torsvik et al.,
1998; Kirk et al., 2004). However, no research paper has been cited to study the mode of
action of dietary NSP and enzyme supplementation on monitoring the composition of the
microbial community and exclusion of pathogens through PCR-DGGE amplicons analysis of
ileum digesta of turkeys.
The hypothesis tested in this study was that diets high in NSP content increases
microbial community diversity and discourages Salmonella colonization, especially when the
diet is supplemented with NSP-hydrolyzing enzyme that increases substrate availability. To
test this hypothesis, PCR-DGGE of 16S rDNA amplicons changes of ileal bacterial
populations of turkeys fed wheat- and corn-based diets with or without exogenous
endoxylanase supplementation was investigated. In addition, the changes on the microbial 237
community diversity characterized by the PCR-DGGE were associated to changes in
Salmonella spp. colonization of turkeys. The Salmonella spp. fecal prevalence and cecal
population were characterized in a simultaneous research carried out on the flock and the
data is described in Chapter 3 of this dissertation.
5.3 MATERIALS AND METHODS
Enzymes
The enzyme activity in the product and feed, and application rate used in the
experimental diets are shown in Table 1. Avizyme® 1302 is a commercial fine granular enzyme preparation obtained from fermentation of Bacillus subtilis and genetically modified
Trichoderma longibrachiatum. It contained standardized activities of at least 5,000 endo-1,4- beta-xylanase units (EXU, EC 3.2.1.8) per gram of product (Danisco, 2003). One EXU is defined as the enzyme activity required to liberate 1 µmol reducing sugar (measured as glucose equivalents) per minute from a 1% xylan solution at pH 3.5 and 40°C. Avizyme®
1302 also contains some protease subtilisin activities (Danisco, 2003). Avizyme® 1500 is a
commercial fine granular preparation obtained from fermentation of Bacillus subtilis,
Bacillus amyloliquifaciens and genetically modified Trichoderma longibrachiatum.
Avizyme® 1500 contained standardized activities of at least 600 EXU (EC 3.2.1.8), 8000
units of subtilisin (EC 3.2.1.8) and 800 units of alpha-amylase (EC 3.4.21.62) per gram of product. The genetically modified Trichoderma longibrachiatum produces an endoxylanase stable to heat processing of about 85ºC, which allowed the enzyme preparation to be added to 238
the feed in the mixer prior to pelleting. All the enzyme preparations were supplied by
Danisco Animal Nutrition1.
Diets
The experimental diets are presented in Table 2 and 3. Four feed phases were used
during the course of the experiment. All diets were formulated using least-cost linear
programming software, such that the diets met or exceed the NRC (1994) recommendations for amino acids and energy. Diets of treatment 2 and 1 consisted of the same wheat-soybean meal basal diet with and without Avizyme® 1302 supplementation, respectively. Diets of
treatment 4 and 3 consisted of the same corn-soybean meal basal diet with and without
Avizyme® 1500 supplementation, respectively. All feed was pellet-processed and fed in
crumble form up to 4 weeks of age, and subsequently as a whole 8 millimeter pellet form.
Composite feed samples from each diet were taken immediately after manufacture and
analyzed for crude protein, fat, ash, Ca, and P. The chemical analyses were performed as shown on the footnote of Table 2 and 3. Additionally, soluble and insoluble fiber content of the pooled feed samples was determined using the Megazyme Total Dietary Fiber Assay kit2.
Pooled samples from the corn-based diets were independently sampled from the wheat-based diets prior to fiber analysis. The pooled samples consisted of five hundred grams of feed sampled from each feed phase that were blended together.
All feed used in this study were manufactured at the North Carolina State University feed mill3. The enzymes were applied during feed mixing in a 500 kg capacity horizontal
double ribbon mixer. All enzymes were added to the diet in amounts recommended by the
1Danisco Animal Nutrition, Wiltshire, UK. 2 Total Dietary Fiber Assay Kit, Megazyme International Ireland Ltd., Co. Wicklow, Ireland. 3 NCSU Feed Mill, Chicken Unit, Lake Wheeler Rd, Raleigh, NC. 239
supplier (Table 1, Danisco, 2003), such that Avizyme® 1302 provided at least 2500 EXU/kg
feed and Avizyme® 1500 provided at least 650 EXU/kg feed. For optimum bioefficacy of the
enzymes, conditioning and pelleting of feed did not exceed temperature of 82ºC.
Bird husbandry
The facility, located at North Carolina State University Turkey Education Unit4, was a curtain-sided house containing forty-eight 9.3 square meter pens. Each pen was top-dressed with 4 cm of soft pine shavings at the start of the experiment. Ventilation was provided by natural air movement through appropriately adjusted curtain sides and air mixing fans located on the ceiling throughout the house. High and low ambient temperatures within the house were recorded at four places twice daily throughout the duration of the trial. The house temperatures was kept at 29-31ºC during the first week (wk), and then gradually stepped down to the ambient outside temperature, which ranged from 2ºC to 28ºC. The house was illuminated with incandescent lights for 23 hours per day on the first week and subsequently by natural daylight thereafter. Heat lamp units5 with 125-watt bulbs6 provided supplemental
heat for each pen. Feed and water were provided ad libitum throughout the duration of the
study. Visual heath inspection of all birds within the study was performed daily and weights
of culled birds and reasons they were removed were recorded. Crippled or dead birds were
removed and recorded.
The purpose of this experiment was to investigate changes of ileum bacterial
population through PCR-DGGE of 16S rDNA amplicons from turkeys fed wheat- and corn-
based diets with or without exogenous enzyme supplementation. To achieve these objectives
4 NCSU Turkey Education Unit, Lake Wheeler Rd, Raleigh, NC. 5Heat Lamp, Model # 54411-Heave Gauge Aluminium Base, Hog Slats, Inc., Newton Grove, NC, 28366. 6125-watt bulb, SLI, China; Distributor: Hog Slats, Inc., Newton Grove, NC, 28366. 240
thirty-two pens of the experimental house were assigned to this trial. The house contained 4
sections with 12 pens each. Each treatment combination was replicated twice in each section
of the house. Thus, each treatment was replicated by 8 pens. The four dietary treatments were randomly assigned to pens using the Proc-Plan procedure of SAS® (SAS, 1996). Each pen of
30 turkeys were subjected to one of four dietary treatments from 1 to 113 (0-16 wk) days of age, as follows: wheat control (WC), wheat with Avizyme® 1302 at 2500 EXU/kg (WE),
corn control (CC), and corn with Avizyme® 1500 at 650 EXU/kg (CE).
Ileum DNA isolation and PCR-DGGE analysis.
At 16 weeks, eight birds per treatment were euthanized by cervical dislocation and
ileum contents were immediately placed into microcentrifuge tubes and snap-frozen in liquid
nitrogen and stored at -80°C until DNA isolation. DNA was isolated from the samples
following a modification of previously described extraction methods (Tsai and Olsen, 1992;
Wilson and Blitchington, 1996). Specifically, ileum samples were vortexed in 20 mL of
sterile phosphate buffered saline solution (PBS) for 10 min and then centrifuged for 2 min at
30 x g. The supernatant, which contained the bacteria, was removed and centrifuged for an
additional 5 min at 12,000 x g. The supernatant from this step was discarded and the pellet
subjected to lysozyme treatment for 30 min at 37°C, at which time stop solution (0.1 mol/L
NaCl, 0.48 mol/L Tris, pH 8.0, 10% Sodium Dodecyl Sulfate-SDS) was added for 30 min at
37°C. These samples were subjected to three freeze-thaw cycles (-80°C and room
temperature, respectively), proteinase K treatment (30 min at 37°C), and extraction by
phenol, phenol/chloroform/isoamyl alcohol (25:24:1) and chloroform, followed by
isopropanol precipitation in ammonium acetate (2.5 mol/L final concentration). 241
For PCR-DGGE analyses, each DNA sample was amplified using primers specific for conserved sequences flanking the variable V3 region of the 16S rDNA, as described previously (Muyzer et al., 1998). Each reaction mixture contained 125 ng of DNA, 5 µL of
25% acetamide, 25 pmol of forward primer (5'CGCCCGCCGCGCGCGGCGGGCGG
GGGGGGCACGGGGGGCCTACGGGAGGCACAG3'), 25 pmol of reverse primer
(5'ATTACCGCGGCTGCTGG3'), 0.2 mmol/L of nucleotide (dNTP) mix, 5 µL of 10X Ex
Taq Buffer7 and 5 U TaKaRa Ex Taq DNA polymerase. The forward primer contained a 40- bp region of high G + C content (the "GC clamp") at the 5' end, which prevented complete dissociation of the DNA strands (Muyzer et al., 1998). To reduce spurious PCR products, touchdown PCR was performed (Muyzer et al., 1998). After a single cycle of 94°C melting for 5 min, 64°C annealing for 1 min and 72°C for 3 min, 19 cycles were performed in which the annealing temperature was decreased 1°C every other cycle. Nine cycles were then performed using an extension of 55°C, followed by a single cycle of 94°C for 1 min, 55°C for 1 min and 72°C for 10 min.
After visual confirmation of the approximately 200-bp PCR product using agarose gel electrophoresis, mung-bean nuclease8 was added to remove single-stranded DNA (Simpson et al., 1999). For each sample, 3 µL of 10X mung-bean buffer and 0.75 U mung-bean nuclease were added to 15 µL of the PCR product. After 10 min incubation at 37°C, mung- bean nuclease reactions were stopped by addition of 10 µL DGGE gel loading buffer (0.05%
bromophenol blue, 0.05% xylene cyanol and 70% glycerol in sterile nanopure H20).
7 10X Ex Taq Buffer, TaKaRa Shuzo, Otsu, Japan. 8 Mung-bean nuclease, Stratagene, La Jolla, CA. 242
Reactions were stored at -20°C until PCR-DGGE analysis, which was performed within 5 d
of PCR.
DGGE was performed using the Bio-Rad D-Code System9 as described previously
(Simpson et al., 1999). To separate PCR fragments, 35–60% linear DNA-denaturing
gradients (100% denaturant is equivalent to 7 mol/L urea and 40% deionized formamide)
were formed in 8% polyacrylamide gels using a Bio-Rad Gradient Former. Gels were
polymerized on GelBond PAG gel support films10. PCR products were loaded in each lane
and electrophoresis performed at 150 V for 2 h at 60°C, then for 1 h at 200 V. Additionally,
bacterial reference ladders representing known bacterial strains were loaded to allow
standardization of band migration and gel curvature among different gels (Simpson et al.,
2000). After electrophoresis, gels were silver-stained (Muyzer et al., 1998) and scanned using
a GS-710 Calibrated Imagining Densitometer11. Some samples did not yielded high-quality
PCR-DGGE gel lanes; therefore, only seven samples from each treatment group were used
for the examination of the PCR-DGGE gels.
Examination of the DGGE gels.
