Energy and Cellular Metabolism

There is no4 good evidence Energy in Biological LO 4.12 Explain the roles of the following that … life evades the second Systems 93 molecules in biological energy transfer and law of thermodynamics, LO 4.1 Define energy. Describe three storage: ADP, ATP, NADH, FADH2, NADPH. but in the downward categories of work that require energy. LO 4.13 Outline the pathways for aerobic LO 4.2 Distinguish between kinetic and and anaerobic metabolism of glucose course of the energy-flow potential energy, and describe potential and compare the energy yields of the two it interposes a barrier and energy in biological systems. pathways. dams up a reservoir which LO 4.3 Explain the first and second laws of LO 4.14 Write two equations for aerobic metabolism of one glucose molecule: one provides potential for its own thermodynamics and how they apply to the human body. using only words and a second using the remarkable activities. chemical formula for glucose. F. G. Hopkins, 1933. “Some Chemical Chemical Reactions 96 LO 4.15 Explain how the electron transport system creates the high-energy bond of Aspects of Life,” presidential address to LO 4.4 Describe four common types of ATP. the 1933 meeting of British Association chemical reactions. for the Advancement of Science. LO 4.5 Explain the relationships between LO 4.16 Describe how the genetic code of free energy, activation energy, and DNA is transcribed and translated to create endergonic and exergonic reactions. proteins. LO 4.6 Apply the concepts of free energy LO 4.17 Explain the roles of transcription and activation energy to reversible and factors, alternative splicing, and irreversible reactions. posttranslational modification in protein synthesis. Enzymes 98 LO 4.7 Explain what enzymes are and how they facilitate biological reactions. Background Basics LO 4.8 How do the terms isozyme, 35 DNA and RNA coenzyme, proenzyme, zymogen, and 65 Organelles cofactor apply to enzymes? 30 Lipids LO 4.9 Name and explain the four major 39 Hydrogen bonds categories of enzymatic reactions. 32 Protein structure 46 Protein interactions Metabolism 102 33 Covalent bonds LO 4.10 Define metabolism, anabolism, and 31 Carbohydrates catabolism. 20 Graphing LO 4.11 List five ways cells control the flow 34 ATP of molecules through metabolic pathways.

Glucose crystals

M04_SILV1226_07_SE_C04.indd 92 24/10/14 1:42 PM CHAPTER 4

- - ). 21/10/14 8:54 AM 93

Fig. 4.1 Energy in Biological Systems in Biological Energy Properties of Living Organisms of Properties Sense and respond to internal and external environments internal and external to Sense and respond with systems internal control through homeostasis Maintain feedback information and transmit use, Store, and die grow, develop, Reproduce, Individuals adapt and species evolve Acquire, transform, store, and use energy store, transform, Acquire, Have a complex structure whose basic unit of organization is of organization whose basic unit structure a complex Have the cell Have emergent properties that cannot be predicted from the from properties that cannot be predicted emergent Have simple sum of the parts Energy is essential for the processes we associate with living living with associate Energy we for processes the essential is Animals, on the other hand, cannot trap energy the sun from other hand, the on Animals, - energy the pro extract Animals through biomolecules from

able 4.1

T 1. 2. 3. 4. 5. 6. 7. 8. uses intricately interconnected biochemical reactions to acquire, acquire, to intricately biochemicaluses reactions interconnected It senses and and use energy and information. store, transform, to changes in its internal and external environments responds reproduces, It canit that so homeostasis. maintain adapts and its species evolves. time, and over and dies; grows, develops, and maintenance of repair, Without energy for growth, things. with a cell filled is like a ghost town the internal environment, Cells need energy slowlycrumbling buildings that are into ruin. - or re and repair make new molecules, to import raw materials, abilityThe of cells energy extract to the from cycle parts. aging and use that energyexternal environment to maintain themselves outstand most their of one is units functioning organized, as at the cell look processes we In this chapter, ing characteristics. which obtains energybody human the through its maintains and 46] [p. interactions will learn protein how You systems. ordered apply to enzyme activity the subcellular compartments and how 8] separate various steps of energy metabolism. [p. Energy in Biological Systems Energy cycling and living organisms is the environment between energy All cells use biology. of concepts fundamental the of one reproduce. and new make parts, grow, to environment their from Plants trap radiant energy it as chemical- the sun and store from energy bond photosynthesisof ( the process through They extract carbon and oxygen from carbon dioxide, nitrogen nitrogen carbonThey extract carbon from dioxide, and oxygen bio make to water from oxygen and and hydrogen the soil, from molecules such as glucose and amino acids. soil to synthesize the air and or use carbon from and nitrogen importThey must chemical-bond energy in- by biomolecules. Ultimately, animals. other or plants of biomolecules the gesting energy photosynthesis energy is the trapped by source however, including humans. for all animals, carbon and produces oxygen which consumes cess of respiration, energy more If animals ingest than they need and water. dioxide - 118 . Living Living . 111 able 4.1 T 104 101 99 Tay-Sachs Disease: A Deadly A Deadly Disease: Tay-Sachs Inheritance

| 93

family trees he constructs, the rabbi can avoid pairing two can avoid he constructs, the rabbi trees family hristine Schmidt, Ph.D., and her graduate students seed seed students graduate and her Ph.D., hristine Schmidt, matrix and an engineered cellsisolated endothelial onto - is success that if their work They know watch them grow. Sarah and David, who met while working on their college and David, Sarah individuals known to carry the gene for Tay-Sachs disease, disease, Tay-Sachs carry to the gene for individuals known fatal, inherited condition that strikes one in 3600 American one in 3600 condition that strikes inherited fatal, Why then can’t biologists, knowing the characteristics of the characteristics knowing of biologists, Why then can’t - properties biologicalof emergent The tremen of systems are in list with the one your compare Now newspaper, are not orthodox Jews. Both are aware, however, however, aware, Both are not orthodox Jews. are newspaper, at have they ancestry children that their Jewish might put any their wedding, Six months before disease. Tay-Sachs risk for determine whether see a genetic counselor to to decide they disease. Tay-Sachs of the gene for carriers are they In many American ultra-orthodox Jewish communities—in which communities—in American ultra-orthodox Jewish In many the norm—the with marriages is entrusted arranged are rabbi record a confidential He keeps task. an important, life-saving of a Babies born with this descent. of Eastern European Jews Based on is no cure. age 4, and there beyond live disease rarely the individuals who carry gene. the deadly

Running Problem

organisms are highly organized and complex entities. Even a one- Even highlyorganisms are organized entities. and complex microscope, a under simple appears it although celledbacterium, It complexity chemicalthe at incredible has level organization. of C ful, the tissue that results might someday help replace a blood blood a replace help someday might results that tissue the ful, a child as Just playing blocks with building in the body. vessel the bioengineer and her students a house, assembles them into the with familiar casesboth In someone cells. from tissue create can what the predict blocks building or cells, starting components, cells tissues. make blocks make buildings; will be: product final how explain carbohydrates, and lipids, proteins, nucleicacids, attri- the remarkable of these molecules acquire combinations canbutes of a living cell? How living cells carry out processes understanding their from predict would what we that far exceed , 2] is emergent propertiesThe answer [p. individual components? the simple traits cannot from that those distinctive be predicted a came across if you example, For parts. sum of the component car mo disassembled a from bolts and pieces metal of collection tor, could you predict (without prior knowledge) that, given an an given (without prior that, predict knowledge) could you tor, this collection could create energy and properly source arranged, thousands of pounds? to move the power to scientists tryingdous interest - a simple com to explain how could have 62], [p. liposome such as a phospholipid partment, for and see if a moment Pause evolved living cell. into the first can properties list the you of life characterize that - all living crea sent samples and pictures at looking a scientist were you If tures. whether for determine to look you would what Mars, back from life exists there? M04_SILV1226_07_SE_C04.indd 93 94 Chapter 4 Energy and Cellular Metabolism

Fig. 4.1 Energy transfer in the environment

Plants trap radiant Animals eat the energy from the plants and either sun and store it use the energy in the chemical S or store it. bonds of Sun biomolecules. Heat Energy lost energy to environment KEY Transfer of radiant or heat energy Radiant energy Transfer of energy in chemical bonds

O2 Energy for work + Photosynthesis Respiration Energy stored CO2 takes place in Energy stored in takes place in in biomolecules plant cells, yielding: biomolecules human cells, yielding: +

H2O CO2

N2 H2O

for immediate use, the excess energy is stored in chemical bonds, Transport work enables cells to move ions, molecules, and just as it is in plants. Glycogen (a glucose polymer) and lipid mol- larger particles through the cell membrane and through the mem- ecules are the main energy stores in animals [p. 31]. These storage branes of organelles in the cell. Transport work is particularly useful molecules are available for use at times when an animal’s energy for creating concentration gradients, distributions of molecules in needs exceed its food intake. which the concentration is higher on one side of a membrane than on the other. For example, certain types of endoplasmic reticulum [p. 71] use energy to import calcium ions from the cytosol. This ion Concept 1. Which biomolecules always include nitrogen in their chemical makeup? transport creates a high calcium concentration inside the organelle Check and a low concentration in the cytosol. If calcium is then released back into the cytosol, it creates a “calcium signal” that causes the cell to perform some action, such as muscle contraction. Energy Is Used to Perform Work Mechanical work in animals is used for movement. At the cellular level, movement includes organelles moving around in a All living organisms obtain, store, and use energy to fuel their cell, cells changing shape, and cilia and flagella beating [p. 68]. activities. Energy can be defined as the capacity to do work, but At the macroscopic level in animals, movement usually involves what is work? We use this word in everyday life to mean various muscle contraction. Most mechanical work is mediated by motor things, from hammering a nail to sitting at a desk writing a paper. proteins that make up certain intracellular fibers and filaments of In biological systems, however, the word means one of three spe- the cytoskeleton [p. 68]. cific things: chemical work, transport work, or mechanical work. Chemical work is the making and breaking of chemical Energy Comes in Two Forms: bonds. It enables cells and organisms to grow, maintain a suit- Kinetic and Potential able internal environment, and store information needed for reproduction and other activities. Forming the chemical bonds of a Energy can be classified in various ways. We often think of en- protein is an example of chemical work. ergy in terms we deal with daily: thermal energy, electrical energy,

M04_SILV1226_07_SE_C04.indd 94 24/10/14 1:42 PM CHAPTER 4

21/10/14 8:54 AM 95

thermodynamics,

Energy in Biological Systems in Biological Energy Kinetic energy summarizes energy of kinetic the relationship and The ball rolling down the ramp is converting the (c) The ball rolling the However, to kinetic energy. potential energy is lost and some energy conversion is not totally efficient, as heat due to friction between the ball, ramp, and air. Kinetic energyKinetic movingthe of ball transformedis po- into tential energy the ball is used to push up the ramp as work (Fig. 4.2a). energy stationarythe in stored is ball of top the Potential at the but is being performed, work No 4.2b). the ramp (Fig. ball. of the position in the capacity is stored to do work The potential energy kinetic energy of the ball becomes Some kinetic 4.2c). the rampdown (Fig. when the ball rolls energy as heat due to friction is lost to the environment the ballbetween ramp. and the air and potential energy in concentra- is stored In biological systems, Figure 4.2 As an open however. a closedis not body The human system,

1. 2. 3. potential energy: It is transformed into kinetic gradients and chemicaltion bonds. or mechanical transport, energy do chemical, when needed to work. Thermodynamics Is the Study of Energy Use basic rules transfer the govern of energy biological in systems Two The first law of as a whole. and in the universe as the lawalso known of conservation of energy, states that the The universe total amount of energy is constant. in the universe nothing and enters —nothing closed system a be to considered is but the Energy type one can from be converted to another, leaves. total amount of energyin a closed system never changes. materials it exchanges and energysystem, with its surroundings. they import it from Because our bodies cannot energy, create bodies lose our By the same token, outside in the form of food. En- to the environment. especially in the form of heat, energy, ergy type one that stays within the body can be changed from to another or can be used to do work. [To learn learn [To . Potential energy (b) The ball sitting at the top of the ramp has potential energy, the potential to do work. Kinetic and potential energy Kinetic and potential