Examination of DGGE gels were based on methods previously described by
McCracken et al. (2001), Konstantinov et al. (2003), and Hoj et al. (2005). First, the gels
were examined using the BioNumerics software12. A number of bands per lane were assessed using bands searching algorithm within the program. A manual check was done and the
DGGE fragments constituting less than 1% of the total area of all bands were omitted. Bands
9 Bio-Rad D-Code System, Hercules, CA. 10 GelBond PAG gel support films, FMC, Rockland, ME. 11 GS-710 Calibrated Imagining Densitometer, BioRad, Hercules, CA. 12 BioNumerics version 3.5, Applied Maths BVBA, Austin, TX. 243
above 1% of the total area of all bands were considered as dominant DGGE bands and included in the further analysis. Subsequently, PCR-DGGE banding patterns were measured by determination of migration distance and intensity of the bands within each lane of the gel
(Simpson et al., 2000). This information was then used to analyze banding patterns via
several measures of community diversity, including band number, Shannon’s index, and
Shannon’s Equitability (Shannon and Weaver, 1949; Sneath and Sokal, 1973; Magurran,
1988). These indices measure ecological diversity using various parameters, including
species richness (the number of different species) and evenness (the distribution of individual
within each species in the ecosystem) (Magurran, 1988). These diversity indices were
developed originally for macroecological analyses to evaluate evenness and species richness, but have also been validated for cultivation- and molecular-based analyses of microbial
diversity (Nubel et al., 1999; Krause et al., 1995; Rasmussen et al., 1998; Eichner et al.,
1999). In the description of the indices that follows, "species" refers to individual bands on the PCR-DGGE gels. However, because the bands on the PCR-DGGE gels correspond to the
percentage of G + C content within the melting domains for the V3 PCR amplicon, bacterial
species with similar G + C content in the amplified V3 region may form assemblages and
appear as a single band, resulting in fewer bands (Muyzer and Smalla, 1998).
Band surface area corresponds to measurements of the optical density of each band
(Figure 1). The optical density were measured based on the plotted band intensity and migration distance. Each band formed a peak relative to its intensity and migration distance, which the area underneath the peaks were measured by the BioNumerics software. Band number corresponds to the number of individual bands in a single lane (Figure 2A). Band 244
frequency was calculated by measuring the percentage of all samples containing each
individual band (Figure 2B). Sorenson’s similarity index was used to compare average
percentage similarities of PCR-DGGE banding patterns (based on the average number of
bands in common) within each treatment group (intragroup comparison, Figure 3A) and between treatment groups (intergroup comparison, Figure 3B). Calculations for the
Sorenson’s similarity index are based on the formula: Cs = [2j/(a+b)]x100, where a is the
number of PCR-DGGE bands in lane 1, b is the number of PCR-DGGE bands in lane 2 and j
is the number of common PCR-DGGE bands within bands 1 and 2. As a parameter for the
structural diversity of the microbial community, the Shannon index of general diversity (H′)
were calculated using the following function: H′=− Pi logPI, where Pi is the proportion of
th individuals in the population belonging to the i species; for analysis of DGGE patterns, Pi corresponds to the proportional abundance of band i (Figure 4A). Therefore, H′ values were calculated on the basis of the bands on the gel tracks that were applied for the generation of the dendrograms by using the intensities of the bands, as judged by peak height in the densitometric curves. The importance probability, Pi, was calculated as: Pi=ni/T, where ni is the height of a peak and T is the sum of all peak heights in the densitometric curve.
Community evenness was calculated using the Shannon’s equitability index (EH index) based
on the formula: EH = H’/lnS, where H’ is the H’ index calculated as previously mentioned, and S is the total number of species in the community (total number of PCR-DGGE bands)
(Foucher et al., 2004, Figure 4B).
The similarity between the DGGE profiles were determined by calculating a band similarity coefficient (SD) (Dice: SD=2nAB/(nA+nB), where nA is the number of DGGE bands 245
in line 1, nB represents the number of DGGE bands in lane 2, and nAB is the number of
common DGGE bands). The Dice coefficient (values between 0 and 1) is an arithmetic
determination of the degree to which banding patterns are alike (i.e. contain the same bands).
Clusters (groups) are determined by sequentially comparing the patterns and the construction
of a relatedness tree (dendrogram) reflecting the relative similarities. The amount of
similarity is reflected by the relative closeness or grouping and is indicated by the percentage coefficient bar located above the dendrogram. The dendrogram of PCR-DGGE profile was constructed based on the similarity matrix (Dice coefficient) data by applying unweighted pair group method with arithmetic averages (UPGMA) cluster analysis on the BioNumerics software (Minamida et al., 2004, Figure 5).
Statistical analysis
All data were analyzed using the general linear models procedure for analysis of
® variance (ANOVA) of SAS (1996) according to the following model: Yij = µ + τi + Eij, where Yij was the observed dependent variable (microbial diversity indexes); µ the overall mean; τi the difference between mean for treatment i and µ (treatment effect); and Eij is the
random error. Individual bird served as the experimental units for statistical analysis unless
otherwise stated. Variables having a significant F-test were compared using the least-squares-
means (lsmeans) function of SAS (SAS, 1996), and they were considered to be significant at
P<0.05. All percentage data was transformed to arc sine of the square root before analysis.
Because no statistical differences were observed between transformed and the original data
(not transformed), statistics presented in this paper are from un-transformed data.
246
Animal ethics
The experiments reported herein were conducted according to the guidelines of the
Institutional Animal Care and Use Committee (IACUC) at North Carolina State University.
All husbandry practices and euthanasia were done with full consideration of animal welfare.
5.4 RESULTS
Ileum content samples collected from individual 16-week old toms were used for the analysis of microbial population profile based on PCR-DGGE from 16S rDNA. The
BioNumerics software was used to analyze PCR-DGGE gel banding patterns. This software analyzed the PCR-DGGE banding patterns by measuring migration distance and intensity of the bands within each lane of a gel. Each band formed a peak relative to its intensity and migration distance, and the area underneath each peak was measured by the BioNumerics software. Average surface area was determined by averaging the surface area of the bands within each lane of each treatment (Figure 1A), and total surface area was determined by summing the surface area of all bands within each lane of each treatment (Figure 1B).
Although no statistical significance were observed on band surface area, enzyme supplementation increased (P=0.2) the total surface area by about 27% as compared to non- supplemented controls. Also, differences between corn- and wheat-based diets approached significance. The average band surface area was 34% higher (P= 0.08) from samples of birds fed wheat-based diets than from turkeys fed corn-based diets (Figure 1A). In addition, the total band surface area was approximately 47% higher (P=0.06) from samples of toms fed wheat-based diets than from those fed corn-based diets (Figure 1B). 247
The effect of diet on the number of PCR-DGGE bands expressed in each sample is
shown on Figure 2A. The number of bands in any individual lane ranged from 5 to 21.
Enzyme supplementation significantly increased (P<0.05) the number of bands by about 45%
and 16% from birds fed WE and CE diets, respectively, as compared to the correspondent
control unsupplemented treatment (WC and CC, respectively). The number of PCR-DGGE
bands from birds fed wheat and corn without enzyme were the same (S= 9.6).
The percentage of samples containing a specific frequency of PCR-DGGE bands was
calculated to characterize the distribution frequency of PCR-DGGE bands among the
different samples (Figure 2B). The maximum number of distinct PCR-DGGE bands for each
treatment was: 23 for wheat- and corn-control birds, 26 for corn-based diets supplemented
with enzyme, and 32 for wheat-based diets supplemented with enzyme. Although the total
number of distinct bands combining all samples was 41 and the mean indicated 26 distinct
bands observed across treatments, the majority of PCR-DGGE bands were expressed in a low
percentage of the samples (Figure 2B). Only 5 common bands were present in >40% of the samples across treatments, and there were no common bands present in >80% of the samples.
Sorenson’s similarity coefficient (Cs) was used to compare average percentage similarities of PCR-DGGE banding patterns. The comparison was based on the average number of bands in common within each treatment group (Figure 3A) and between treatment groups (Figure 3B). Cs of 100% indicates that DGGE profiles are identical, while Cs of 0% indicates DGGE profiles are completely different (Waters et al., 2005). The Cs among samples within each treatment group were not significantly different (P<0.05, Figure 3A).
The Cs between treatment groups revealed several diet- and enzyme-dependent differences in 248
the bands of ileum microbial population (Figure 3B). The similarity value for the intergroup comparison of the wheat- with corn-control diets had the highest Cs value (34.3 vs 23.8%,
P<0.001) as compared to other intergroup treatment comparisons. The lowest observed Cs
was the comparison between corn-control and wheat-based diet supplemented with enzyme
treatments (19 vs 27%, P<0.001).
PCR-DGGE banding patterns of ileum microflora were analyzed using Shannon’s
index (microbial community diversity, H’) and Shannon’s Equitability index (microbial
community evenness, EH) (Figure 4). Shannon’s index measures the degree of order (or
disorder) observed within a particular system (communication entropy) (Uramoto et al.,
2005). In ecological studies, the degree of order is characterized by the number of individuals
observed for each species in the sample (e.g., PCR-DGGE band pattern in this study). The
community entropy decreases as the H’ value decreases, consequently the sample diversity would be small (Uramoto et al., 2005). Likewise, as sample diversity increases, H’ value
increases (Uramoto et al., 2005). Shannon’s Equitability index (EH) is used to describe how
evenly individuals are distributed among the species present within the community (Hill,
1973). Equitability assumes a value between 0 and 1, with 1 being complete evenness and
lower values indicate species deviation from this equitability (Uramoto et al., 2005). In the current study, enzyme supplementation (H’= 2.2) significantly increased (P<0.05) community diversity in comparison to unsupplemented groups (H’= 1.9, Figure 4A). Enzyme supplementation of the corn-based diet increased (P<0.05) community diversity, such that it was statistically equivalent to the wheat-based diets. In addition, the microbial community in birds fed wheat-based diets were more (P<0.05) evenly distributed (EH = 0.9) than in birds 249
fed the corn-based diets (EH = 0.8). Enzyme supplementation of the corn-based diets
increased (P<0.05) community evenness, such that it was statistically equivalent to the
wheat-based diets.
The similarities between the DGGE profiles were determined and a dendrogram was
constructed (Figure 5). The effects of diet or enzyme supplementation on microbial
composition were more clearly distinguished by the cluster analysis based on unweighted
pair group method with arithmetic averages (UPGMA). The principal goal of cluster analysis
is to classify samples into two or more close resembling groups based on similarities between
the measurements that have been made on the samples (Cross-Smiecinski, 2002). In the
dendrogram, distinct clusters by diet were observed, such that clusters were formed based on
type of grain and presence of enzyme. The microbial population of the enzyme supplemented treatments resembled each other. Similarly, a cluster of about 50% similarities were formed from the microbial population of the unsupplemented treatments. Cophenetic correlation
values were estimated by BioNumerics software and the values are shown on the dendrogram
of PCR-DGGE banding patterns (Figure 5). The Cophenetic correlation values were
calculated by the correlation between the dendrogram-derived similarities and the matrix
similarities (BioNumerics, 2003). The value is usually calculated for the whole dendrogram
to have an estimation of accuracy of the cluster analysis (BioNumerics, 2003). The
Cophenetic correlation values calculated for each cluster (branch) by BioNumerics software
estimated the accuracy of each subcluster of the dendrogram. Thus, the Cophenetic
correlation value for the entire dendrogram is showing at the root of the dendrogram
(BioNumerics, 2003), which was high (72 value) in this current study. 250
5.5 DISCUSSION
This research investigated changes of ileum bacterial population of 16 week-old turkeys fed corn/SBM- and wheat/SBM-based diets with and without exogenous enzyme supplementation since the day of placement. Another objective of this research was to evaluate the changes in the microbial community associated to changes in fecal shedding and cecal colonization of Salmonella spp. The Salmonella spp. data is presented in Chapter 3 of this dissertation.