Kinetic energy 4.2 A key of all feature types of energy is the ability of potential The amount of energy lost in the transformation depends motion}. Kinetic energy is the energy { motion}. kinetikos, of motion A ballthe top poised at energy energy. Potential is stored Work is used to push a ball up a (a) Work of movement up ramp. Kinetic energy in the the ramp is being stored position. of the ball’s potential energy Fig. more about kinetic and potential energy, see Appendix B.] see Appendix about kinetic and potential energy, more energy kinetic energy to become and vice versa. energy of Recall definition general a that capacity the is do to is associated always and therefore movement involves Work work. energycan perform also be used to Potential with kinetic energy. but the potential energy to kinetic be converted first must work, potential energy from to kinetic energyThe conversion is energy. certain and a amount of energy is lost to the never efficient, 100% usually as heat. environment, the efficiencyon in physiological Many processes of the process. 70% of the example, For not verythe human body are efficient. energyrather heat as is lost trans than - physicalin used exercise of muscleformed contraction. into the work Energy Can Be Converted from One FormEnergy Can Be Converted from to Another concentration side of a concentration gradient stores potential potential stores gradient concentration a of side concentration energy because it has the potential energy the down to move energy potential in the is stored In chemical bonds, gradient. 33] [p. form that bond the electrons the of position of energy speak in chemical stored bonds. We mechanical energy. all However, Each type of energy characteristics. has its own typesenergyof kinetic as abilityan forms: two in share appear to energy energy. or as potential through perfumespreading molecules hill, a A ball down rolling warming heat lines, power electric through charge flowing the air, biological moving membranes and molecules across a frying pan, energy. kinetic all examples of bodies that have are of a hill has potential energy because it has the potential to the high- on positioned A molecule start moving the hill. down M04_SILV1226_07_SE_C04.indd 95 96 Chapter 4 Energy and Cellular Metabolism

The second law of thermodynamics states that natural Table 4.2 Chemical Reactions spontaneous processes move from a state of order (nonrandom- ness) to a condition of randomness or disorder, also known as Reactants Reaction Type (Substrates) Products entropy. Creating and maintaining order in an open system such as the body requires the input of energy. Disorder occurs when Combination A + B ¡ C open systems lose energy to their surroundings without regaining Decomposition C ¡ A + B it. When this happens, we say that the entropy of the open system has increased. Single L + MX ¡ LX + M displacement* The ghost-town analogy mentioned earlier illustrates the second law. When people put all their energy into activities away Double LX + MY ¡ LY + MX from town, the town slowly falls into disrepair and becomes less displacement*

organized (its entropy increases). Similarly, without continual in- *X and Y represent atoms, ions, or chemical groups. put of energy, a cell is unable to maintain its ordered internal environment. As the cell loses organization, its ability to carry out normal functions disappears, and it dies. The purpose of chemical reactions in cells is either to trans- In the remainder of this chapter, you will learn how cells ob- fer energy from one molecule to another or to use energy stored tain energy from and store energy in the chemical bonds of bio- in reactant molecules to do work. The potential energy stored in molecules. Using chemical reactions, cells transform the potential the chemical bonds of a molecule is known as the free energy of energy of chemical bonds into kinetic energy for growth, mainte- the molecule. Generally, complex molecules have more chemical nance, reproduction, and movement. bonds and therefore higher free energies. For example, a large glycogen molecule has more free energy than a single glucose molecule, which in turn has more free Concept 2. Name two ways animals store energy in their bodies. energy than the carbon dioxide and water from which it was Check 3. What is the difference between potential energy and kinetic energy? synthesized. The high free energy of complex molecules such 4. What is entropy? as glycogen is the reason that these molecules are used to store energy in cells. To understand how chemical reactions transfer energy between molecules, we should answer two questions. First, how do reactions get started? The energy required to initiate a reaction Chemical Reactions is known as the activation energy for the reaction. Second, what happens to the free energy of the products and reactants during Living organisms are characterized by their ability to extract en- a reaction? The difference in free energy between reactants and ergy from the environment and use it to support life processes. products is the net free energy change of the reaction. The study of energy flow through biological systems is a field known as bioenergetics {bios, life + en-, in + ergon, work}. In a biological system, chemical reactions are a critical means of trans- Activation Energy Gets Reactions Started ferring energy from one part of the system to another. Activation energy is the initial input of energy required to bring reactants into a position that allows them to react with Energy Is Transferred between Molecules one another . This “push” needed to start the reaction is shown in during Reactions Figure 4.3a as the little hill up which the ball must be pushed before it can roll by itself down the slope. A reaction with low In a chemical reaction, a substance becomes a different sub- activation energy proceeds spontaneously when the reactants are stance, usually by the breaking and/or making of covalent bonds. brought together. You can demonstrate a spontaneous reaction by A reaction begins with one or more molecules called reactants pouring a little vinegar onto some baking soda and watching the and ends with one or more molecules called products (Tbl. 4.2). two react to form carbon dioxide. Reactions with high activation In this discussion, we consider a reaction that begins with two energies either do not proceed spontaneously or else proceed too reactants and ends with two products: slowly to be useful. For example, if you pour vinegar over a pat of butter, no observable reaction takes place. A + B S C + D Energy Is Trapped or Released The speed with which a reaction takes place, the reaction during Reactions rate, is the disappearance rate of the reactants (A and B) or the appearance rate of the products (C and D). Reaction rate is mea- One characteristic property of any chemical reaction is the free sured as change in concentration during a certain time period and energy change that occurs as the reaction proceeds. The products is often expressed as molarity per second (M/sec). of a reaction have either a lower free energy than the reactants

M04_SILV1226_07_SE_C04.indd 96 24/10/14 1:42 PM CHAPTER 4

21/10/14 8:54 AM 97

end(o), work}. work}. Where

ergon, y

g H r e + n e eactions out + G , - +

i Chemical Reactions Chemical

ex +

(Theof forward naming +

i 2.

ADP + P P

A D

S ATP

O it releases energy- it releases in the re as it proceeds

2 +

H F D2, + . Energy when theduring this reaction is released . 1C + + + TP E A C S ) and H i B In this type of coupled reaction, the two reactions take place take place reactions the two In this type of coupled reaction, it is not always to be directly practical for reactions However, If the free energy of the products is lower than the free en- energy than the free free the If lower is products the of the Figure with of 4.3b reaction exergonic the contrast Now Some remains the energy of reaction endergonic to an added traps energy direction If a reaction in one as it proceeds An important biological example of an exergonic reaction is is importantAn reaction biological example of an exergonic + oupling Endergonic and Exergonic R Exergonic and Endergonic oupling 1A does the activation energy for metabolic reactions come from? energydoes the activation from? come for metabolic reactions energy activation for The simplest way a cell to acquire is to Some of reaction. to an endergonic reaction couple an exergonic those that use the energy are the most familiar coupled reactions to drive an the high-energy breaking by of ATP bond released reaction: endergonic high-energy phosphate bond of the ATP molecule is broken: molecule high-energy of the ATP bond phosphate and reverse directions is arbitrary.) For example, the energy the energy example, For is arbitrary.) directions and reverse during glycogen of synthesis its trappedbonds the in released is back into glucose. down is broken when glycogen simultaneously and in the same location, so that the energy from simultaneously and in the same location, can be used immediately reaction to drive the endergonic ATP E and F. reactants between developed cellsways living have Consequently, this. like coupled C or a higher free energy than the reactants. A change in free en- free A change in energy free or a higher the reactants. than trapped or released either has ergy reaction the that level means energy. en- releases reaction the as in Figure 4.3b, ergy of the reactants, ergy and is called { reaction an exergonic retain products In the latter, Figure in 4.3c. represented reaction free their making energypart activation the of added, was that that reactions These reactants. the of energy that than greater a net input of energy { to be endergonic require said are or energy-utilizing, reactions. within + ergon, work}, energy-These trappedchemicalthe in products. the of bonds in which- com often are synthesis reactions, reactions consuming example, For smaller molecules. from made plex molecules are glucose molecules together links many reaction an endergonic glycogen complex The polymer glucose the glycogen. create to energy free molecule has more than the simple glucose molecules used to make it. reaction or energy-producing, reaction The energy an exergonic, by released off as be given or may other molecules to do work be used by may is the energy reaction an exergonic in released In a few cases, heat. energy as potential stored gradient. in a concentration - phos inorganic and water to form ADP, of ATP the combination (P phate verse direction direction verse Activation of reaction Reactants Reaction process Products Products KEY C+D energy change Net free Net free G+H energy change energy Time Time Starting free Starting free level energy Reactants Activation energy in exergonic and in exergonic energy Activation endergonic reactions Final free energy level energy Final free E+F

Activation energy

Activation energy A+B 4.3 products, which then have more free energy than the reactants. energy free which then have more products, products have less energy than the reactants. than the have less energy products

Free energy of molecule of energy Free trap some activation energy in the trap some activation energy (c) Endergonic reactions molecule of energy Free release energy because the energy release (b) Exergonic reactions is the “push” needed to start a reaction. energy is the “push” (a) Activation Activation energy

Fig. M04_SILV1226_07_SE_C04.indd 97 98 Chapter 4 Energy and Cellular Metabolism

Fig. 4.4 Energy in biological reactions

Energy released by exergonic reactions can be trapped in the high-energy electrons of NADH, FADH2, or NADPH. Energy that is not trapped is given off as heat. Nucleotides capture and transfer energy Exergonic reactions release energy. Heat energy and electrons. Endergonic reactions will not occur without input of energy. ENERGY A+B C+D + NADPH released ENERGY + E+F G+H High-energy utilized electrons NADH ATP

FADH2

to trap the energy released by exergonic reactions and save it for Concept 5. What is the difference between endergonic and later use. The most common method is to trap the energy in the Check exergonic reactions? form of high-energy electrons carried on nucleotides [p. 33]. The 6. if you mix baking soda and vinegar together in a nucleotide molecules NADH, FADH2, and NADPH all cap- bowl, the mixture reacts and foams up, releasing Fig. 4.4 carbon dioxide gas. Name the reactant(s) and ture energy in the electrons of their hydrogen atoms ( ). product(s) in this reaction. NADH and FADH2 usually transfer most of this energy to ATP, 7. Do you think the reaction of question 6 is endergonic which can then be used to drive endergonic reactions. or exergonic? Do you think it is reversible? Defend your answers. Net Free Energy Change Determines Reaction Reversibility Enzymes The net free energy change of a reaction plays an important role in determining whether that reaction can be reversed, because Enzymes are proteins that speed up the rate of chemical reac- the net free energy change of the forward reaction contributes to tions. During these reactions, the enzyme molecules are not the activation energy of the reverse reaction. A chemical reaction changed in any way, meaning they are biological catalysts. With- that can proceed in both directions is called a reversible reaction. out enzymes, most chemical reactions in a cell would go so slowly In a reversible reaction, the forward reaction A + B S C + D + S + and its reverse reaction C D A B are both likely to take Fig. 4.5 Some reactions have large activation place. If a reaction proceeds in one direction but not the other, it energies is an irreversible reaction.

For example, look at the activation energy of the reaction KEY + S + Figure 4.5 C D A B in . This reaction is the reverse of Reactants

the reaction shown in Figure 4.3b. Because a lot of energy was Activation released in the forward reaction A + B S C + D, the activa- of reaction tion energy of the reverse reaction is substantial (Fig. 4.5). As Activation A+B Reaction you will recall, the larger the activation energy, the less likely energy process it is that the reaction will proceed spontaneously. Theoretically, Products Net free all reactions can be reversed with enough energy input, but energy some reactions release so much energy that they are essentially change irreversible.

In your study of physiology, you will encounter a few irre- of molecule energy Free versible reactions. However, most biological reactions are revers- C+D ible: if the reaction A + B S C + D is possible, then so is the reaction C + D S A + B. Reversible reactions are shown with Time arrows that point in both directions: A + B N C + D. One Q GRAPH QUESTION of the main reasons that many biological reactions are revers- Is this an endergonic ible is that they are aided by the specialized proteins known as or exergonic reaction? enzymes.