The experimental turkey flock studied herein was naturally infected with Salmonella spp. and no specific source of Salmonella present in the experiment could be identified
(Chapter 3 of this dissertation). Salmonella was present in almost all the pens at 3 weeks of age. Salmonella prevalence was not significantly (P<0.05) influenced by grain type (corn or wheat) or enzyme supplementation before 14 weeks. At 15 weeks, however, Salmonella spp. was not recovered from any pens receiving wheat-based diets, whereas 38% of the pens receiving the corn-based diets were positive. Salmonella prevalence in fecal content of corn- fed turkeys at 15 weeks of age was significantly reduced (P<0.05) by enzyme supplementation, such that it was statistically equivalent to those birds fed wheat-based diets.
Additionally, Salmonella spp. was not recovered from fecal samples collected from 18 week- old toms fed the enzyme-supplemented corn-based diets or the wheat-based diets; but, it was present in 13% of the fecal samples collected from toms fed the corn-control diet. These data indicated that turkeys fed wheat-based diets and enzyme-supplemented corn-based diet could reduce enteric Salmonella population by 16 to 18 weeks of age in comparison to corn-control treatment. Presumable, dietary NSP or fermentable oligosaccharides generated by dietary 251
enzyme supplementation encouraged a microbial population that competitively excluded
Salmonella.
Corn and wheat were chosen to be the major component of the experimental diets
because their common use in poultry feed throughout the world, and their great difference in
NSP content. Therefore, by using corn and wheat to formulate the experimental diets (Table
2 and 3), allowed to test the hypothesis that dietary NSP level alters the gut microbial
ecosystem by changing the availability of fermentable carbohydrates. The corn-soy
experimental diet had an average of 1.6% soluble dietary fiber (SDF) and 14.5% insoluble
dietary fiber (IDF) on a dry matter basis (DM) (Table 3), whereas the wheat-based diets
contained 2.0% DM-SDF and 17.9% DM-IDF (Table 2). Thus, the difference in total NSP
between these two diets averaged 37.2g/kg. Several researchers have demonstrated that
dietary NSP content from 2 to 40g/kg can change the animal performance, intestinal
viscosity, nutrient digestibility and microbial community structure (Choct and Annison,
1992; Annison, 1993; Langhout et al., 2000; Svihus, 2001; Lan, 2004). In agreement, distinct
PCR-DGGE banding pattern clusters by diet were observed in this current experiment, such that clusters were easily associated based on the type of grain and dietary enzyme supplementation. The microbial population of the enzyme-supplemented treatments resembled each other, and a cluster was formed with approximately 50% similarity among the bacterial communities. Also, a cluster of about 52% similarity was formed from the microbial population sampled from turkeys fed the diets that were not supplemented with enzyme. The Cs between treatment groups supported the clusters analysis. The highest Cs values were observed among the wheat- and corn-based control diets (WC-CC, Cs = 35%) 252
and the enzyme-supplemented diets (WE-CE, Cs = 28%). The lowest Cs value was observed for the comparison between corn-control diet and wheat-based diet supplemented with
enzyme (CC-WE, Cs= 19%). Therefore, NSP and enzyme supplementation altered the
intestinal community structure.
Dietary fiber is composed of non-starch polysaccharides (NSP) and lignin that are
resistant to hydrolysis of endogenous digestive enzymes of animals and humans (Trowell,
1976). Non-starch polysaccharides are primary substrate for Lactobacillus and
Bifidobacterium, which are important commensal bacteria of the GIT. Lan (2004) theorized
that an increase in substrate availability increases the overall microbial fermentation.
However, the intestinal environment, which influences the proliferation of microbial
communities, will be influenced by the source and level of dietary fiber (Hogberg, 2003).
A corn-soy diet contains a low amount of NSP, which is largely insoluble and
provides a limited amount of slowly fermentable substrate for microbial growth in the hind
gut of poultry (Bach Knudsen, 1997, 2001; Hogberg, 2003). Low NSP diets result in
decreased passage rate through the proximal gastro-intestinal tract and increased cecal
contents associated with a low cecal turnover rate (Fraga et al., 1991). Thus, the growth of
organisms that are permanent members of the normal microflora, such as Lactobacillus and
Bifidobacterium, are promoted on this stagnated environment. However, transient bacteria,
which are present only under unusual environmental conditions, may also grow (Hogberg,
2003). The increase of transient microbes may be supported by the degree of Salmonella
infection in birds fed corn-soy diets of this experimental flock (Chapter 3). Furthermore, as
indicated by the decrease in band surface area and H’ values of birds fed corn-soy diets, the 253
diversity as well as the activity of the resident flora decreased due to the limited amount of
substrate (Hogberg, 2003).
A diet with a high NSP content and a large amount of insoluble NSP, as in wheat-
based diets provides plenty of substrate to support increased microbial growth (Bach
Knudsen et al., 1991). In the present research, all the diversity indexes were higher for
wheat-based diets than for corn-based diets. Also, total and average band surface area was
higher in turkeys fed the wheat-based diets than those fed the corn-based diets, which
indicates an increased number of microbes in the overall community. Similarly, previous
studies have reported that fiber-containing diets increased populations of intestinal bacteria in
different animals including poultry (Wise et al., 1986; Gestel et al., 1994; Le Blay et al.,
1999) and increased diversity of intestinal microflora in mice (McCracken et al., 2001) and pigs (Hogberg, 2003).
The wheat- and corn-control diets resulted in lower richness-index compared to the enzyme-supplemented treatments indicating that the two control diets supported lower number of bacterial species. The richness of the WC treatment was low probably because the majority of the NSP substrate available in this diet was insoluble fiber characterized by low digestibility, slow degradation rate (Bach Knudsen and Jorgensen, 2001) and increased GIT passage rate (Kass et al., 1980; Bach Knudsen, 2001). Therefore, only a more specialized microflora capable of fermenting this kind of substrate present in the wheat-based diets was probable able to grow (Hogberg, 2003). In contrast, the richness of CC diets was low due to high competition for substrate (Hogberg, 2003). In this highly competitive ecosystem, only dominant microbial niches were able to grow, which also resulted in decreased microbial 254
community evenness (EH value). Therefore, the enteric microbial community diversity in
turkeys fed corn-soy diets decreased because of decreased in both richness (number of
species) and evenness (the distribution of individuals within each species in the community).
Dietary exogenous enzyme supplementation apparently increased the availability and variety of substrates that supported the growth of a more diverse microflora. Both enzyme preparations used in this study contained endoxylanase. Oligosaccharides of intermediate length, such as xylobiose, xylotriose and xylopentaose, are products of the hydrolysis by endoxylanase (Uchino and Nakane, 1981; Akiba and Horikoshi, 1988; Bataillon et al., 2000) as used in this experiment. These xylooligosaccharides have been shown to be readily fermented by the GIT microflora (Van Laere and et al., 1997), especially for Lactobacillus and Bifidobacteria (Van Laere et al., 1997; Hogberg and Lindberg, 2004). In agreement, in this current experiment enzyme supplementation increased total PCR-DGGE band surface area by about 27% as compared to unsupplemented treatments. Similarly, Hogberg and
Lindberg (2004) studied the influence of cereal-NSP and enzyme supplementation on digestion and gut environment and showed that the substrate for the growth of lactic acid bacteria (i.e. Lactobacillus) was released in the diet when enzyme was added. Therefore, dietary supplementation of NSP-hydrolyzing enzymes promoted growth of commensal bacteria through increased substrate availability in the hind gut.
The xylooligossacharides released by endoxylanase may have supported the growth of a greater variety of bacterial species that efficiently hydrolyze these substrates. The increased number of PCR-DGGE bands (richness) observed among samples from birds fed diets supplemented with enzyme indicated increased microbial population diversity. In 255 addition to the increased number of species, enzyme supplementation also increased the microbial community evenness in birds fed the corn-based diets and it maintained high the microbial community evenness in turkeys fed the wheat-based diets. Consequently, a higher diversity index was observed among the enzyme-supplemented treatment groups compared to the unsupplemented treatments. Thus, the release of substrate by the enzyme not only increased some bacterial niches, but also allowed the overall microflora to grow evenly and probably maintained a more stable enteric community. Similarly, Bartelt et al. (2002) measured the pre-cecal digestibility of arabinoxylans in piglets and reported considerable digestibility of insoluble arabinoxylans, but not the entire soluble fiber fraction. They demonstrated that the digestibility of soluble and insoluble NSP increased with dietary xylanase supplementation. The authors suggested that this improved NSP digestibility might be a direct effect of the exogenous enzyme, but also of a stimulated degradation by supporting a specialized group of NSP-hydrolyzing bacteria.
Microbial community diversity seems to be an important condition to control
Salmonella colonization of turkey intestine. The turkeys fed CC diet had lower community diversity but higher Salmonella prevalence than the birds fed CE and wheat diets (Chapter 3).
In contrast, turkeys fed the wheat-based diets had higher microbial community diversity but lower Salmonella prevalence than those fed the corn-based diets (Chapter 3). In addition, dietary enzyme supplementation increased the microbial diversity in turkeys fed either the corn- or wheat-based diets, and it decreased the presence of Salmonella in turkey toms as compared to those birds fed diets not supplemented with the enzyme (Chapter 3). Similarly, another research carried out in our laboratory (Chapter 4) studied the effect of corn-, wheat-, 256
and triticale-based diets on Salmonella enterica population and observed that Salmonella enterica population was higher throughout the trial among treatment groups receiving corn than the other grains. Also, the endoxylanase supplemented treatment groups had lower
Salmonella enterica population than the unsupplemented treatment groups at 14 and 21 days of age. Therefore, results observed in this experiment in association with others reported by our laboratory (Chapter 3, 4 and 5) support the hypothesis that diets with high NSP content increases microbial community diversity and discourages Salmonella colonization, especially when the diet is supplemented with NSP-degrading enzymes.
As claimed by Ferket (1991), the stability of the microflora population and its ability to cope with minor changes in gut environment increases as the number of microbial species increases. An increase in community diversity increases the symbiotic relationship within the community, which helps maintain a dynamic intestinal ecosystem (Hentschel et al., 2000) that competitively excludes Salmonella. These symbiotic mechanisms often exist among bacteria and it can facilitate or hinder the success of a particular microbial niche (Hentschel et al., 2000). These symbiotic groups of microorganisms probably competitively excluded
Salmonella by competing for available nutrients and maintaining their habitat by consuming and metabolizing substrate resources of the intestine (Roberfroid et al., 1995; Falk et al.,
1998). In addition, the increased microflora community diversity and associated dynamics of the intestinal ecosystem, increased competitive exclusion against Salmonella as follows: 1) by competing for gut lining attachment (Roberfroid et al., 1995; Falk et al., 1998); 2) by producing bacteriocins and antimicrobial peptides (Hancock and Rozek, 2002; Joerger,
2003); 3) by stimulating the intestinal associated immune system through cell wall 257
components (Nousiainen and Setala, 1998); and 4) by increasing the production of SCFA,
which have bacteriostatic and bactericidal properties (Fuller, 1977) and stimulates
intraepithelial lymphocytes and natural killer cells that enhances the host’s immunological
defense mechanism (Ishizuka and Tanaka, 2002; Ishizuka et al., 2004; Lan, 2004).
In theory, the high amount of readily fermentable substrate from NSP-rich diets,
especially when supplemental enzymes are used to facilitate NSP hydrolysis, would
encourage transient microbes like Salmonella because the microbial competition for substrate
is diminished. However, birds fed wheat-based diets had lower Salmonella prevalence as compared to those fed the corn-based diets, especially when supplemented with enzyme
(Chapter 3 and 4). The mechanism by which NSP acts as a prebiotic compound (selectively metabolized by beneficial members of the intestinal microbiota) is not completely understood at the present time (Rastall et al., 2005). It is presumed that symbiotic bacteria are able to
produce prebiotic-hydrolyzing enzymes, whereas transient microbes express very low
enzyme activity (Rastall et al., 2005). Although, this hypothesis has not been validated in
vivo, the current experimental results indicate that Salmonella colonization is inhibited as
commensal microflora proliferation is promoted by dietary NSP and endoxylanase
supplementation.
The PCR-DGGE technique has been used to evaluate dietary effects on changes in
the microflora profile of chickens (Hume et al., 2003) and turkeys (Waters et al., 2005), but
it has some limitations. PCR-DGGE provides a convenient method to evaluate entire
microbial ecosystems and it allows the analysis of a large number of samples, but this
technique is most useful for determining shifts in predominant microbial populations 258
(McCracken, 2001). Microbial populations comprising less than 9% of the total intestinal
microbial ecosystem are not detected using temperature gradient gel electrophoresis (TGGE),
which is an approach similar to PCR-DGGE (Zoetendal et al., 1998). Moreover, the apparent
community diversity determined by PCR-DGGE may be lower than expected because different bacterial species, possessing similar G + C content of the 16S rDNA gene, may be
represented in the same PCR-DGGE band (Muyzer, 1999; Palys et al., 1999). Consequently, the number of PCR-DGGE bands generally is lower than the number of bacterial species detectable by cultivation-based methods and direct cloning strategies (Zoetendal et al., 1998;
Simpson et al., 1999; Lesser et al., 2000; Muyzer, 1999). These limitations may account in part for the decreased band number in the present study.
Although the intestinal microbiota may contain up to 400 species of bacteria (Moore and Holdeman, 1974), many of these species are rarely detected by cultivation-based studies
(Moore and Moore, 1995). Newer molecular techniques, such as direct cloning and terminal restriction fragment length polymorphism, indicate the presence of approximately 80 microbial species in the mammalian intestine (Zoetendal et al., 1998; Suau et al., 1999;
Lesser et al., 2000), but these techniques do not determine proportional abundance of
microbial species. Therefore, many of the bacterial species represented both in cultivation-
based techniques and in newer molecular techniques may be minor constituents of the
intestinal microbiota, agreeing with estimates that about 99% of the intestinal bacterial
population is composed of only 30 to 40 general species (Draser and Barrow, 1985).
Similarly, analysis of the turkey ileal bacterial community in this current study identified 41 distinct bands when combining distinct PCR-DGGE bands of all samples. There was a 259
maximum of 21 bands within a single sample. These results are consistent with other authors
who observed 38 distinct bands from fecal samples of humans (Zoetendal et al., 1998), 35
bands from fecal samples of pigs (Simpson et al., 2000), 32 bands from fecal samples of
mice (McCracken et al., 2001), and 41 bands from cecal samples of turkeys (Waters et al.,
2005).
This study demonstrated the utility of PCR-DGGE analysis for monitoring diet- and enzyme-induced alterations of the complex intestinal microbial ecosystem and correlating these changes with Salmonella infection in the turkeys. This cultivation independent technique is less time-consuming and less labor-intensive than traditional microbiological techniques. This technique can also be used to evaluate the effect of other dietary treatments, drug treatments, or disease conditions on intestinal microbial populations. The results of this current study confirm that PCR-DGGE is a useful tool to study shifts in gastrointestinal microflora of birds (Hume et al., 2003; Waters et al., 2005).
In conclusion, the total microbial population as well as the diversity of the bacterial community was influenced by dietary NSP and enzyme supplementation. The NSP content of cereal grain-based diets (i.e. wheat, triticale, and rye) and enzyme dietary supplementation increased microbial community diversity and discouraged Salmonella colonization in turkey intestine. Thus, NSP and dietary exogenous enzyme supplementation may be a practical tool to control enteric pathogens and benefit intestinal health and food safety.
260
ACKNOWLEDGMENTS
This work was supported by the North Carolina Agricultural Foundation and the
United States Department of Agriculture. The authors wish to thank Annette Israel, Jamie
Warner, Jean de Oliveira, Yuwares Sungwarapon, Ondulla Foye, Renee Plunske, Mike
Mann, Robert Neely, Pam Jenkins, and the NCSU Poultry Educational Unit farm employees
for their technical assistance during this trial. Appreciation is also extended to Dr. Sophia
Kathariou and Robin Siletzky from Food Science Dept., NCSU, Raleigh, NC for technical assistance and equipment support of BioNumerics software.
261
5.6 TABLES AND FIGURES
TABLE 1: Enzyme product, dietary inclusion level, and target enzyme activity in the experimental diets1
Inclusion rate Activity in feed Enzyme Product (kg enzyme/tonne feed) (EXU/kg feed)2 XY13 0.5 2500 XY24 0.2 650 1Products supplied by Danisco Animal Nutrition, Witshire, UK. Data from Danisco, 2003. 2Endo-xylanase Unit (EXU) = One endo-xylanase unit is defined as the enzyme activity required to liberate 1 µmol reducing sugar (measured as glucose equivalents) per minute from a 1% xylan solution at pH 3.5 and 40ºC. 3 XY1 = Avizyme 1302 supplemented to the wheat-based diet (treatment 2). 4XY2 = Avizyme 1500 supplemented to the corn-based diet (treatment 4).
262
TABLE 2: Composition and nutrient content of the wheat-based diets6 fed to turkeys from 1 to 113 days
Prestarter Starter Grower Developer Ingredients 1-28 d 29-56 d 57-84 d 85-113 d
(%) Wheat 36.25 37.10 46.12 52.00 SBM-48 35.82 38.01 30.58 20.86 Wheat middlings 8.00 8.00 8.00 10.00 Triticale 9.00 8.00 8.00 10.00 Corn Gluten Meal 5.00 1.86 0.00 0.00 Dical Phosphate (18.5%) 2.19 1.68 1.28 1.08 Limestone 1.46 1.24 1.14 1.05 Soy Oil 1.00 3.00 3.86 4.00 Salt 0.35 0.30 0.22 0.22 Mineral Premix (TM-90)1 0.20 0.20 0.20 0.20 D,L-Methionine 0.13 0.13 0.10 0.04 L-Threonine 0.00 0.00 0.00 0.08 L-Lysine HCl 0.30 0.18 0.20 0.17 Vitamin Premix (NCSU-90)2 0.20 0.20 0.20 0.20 Selenium Premix3 0.8 0.8 0.8 0.8 Calculated Analysis Crude Protein, % 26.70 25.73 22.00 18.50 ME, kcal/kg 2694.6 2800.0 2900.0 2951.9 Calcium, % 1.2 1.0 0.85 0.75 Phosphorus, % 0.93 0.83 0.72 0.67 Avail. P, % 0.60 0.50 0.42 0.38 Fat, % 2.63 4.49 5.35 5.58 Fiber, % 3.06 3.07 3.01 3.03 Metionine, % 0.54 0.52 0.42 0.31 Cysteine, % 0.45 0.43 0.38 0.34 Met+Cys, % 1.00 0.95 0.80 0.65 Lysine, % 1.56 1.50 1.30 1.02 Sodium, % 0.17 0.15 0.12 0.12 Chemical Analysis (dry matter basis)4 Dry Matter, % 92.3 89.3 92.3 92.2 Crude Protein, % 28.60 27.70 24.10 20.04 Gross Energy, kcal/kg 4239.7 4352.3 4345.7 4320.2 Fat (Ether extraction), % 2.80 4.68 6.06 6.10 Ash, % 7.45 6.99 6.16 5.63 Fiber Total5, % 19.86 Insoluble, % 17.89 Soluble, % 1.98 1 . . Supplied the following per kilogram of feed: 120 mg Zn as ZnSO4 H2O; 120 mg MN as MnSO4 H2O; 80 mg Fe as . FeSO4 H2O; 10 mg Cu as CuSO4; 2.5 mg I as Ca(IO3)2; 1.0 mg Co as CoSO4. 2Supplied the following per kilogram of feed: vitamin A, 26,400 IU; cholecalciferol, 8,000 IU; niacin, 220 mg; pantothenic acid, 44 mg; riboflavin, 26.4 mg; pyridoxine, 15.8 mg; menadione, 8 mg; folic acid, 4.4 mg; thiamin, 8 mg; biotin, 0.506 mg; vitamin B12, 0.08 mg; ethoxyquin, 200 mg. The vitamin E premix provided the necessary amount of vitamin E as DL-α- tocopheryl acetate. 3Selenium premix provided 0.3 ppm Se from sodium selenate. 4Chemical analysis: (1) Crude protein used Kjeldahl automatic analyzer (Kjeltec Auto 1030 Analyser, Tecator, Sweden), (2) Gross Energy used Bomb Calorimeter (IKA Calorimeter System C5000 control, IKA® Werke Labortechnik, Staufen, Germany), (3) Fat used Ether Extract method, and (4) Ash used Muffle Oven method. 5Dietary Fiber analyses were performed on a pool sample. 500 g samples of feed from each feed phase of wheat-based diet were blended together to form the pool sample prior to analysis. The fiber analyses were performed using the Megazyme Total Dietary Fiber Assay Kit (Megazyme International Ireland Ltd., Co. Wicklow, Ireland). 6Treatments WC and WE were fed wheat-based diets. 263
TABLE 3: Composition and nutrient content of the corn-based diets6 fed to turkeys from 1 to 113 days
Prestarter Starter Grower Developer Ingredients 1-28 d 29-56 d 57-84 d 85-113 d