M04_SILV1226_07_SE_C04.indd 98 21/10/14 8:54 AM CHAPTER 4

21/10/14 8:54 AM 99

. Enzymes is equal to the is equal to the At equilibrium, equilibrium, At 2. D2 able 4.3 T B + + C A S S B Cancer of the prostate Cancer Diseases of bone or liver disease Pancreatic (heart infarction Myocardial disease muscle attack), heart, damage to Tissue liver, blood red muscle, skeletal cells Related Diseases Related D + + 1A 1C Diagnostically Important Enzymes Diagnostically Isozymes an important of certain in the diagnosis have role In protein-binding interactions, if the amount of protein (in (in if the amount of protein interactions, In protein-binding reaction a reversible consider This seems simple until you able 4.3 . The different LDH isozymes are tissue specific, including isozymes specific, tissue LDH The different are . 4 T of the suggestive of these enzymes are levels blood Elevated pathologies listed. Enzyme phosphatase* Acid Alkaline phosphatase Alkaline Amylase kinase (CK) Creatine (LDH) dehydrogenase Lactate test for acid phosphatase in the diagnosis of prostate cancer. the diagnosis of prostate in acid phosphatase for test one found primarilyone in the heart found in skeletal and a second muscle and the liver. in the hours following a heart example, For medical conditions. heart damaged muscle enzymes cells release into the blood. attack, chest pain was indeed to determine whether a person’s One way due to a heart for attack is to look elevated levelsof heart isozymes Some diagnostically important enzymes blood. the in dis- the and listed in are suggestive eases of which they are rate of the reverse reaction reaction rate of the reverse *A newer test for a molecule called prostate specific antigen (PSA) has replaced the has replaced antigen (PSA) specific a molecule called prostate for test *A newer M Are Variable Reaction Rates the rate of an enzymatic monitoring measure by reaction We synthesized are fast the sub- fast the products or how either how a number of rate can by Reaction be altered consumed. strates are the amount of enzyme including changes in temperature, factors, we In mammals, 52]. and substrate [p. concentrations present, en- This leaves to be essentially temperature consider constant. zyme main vari and substrate as the two amount concentration - rate. ables that affect reaction rate is proportional the reaction enzyme) is constant, this case, One strategy cellsto control use to the substrate concentration. In of enzyme the amount rates is to regulate reaction in the cell. go biological many reactions the absence of appropriate enzyme, - the rate of the reac If enzymevery present, is slowlyall. or not at of enzyme to the amount is proportional tion and the amount of substrate is so much that all enzyme unless there bind- substrate, 51]. capacity at maximum saturated [p. and working ing sites are what determines in In that case, that can in both directions. go reversible that is answer The goes? reaction the whichdirection - rate the reac the equilibrium, of of a state to go where reactions in the forwardtion direction , and , 118 2 M 2 - 111 , H (LDH) has has (LDH) 4 e m y z n e + D 104 101 D + + C e C m y 99 z S n ¡ e e

m B y z + n e A + 93 B + A Hexosaminidase A is also required to remove gangliosides gangliosides remove to A is also required Hexosaminidase in- on this Based the light-sensitive cells of the eye. from disease Tay-Sachs of what is another symptom formation, function? and brain besides loss of muscle control A fewA enzymes variety forms a in (isoforms) come related of the enzyme dehydrogenase lactate example, For In enzymatically catalyzed reactions, the reactants A and B In enzymatically B A and the reactants catalyzed reactions, This way of writing the reaction shows that the enzyme of writing shows This way the reaction - par age diseases, genetic mutations result in lysosomal enzymes in lysosomal result genetic mutations age diseases, lack disease patients Tay-Sachs or absent. ineffective that are called , an enzyme that digests glycolipids hexosaminidase A in nerve accumulate gangliosides As a result, . gangliosides abnormally. and function swell causing them to cells in the brain, and control lose muscle disease slowly Tay-Sachs with Infants Tay- for or cure no treatment is currently There function. brain age 4. before die usually children and affected disease, Sachs Q1: Tay-Sachs disease is a devastating condition. Normally, Normally, condition. disease is a devastating Tay-Sachs enzymes that digest old, worn-out in cells contain lysosomes stor lysosomal and related Tay-Sachs In parts cell. of the

Running Problem Enzymes Are Proteins three-dimensional enzymesMost complex with proteins large are can RNA that discovered researchers recently although shapes, that bind to sub- Like other proteins as a catalyst. act sometimes and satu- competition, enzymes protein exhibit specificity, strates, 46]. ration [p. Isozymes as isozymes known and are another. {iso-, equal} of one enzymesare that catalyze but under different the same reaction iso- The structures of related tissues. or in different conditions which causes the zymes another, one slightly from are different isozymes Many struc complex have - variability in their activity. chains. protein with multiple tures are calledare substrates. into assembled are that M, and H named subunits, of kinds two isozymes LDH include H of four. —groups tetramers ticipates with reactants A and B but is unchanged at the end of of end the at unchanged is but B and A reactants with ticipates shorthand common for enzymatic A more reactions the reaction. like this: the name of the enzymeshows arrow, the reaction above Because enzyme an is not be unable to live. that the cell would we it catalyzes, permanently up in the reaction changed or used this way: equation might write it in a reaction M04_SILV1226_07_SE_C04.indd 99 100 Chapter 4 Energy and Cellular Metabolism

Fig. 4.6 pH affects enzyme activity

Biotechnology Most enzymes in humans have optimal activity Seeing Isozymes near the body's internal pH of 7.4. One way to determine which isozymes are present in a tissue sample is to use a technique known as electrophoresis. In this technique, a solution derived from the tissue sample is placed at one end of a container filled with a polyacryl- amide polymer gel. An electric current passed through the gel causes the negatively charged proteins to move toward the positively charged end of the gel. The rate at which the proteins move depends on their size, their shape, and the

electrical charge on their amino acids. As proteins move along Rate of enzyme activity the gel at different rates, they separate from one another and appear as individual bands of color when stained with a dye 5 6 7 8 9 called Coomassie blue or with silver. Electrophoresis can pH separate mixtures of charged macromolecules, such as proteins and DNA. Q FIGURE QUESTION If the pH falls from 8 to 7.4, what happens to the activity of the enzyme?

there is no net change in the amount of substrate or product, and the ratio [C][D]/[A][B] is equal to the reaction’s equilibrium enzyme activity can vary over a range of pH values. By turning constant, K [p. 47]. eq reactions on and off or by increasing and decreasing the rate at If substrates or products are added or removed by other reac- which reactions take place, a cell can regulate the flow of bio- tions in a pathway, the reaction rate increases in the forward or molecules through different synthetic and energy-producing reverse direction as needed to restore the ratio [C][D]/[A][B]. pathways. According to the law of mass action, the ratio of [C] and [D] to [A] and [B] is always the same at equilibrium. Concept 8. What is a biological advantage of having multiple Check isozymes for a given reaction rather than only one Enzymes May Be Activated, Inactivated, or form of the enzyme? 9. The four protein chains of an LDH isozyme are an ex- Modulated ample of what level of protein structure? (a) primary (b) secondary (c) tertiary (d) quaternary Enzyme activity, like the activity of other soluble proteins, can be altered by various factors. Some enzymes are synthesized as inactive molecules (proenzymes or zymogens) and activated on demand by proteolytic activation [p. 49]. Others require the binding Enzymes Lower Activation Energy + + of inorganic cofactors, such as Ca2 or Mg2 before they become of Reactions active. Organic cofactors for enzymes are called coenzymes. How does an enzyme increase the rate of a reaction? In thermo- Coenzymes do not alter the enzyme’s binding site as inorganic dynamic terms, it lowers the activation energy, making it more Fig. 4.7 cofactors do. Instead, coenzymes act as receptors and carriers likely that the reaction will start ( ). Enzymes accomplish for atoms or functional groups that are removed from the sub- this by binding to their substrates and bringing them into the strates during the reaction. Although coenzymes are needed for best position for reacting with each other. Without enzymes, the some metabolic reactions to take place, they are not required in reaction would depend on random collisions between substrate large amounts. molecules to bring them into alignment. Many of the substances that we call vitamins are the pre- The rate of a reaction catalyzed by an enzyme is much more cursors of coenzymes. The water-soluble vitamins, such as rapid than the rate of the same reaction taking place without the the B vitamins, vitamin C, folic acid, biotin, and pantothenic enzyme. For example, consider carbonic anhydrase, which facili- acid, become coenzymes required for various metabolic reac- tates conversion of CO2 and water to carbonic acid. This enzyme tions. For example, vitamin C is needed for adequate collagen plays a critical role in the transport of waste CO2 from cells to synthesis. lungs. Each molecule of carbonic anhydrase takes one second to Enzymes may be inactivated by inhibitors or by becoming catalyze the conversion of 1 million molecules of CO2 and water denatured. Enzyme activity can be modulated by chemical fac- to carbonic acid. In the absence of enzyme, it takes more than a Figure 4.6 tors or by changes in temperature and pH. shows how minute for one molecule of CO2 and water to be converted to

M04_SILV1226_07_SE_C04.indd 100 21/10/14 8:54 AM CHAPTER 4

s I 21/10/14 8:54 AM 101 hydr-,

+ addition addition O. When O. 2 eduction eduction An Enzymes . For example, example, For .

+ out de-, to loosen or lysis, to loosen or

Oxidation-reduction Oxidation-reduction - Hydrolysis and dehydra

oss (of electrons), R oss (of electrons), water + hydro, L The first part of the enzyme’s part enzyme’s the of first The ase. s I and a hydrogen ion H ion and a hydrogen - { reactions dehydration Use the mnemonic OIL RIG to remember OIL to remember the mnemonic RIG Use xidation xidation One way to think of this is to remember that that to think of this is to remember One way to the substrate. 33] to the substrate. [p. group it will a phosphate add A few enzymes have two names. These enzymes were enzymesThese were fewA enzymes names. two have For example, phosphate groups may be transferred from one one be transferred from may groups phosphate example, For In a hydrolysis { reaction When an enzyme of the substrate name consists name plus kinase removes a functional group from one or or one from group a functional subtraction removes reaction ain. G - dehydra In many of the products. is one a water molecule water}, losing water in into one, molecules combine two reactions, tion the monosaccharides and fruc glucose - example, For the process. In the process, 31]. molecule [p. sucrose tose join to make one -OH and the other group substrateone molecule loses a hydroxyl H water, to create substrate a hydrogen molecule loses are the most important reactions in energy important the most are reactions reactions extraction from transfer electrons These reactions and transfer in cells. is said A molecule that gains electrons molecule to another. one . to be reduced reduces the electric negativelyadding charge charged electrons are molecules that lose electrons Conversely, the molecule. on said to be oxidized. O what happens: Addition-Subtraction-Exchange Reactions recognizable by the suffix - suffix the by recognizable name (everything usually the suffix) to the refers that precedes or which the substrate to the enzyme upon acts, type of reaction, and as its substrate, has glucose glucokinase example, For to both. as a is called group phosphorylation of a phosphate Addition . for naming standards when the current 1972, before discovered a new both they have As a result, enzymes adopted. first were two and trypsin, Pepsin name and a commonly used older name. examples of older enzyme are names. enzymes, digestive Reactions Oxidation-Reduction Hydrolysis-Dehydration Reactions adds a functional group to one or more of the substrates. of the substrates. or more to one group a functional adds reaction A between exchanged are groups Functional of the substrates. more substratesor among during. exchange reactions - re or exchange subtraction, molecule to another during addition, is an important The transfer groups means of phosphate actions. dissolve}, a substrate changes into one or more products through through products more or substratea one into changes dissolve}, the covalent of bonds In these reactions, of water. the addition (“lysed”) broken the water molecule are the water reacts so that OH group as a hydroxyl a dehydration reaction results in the synthesis of a new molecule, synthesisthe in of a new results molecule, reaction a dehydration synthesis. as dehydration is known the process tion reactions are important in the breakdown and synthesis of synthesis and important of are in the breakdown reactions tion In biomolecules. large an amino acid can be removed from the end of a peptide chain the end of a peptide chain from canan amino acid be removed reaction. a hydrolysis through One ex- the enzyme -ase, the suffix causes reaction. a hydrolysis an enzymeample is lipase, lipids into smaller up large that breaks is an enzyme A peptidase an removes that hydrolysis. lipids by a peptide. from amino acid