(%) Corn 34.76 38.19 43.66 52.00 SBM-48 36.15 35.43 30.11 23.07 Triticale 10.00 8.00 10.00 10.00 Wheat Middlings 10.00 10.00 10.00 10.00 Corn gluten 3.00 3.00 0.00 0.00 Dical Phosphate (18.5%) 2.38 2.13 1.92 1.68 Limestone 0.84 1.00 0.77 0.68 Soy Oil 1.60 1.00 2.32 1.60 Salt 0.39 0.37 0.37 0.37 Mineral Premix (TM-90)1 0.20 0.20 0.20 0.20 D,L-Methionine 0.13 0.13 0.11 0.10 L-Threonine 0.00 0.00 0.00 0.00 L-Lysine HCl 0.25 0.25 0.24 0.00 Vitamin Premix (NCSU-90)2 0.20 0.20 0.20 0.20 Selenium Premix3 0.80 0.80 0.80 0.80 Calculated Analysis Crude Protein, % 25.18 24.90 21.22 19.00 ME, kcal/kg 2800.0 2783.8 2900.0 3017.87 Calcium, % 1.0 1.0 0.85 0.75 Phosphorus, % 0.95 0.90 0.83 0.77 Avail. P, % 0.60 0.55 0.50 0.45 Fat, % 3.98 3.50 4.88 4.51 Fiber, % 3.16 3.15 3.12 3.15 Metionine, % 0.53 0.52 0.44 0.41 Cysteine, % 0.42 0.42 0.36 0.34 Met+Cys, % 0.95 0.94 0.80 0.75 Lysine, % 1.50 1.48 1.30 0.96 Sodium, % 0.18 0.17 0.17 0.17 Chemical Analysis (dry matter basis)4 Dry Matter, % 89.2 89.3 91.5 91.1 Crude Protein, % 27.7 26.21 22.90 18.92 Gross Energy, kcal/kg 4325.4 4251.7 4241.0 4216.5 Fat (Ether extraction), % 4.12 3.83 5.50 4.77 Ash, % 6.53 6.97 6.29 5.72 Fiber Total5, % 16.14 Insoluble, % 14.51 Soluble, % 1.63 1 . . Supplied the following per kilogram of feed: 120 mg Zn as ZnSO4 H2O; 120 mg MN as MnSO4 H2O; 80 mg Fe as . FeSO4 H2O; 10 mg Cu as CuSO4; 2.5 mg I as Ca(IO3)2; 1.0 mg Co as CoSO4. 2Supplied the following per kilogram of feed: vitamin A, 26,400 IU; cholecalciferol, 8,000 IU; niacin, 220 mg; pantothenic acid, 44 mg; riboflavin, 26.4 mg; pyridoxine, 15.8 mg; menadione, 8 mg; folic acid, 4.4 mg; thiamin, 8 mg; biotin, 0.506 mg; vitamin B12, 0.08 mg; ethoxyquin, 200 mg. The vitamin E premix provided the necessary amount of vitamin E as DL-α- tocopheryl acetate. 3Selenium premix provided 0.3 ppm Se from sodium selenate. 4Chemical analysis: (1) Crude protein used Kjeldahl automatic analyzer (Kjeltec Auto 1030 Analyser, Tecator, Sweden), (2) Gross Energy used Bomb Calorimeter (IKA Calorimeter System C5000 control, IKA® Werke Labortechnik, Staufen, Germany), (3) Fat used Ether Extract method, and (4) Ash used Muffle Oven method. 5Dietary Fiber analyses were performed on a pool sample. 500 g samples of feed from each feed phase of corn-based diet were blended together to form the pool sample prior to analysis. The fiber analyses were performed using the Megazyme Total Dietary Fiber Assay Kit (Megazyme International Ireland Ltd., Co. Wicklow, Ireland). 6Treatments CC and CE were fed corn-based diets. 264
(A) 9000
8000
7000
6000 5000
4000
3000
2000
Band Surface Area (Average Surface)Band (Average Surface Area 1000
0 WC WE CC CE
(B)
100000
90000
80000
70000
60000
50000
40000
30000
20000
(TotalBand Surface Area Surface) 10000
0 WC WE CC CE FIGURE 1: Band surface area plots of polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) bands from ileum content of 16 week-old turkeys fed wheat-based diet with and without enzyme supplementation (WE and WC, wheat-enzyme and wheat-control, respectively) and corn-based diet with and without enzyme supplementation (CE and CC, corn-enzyme and corn-control, respectively). Band surface area corresponds to measurements of the optical density of each band. The optical density were measured based on the plotted band intensity and migration distance. Each band formed a peak relative to its intensity and migration distance, which the area underneath the peaks were measured by the BioNumerics software (Applied Maths, Austin, TX). The scale of the y-axis represents the optical density of each band. (A) Average surface area was determined by averaging the surface area of the bands within each lane of each treatment. (B) Total surface area was determined by summing all bands surface area within each lane of each treatment. 265
(A) 16 a
14
ab 12 b b 10
8
6
4 Number of Bands (Richness, S) 2
0 WC WE CC CE
(B) 14
12
10
8
6
4
Bands Number of Common 2
0 0-10 10-20 20-30 30-40 40-50 50-60 60-70 70-80 % of Samples With Band
FIGURE 2: Number and frequency distribution of polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) bands from ileum content of 16 week-old turkeys fed wheat-based diet with and without enzyme supplementation (WE and WC, wheat-enzyme and wheat-control, respectively) and corn-based diet with and without enzyme supplementation (CE and CC, corn-enzyme and corn-control, respectively). (A) Band number, S-index or species richness corresponds to the average number of DGGE bands from the samples for the corresponding treatment group. Treatment groups sharing different superscript letters are different (P<0.05). (B) The frequency distribution of DGGE gel bands is expressed as the number of common bands observed within all the samples. Thus, 14 bands were expressed in 0-10% of the DGGE gel lanes, whereas only 1 band was expressed in 70-80% of all samples. 266
(A) 45
40
35
) 30 s
25
20
% Similarity (C % Similarity 15
10
5
0 WC WE CC CE
(B) 40 a 35
b 30 b bc )
s 25 cd d 20
15 (C % Similarity 10
5
0 WC-CC WE-CE WC-CE WC-WE CC-CE CC-WE
FIGURE 3: Percentage of similarities for polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) banding patterns from ileum content of 16 week-old turkeys fed wheat-based diet with and without enzyme supplementation (WE and WC, wheat-enzyme and wheat-control, respectively) and corn-based diet with and without enzyme supplementation (CE and CC, corn-enzyme and corn-control, respectively). Sorenson’s similarity index was used to compare average percentage similarities of PCR-DGGE banding patterns (based on the average number of bands in common) within each treatment group (Figure A) and between treatment groups (Figure B). Calculations are based on the formula: Cs = [2j/(a+b)]x100, where a is the number of PCR-DGGE bands in lane 1, b is the number of PCR-DGGE bands in lane 2 and j is the number of common PCR-DGGE bands within bands 1 and 2. Values represent means from each group of comparison. Values not sharing a common superscript letter are different (P< 0.05). 267
(A) 2.5 a
ab ab 2.0 b
1.5
1.0
0.5 H') (Diversity, Index Shannon's
0.0 WC WE CC CE
0.95 (B) a a
) H 0.90 ab
0.85
b
0.80
0.75
Shannon's Equitability (Evenness, E 0.70 WC WE CC CE
FIGURE 4: Diversity and evenness indexes of polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) bands from ileum contents of 16 week-old turkeys fed wheat-based diet with and without enzyme supplementation (WE and WC, wheat-enzyme and wheat-control, respectively) and corn-based diet with and without enzyme supplementation (CE and CC, corn-enzyme and corn-control, respectively). (A) Diversity was calculated using the Shannon’s index (H’ index) based on the formula: H’ = –Σpi ln pi, where pi is the proportion of individuals in the population belonging to the ith species, which corresponds to the proportional abundance of band i. (B) Evenness was calculated using the Shannon’s equitability index (EH index) based on the formula: EH = H’/lnS, where H’ is the H’ index calculated as previously mentioned, and S is the total number of species in the community (total number of PCR-DGGE bands). Values represent means from the samples for the corresponding treatment group. Values not sharing a common superscript letter are different (P< 0.05). 268
■ WC ■ WC ■ WC ■ WC ■ WC ■ WC ● CC ● CC ● CC ● CC ● CC ● CC ● CC ▲WE ♥ CE ♥ CE ▲WE
♥ CE ♥ CE ♥ CE ♥ CE ♥ CE ▲WE ▲WE ▲WE ▲WE ■ WC ▲WE
FIGURE 5: Dendrogram representing dietary and enzyme supplementation associated correlations of polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) banding patterns of ileum contents of 16 week-old turkeys fed wheat-based diet with and without enzyme supplementation (wheat-control and wheat-enzyme, respectively) and corn-based diet with and without enzyme supplementation (corn-control and corn-enzyme, respectively). The dendrogram was constructed using Unweighted Pair Group Method with Arithmatic Mean (UPGMA) and the BioNumerics software (Applied Maths, Austin, TX). The values on the dendrogram are cophenetic correlation values. Cophenetic correlation is a parameter to express the consistence of a cluster (BioNumerics, 2003). In BioNumerics software the value was calculated for each cluster (branch) thus estimating the faithfulness of each subcluster of the dendrogram. Clusters (groups) were determined by sequentially comparing the patterns and the construction of a relatedness tree (dendrogram) reflecting the relative similarities. The amount of similarity is reflected by the relative closeness or grouping and is indicated by the percentage coefficient bar located above the dendrogram. Squares indicate PCR-DGGE pattern obtained from ileum samples from turkeys receiving wheat-control diet (WC). Circles indicate PCR-DGGE pattern obtained from ileum samples from turkeys receiving corn-control diet (CC). Triangles indicate PCR-DGGE pattern obtained from ileum samples from turkeys receiving wheat-based diet supplemented with enzyme (WE). Hearts indicate PCR-DGGE pattern obtained from ileum samples from turkeys receiving corn-based diet supplemented with enzyme (CE). Distances are measured in arbitrary units.
269
5.7 REFERENCES
Akiba, T., and K. Horikoshi, 1988. Xylanases of alkalophilic thermophilic Bacillus. Methods Enzymol. 160:655-659. Amann, R., W. Ludwig, and K.H. Schleifer, 1995. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol. Rev. 59:143-169. Andrew, V.K., T.W. Shirkey, R.H. Siggers, M.D. Drew, and B. Laarveld, 2004. Commensal bacteria and intestinal development: studies using gnotobiotic pigs. Pages 47-59. In: Interfacing immunity, gut health and performance. L.A. Tucker, and J.A. Taylor-Pickard, eds. Nottingham University Press, Nottingham, United Kingdom. Annison, G., 1993. Corrigendum – The role of wheat non-starch polysaccharides in broiler nutrition. Aust. J. Agric. Res. 44(3):405-422. Apajalahti, J.H.A., L.K. Sarkilahti, B.R.E. Maki, J.P. Heikkinen, P.H. Nurminen, and W. E. Holben, 1998. Effective recovery of bacterial DNA and percent-guanine-plus-cytosine- based analysis of community structure in the gastrointestinal tract of broiler chickens. Appl. Environ. Microbiol. 64:4084-4088. Bach Knudsen, K.E., B.B. Jensen, J.O. Andersen, and I. Hansen, 1991. Gastrointestinal implications in pigs of wheat and oat fractions. 2. Microbial activity in the gastrointestinal tract. Br. J. Nutr. 65:233-248. Bach Knudsen, K.E., 1997. Carbohydrate and lignin contents of plant materials used in animal feeding. Anim. Feed Sci. Technol. 67:319-338. Bach Knudsen, E.E., 2001. The nutritional significance of “dietary fibre” analysis. Anim. Feed Sci. Technol. 90:3-20. Bach Knudsen, K.E., and H. Jorgensen, 2001. Intestinal degradation of dietary carbohydrates – from birth to maturity. Pages 109-120. In: Digestive physiology of pigs. J.E. Lindberg, and B. Ogle, eds. CABI Publishings, Wallingford. Bartelt, J., A. Jadamus, F. Wiese, E. Swiech, L. Buraczewska, and O. Simon, 2002. Apparent precaecal digestibility of nutrients and level of endogenous nitrogen in digesta of the small intestine of growing pigs as affected by various digesta viscosities. Arch. Anim. Nutr. 56:93-107. Bataillon, M., A.P.N. Cardinali, N. Castillon, and F. Duchiron, 2000. Purification and characterization of a moderately thermostable xylanase from Bacillus sp. Strain SPS-0. Microb. Technol. 26:187-192. BioNumerics, 2003. The BioNumerics manual. Version 3.5. Applied Maths BVBA, Austin, TX. Choct, M., and G. Annison, 1992. Anti-nutritive effect of wheat pentosans in broiler: roles of viscosity and gut microflora. Br. Poult. Sci. 33:821-834.
270
Collier, C.T., M.R. Smiricky-Tjardes, D.M. Albin, J.E. Wubben, V.M. Gabert, B. Deplancke, D. Bane, D.B. Anderson, and H.R. Gaskins, 2003a. Molecular ecological analysis of porcine ileal microbiota responses to antimicrobial growth promoters. J. Anim. Sci. 81: 3035-3045. Collier, C.T., J.D. van der Klis, B. Deplancke, D.B. Anderson, and H.R. Gaskins, 2003b. Effects of tylosin on bacterial mucolysis, Clostridium perfringens colonization, and intestinal barrier function in a chick model of necrotic enteritis. Antimicrobial Agents Chemother. 47: 3311-3317. Cross-Smiecinski, A.J., 2002. Quality Assurance. Pages: 158-165. In: Manual of Environmental Microbiology. Hurst, C.J., Crawford, R.L., Knudsen, G.R., McInerney, M.J., Stetzenbach, L.D., eds., 2nd rev. ed. ASM Press, Washington, DC, USA. Danisco, 2003. Technical information from Danisco Animal Nutrition. Witshire, UK. Personal communication. Denise, D., 2004. Regulation of gut function and immunity. Pages 61-76. In: Interfacing immunity, gut health and performance. L.A. Tucker, and J.A. Taylor-Pickard, eds. Nottingham University Press, Nottingham, United Kingdom. Draser, B.S., and P.A. Barrow, 1985. Intestinal microbiology. American Society for Microbiology, Washigton, DC. Eichner C.A., R.W. Erb, K.N. Timmis, and I. Wagner-Dobler, 1999. Thermal gradient gel electrophoresis analysis of bioprotection from pollutant shocks in the activated sludge microbial community. Appl. Environ. Microbiol. 65:102-109. Falk, P.G., L.V. Hooper, T. Midtvedt, and J.I. Gordon, 1998. Creating and maintaining the gastrointestinal ecosystem: what we know and need to know from gnotobiology. Microbiol. Mol. Biol. Rev. 62: 1157-1170. Ferket, P.R., 1991. Effect of diet on gut microflora of poultry. Zootecnica International. July/August: 44-49. Ferket, P.R., and A.A. Santos Jr., 2005. How nutrition influences gut health and pathogen colonization? Proceedings of the 2nd Alltech’s Annual Brazilian Feed Industry Symposium – the Premier Brazilian Meeting for Animal Nutrition. Curitiba, Parana, Brazil, August 28-30. Foucher, A.L.J.L., T. Bongers, L.R. Noble, and M.J. Wilson, 2004. Assessment of nematode biodiversity using DGGE of 18S rDNA following extraction of nematodes from soil. Soil Biol. Biochem. 36:2027-2032. Fraga, M.J., P.P. Ayala, R. Carabano, and J.C. Blas, 1991. Effect of type of fiber on the rate of passage and on the contribution of soft feces to nutrient intake of finishing rabbits. J. Anim. Sci. 69:1566-1574. Fuller, R., 1977. The importance of lactobacilli in maintaining normal microbial balance in the crop. Br. Poult. Sci. 18:85-94.
271
Gestel, G., P. Besancon, and J.M. Rouanet, 1994. Comparative evaluation of the effects of two different forms of dietary fibre (rice bran vs. wheat bran) on rat colonic mucosa and faecal microflora. Ann. Nutr. Metab. 38:249-256. Hancock, R.E.W., and A. Rozek, 2002. Role of membranes in the activities of antimicrobial cationic peptides. FEMS Microbiol. Lectt. 206:143-149. Hentschel, U., Steinert M., and J. Hacker, 2000. Common molecular mechanisms of symbiosis and pathogenesis. Trends Microbiol. 8:226-231. Hill, M.O., 1973. Diversity and evenness: a unifying notation and its consequences. Ecology. 54: 427. Hogberg, A., 2003. Cereal non-starch polysaccharides in pig diets: influence on digestion site, gut environment and microbial populations. Ph.D. Thesis, Swedish University of Agricultural Science, Uppsala. Hogberg, A., J.E. Lindberg, 2004. Influence of cereal non-starch polysaccharides and enzyme supplementation on digestion site and gut environment in weaned piglets. Anim. Feed Sci. Technol. 116:113-128. Hoj, L., R.A. Olsen, and V.L. Torsvik, 2005. Archaeal communities in high artic wetlands at Spitsbergen, Norway (79ºN) as characterized by 16S rRNA gene fingerprinting. FEMS Microbiol. Ecol. Article In Press. Hume, M.E., L.F. Kubena, T.S. Edrington, C.J. Donskey, R.W. Moore, S.C. Ricke, and D.J. Nisbet, 2003. Poultry digestive microflora biodiversity as indicated by denaturing gradient gel electrophoresis. Poult. Sci. 82:1100-1107. Ishii, K., and S. Takii, 2003. Comparison of microbial communities in four different composting processes as evaluated by denaturing gradient gel electrophoresis analysis. J. Appl. Microbiol. 95:109-119. Ishizuka, S., and S. Tanaka, 2002. Modulation of CD8+ intraepithelial lymphocyte distribution by dietary fiber in the rat large intestine. Exp. Biol. Med. 227: 1017-1021. Ishizuka, S., S. Tanaka, H. Xu, and H. Hara. 2004. Fermentable dietary fiber potentiates the localization of immune cells in the rat large intestinal crypts. Exp. Biol. Med. 229:876- 884. Joerger, R.D., 2003. Alternatives to antibiotics: bacteriocins, antimicrobial peptides and bacteriophages. Poult. Sci. 82:640-647. Kass, M.L., P.J. Van Soest, and W.G. Pond, 1980. Utilization of dietary fiber alfafa by growing swine. 2. Volatile fatty acid concentrations in an disappearance from the gastrointestinal tract. J. Anim. Sci. 50:192-197. Kirk, J.L., L.A. Beaudette, M. Hart, P. Moutoglis, J.N. Klironomos, H. Lee, and T. Trevors, 2004. Methods of studying soil microbial diversity. J. Microbiol. Methods. 58: 169-188.
272
Konstantinov, S.R., W.Y. Zhu, B.A. Williams, S. Tamminga, W.M. Vos, and A.D.L. Akkermans, 2003. Effect of fermentable carbohydrates on piglet faecal bacterial communities as revealed by denaturing gradient gel electrophoresis analysis of 16S ribosomal DNA. FEMS Microbiol. Ecol. 43:225-235. Krause D.O., R.A. Easter, B.A. White, and R.I. Mackie, 1995. Effect of weaning diet on the ecology of adherent lactobacilli in the gastrointestinal tract of the pig. J. Anim. Sci. 73:2347-2354. Lan, Y., 2004. Gastrointestinal health benefits of soy water-soluble carbohydrates in young broiler chickens. Ph.D. Thesis, Wageningen University, The Netherlands, 269 pp. Lane, D.J., B. Pace, G.J. Olsen, D.A. Stahl, M.L. Sogin, and N.R. Pace, 1985. Rapid determination of 16S ribosomal RNA sequences for phylogenetic analysis. Proceedings of the National Academy of Science USA 82:6955-6959. Langhout, D.J., J.B. Schutte, J. de Jong, H. Sloetjes, M.W.A. Verstegen, and S. Tamminga, 2000. Effect of viscosity on digestion of nutrients in conventional and germ-free chicks. Br. J. Nutr. 83:533-540. Le Blay, G., H.M. Bottiere, and C. Cherubt, 1999. Prolonged intake of fructo- oligosaccharides induces a short-term elevation in lactic acid-producing bacteria and a persistent increase in cecal butyrate in rats. J. Nutr. 129:2231-2235. Lesser, T.D., R.H. Lindecrona, B.B. Jensen, and K. Molier, 2000. Changes in bacterial community structure in the colon of pigs fed different experimental diets and after infection with Brachyspira hyodysenteriae. Appl. Environ. Microbiol. 66:3290-3296. Liu, W.T., and D.A. Stahl, 2002. Molecular approaches for the measurement of density, diversity, and phylogeny. Pages: 114-134. In: Manual of Environmental Microbiology. Hurst, C.J., Crawford, R.L., Knudsen, G.R., McInerney, M.J., Stetzenbach, L.D., eds., 2nd rev. ed. ASM Press, Washington, DC, USA. Magurran A., 1988. Diversity indices and species abundance models. Pages 8-45. In: Ecological Diversity and Its Measurement. Princeton University Press, Princeton, NJ. McCracken, V.J., J.M. Simpson, R.I. Mackie, and H.R. Gaskins, 2001. Molecular ecological analysis of dietary and antibiotic-induced alterations of the mouse intestinal microbiota. J. Nutr. 131:1862-1870. Minamida, K., I.N. Sujaya, A.Tamura, N. Shigematsu, T. Sone, A. Yokota, K. Asano, Y. Benno, and F. Tomita, 2004. The effects of Di-D-Fructofuranose-1,2’:2,3’-Dianhydride (DFA III) administration on human intestinal microbiota. J. Biosci. Bioeng. 98(4):244- 250. Montagne, L., J.R. Pluske, and D.J. Hampson. 2003. A review of interactions between dietary fibre and the intestinal mucosa, and their consequences on digestive helath in young non-ruminant animals. Anim. Feed Sci. Technol. 108:95-117. Moore, L.V.H., and L.H. Moore, 1995. Intestinal floras of populations that have a high risk of colon cancer. Appl. Environ. Microbiol. 61:3202-3207. 273
Moore, W.E., and L.V. Holdeman, 1974. The normal flora of 20 Japanese-Hawaiians. Appl. Microbiol. 27:961-979. Muyzer, G., E.C. De Wall, and A.G. Uitterlinden, 1993. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 59:695-700. Muyzer G., and K. Smalla, 1998. Application of denaturing gradient gel electrophoresis (DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial ecology. Antonie Leeuwenhoek 73:127-141. Muyzer G., T. Brinkhoff, U. Nübel, C. Santegoeds, H. Schäfer, and Wawer, 1998. Denaturant gradient gel electrophoresis in microbial ecology. Pages 1-27. In: Molecular Microbial Ecology Manual. A. Akkermans, J.D. van Elsas, F. de Bruijn, eds. Vol. 3.4.4. Kluwer Academic Publishers, Boston, MA. Muyzer, G., 1999. DGGE/TGGE a method for identifying genes from natural ecosystems. Curr. Opin. Microbiol. 2:317-322. National Research Council (NRC), 1994. Nutrient Requirements of Poultry. 9th Rev. Ed. National Academy Press, Washington, DC. Nousiainen, J., and J. Setala, 1998. Lactic acid bacteria as animal probiotics. Pages 437-473. In: Lactic Acid Bacteria: Microbiology and functional aspects. S. Salminen, and A. Wright, Marcel Dekker, NY. Nübel U., F. Garcia-Pinchel, M. Kühl, and G. Muyzer, 1999. Quantifying microbial diversity: morphotypes, 16S rRNA genes, and carotenoids of oxygenic phototropes in microbial mats. Appl. Environ. Microbiol. 65:422-430. Palys, T., L.K. Nakamura, and F.M. Cohan, 1997. Discovery and classification of ecological diversity in the bacterial world: the role of DNA sequence data. Int. J. Syst. Bacteriol. 47:1145-1156. Raskin, L., W. Capman, R. Sharp, L. Poulsen, and D. Stahl, 1997. Molecular ecology of gastrointestinal ecosystems. Pages: 243-298. In: Gastrointestinal microbiology. R.I. Mackie, B.A. White, and R.E. Isaacson, eds. Vol 2. Chapman and Hall, New York, NY. Rasmussen L.D., and S.J. Sörensen, 1998. The effect of longterm exposure to mercury on the bacterial community in marine sediment. Curr. Microbiol. 36:291-297. Rastall, R.A., G.R. Gibson, H.S. Gill, F. Guarner, T.R. Klaenhammer, B. Pot, G. Reid, I.R. Rowland, and M.E. Sanders, 2005. Modulation of the microbial ecology of the human colon by probiotics, prebiotics and synbiotics to enhance human health: An overview of enabling science and potential applications. FEMS Microbiol. Ecol. 52: 145-152. Remus, J., 2003. Control strategies for salmonella in swine discussed. Dec. 22, 2003: 14-16. Roberfroid, M.B., F. Bornet, C. Bouley, and J.H. Cummings, 1995. Colonic microflora: nutrition and health: summary and conclusions of an International Life Sciences Institute (ILSI). Workshop held in Barcelona, Spain. Nutr. Rev. 53:127-130. 274