- - -

118 Activation of reaction Reactants Reaction process Products

able 4.4

T 111 KEY

C+D 104 101 of enzyme Lower activation energy in presence energy 93 99 Time

Enzymes lower the activation energy energy the activation lower Enzymes of reactions - the dis do not develop Carriers of the disease. carriers

How could you test whether Sarah and David are carriers of carriers are and David whether Sarah could you test How gene? the Tay-Sachs A+B 4.7 without enzyme An enzyme’s name can important provide enzyme’s cluesAn to the type

Activation energy Activation energy

In the absence of enzyme, the reaction (curved dashed (curved of enzyme, the reaction In the absence energy. activation have much greater line) would means that for a baby to be born with Tay-Sachs Tay-Sachs be born to with a baby means that for Recessive each par one from genes, inherit it must twodisease, defective gene and one normal gene are Tay-Sachs with one People ent. called People their children. gene on to can pass the defective ease but - two normal normal amounts of hexosa who have genes have levels lower-than-normal have Carriers in their blood. A minidase excessive prevent this amount is enough to but of the enzyme, in cells. of gangliosides accumulation Q2: genetic disorder caused by a caused by genetic disorder disease is a recessive Tay-Sachs A. of hexosaminidase synthesis in the gene that directs defect Free energy of molecule of energy Free change-addition-subtraction, and ligation reactions. reactions. and ligation change-addition-subtraction, enzymessummarizes common categories gives these and for dif typesferent of reactions. the enzyme Most enzymesof reaction catalyzes. instantly are Enzymatic Reactions Can Be Categorized Enzymatic Reactions Can Be catalyzedMost reactions enzymes by can be classified into four ex hydrolysis-dehydration, oxidation-reduction, categories: carbonic acid. Without and other enzymes carbonic anhydrase in carbonic acid. so slowly go that cells would would biological reactions the body, be unable to live. Fig.

Running Problem M04_SILV1226_07_SE_C04.indd 101 102 Chapter 4 Energy and Cellular Metabolism

Table 4.4 Classification of Enzymatic Reactions Reaction Type What Happens Representative Enzymes

1. Oxidation-reduction Add or subtract electrons Class:* oxidoreductase (a) Oxidation Transfer electrons from donor to oxygen Oxidase Remove electrons and H+ Dehydrogenase (b) Reduction Gain electrons Reductase

2. Hydrolysis-dehydration Add or subtract a water molecule Class:* hydrolase (a) Hydrolysis Split large molecules by adding water Peptidases, saccharidases, lipases (b) Dehydration Remove water to make one large mol- Dehydratases ecule from several smaller ones

3. Transfer chemical groups Exchange groups between molecules Class:* transferases Add or subtract groups Class:* lyases (a) Exchange reaction Phosphate Kinase Amino group (transamination) Transaminase (b) Addition Phosphate (phosphorylation) Phosphorylase Amino group (amination) Aminase (c) Subtraction Phosphate (dephosphorylation) Phosphatase Amino group (deamination) Deaminase

4. Ligation Join two substrates using energy from ATP Class:* ligases Synthetase

*Enzyme classes as defined by the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology, www.chem.qmul.ac.uk/iubmb/enzyme.

of covalent modulation [p. 49], turning reactions on or off or in- Metabolism creasing or decreasing their rates. Several types of enzymes catalyze reactions that transfer phosphate groups. Kinases transfer a Metabolism refers to all chemical reactions that take place in phosphate group from a substrate to an ADP molecule to create an organism. These reactions (1) extract energy from nutrient ATP, or from an ATP molecule to a substrate. For example, cre- biomolecules (such as proteins, carbohydrates, and lipids) and atine kinase transfers a phosphate group from creatine phosphate (2) either synthesize or break down molecules. Metabolism is to ADP, forming ATP and leaving behind creatine. often divided into catabolism, reactions that release energy The addition, subtraction, and exchange of amino groups through the breakdown of large biomolecules, and anabolism, [p. 32] are also important in the body’s use of amino acids. energy-utilizing reactions that result in the synthesis of large bio- Removal of an amino group from an amino acid or peptide is a molecules. Anabolic and catabolic reactions take place simultane- deamination reaction. Addition of an amino group is amination, ously in cells throughout the body, so that at any given moment, and the transfer of an amino group from one molecule to another some biomolecules are being synthesized while others are being is transamination. broken down. The energy released from or stored in the chemical bonds Ligation Reactions Ligation reactions join two molecules to- of biomolecules during metabolism is commonly measured in gether using enzymes known as synthetases and energy from ATP. kilocalories (kcal). A kilocalorie is the amount of energy needed An example of a ligation reaction is the synthesis of acetyl coen- to raise the temperature of 1 liter of water by 1 degree Celsius. zyme A (acetyl CoA) from fatty acids and coenzyme A. Acetyl One kilocalorie is the same as a Calorie, with a capital C, used CoA is an important molecule in the body, as you will learn in the for quantifying the energy content of food. One kilocalorie is also next section. equal to 1000 calories (small c). Much of the energy released during catabolism is trapped in Concept 10. Name the substrates for the enzymes lactase, pep- the high-energy phosphate bonds of ATP or in the high-energy tidase, lipase, and sucrase. Check electrons of NADH, FADH2, or NADPH. Anabolic reactions 11. Match the reaction type or enzyme in the left col- then transfer energy from these temporary carriers to the cova- umn to the group or particle involved. lent bonds of biomolecules. a. kinase 1. amino group Metabolism is a network of highly coordinated chemical re- b. oxidation 2. electrons actions in which the activities taking place in a cell at any given c. hydrolysis 3. phosphate group moment are matched to the needs of the cell. Each step in a met- d. transaminase 4. water abolic pathway is a different enzymatic reaction, and the reactions of a pathway proceed in sequence. Substrate A is changed into

M04_SILV1226_07_SE_C04.indd 102 21/10/14 8:54 AM CHAPTER 4

21/10/14 8:54 AM 103

Ribose 5- phosphate In this formthis In Metabolism Fructose 6- phosphate Fructose 1,6- bisphosphate Glucose 6-phosphate Glycogen Glucose 3-phosphate feedback inhibition. Modulators, which alter the activity of which activity alter the of Modulators,

DHAP , acts as an inhibitory modulator of the pathway. As As an inhibitory as acts pathway. of the modulator , . For enzymes, the production of modulators is frequently frequently is modulators of production the enzymes, For . Fructose 1-phosphate By controlling enzymeBy controlling concentrations rates that change reaction modulators By producing enzymes different two By using catalyze to reversible reactions By compartmentalizing enzymes within intracellular organelles to ADP ratio ATP of By maintaining an optimum effectsdiscussed the changingof enzyme concentration We In addition, some metabolic pathways have their own built- their own metabolic pathways some have In addition,

1. 2. 3. 4. 5. the pathway proceeds and Z accumulates, the enzyme catalyzing and Z accumulates, proceeds the pathway of the enzyme Inhibition of A to B is inhibited. the conversion the Once cellthe until Z of can up. it use production down slows feedback enzyme on inhibition and 1 is removed levelsfall, of Z Enzyme Modulation Figure 4.9 as enzyme- concen reactions: of protein-binding in the discussion The sections 51]. [p. rate increases the reaction tration increases, four the list. items on that follow examine the remaining [p. 49] [p. outside from hormones and other signals coming by controlled This type is a key element in the of outside regulation the cell. metabolism following a meal or of the body’s integrated control during periods meals. of fasting between called formin modulation, of as Z in shown of a pathway, the end product of modulation, a protein, were introduced in the discussion of protein binding of protein discussion the in introduced were protein, a DHAP = dihydroxyacetone phosphate DHAP = dihydroxyacetone Glucose Fructose Glycerol (b) Metabolic Pathways Drawn Like a Road Map D S C S B ). Just as a map shows a network of of a network as a map shows Just ). S A Fig. 4.8 Fig. Metabolic pathways resemble a road map a road resemble Metabolic pathways

4.8 We call intermediates pathway the molecules of the because We pathways of metabolic is similar to a group ways, In many Cities on the map are equivalent to intermediates in metabolism. equivalent to intermediates in Cities on the map are one than one way to go from may be more In metabolism, there may be many as on the map, there just intermediate to another, one city to another. ways to get from (a) Section of Road Map roads that connect various cities and towns, you can think of me- you various connect that cities and towns, roads various connecting of chemicaltabolism as a network reactions chemicity Each - different a is town or intermediateproducts. and reactions, irreversible are roads One-way cal intermediate. key intermediates. to several are destinations big cities with roads to place one from get to way one than be more may there as Just can there be several pair of given pathways any between another, chemical intermediates. Fig. Cells Regulate Their Metabolic Pathways Cells Regulate Their Metabolic their meta- of molecules through the flow do cellsHow regulate basic ways: They do so in five bolic pathways? the products of one reaction become the substrates for the next. for next. the substrates the become reaction one of products the will hear metabolic pathways called sometimes intermediary You called par- key intermediates, Certain intermediates, . metabolism branchthe as act points and pathway one than more in ticipate for Glucose, or another. for channeling direction substrate in one is a key intermediate in several metabolic pathways. instance, map ( a detailed road the substrate which for then becomes the next reaction B, product forth: and so into C, B is changed in the pathway. M04_SILV1226_07_SE_C04.indd 103 104 Chapter 4 Energy and Cellular Metabolism

Fig. 4.9 Feedback inhibition Ratio of ATP to ADP The energy status of the cell is one final mechanism that can influence metabolic pathways. Through com- The accumulation of end product Z inhibits the first step of the pathway. As the cell consumes Z in another metabolic reaction, plex regulation, the ratio of ATP to ADP in the cell determines the inhibition is removed and the pathway resumes. whether pathways that result in ATP synthesis are turned on or off. When ATP levels are high, production of ATP decreases. enzyme 1 enzyme 2 enzyme 3 A B C Z When ATP levels are low, the cell sends substrates through pathways that result in more ATP synthesis. In the next section, we look further into the role of ATP in cellular metabolism. Feedback inhibition ATP Transfers Energy between Reactions

the pathway starts to run again. Because Z is the end product of The usefulness of metabolic pathways as suppliers of energy is the pathway, this type of feedback inhibition is sometimes called often measured in terms of the net amount of ATP the pathways end-product inhibition. can yield. ATP is a nucleotide containing three phosphate groups [p. 34]. One of the three phosphate groups is attached to ADP by Reversible Reactions Cells can use reversible reactions to a covalent bond in an energy-requiring reaction. Energy is stored regulate the rate and direction of metabolism. If a single enzyme in this high-energy phosphate bond and then released when the can catalyze the reaction in either direction, the reaction will go bond is broken during removal of the phosphate group. This rela- to a state of equilibrium, as determined by the law of mass action tionship is shown by the following reaction: (Fig. 4.10a). Such a reaction, therefore, cannot be closely regulated

except by modulators and by controlling the amount of enzyme. ADP + Pi + energy L ADP ∼ P = ATP However, if a reversible reaction requires two different en- 1 2 zymes, one for the forward reaction and one for the reverse reac- Running Problem tion, the cell can regulate the reaction more closely (Fig. 4.10b). If no enzyme for the reverse reaction is present in the cell, the In 1989, researchers discovered three genetic mutations respon- reaction is irreversible (Fig. 4.10c). sible for Tay-Sachs disease. This discovery paved the way for a new carrier screening test that detects the presence of one of Compartmentalizing Enzymes in the Cell Many enzymes the three genetic mutations in blood cells rather than testing for of metabolism are isolated in specific subcellular compartments. lower-than-normal hexosaminidase A levels. David and Sarah Some, like the enzymes of carbohydrate metabolism, are dissolved will undergo this genetic test. in the cytosol, whereas others are isolated within specific organelles. Mitochondria, endoplasmic reticulum, Golgi apparatus, and Q3: Why might the genetic test for mutations in the Tay-Sachs lysosomes all contain enzymes that are not found in the cytosol. gene be more accurate than the test that detects de- This separation of enzymes means that the pathways controlled creased amounts of hexosaminidase A? by the enzymes are also separated. That allows the cell to control Q4: Can you think of a situation in which the enzyme test might metabolism by regulating the movement of substrate from one be more accurate than the genetic test? cellular compartment to another. The isolation of enzymes within organelles is an important example of structural and functional compartmentation [p. 8]. 93 99 101 104 111 118

Fig. 4.10 Enzymes control reversibility of metabolic reactions

Reversible Reactions Irreversible Reactions

(a) Some reversible reactions (b) Reversible reactions requiring (c) Irreversible reactions lack use one enzyme for both two enzymes allow more the enzyme for the reverse directions. control over the reaction. direction.