SAS Institute Inc., 1996. SAS/STAT User’s Guide, Version 6, Fourth Edition, Vol. 2. SAS Proprietary Software Release 6.12. SAS Institute, Inc., Cary, NC. Shannon C.E., and W. Weaver, 1949. The Mathematical Theory of Communication. University of Illinois Press Urbana, IL. Simon, O., W. Vahjen, and D. Taras, 2004. Interaction of nutrition with intestinal microbial communities. Pages 33-46. In: Interfacing immunity, gut health and performance. L.A. Tucker, and J.A. Taylor-Pickard, eds. Nottingham University Press, Nottingham, United Kingdom. Simpson J.M., V.J. McCracken, B.A. White, H.R. Gaskins, and R.I. Mackie, 1999. Application of denaturant gradient gel electrophoresis for the analysis of the porcine gastrointestinal microbiota. J. Microbiol. Methods. 36:167-179. Simpson J.M., V.J. McCracken, H.R. Gaskins, and R.I. Mackie, 2000. Denaturing gradient gel electrophoresis analysis of 16S rDNA amplicons to monitor changes in fecal bacterial populations of weaning pigs after introduction of Lactobacillus reuteri strain MM53. Appl. Environ. Microbiol. 66:4705-4711. Sneath P.H., and R.R. Sokal, 1973. Numerical Taxonomy: The Principles and Practice of Numerical Classification. W. H. Freeman & Company, San Francisco, CA. Suau, A., R. Bonnet, M. Sutren, J.J. Godon, G.R. Gibson, M.D. Colins, and J. Dore, 1999. Direct analysis of genes encoding 16S rRNA from complex communities reveals many novel molecular species within the human gut. Appl. Environ. Microbiol. 65:4799-4807. Svihus, B., 2001. Research note: a consistent low starch digestibility observed in pelleted broiler chicken diets containing high levels of different wheat varieties. Anim. Feed Sci. Technol. 92:45-49. Torsvik, V., F.L. Daae, R.A. Sandaa, and L. Ovreas, 1998. Novel techniques for analyzing microbial diversity in natural and perturbed environments. J. Biotechnol. 64:53-62. Trowell, H., D.A.T. Southgate, T.M.S. Wolever, A.R. Leeds, M.A. Gussell, and D.J.A. Jenkins, 1976. Dietary fiber redefined. Lancet. 1: 967. Tsai Y.L., and B.H. Olsen, 1992. Rapid method for separation of bacterial DNA from humic substances in sediments for polymerase chain reaction. Appl. Environ. Microbiol. 58:2292-2295. Uchino, F., and T. Nakane, 1981. A thermostable xylanase from a thermophilic acidophilic Bacillus sp. Agric. Biol. Chem. 45:1121-1127. Van Laere, K.M.J., M. Bosveld, H.A. Schols, G. Beldman, and A.G.J. Voragen. 1997. Fermentative degradation of plant cell wall derived oligosaccharides by intestinal bacteria. Pages: 37-46. In: Proceedings, International Symposium Non-digestable oligosaccharides: healthy food for the colon? Hartemink, R., ed. Wageningen Graduate School VLAG, Wageningen. Vaughan, E.E., F. Schut, H.G.H.J. Helig, E.G., W.M. de Vos, and A.D.L. Akkermans, 2000. A molecular view of the intestinal ecosystem. Curr. Issues Intest. Microbiol. 1:1-12. 275
Waters, S.M., C.F. Duffy, and R.F.G. Power, 2005. PCR-DGGE analysis of caecal microflora of NatustatTM supplemented turkeys challenged with Histomonas meleagridis. Int. J. Poult. Sci. 4(9):620-627. Wilson K.H., and R.B. Blitchington, 1996. Human colonic biota studied by ribosomal DNA sequence analysis. Appl. Environ. Microbiol. 62:2273-2278. Wise, A., A.K. Mallet, and I.R. Rowland, 1986. Effect of mixtures of dietary fibers on the enzyme activity of the rat caecal microflora. Toxicology 38:241-248. Yan, S.S., and J.M. Gilbert, 2004. Antimicrobial drug delivery in food animals and microbial food safety concerns: an overview of in vitro and in vivo factors potentially affecting the animal gut microflora. Adv. Drug Deliv. Rev. 56:1497-1521. Zoetendal, E.G., A.D.L. Akkermans, and W.M. De Vos, 1998. Temperature gradient gel electrophoresis analysis of 16S rRNA from human fecal samples reveals stable and host- specific communities of active bacteria. . Appl. Environ. Microbiol. 64: 3854-3859.
276
CHAPTER 6
SUMMARY
277
World poultry consumption has been on an upward trend for many years and it will continue as poultry becomes the world’s primary choice meat product during the next decade or two. The modern commercial broiler and turkey continues to show increased yearly
genetic gains. Poultry has become susceptible to enteric health problems. Intestinal health has
a major influence on growth performance of poults and chicks as it affects feed digestion,
nutrient absorption, and mortality. In addition, intestinal health is associated with animal infectious diseases and enteric foodborne pathogen colonization. Therefore, intestinal health impacts the poultry industry through animal productivity and contamination of poultry products for human consumption.
Salmonella enterica subspecies enterica is a common pathogen of many species of mammals and birds. It is one of the most common causes of bacterial gastroenteritis in human, and it is usually associated with the ingestion of contaminated chicken eggs, egg products, or poultry meat. Much effort has been made to inhibit Salmonella infection in
poultry. However, the prevention of Salmonella colonization of poultry intestine is still a current concern. Methods that could control Salmonella at the pre-harvest level could help to
reduce contamination levels at the processing plant. When contamination levels of poultry
are reduced prior to arrival at the slaughter house, cross-contamination of carcasses and the final product may be reduced or eliminated during processing.
Intestinal health is a complex condition influenced by the diet, the microflora, and the intestinal mucosa. Each of these elements interact one with the other in order to maintain a dynamic equilibrium ensuring function of the digestive system and lack of pathology, a state defined as enteric health. Diet, among other environmental and genetic factors, has an 278
important role in intestinal health and disease of animals and humans. Several benefits have been associated with the presence of non-starch polysaccharides (NSP) in the diet.
Manipulation of the dietary NSP composition and NSP-hydrolyzing enzyme supplementation
in order to change the microflora profile and promote enteric health has been proposed as a
prominent program to control pathogen colonization of intestine of humans and animals.
The hypothesis tested in this dissertation was that dietary exogenous enzyme
supplementation and NSP promotes intestinal health and discourages the colonization of
Salmonella spp. in turkey intestine, improving growth performance and reducing the
presence of potential pathogenic microorganisms in turkeys. To test this hypothesis four
experiments were performed (Figure 1), and their results and discussion are summarized
bellow.
The first experiment, reported in Chapter 2 of this dissertation, determined if the
adverse effects of non-starch polysaccharides (NSP) on intestinal size and histomorphometry
of turkeys fed wheat-based diets might be alleviated by dietary supplementation of
endoxylanase (to address problems of excessive digesta viscosity) or phospholipase (to
address fat digestibility problems). A blend of different enzymes was supplemented to the
diet such that it contained the same level of endoxylanase activity in the feed (5,500 EXU/kg)
as supplemented from an endoxylanase-exclusive product produced by a genetically
modified organism. This treatment design allowed the evaluation of the effect of dietary
endoxylanase supplemented alone (as a single enzyme product, EE) or in combination with
several other enzymes (as an enzyme blend product, BL). Phospholipase (500 phospholipase
units per kg feed) was also used to test the hypothesis that the adverse effects of NSP could 279
be alleviated by improving fat micelle formation and fat digestibility. In this experiment,
ileum digesta viscosity, intestinal size (weight and length) relative to bird body weight, and ileum histomorphometry were determined from 56-days old turkeys.
Dietary enzyme supplementation had significant effects on the physical characteristics and morphology of the intestine of turkeys. Dietary endoxylanase supplementation decreased ileum digesta viscosity as expected, and it was positively correlated with decreased intestinal weight and length. In contrast, dietary phospholipase supplementation increased ileum digest viscosity and the size of the intestines of turkeys. A
positive correlation between intestinal size and viscosity, but a negative correlation with
body weight were observed. Moreover, birds supplemented with the blended enzyme
preparation had the highest crypt and the lowest villus height:crypt depth ratio, indicating
increased enterocyte turnover rate. Evidently, dietary NSP influences the anatomy,
development and function of the intestine by affecting both the intestinal mucosa and the
microflora. These effects on enteric characteristics significantly impact the growth
performance of birds. Therefore, the results of this experiment showed that NSP and dietary
exogenous enzyme supplementation have major affects on intestinal size and
histomorphometry as the bird attempts to adapt to alterations in digesta viscosity,
compromised nutrient digestibility, and adverse physicochemical effects of NSP.