+ + + CO2 H2O Glucose PO4 Glucose PO4

carbonic carbonic hexokinase glucose 6- hexokinase anhydrase anhydrase phosphatase Q FIGURE QUESTION What is the difference between Carbonic acid Glucose 6-phosphate a kinase and a phosphatase? Glucose 6-phosphate (Hint: See Tbl. 4.4.)

M04_SILV1226_07_SE_C04.indd 104 21/10/14 8:54 AM CHAPTER 4

- 21/10/14 1:23 PM 10

5 O 2 2 H 2 S Metabolism

+ i P +

2 H

2 + carbohydrates lipids polysaccharides proteins triglycerides

+ 1. 2. 3. 4. 5. ADP

2 NADH +

2 +

NAD

2 ATP

2 + . These compounds transfer the electrons to to transferThese compounds the electrons . 2 glucose fatty acids fatty amino acids amino glycerol +

(b) (c) (d) the products? Match each component on the left to the molecule(s) it is part of: (a) Do endergonic reactions release energy or trap it in summarizes the key steps of glycolysis, the con- summarizes the key steps of glycolysis, pyruvate how to acetyl shows is converted CoA illustrates the energy-transferring of pathway

Glucose 15. 16.

Pyruvate has a net yield of two 3-carbon pyruvate molecules, has a net yield 3-carbon of two pyruvate molecules,

6 2 k O c ept 12 c version of glucose to pyruvate. version carbons acetyl the citricand how through acid from CoA go cycle. transportthe electron system. and lipid catabolism will and synthetic examine protein We exam- a good are production pathways for ATP The aerobic In glycolysis (Fig. 4.12), metabolism of one glucose molecule metabolism of one 4.12), In glycolysis (Fig. Figure 4.12 Figure 4.13 Figure 4.14 Because glucose is the only that follows molecule - both path (ETS) in the mitochondria. The The electron transport systemmitochondria. the in (ETS) in the intermembrane the energy compartment stores needed H + 6 • • • Con Che pathways for lipids and glucose when we look at the fate of the at the fate of the pathways look for lipids and glucose when we nutrients eat [Chapter 22]. we The enzymes of glycolysis ple of compartmentation within cells. enzymesthe and citricthe of cycle locatedacid cytosol, the in are of concentration Within mitochondria, in the mitochondria. are H One Glucose Molecule Can Yield One Glucose Molecule Can Yield 30–32 ATP glu- one of metabolism Figure Recallaerobic the that 4.11 from and 30–32 ATP. water, carboncose molecule produces dioxide, Let’s review of glycolysis the role and the citric cycle acid in that production. ATP C to make the high-energy of ATP. bond the energy elec uses those from turn, in transport system, electron vari At - high-energythe make to ATP. of bond trons phosphate Cells carbon water. and produces dioxide process the points, ous and must but carbon is a waste product dioxide can use the water, the body. from be removed at only look glucose we in this chapter, ways in their entirety, catabolism. 2 ATPs, and high-energy carried electrons 2 NADH: on 2 ATPs, NADH and FADH NADH

- . is the is the i - citric cycle acid path- or oxidative, air} pathways, which are which are pathways, air} aer,

TP molecule is energy TP molecule is energy dissolve}lysis, the and without + without , an- ment of substrates through metabolic pathways. trapped and stored? In which part of a NADH trapped and stored? In which part of a NADH molecule is energy stored? Name five ways in which cells regulate the move In which part of an A What is the difference between aerobic and anaero bic pathways?

12. 13. 14.

summarizes the catabolic pathways that extract en- k { Anaerobic c ept c The metabolic pathways that yield the most ATP molecules molecules The metabolic pathways that yield the most ATP ATP is more important is more as a carrier of energy than as an ATP The squiggle ~ indicates a high-energy bond, and P ~ indicatesThe squiggle a high-energybond, Both glycolysis and the citric cycle acid small produce Carbohydrates enter glycolysis enter Carbohydrates the form in (top of of glucose Con Che those that can proceed without oxygen, also produce ATP mol- ATP produce also oxygen, without canthat those proceed yield of ATP The lower smallerecules but in much quantities. pathways means that most animals (includinganaerobic humans) unable to surviveare metabo- for extended periods anaerobic on are biomolecules how consider we section, In the next alone. lism metabolized to transfer energy to ATP. ways. ways. , aerobic oxygen—the those that require are abbreviation for an inorganic phosphate group. Estimates of the of the Estimates group. for phosphate an inorganic abbreviation energy free of amount when a high-energy released phosphate 7 to 12 kcal of ATP. per mole range from broken is bond cells can only contain thing, one For energy-storage molecule. human needs 40 kg adult A resting ATP. a limited amount of to supply the energy to support required (88 pounds!) of ATP cells than our far more worth of metabolic activity, day’s one most of its daily energy the body acquires Instead, could store. the chemical biomolecules. of complex from bonds requirement transfer that chemical energyMetabolic reactions bond to the to the high-energy or in a few cases, high-energyof ATP, bonds nucleotide GTP of the related bonds guanosine triphosphate, - pro Aerobic ergy and transfer biomolecules it to ATP. from pathways: follows two commonly glucose from ATP of duction glycolysis + sweet -, {glyco Catabolic Pathways Produce ATP Catabolic Pathways Produce Figure 4.11

[p. 30], which enter the pathway at different points: glycerol feeds glycerol points: which at different enter the pathway 30], [p. and fatty metabolized are to acetyl acids CoA. into glycolysis, which also enter at into amino acids, down broken are Proteins glycolysis Carbons from and other nutrients enter various points. each At which makes a never-ending circle. the citric cycle, acid high-energy elec- cyclethe carbons ATP, adds produces and turn, and carbon dioxide. trons, important but their most contribu - directly, amounts of ATP synthesis is trapping energy carried in electrons by to ATP tion (also known as the tricarboxylic acid cycle). The citric cycle acid the tricarboxylic as (also known cycle). acid called so it is sometimes the Krebs, Hans A. describedwas first by described other metabolic cycles, Krebs Because Dr. Krebs. cycle the term using citric by confusion will avoid we acid. cycle and fatty into glycerol down acids broken are Lipids 4.11). Fig. M04_SILV1226_07_SE_C04.indd 105 Fig. 4.11 ESSENTIALS ATP Production Glucose The catabolic pathways that extract energy from biomolecules and NAD+ transfer it to ATP are summarized G in this overview figure of aerobic L Y Glycerol NADH respiration of glucose. C O L ADP Y Amino S acids I ATP S Glycolysis and the citric acid cycle produce small amounts of ATP Glucose directly, but their most important contributions to ATP synthesis are Amino Pyruvate high-energy electrons carried by acids Cytosol NADH and FADH2 to the electron NAD+ Pyruvate transport system in the mitochondria. NADH Mitochondrion Acetyl CoA

Fatty acids Acetyl CoA Citric acid cycle

High-energy electrons

ADP ETS Amino CITRIC acids ACID ATP CYCLE This icon represents the different steps in the metabolic summary figure. Look for it in the Aerobic Metabolism of Glucose CO figures that follow to help 2 you navigate your way The energy production from one glucose through metabolism. molecule can be summarized in the following two equations. High-energy electrons and H+

Glucose + O + ADP + P CO + H O + ATP 2 i 2 2 ADP ELECTRON TRANSPORT SYSTEM ATP

30–32 ADP + Pi 30–32 ATP

C6H12O6 + 6 O2 6 CO2 + 6 H2O O2 H2O

+ In the next phase, the conversion of pyruvate to acetyl CoA compartment of the mitochondria (Fig. 4.14). When the H produces one NADH (Fig. 4.13). Carbons from one acetyl CoA move down their concentration gradient through a channel in going through the citric acid cycle trap energy in 3 NADH mol- the ATP synthase, the energy released is transferred to the high- ecules, 1 FADH2 and 1 ATP. These steps happen twice for each energy phosphate bond of ATP. On average, the NADH and glucose, giving a total yield of 8 NADH, 2 FADH2, and 2 ATP FADH2 from one glucose produce 26–28 ATPs. for the pyruvate-citric acid cycle phase of glucose metabolism. When we tally the maximum potential energy yield for the In the final step, high-energy electrons of NADH and catabolism of one glucose molecule through aerobic pathways, Fig. 4.15b FADH2 passing along the proteins of the electron transport sys- the total comes to 30–32 ATP ( ). These numbers are + tem use their energy to concentrate H in the intermembrane the potential maximum because often the mitochondria do not

106

M04_SILV1226_07_SE_C04.indd 106 21/10/14 8:54 AM Fig. 4.12 ESSENTIALS Glycolysis

During glycolysis, one molecule of glucose is converted by a GLUCOSE series of enzymatically catalyzed reactions into two ATP pyruvate molecules, producing 1 Glucose is phosphorylated to glucose 6-phosphate. (The “6” a net release of energy. ADP P in glucose 6-phosphate tells Glucose 6-phosphate you that the phosphate group has been attached to carbon 6 of the glucose molecule.)

P 2 Key Features of Glycolysis Fructose 6-phosphate ATP • In glycolysis, one 6-carbon 3 molecule of glucose becomes two ADP P P 3-carbon pyruvate molecules. Fructose 1,6- • Two steps of glycolysis require Glucose bisphosphate energy input from ATP. Other steps trap energy in ATP and the 4 high-energy electrons of NADH. P Dihydroxyacetone • Glycolysis does not require phosphate oxygen. It is the common pathway Pyruvate for aerobic and anaerobic catabolism of glucose.

P 2 Glyceraldehyde 3-phosphate 2 + P NAD 5 Steps 5–9 occur twice for each NADH glucose that begins the pathway. P 2 1, 3-Bisphosphoglycerate 2 P ADP 6 ATP

P 2 3-Phosphoglycerate 2 KEY

= Carbon 7 = Oxygen = Phosphate group P P 2 2-Phosphoglycerate (side groups not shown) 2

8 H2O P 2 Phosphoenol pyruvate 2 FIGURE QUESTIONS Q ADP 1. Overall, is glycolysis an endergonic or Pyruvate is the branch point exergonic pathway? 9 ATP for aerobic and anaerobic 2. Which steps of glycolysis metabolism of glucose. (a) use ATP? (b) make ATP or NADH? 2 Pyruvate 2 (c) are catalyzed by kinases? (d) are catalyzed by dehydrogenases? (Hint: See Tbl. 4.4.) 3. What is the net energy yield (ATP and NADH) for one glucose?

107

M04_SILV1226_07_SE_C04.indd 107 21/10/14 8:54 AM Fig. 4.13 ESSENTIALS Pyruvate, Acetyl CoA, and the Citric Acid Cycle

If the cell has adequate oxygen, each 3-carbon pyruvate formed during glycolysis reacts with Pyruvate 1 If the cell has adequate coenzyme A (CoA) to form one acetyl CoA Cytosol oxygen, pyruvate is and one carbon dioxide (CO2). transported into the 1 mitochondria. The 2-carbon acyl unit of acetyl CoA Pyruvate Mitochondrial enters the citric acid cycle pathway, matrix allowing coenzyme A to recycle and 2 Pyruvate reacts with react with another pyruvate. 2 coenzyme A to produce NAD+ acetyl CoA, one NADH, The citric acid cycle makes a and one CO2. never-ending circle, adding carbons from acetyl CoA with NADH each turn of the cycle and 3 Acetyl CoA has two CoA 4 parts: a 2-carbon acyl producing ATP, high-energy CO2 unit, derived from electrons, and carbon pyruvate, and Acetyl CoA dioxide. 3 coenzyme A. CoA

4 Coenzyme A is made from the vitamin pantothenic acid. Acyl unit Coenzymes, like enzymes, are not changed during 5 reactions and can be Citrate (6C) reused.