The second experiment (reported in Chapter 3) determined the effect of grain-based
formulation and dietary exogenous enzyme supplementation on intestinal Salmonella spp.
colonization and performance of turkeys. Turkeys raised on litter floors were fed
wheat/SBM- and corn/SBM-based diets with and without enzyme preparations (XY1 & 280
XY2, respectively) from 0-126 days. XY1 is a pure endoxylanase, whereas XY2 is endoxylanase, protease and α-amylase blend preparation. The enzymes levels (EXU/kg feed) were 2500 of XY1 or 325 of XY2. In this experiment, performance and prevalence of
Salmonella spp. in excreta was determined from 1-126 d. Weights and lengths of intestinal segments and weights of accessory glands (liver, pancreas) were measured from 16 sampled birds at 16 weeks of age.
As hypothesized, Salmonella colonization in turkey intestine was reduced by the wheat-based diet (high in NSP content) and enzyme supplementation. Consequently, toms infected with Salmonella spp. had better performance when fed diets high in NSP (wheat- based diets) than on diets low in NSP content (corn-based diets). In addition, dietary supplementation of the enzyme blend product (XY2) significantly improved growth performance of toms fed corn-based diets. However, supplementation of the endoxylanase product (XY1) to wheat/SBM-based diets did not affect growth performance throughout the trial, perhaps because of insufficient activity of endoxylanase or the synergy in activities among enzymes when they are supplemented as a blended preparation. Moreover, this study showed that birds fed wheat/SBM-based diets had heavier cecum (possibly due to increased microbial fermentation), but lower pancreas than toms receiving corn basal diets (possibly due to intestinal adaptation from the enteric damage caused by the degree of Salmonella infection). Therefore, this experiment demonstrated that cereal-based diets high in NSP content, especially when the diets are supplemented with exogenous endoxylanase promoted intestinal health by encouraging the proliferation of commensal microflora and discouraging the colonization of Salmonella spp. in the intestinal tract of turkeys. Enzymes 281
supplementation reduced Salmonella colonization in addition to improving growth
performance in turkeys.
Experiment 3 (reported in Chapter 4) evaluated the effect of dietary NSP content
level (as supplied by wheat or triticale) and dietary xylanase supplementation on cecal
Salmonella enterica colonization in turkeys. Turkeys raised in battery cages were fed
wheat/SBM- and triticale/SBM- based diets with and without supplementation of 5,500 EXU
endoxylanase per kg feed from 0-28 days and compared with turkeys fed a typical corn/SBM
control diet. Growth performance, cecal Salmonella population, cecal pH, ileum digesta
viscosity, intestinal size (weight and length relative to body weight), and ileum
histomorphometry were measured.
As observed in Experiment 2, enteric colonization of Salmonella enterica in turkeys
of Experiment 3 was reduced by high dietary NSP content and xylanase supplementation.
Performance was not affected by xylanase supplementation, but toms fed wheat and triticale
(intermediate and high NSP content diets, respectively) had better performance during the
starting phase (0-14 days) than the corn-fed (low NSP content diet) turkeys. The birds fed the
corn-based diets had higher Salmonella populations throughout the trial than birds fed the
wheat- or triticale-based diets. Xylanase supplementation also reduced cecal Salmonella enterica populations, independent of the type of small grain (wheat or triticale). Salmonella enterica population was negatively correlated with body weight of toms at 21 and 28 days, indicating that pathogenic load of Salmonella enterica adversely affects intestinal health and nutrient utilization. 282
Experiment 3 also showed that ileum digesta viscosity increased as the total- and
soluble-NSP content of the diet increased. Ileum digesta viscosity was higher in birds fed the
diet containing the greatest soluble-NSP level (triticale-based diet) than fed the other dietary
treatments. Dietary endoxylanase supplementation significantly decreased viscosity of both
triticale- and wheat-based diets, such that triticale-based diet was equivalent to the wheat-
based diet, and wheat-based diet was equivalent to corn-based diet. Crypt and muscularis
depth increased, and villus height:crypt depth ratio decreased as the level of total and soluble
dietary NSP increased, especially with the addition of xylanase. As hypothesized, inclusion
of high dietary NSP content, especially when the diets were supplemented with exogenous
endoxylanase, discouraged Salmonella enterica colonization of turkey intestine. Non-starch
polysaccharides from wheat and triticale provide fermentation substrate to commensal
organisms that competitively excluded Salmonella, and endoxylanase supplementation
increased the spectrum of oligosaccharides available to different microbial niches, which
resulted in a more diverse and stable cecal microflora.
Experiment 4 (reported on Chapter 5) was conducted to show that microbial
community diversity, a factor dependent on species richness (number of species or PCR-
DGGE bands) and evenness (the relative distribution of species), is an important condition to
increase the competitive exclusion against transient microbes, and thus control Salmonella
colonization of turkey intestine. Polymerase chain reaction (PCR) denaturing gradient gel
electrophoresis (DGGE) was used as a cultivation-independent method to analyze changes in ileum bacterial population of Salmonella spp.–infected turkeys fed corn- or wheat-based diets
with or without the addition of enzymes. Briefly, turkeys were fed wheat/SBM- and 283
corn/SBM-based diets with and without enzyme preparations (XY1 & XY2, respectively)
from 0-126 days. XY1 contained endoxylanase exclusively, whereas XY2 contained a blend
of endoxylanase, protease and α-amylase. Microbial DNA was extracted from ileum digesta
of 16 week-old turkeys, and 16S ribosomal-DNA (rDNA) gene was amplified by PCR and
analyzed by DGGE. Diversity indexes, including richness (number of species or DGGE
bands), evenness (the relative distribution of species), diversity (using Shannon’s index that
include richness and evenness), and Sorenson’s pairwise similarities coefficient (measures
the species in common between different habitats) were measured. Also, band surface area
by measuring band intensity and migration distance was evaluated. Additionally, similarities
of banding pattern among treatment groups by dendrogram cluster analysis were determined.
Diversity indexes were associated with changes in enteric Salmonella colonization of
turkeys.
Confirming the experimental hypothesis, wheat-based diets resulted in higher cecal
microflora diversity indexes than corn-based diets. Enzyme supplementation stimulated the
growth of the overall microflora and increased the diversity indexes in comparison to
unsupplemented treatments. The corn-control treatment had lower microbial community
diversity but higher Salmonella prevalence than the corn-enzyme and wheat-based dietary
treatments. In contrast, birds fed the wheat-based diets had higher microbial community
diversity but lower Salmonella prevalence. Therefore, the wheat-based diets, likely supported
a more stable, diverse and dynamic resident flora that competitively discouraged the growth
of transient microbes, like Salmonella, especially when supplemented with dietary exogenous
enzyme. In contrast to the birds fed the wheat-based diets, those fed the corn-based diets 284
likely had slower GIT transit and cecal turnover rates, which stimulated the growth of resident and transient microbes. Moreover the low diversity of the bacterial community observed among the corn-fed birds was probably associated with a decreased level of
competitive exclusion against Salmonella colonization. Evidently, the high NSP content in
the wheat- and triticale-based diets, and exogenous enzyme supplementation stimulated
microbial community diversity and discouraged Salmonella colonization.
In conclusion, this dissertation presents evidence that dietary NSP interacts both with
the mucosa and the microflora, and it has a positive influence on enteric health, intestinal
anatomy, intestinal development and intestinal function, especially if turkeys are challenged
with enteric pathogens, such as Salmonella. Dietary supplementation of NSP-degrading
enzymes (endoxylanase and complementary enzymes blends) reduces the adverse effects of
dietary NSP on nutrient digestibility, and likely increases the diversity of non-starch
oligosaccharides that serve as substrate for a more diverse microflora, thus augmenting the positive effect of NSP on ecosystem stability. Maintaining a stable and synergistic microbial ecosystem that prevents the colonization of unfavorable microbial communities will benefit growth performance of birds. This body of work clearly demonstrates that diet formulation has a significant influence on Salmonella colonization in turkeys. Dietary inclusion of NSP
(primarily arabinoxylan) and complementary enzymes can be used as a method to reduce the risk of Salmonella contamination of turkey to be processed for human consumption. More
research should be done to determine the amount of dietary soluble and insoluble NSP and the optimum oligosaccharide characteristics that result in the greatest control of enteric pathogen colonization. 285
In summary, the results and discussion presented in this dissertation leads to the following conclusions:
1. Dietary non-starch polysaccharides increases intestinal weight and length of
turkeys as an adaptation response to increased intestinal digesta viscosity,
compromised nutrient digestibility, and increased intestinal microbial
fermentation. However, this response can be reversed by dietary supplementation
of NSP-hydrolyzing enzymes.
2. Dietary endoxylanase supplementation increases mucosal crypt depth and
decreases villus height:crypt depth ratio, indicating increased enterocyte turnover
rate. Increased gut epithelial cell proliferation may increase the metabolic costs to
maintain GIT, which may compromise growth performance. Although, increase
gut epithelium proliferation is costly in terms of energy and nutrient expenditures,
it may be advantageous to the animal health because it may remove cells that
might have been invaded by pathogens.
3. Ileum digesta viscosity increases as the NSP content in the diet increases, but
xylanase supplementation can decrease viscosity and the associated adverse
effects on nutrient utilization and growth performance. Therefore, xylanase
supplementation will enhance the feeding value of cereal grains, especially those
with high NSP content.
4. Dietary supplementation of a blend of different enzyme activities has a better
response on intestinal health and growth performance of turkey than 286
supplementation of a single enzyme preparation, presumably due to the
synergistic activity among the different enzymes.
5. Enteric colonization of Salmonella in turkeys can be discouraged by diets high in
NSP content from wheat and triticale, and this response can be enhanced by
dietary supplementation of NSP-hydrolyzing enzymes. Consequently, feeding
Salmonella-challenged turkeys with diets high in NSP (wheat-based diets) may
result in better performance than those fed diets low in NSP content (corn-based
diets).
6. Enzyme supplementation increases the diversity, richness, and evenness of the
ileum microbial community, which indicates a stable, diverse and dynamic
resident flora that likely discourage colonization of foodborne pathogenic
Salmonella in turkeys.
7. Diets with high non-starch polysaccharide content (i.e. wheat- and triticale-based
diets) increases microbial community diversity indexes and thus discourage
Salmonella colonization.
8. Dietary inclusion of NSP (primarily arabinoxylan) and complementary enzymes
presumably can be used as a method to reduce the risk of Salmonella
contamination of turkey to be processed for human consumption.
287
Dissertation: Poultry intestinal health through diet formulation and exogenous enzyme supplementation.
Hypothesis: Manipulation of dietary NSP content and dietary exogenous enzyme supplementation promotes intestinal health and discourages the colonization of Salmonella spp. in turkey intestine, improving growth performance and reducing the presence of potential pathogenic microorganisms in turkeys
Experiment 1 (Chapter 2)
Effect of dietary supplementation of endoxylanase and phospholipase on intestinal size and histomorphometry of turkeys fed wheat-based diets
Experiment 2 (Chapter 3) Experiment 3 (Chapter 4)
Effect of dietary enzyme supplementation Reduction of intestinal Salmonella and non-starch polysaccharide content on enterica colonization in turkeys by wheat, performance, intestinal morphometry and triticale and enzyme supplementation Salmonella spp. colonization of turkeys
Experiment 4 (Chapter 5)
Denaturing gradient gel electrophoresis analysis of 16S ribosomal DNA amplicons to analyze changes in ileum bacterial population of turkeys fed different diets and after infection with Salmonella spp.
Summary (Chapter 6)
FIGURE 1: Schematic representation of the experiments used in the present dissertation.