6 Oxaloacetate (4C) 5 The 2-carbon acyl unit Pyruvate enters the cycle by combining with a Acetyl CoA 4-carbon oxaloacetate NADH Isocitrate (6C) molecule.

Citric acid NAD+ cycle Malate (4C) 6 The 6-carbon citrate NAD+ 7 molecule goes through High-energy a series of reactions electrons until it completes the CO NADH 2 cycle as another CITRIC ACID oxaloacetate molecule. H2O CYCLE

a Ketoglutarate (5C) Fumarate (4C) 7 Two carbons are removed in the form of CO2. NAD+ CO2 FADH2 8 NADH 8 Most of the energy ATP FAD released is captured as CoA high-energy electrons ADP on three NADH and one Succinate (4C) Succinyl CoA (4C) FADH2. Some energy CoA GTP GDP + P goes into the i high-energy phosphate bond of one ATP. The CoA remaining energy is given off as heat. Q FIGURE QUESTIONS 1. Overall, is the citric acid cycle an endergonic or exergonic pathway?

2. What is the net energy yield (ATP, FADH2, and NADH) for one pyruvate completing the cycle? KEY 3. How many CO2 are formed from one pyruvate? Compare = Carbon CoA = Coenzyme A the number of carbon atoms in the pyruvate and CO2s. = Oxygen Side groups not shown

108

M04_SILV1226_07_SE_C04.indd 108 21/10/14 8:54 AM Fig. 4.14 ESSENTIALS The Electron Transport System

The final step in aerobic ATP production is energy transfer from high-energy electrons of NADH and FADH2 to ATP. This energy transfer requires mitochondrial proteins known as the electron transport system (ETS), located in the inner mitochondrial membrane. ETS proteins include enzymes and iron-containing cytochromes. The synthesis of ATP using the ETS is called oxidative phosphorylation because the system requires oxygen to act as the final acceptor of electrons and H+. The chemiosmotic theory says that potential energy stored by concentrating H+ in the intermembrane space is used to make the high-energy bond of ATP.

CITRIC Mitochondrial matrix ACID Inner CYCLE mitochondrial membrane 4 2 H O O + Matrix pool of H+ e- 2 2

1 ATP

4e- ADP 5 High-energy electrons + P 6 i ATP synthase H+ + H+ H 2 3 H+

H+ High-energy + H+ electrons H Electron H+ transport + H ce. system H+ H+ pa ne s + + bra H H mem inter + in the H+ es H centrat TEM con ELECTRON TRANSPORT SYS KEY Outer

+ mitochondrial = Lower H membrane concentration

= Higher H+ High-energy electrons concentration from glycolysis Cytosol

+ + 1 NADH and FADH2 2 Energy released when 3 By the end of 4 Each pair of 5 H flow back into the matrix 6 Each three H release high- pairs of high-energy the ETS, the electrons released through a protein known as ATP that shuttle energy electrons electrons pass along electrons have by the ETS synthase. As the H+ move through the + and H to the ETS. the transport system is given up their combines with two down their concentration ATP synthase + + + NAD and FAD are used to concentrate H stored energy. H and an oxygen gradient, the synthase transfers make a coenzymes that from the mitochondrial atom, creating a their kinetic energy to the maximum of recycle. matrix in the molecule of water, high-energy phosphate bond of one ATP. intermembrane space. H2O. ATP. Because energy The H+ concentration conversions are never gradient is a source of completely efficient, a portion of potential energy. the energy is released as heat.

Q FIGURE QUESTIONS 1. What is phosphorylation? What is phosphorylated in oxidative phosphorylation? 2. Is the movement of electrons through the electron transport system endergonic or exergonic? 3. What is the role of oxygen in oxidative phosphorylation?

109

M04_SILV1226_07_SE_C04.indd 109 21/10/14 8:54 AM 110 Chapter 4 Energy and Cellular Metabolism

Fig. 4.15 Energy yields from catabolism of one glucose molecule

– + (a) Anaerobic Metabolism C6H12O6 2 C3H5O3 + 2 H (b) Aerobic Metabolism C6H12O6 + 6 O2 6 CO2 + 6 H2O

One glucose metabolized One glucose metabolized aerobically through anaerobically yields only 2 ATP. the citric acid cycle yields 30–32 ATP.

1 Glucose NADH FADH2 ATP CO2 1 Glucose NADH FADH2 ATP CO2 G G L L Y Y C 4 C +4 O 2 O 2* L L –2 Y –2 Y S S I I S S

2 Pyruvate 2 Pyruvate –2 2 2 2 Lactate 2 Acetyl CoA

0 2 TOTALS NADH ATP Citric acid 6 2 2 4 cycle

6 O High-energy electrons 2 and H+

ELECTRON TRANSPORT 26–28 Q FIGURE QUESTIONS SYSTEM 1. How many NADH enter the electron transport system when glucose is metabolized to lactate? 6 30–32 6 2. Some amino acids can be converted to pyruvate. TOTALS H2O ATP CO2 If one amino acid becomes one pyruvate, what is the ATP yield from aerobic metabolism of that * Cytoplasmic NADH sometimes yields only amino acid? 1.5 ATP/NADH instead of 2.5 ATP/NADH.

work up to capacity. There are various reasons for this, includ- system functioning. But what happens to a cell whose oxygen + ing the fact that a certain number of H ions leak from the in- supply cannot keep pace with its ATP demand, such as often termembrane space back into the mitochondrial matrix without happens during strenuous exercise? In that case, the metabo- producing an ATP. lism of glucose shifts from aerobic to anaerobic metabolism, A second source of variability in the number of ATP pro- starting at pyruvate (Fig. 4.16). duced per glucose comes from the two cytosolic NADH mol- In anaerobic glucose metabolism, pyruvate is converted to ecules produced during glycolysis. These NADH molecules are lactate instead of being transported into the mitochondria: unable to enter mitochondria and must transfer their electrons NADH NAD+ through membrane carriers. Inside a mitochondrion, some of Pyruvate Lactate these electrons go to FADH2, which has a potential average yield Lactate dehydrogenase of only 1.5 ATP rather than the 2.5 ATP made by mitochondrial NADH. If cytosolic electrons go to mitochondrial NADH in- Pyruvate is a branch point for metabolic pathways, like a hub city stead, they produce two additional ATP molecules. on a road map. Depending on a cell’s needs and oxygen content, pyruvate can be shuttled into the citric acid cycle or diverted into Anaerobic Metabolism Makes 2 ATP lactate production until oxygen supply improves. The conversion of pyruvate to lactate changes one NADH + The metabolism of glucose just described assumes that the back to NAD when a hydrogen atom and an electron are trans- cells have adequate oxygen to keep the electron transport ferred to the lactate molecule. As a result, the net energy yield for

M04_SILV1226_07_SE_C04.indd 110 21/10/14 8:54 AM CHAPTER 4

- - 21/10/14 8:54 AM 111 - or 16 or 16

2 4 118 111 Metabolism shows the genetic the genetic shows or 64 different amino amino or 64 different 3 4 104 101 are indeed the way informa indeed the way - are Figure 4.17 , 99 One of the mysteries of biology until

The Tay-Sachs gene is a recessive gene (t). If Sarah is a If Sarah gene (t). gene is a recessive Tay-Sachs The what is the is not (TT), (Tt) but David of the gene carrier (Consult a be a carrier? will theirs of child that any chance if you need help solving this or genetics text biology general problem.) The power of proteins arises from their tremendous variabil- their tremendous arises of proteins from The power The classic change causing- example of an amino acid a prob David and Sarah had their blood drawn for the genetic test sev the genetic test for drawn had their blood and Sarah David the results. awaiting been anxiously ago and have weeks eral The tests hear the news. to the hospital returned to they Today, disease but Tay-Sachs carries the gene for that Sarah show some of their children This means that although does not. David none of the Sarah, gene like Tay-Sachs of the be carriers may the disease. will develop children Q5: tion is encoded in DNA and RNA. and RNA. is encoded in DNA tion acids. These triplets, called codons These triplets, acids. of carbohydrates, lipids, structural proteins, and signal molecules. and signal molecules. structural proteins, lipids, of carbohydrates, or in cell the and membrane in transporters pores and Protein into and molecules of movement the ganellemembranes regulate form Otherthe structural proteins skeleton out of compartments. synthesis protein is and other ways, In these of cells and tissues. critical to cell function. synthesis can using 20 amino acids be Protein ity and specificity. of 20 letters. an alphabet with a language to creating compared let of hundreds to letters vary three from length in “words” The spelling proteins out the structure of thousands of different ters, during- amino acid in one pro A change functions. with different changingjust as one function, synthesistein can protein’s the alter “food.” into “foot” letter turns the word when the inherited In this condition, lem is sickle cell disease. chain, in the protein acid glutamic one valine replaces amino acid blood red As a result, the change alters the shape of hemoglobin. a crescent take on cells the abnormal hemoglobin containing which causes tangled up and block them to get (sickle)shape, small blood vessels. Protein “Alphabet” The different amino acids. Because we have 20 amino acids, this is still 20 amino acids, Because have we amino acids. different forcodes the different If triplets were of bases satisfactory. not could create DNA however, molecules, the 1960s was the question of how only four nitrogenous bases bases only of how fourthe 1960s was the question nitrogenous cytosine (C), guanine (G), (A), molecule—adenine in the DNA and thymine (T)—could amino than 20 different code for more a the synthesis acid, amino of one If each base controlled acids. If pairs of bases cell could make only amino acids. four different cell the could make amino acids, different represented code as it appears in one form of RNA. Remember that RNA Remember that RNA formcode as it appears in one of RNA. 35]. base thymine [p. substitutes the base uracil (U) for the DNA

Running Problem

CoA [Aerobic and anaerobic me- and anaerobic [Aerobic CoA CYCLE Aerobic Acyl unit Pyruvate Pyruvate Acetyl CoA CITRIC ACID = Coenzyme A NADH CoA H and –OH not shown Describe two differences between aerobic and anaerobic metabolism of glucose. Lactate dehydrogenase acts on lactate by (adding Lactate dehydrogenase acts on lactate by (adding or removing?) a(n) _____ and a(n) _____. This process is called (oxidation or reduction?). How is the separation of mitochondria into two synthesis? compartments essential to ATP + matrix Aerobic and anaerobic metabolism anaerobic and Aerobic 17. 19. 18.

NAD Mitochondrial

= Carbon = Oxygen 4.16 KEY Lactate Anaerobic Cytosol Pyruvate is the branch point between aerobic aerobic the branch point between Pyruvate is of glucose. metabolism and anaerobic Proteins Are the Key to Cell Function the molecules that run are a cell from proteins seen, have As you enzymes synthesisthe breakdown and Protein control day. to day 0 NADH (Fig. 4.15a), a very puny yield when compared to the very the a to yield compared when puny 4.15a), (Fig. NADH 0 metabolism aerobic from result that ATP/glucose 30–32 metabolism severely efficiencyThe low of anaerobic (Fig. 4.15b). whose metabolic en- limits its usefulness in most vertebrate cells, ergy metabolism can provide. than anaerobic demand is greater cantolerate anaerobic muscle cells, such exercising as Some cells, they however, Eventually, metabolism for a limited period of time. shiftmust metabolism. back to aerobic tabolism in muscle discussed further are in Chapters 12 and 25.] the anaerobic metabolism of one glucose molecule is 2 ATP and and ATP 2 is molecule glucose one of metabolism anaerobic the

Concept Check Fig. M04_SILV1226_07_SE_C04.indd 111 112 Chapter 4 Energy and Cellular Metabolism

Fig. 4.17 The genetic code as it appears in the RNA is processed in the nucleus after it is made 3 . It may either codons of mRNA undergo alternative splicing (discussed shortly) before leaving the The three-letter abbreviations to the right of the brackets nucleus or be “silenced” and destroyed by enzymes through RNA indicate the amino acid each codon represents. The start interference. Processed mRNA leaves the nucleus and enters the cy- and stop codons are also marked. tosol. There it works with tRNA and rRNA to direct translation, 4 Second base of codon the assembly of amino acids into a protein chain . Newly synthesized proteins are then subject to posttrans- U C A G lational modification (Fig. 4.18 5 ). They fold into complex UUU UCU UAU UGU U Phe Cys shapes, may be split by enzymes into smaller peptides, or have UUC UCC UAC Tyr UGC C U Ser various chemical groups added to them. The remainder of this UUA UCA UAA UGA Stop Leu Stop A UUG UCG UAG chapter looks at transcription, RNA processing, translation, and UGG Trp G posttranslational modification in more detail. CUU CCU CAU CGU U Third base of codon CUC CCC CAC His CGC C C Leu Pro Arg CUA CCA CAA CGA A Gln DNA Guides the Synthesis of RNA CUG CCG CAG CGG G AUU ACU AAU AGU U The first steps in protein synthesis are compartmentalized within AUC IIe ACC AAC Asn AGC Ser C A Thr the nucleus because DNA is a very large molecule that cannot AUA ACA AAA AGA A First base of codon AUG Met ACG AAG Lys AGG Arg pass through the nuclear envelope. Transcription uses DNA as Start G a template to create a small single strand of RNA that can leave U GUU GCU GAU GGU the nucleus (Fig. 4.19). The synthesis of RNA from the double- GUC GCC GAC Asp GGC C G Val GUA GCA Ala GAA GGA Gly A stranded DNA template requires an enzyme known as RNA Glu GUG GCG GAG GGG G polymerase, plus magnesium or manganese ions and energy in the form of high-energy phosphate bonds:

Of the 64 possible triplet combinations, one DNA codon DNA template + nucleotides A, U, C, G (TAC) acts as the initiator or “start codon” that signifies the be- RNA polymerase, ginning of a coding sequence. Three codons serve as termina- Mg2+ or Mn2 + , tor or “stop codons” that show where the sequence ends. The and energy remaining 60 triplets all code for amino acids. Methionine and DNA template + mRNA tryptophan have only one codon each, but the other amino acids have between two and six different codons each. Thus, like letters spelling words, the DNA base sequence determines the amino A promoter region that precedes the gene must be activated acid sequence of proteins. before transcription can begin. Regulatory-protein transcription factors bind to DNA and activate the promoter. The active pro- Unlocking DNA’s Code How does a cell know which of the moter tells the RNA polymerase where to bind to the DNA thousands of bases present in its DNA sequence to use in making (Fig. 4.19 1 ). The polymerase moves along the DNA molecule a protein? It turns out that the information a cell needs to make a and “unwinds” the double strand by breaking the hydrogen bonds particular protein is contained in a segment of DNA known as a between paired bases 2 . One strand of DNA, called the template gene. What exactly is a gene? The definition keeps changing, but strand, serves as the guide for RNA synthesis 3 . The promoter for this text we will say that a gene is a region of DNA that con- region is not transcribed into RNA. tains the information needed to make a functional piece of RNA, During transcription, each base in the DNA template strand which in turn can make a protein. pairs with the complementary RNA base (G-C, C-G, T-A, Figure 4.18 shows the five major steps from gene to RNA A-U). This pairing of complementary bases is similar to the pro- to functional protein. First, a section of DNA containing a gene cess by which a double strand of DNA forms [see Appendix C must be activated so that its code can be read 1 . Genes that for a review of DNA synthesis]. For example, a DNA segment are continuously being read and converted to RNA messages containing the base sequence AGTAC is transcribed into the are said to be constitutively active. Usually these genes code for RNA sequence UCAUG. proteins that are essential to ongoing cell functions. Other genes As the RNA bases bind to the DNA template strand, are regulated —that is, their activity can be turned on (induced) or they also bond with one another to create a single strand of turned off (repressed) by regulatory proteins. RNA. During transcription, bases are linked at an average rate Once a gene is activated, the DNA base sequence of the of 40 per second. In humans, the largest RNAs may contain gene is used to create a piece of RNA in the process known as as many as 5000 bases, and their transcription may take more transcription {trans, over + scribe, to write} (Fig. 4.18 2 ). Human than a minute—a long time for a cellular process. When RNA cells have three major forms of RNA: messenger RNA (mRNA), polymerase reaches the stop codon, it stops adding bases to the transfer RNA (tRNA), and ribosomal RNA (rRNA). Messenger growing RNA strand and releases the strand (Fig. 4.19 4 ).

M04_SILV1226_07_SE_C04.indd 112 21/10/14 8:54 AM Fig. 4.18 ESSENTIALS Overview of Protein Synthesis The major steps required to convert the genetic code of DNA into a functional protein.

Gene Regulatory proteins 1 GENE ACTIVATION

Constitutively Regulated active activity

Induction Repression

2 TRANSCRIPTION (see Fig. 4.19)

siRNA mRNA

Alternative 3 mRNA PROCESSING Interference splicing (see Fig. 4.20)

mRNA “silenced” Processed mRNA

Nucleus

Cytosol • rRNA in ribosomes • tRNA • Amino acids 4 TRANSLATION (see Fig. 4.21)

Protein chain

5 POSTTRANSLATIONAL MODIFICATION Folding and Cleavage into Addition of groups: Assembly into cross-links smaller peptides • sugars polymeric proteins • lipids • -CH3 • phosphate

113

M04_SILV1226_07_SE_C04.indd 113 21/10/14 8:54 AM 114 Chapter 4 Energy and Cellular Metabolism

Fig. 4.19 Transcription

A gene is a segment of DNA that can produce a functional piece of RNA, which in turn can make a protein. Base pairing is RNA the same as in DNA synthesis, except that the base uracil (U) polymerase substitutes for thymine (T).

1 RNA polymerase binds to DNA.

2 The section of DNA that contains the gene unwinds.

RNA bases

3 RNA bases bind to DNA, creating a single strand of mRNA.

Template strand Site of nucleotide assembly

DNA

Lengthening mRNA strand mRNA RNA transcript polymerase

4 mRNA and the RNA polymerase detach from DNA, and the mRNA goes to the cytosol after processing. RNA mRNA strand polymerase released

Leaves nucleus after processing

it can be translated into proteins (see the Emerging Concepts Concept 20. use the genetic code in Figure 4.17 to write the DNA codons that correspond to the three mRNA stop box). In alternative splicing, enzymes clip segments out of the Check codons. middle or off the ends of the mRNA strand. Other enzymes then 21. What does the name RNA polymerase tell you about splice the remaining pieces of the strand back together. the function of this enzyme? Alternative splicing is necessary because a gene contains both segments that encode proteins (exons) and noncoding segments called introns (Fig. 4.20). That means the mRNA initially made Alternative Splicing Creates Multiple from the gene’s DNA contains noncoding segments that must be Proteins from One DNA Sequence removed before the mRNA leaves the nucleus. The result of alternative splicing is a smaller piece of mRNA that now contains The next step in the process of protein synthesis is mRNA pro- only the coding sequence for a specific protein. cessing, which takes two forms (Fig. 4.18 3 ). In RNA interfer- One advantage of alternative splicing is that it allows a single ence, newly synthesized mRNA is inactivated or destroyed before base sequence on DNA to code for more than one protein. The

M04_SILV1226_07_SE_C04.indd 114 21/10/14 8:54 AM CHAPTER 4

- 21/10/14 8:54 AM 115 pep I

H I Metabolism G F i H ) of the newly arrived D 2 h

E B Introns removed Introns G g Exons for protein #2 Exons for protein - con of each tRNA One region ). 4 C F f E A e D d Transcribed section Transcribed gene by Gene C c may produce two may produce proteins from one from proteins During translation, the mRNA codons are matched to the matched the to are codons mRNA the During translation, As translation begins, the anticodons of tRNAs carrying tRNAs of anticodons the begins, translation As a creating by synthesisamino acids links Dehydration TRANSCRIPTION alternative splicing. mRNA Processing H B ribosomal subunit binds the mRNA, then adds the large sub- the large then adds ribosomal the mRNA, subunit binds the Now is sandwiched in the middle. unit so that the mRNA to begin translation. is ready complex ribosome-mRNA This matching with the assistance of is done amino acid. proper 4.21 molecule (Fig. a tRNA tains a three-base sequence calledtains a three-base an anticodon- that is comple of the tRNA region A different mentary codon. to an mRNA amino acid. molecule binds to a specific to the complementary attach amino acids of ribosomal codons sequence UUU with anticodon a tRNA example, For mRNA. pairs with The UUU anticodon carries lysine. acid the amino The mRNA. on for codons lysine, of two one an AAA codon, newlyputs tRNA arrivedand amino pairingmRNA between peptide orientation to link to the growing into the correct acids chain. (-NH the amino group between tide bond amino acid and the carboxyl and the acid chainamino the peptide of (-COOH) end tRNA. “empty” the releases mRNA Once this happens, 32]. [p. with molecule acid amino another to can attach then tRNA The the aid of a cytosolic enzyme and ATP. F b A strand E a

Template I arrival D Exons for protein #1 Exons for protein B ). The small ). C 3 mRNA

Promoter Unprocessed G Introns removed Introns

Fig. 4.21 A DNA Explain in one or two sentences the relationship of Explain in one or two sentences the relationship of mRNA, nitrogenous bases, introns, exons, mRNA processing, and proteins. mRNA processing 22.

are probably made by alternative splicing of a a of splicing alternative by probably made are isozymes

4.20 After mRNA has been processed, it exits the nucleus through After has been processed, mRNA Concept Check Removing different introns from mRNA allows a from introns Removing different For protein single gene to code for multiple proteins. For protein removed. A, C, G, and I were #1, introns and H became the introns. #2, segments B, D, F, The promoter segment of DNA is not segment of DNA The promoter transcribed into RNA. In mRNA processing, segments of the newly created created segments of the newly In mRNA processing, The removed. are called introns mRNA strand back together to form spliced exons are remaining for a functional protein. the mRNA that codes mRNA Translation Links Amino Acids mRNA Translation among cooperation and coordination synthesis requires Protein Upon and tRNA. rRNA, mRNA, typesall three RNA: of which are binds to ribosomes, mRNA processed in the cytosol, Each 35]. small particles and several types of protein [p. of rRNA come that small, one and large one ribosomesubunits, two has synthesis begins ( when protein together designation of segments as coding or noncoding is not fixed for for is not fixed of segments as coding or noncoding designation time one removed that are Segments of mRNA gene. a given with a mRNA a finished producing can be left in the next time, closelyThe forms enzymesingle a of related sequence. different as known single gene. mRNA There nuclear to ribosomes and goes in the cytosol. pores the construction of protein. directs Fig. M04_SILV1226_07_SE_C04.indd 115 116 Chapter 4 Energy and Cellular Metabolism

Peptides synthesized on ribosomes attached to the rough endo- Emerging Concepts plasmic reticulum have a signal sequence directs them through the membrane of the rough ER and into the lumen of this organelle. Purple Petunias and RNAi Once a protein enters the ER lumen, enzymes remove the signal Who could have guessed that research to develop a deep sequence. purple petunia would lead the way to one of the most exciting new areas of molecular biology research? RNA Proteins Undergo Posttranslational interference (RNAi) was first observed in 1990, when botanists who introduced purple pigment genes into petu- Modification nias ended up with plants that were white or striped with The amino acid sequence that comes off a ribosome is the pri- white instead of the deeper purple color they expected. mary structure of a newly synthesized protein [p. 32], but not This observation did not attract attention until 1998, when the final form. The newly made protein can now form differ- scientists doing research in animal biology and medicine had similar problems in experiments on a nematode ent types of covalent and noncovalent bonds, a process known worm. Now RNAi is one of the newest tools in biotechnol- as posttranslational modification. Cleavage of the amino acid ogy research. chain, attachment of molecules or groups, and cross-linkages are In very simple terms, RNA “silencing” of mRNA is a three general types of posttranslational modification. More than naturally occurring event accomplished through the pro- 100 different types of posttranslational modification have been duction or introduction of short RNA molecules. These described so far. short RNAs bind to mRNA and keep it from being trans- In some common forms of posttranslational modification, lated. They may even target the mRNA for destruction. the amino acid chain can: RNAi is a naturally occurring RNA processing mechanism that may have evolved as a means of blocking the 1. fold into various three-dimensional shapes. Protein folding replication of RNA viruses. Now researchers are using it creates the tertiary structure of the protein. to selectively block the production of single proteins within 2. create cross-links between different regions of its amino acid a cell. The scientists’ ultimate goal is to create technolo- chain gies that can be used for the diagnosis and treatment of 3. be cleaved (split) into fragments disease. 4. add other molecules or groups 5. assemble with other amino acid chains into a polymeric (many-part) protein. Assembly of proteins into polymers creates the quaternary structure of the protein.

When the last amino acid has been joined to the newly syn- Protein Folding Peptides released from ribosomes are free to thesized peptide chain, the termination stage has been reached take on their final three-dimensional shape. Each peptide first (Fig. 4.21 5 ). The mRNA, the peptide, and the ribosomal sub- forms its secondary structure, which may be an a-helix or a b- units separate. The ribosomes are ready for a new round of pro- strand [p. 32]. The molecule then folds into its final shape when tein synthesis, but the mRNA is broken down by enzymes known hydrogen bonds, covalent bonds, and ionic bonds form between as ribonucleases. Some forms of mRNA are broken down quite amino acids in the chain. Studies show that some protein fold- rapidly, while others may linger in the cytosol and be translated ing takes place spontaneously, but it is often facilitated by helper many times. proteins called molecular chaperones. The three-dimensional shape of proteins is often essential Protein Sorting Directs Proteins for proper function. Misfolded proteins, along with other pro- to Their Destination teins the cell wishes to destroy, are tagged with a protein called ubiquitin and sent to proteasomes, cylindrical cytoplasmic enzyme One of the amazing aspects of protein synthesis is the way spe- complexes that break down proteins. cific proteins go from the ribosomes directly to where they are needed in the cell, a process called protein sorting. Many newly Cross-Linkage Some protein folding is held in place by rela- made proteins carry a sorting signal, an address label that tells the tively weak hydrogen bonds and ionic bonds. However, other pro- cell where the protein should go. Some proteins that are synthe- teins form strong covalent bonds between different parts of the sized on cytosolic ribosomes do not have sorting signals. Without amino acid chain. These bonds are often disulfide bonds (S–S) a “delivery tag,” they remain in the cytosol when they are released between two cysteine amino acids, which contain sulfur atoms. from the ribosome [Fig. 3.7, p. 73]. For example, the three chains of the digestive enzyme chymo- The sorting signal is a special segment of amino acids known trypsin are held together by disulfide bonds. as a signal sequence. The signal sequence tag directs the protein to the proper organelle, such as the mitochondria or peroxisomes, Cleavage Some biologically active proteins, such as enzymes and allows it to be transported through the organelle membrane. and hormones, are synthesized initially as inactive molecules that

M04_SILV1226_07_SE_C04.indd 116 21/10/14 8:54 AM CHAPTER 4

. 21/10/14 8:54 AM 117

- (Addi .

U Anticodon

Metabolism U amino acid bound to an Incoming tRNA Lys (described on p. 99) (described on A Many complex proteins proteins complex Many

A A Trp G C G C A U and methyl groups, -CH and methyl groups, Phe - C G 2 Ribosome 4 A U Growing peptide Growing chain O A U Asp P U A G

C Each tRNA molecule attaches at one end to a specific amino acid. The anticodon of the tRNA molecule pairs codon on the mRNA, allowing with the appropriate specified by the amino acids to be linked in the order mRNA code. mRNA tion of a methyl group is called group of a methyl tion methylation.) Assembly into Polymeric Proteins are phosphate groups, groups, phosphate are Another example is the hemoglobin molecule, with four protein with four protein is the hemoglobin molecule, example Another 32]. p. 2.3, chains [Fig. - in which pro a quaternaryhave subunits, structure with multiple One ex- or tetramers. trimers, tein chains assemble into dimers, enzyme the is ample dehydrogenase lactate Outgoing “empty” tRNA

Nuclear membrane tRNA Amino acid Proteins can be can be Proteins

Completed peptide RNA polymerase mRNA Processed mRNA leaves the nucleus Processed and associates with ribosomes. subunits Ribosomal DNA Translation

4.21 Attachment of ribosomal subunits Termination Translation Transcription mRNA processing 5 4 3 1 2 Translation matches the codons of RNA the codons of RNA matches Translation a protein. acids to create with amino must have segments removed before they become active. The The active. they become before removed segments have must enzyme chymotrypsin small fragments two peptide have must - Post 50]. p. 2.12a, it can before catalyzeremoved [Fig. a reaction peptide hormones. some also activates translational processing Addition of Other Molecules or Groups Fig. modified by the addition of sugars (glycosylation) to create gly of sugars (glycosylation) create to - the addition by modified with lipids to make lipoproteins combination or by coproteins, . The two most common chemical groups added to proteins chemical to proteins added most common The two groups 29]. [p. M04_SILV1226_07_SE_C04.indd 117 118 Chapter 4 Energy and Cellular Metabolism

Concept 23. What is the removal of a phosphate group called? where the protein occurs in or outside the cell, and what it Check 24. List three general types of posttranslational modifi- does. Scientists working on the Human Genome Project ini- cation of proteins. tially predicted that our DNA would code for about 30,000 25. is hemoglobin a monomer, dimer, trimer, or tetramer? proteins, but they were not taking into account alternative splicing or posttranslational modifications. Scientists working on the Human Proteomics Initiative are now predicting that The many ways that proteins can be modified after synthe- we will find more than a million different proteins. The magni- sis add to the complexity of the human body. We must know tude of this project means that it will continue for many years not only the sequence of a protein but also how it is processed, into the future.

Running Problem Conclusion Tay-Sachs Disease

In this running problem, you learned that Tay-Sachs disease is You have also learned that a blood test can detect the pres- an incurable, recessive genetic disorder in which the enzyme that ence of genetic mutations that cause this deadly disease. breaks down gangliosides in cells is missing. One in 27 Ameri- Check your understanding of this running problem by compar- cans of Eastern European Jewish descent in the United States ing your answers to those in the summary table. To read more carries the gene for this disorder. Other high-risk populations in- on Tay-Sachs disease, see the NIH reference page (www clude French Canadians, Louisiana “Cajuns,” and Irish Americans. .ninds.nih.gov/disorders/taysachs/taysachs.htm) or the web By one estimate, about one person in every 250 in the general site of the National Tay-Sachs & Allied Diseases Association American population is a carrier of the Tay-Sachs gene. (www.ntsad.org).

Question Facts Integration and Analysis Q1: What is another symptom of Tay- Hexosaminidase A breaks down gan- Damage to light-sensitive cells of the Sachs disease besides loss of gliosides. In Tay-Sachs disease, this eye could cause vision problems and muscle control and brain function? enzyme is absent, and gangliosides even blindness. accumulate in cells, including light- sensitive cells of the eye, and cause them to function abnormally. Q2: How could you test whether Sarah Carriers of the gene have lower-than- Run tests to determine the average and David are carriers of the Tay- normal levels of hexosaminidase A. enzyme levels in known carriers of the Sachs gene? disease (i.e., people who are parents of children with Tay-Sachs disease) and in people who have little likelihood of being carriers. Compare the enzyme levels of suspected carriers such as Sarah and David with the averages for the known carriers and noncarriers. Q3: Why might the genetic test for The genetic test detects three mutations The genetic test is a direct way to test if mutations in the Tay-Sachs gene in the gene. The enzyme test analyzes a person is a carrier. The enzyme test is be more accurate than the test levels of the enzyme produced by the an indirect indicator. It is possible for fac- that detects decreased amounts gene. tors other than a defective gene to alter a of hexosaminidase A? person’s enzyme level. Can you think of some? (Answer in Appendix A, p. A-4.) Q4: Can you think of a situation in The genetic test looks for three muta- There are more than three mutations which the enzyme activity test tions in the Tay-Sachs gene. that can cause Tay-Sachs disease. If the might be more accurate than the person does not have one of the three genetic test? mutations being tested, the result will appear to be normal. Q5: The Tay-Sachs gene is a recessive Mating of Tt × TT results in the following If only one parent is a carrier, each child gene (t). What is the chance that offspring: TT, Tt, TT, Tt. Mating of Tt × has a 50% chance of being a carrier any child of a carrier (Tt) and a Tt results in the following offspring: TT, (Tt). If both parents are carriers, there noncarrier (TT) will be a carrier? Tt, Tt, tt. is a 25% chance that a child will have What are the chances that a Tay-Sachs disease and a 50% chance a child of two carriers will have the child will be a carrier. disease or be a carrier?

93 99 101 104 111 118

M04_SILV1226_07_SE_C04.indd 118 21/10/14 8:54 AM CHAPTER 4

21/10/14 8:54 AM

119 .

+ ® give up their give 2 (pp. 98, 99) 98, (pp. . Chapter SummaryChapter (p. 102) (p. Tbl. 4.4) Tbl. (p. 105) (p. Fig. 4.13) Fig. 108; p. A&P Mastering . ( 2 one molecule of glucose is converted intois converted molecule of glucose one , release energy release Catabolic reactions down and break . (p. 100) (p. glycolysis (p. 99) (p. Muscular: Muscle Metabolism Muscle Muscular:

Cells regulate the flow of molecules through their metabolic their metabolic of molecules through the flow Cells regulate (2) producing enzyme (1) controlling pathways by concentrations, enzymes (3) using different to allosteric and covalent modulators, (4) isolating enzymes in intracellular catalyze reactions, reversible to ADP. ratio of ATP or (5) maintaining an optimum organelles, 103) (p. and yield the most ATP. oxygen pathways require Aerobic ATP but produce pathways can without oxygen Anaerobic proceed smallerin much quantities. Like other proteins that bind ligands, enzymes exhibit saturation, enzymes exhibit saturation, that bind ligands, Like other proteins isozymes Related different have may and competition. specificity, activities. be Some and must enzymes precursors as inactive produced are . Organic of a cofactor the presence require This may activated. 100) called are cofactors coenzymes. (p. and modulator pH, Enzyme temperature, activity by is altered molecules. Enzymes energy the activation lowering by of a reaction. work 4.7) Fig. 100; (p. can be classified, Most reactions as oxidation-reduction hydrolysis-dehydration, addition-subtraction-exchange, or 102; 101, (pp. ligation reactions. Through Through High-energy and FADH NADH from electrons energy the electron transport as they pass through system. Their Fig. 4.14) 105; (p. energy is trapped in the high-energy of ATP. bonds energyMaximum glucose yield metabolism of one for aerobic 4.15) Fig. 105; (p. molecule is 30–32 ATP. Enzymes biological are catalysts that speed up the rate of chemical catalyzed In reactions without themselves being changed. reactions called are substrates the reactants enzymes, by All the chemical reactions in the body are known collectively known as All in the body are the chemical reactions metabolism require a net input of energy require Anabolic reactions biomolecules. large and synthesize biomolecules. large two pyruvate molecules, and yields 2 ATP, 2 NADH, and 2 H and 2 2 NADH, and yields 2 ATP, pyruvatetwo molecules, Fig. 4.12) 105; (p. of oxygen. Glycolysis the presence does not require metabolism of pyruvate the citric through Aerobic cycle acid and high-energy captured by electrons carbon dioxide, yields ATP, and FADH NADH

17. 18. 11. 12. 13. 14. 15. 19. 21. 22. Enzymes 10. Metabolism 16. P Production AT 20.

(p. 97) (p. reactions

rate is

(p. 96) (p. Fig. 4.4) Fig. (p. 98) (p. (p. 97; (p. of enzymesCompartmentation energy allows cells to direct and and reactants chemical or more begins with one reaction Other kinds of structure-function themes in the chapter two involve can proceed in both directions. Irreversible can in both directions. Reversible reactions proceed The net free but not the other. can direction reactions in one go is energy determines whether that reaction change of a reaction reversible. Activation energy is the initial input of energyto begin a required 96; 4.3) (p. Fig. reaction. Endergonic energy-producing. are reactions Exergonic is the capacity to do work. ChemicalEnergy enables cells work is the capacity to do work. and carry out normal activities. reproduce, and organisms to grow, enables cells work molecules to create to move Transport Mechanical is used for work movement. gradients. concentration 94) (p. energyKinetic energy Potential is stored is the energy of motion. 95; 4.2) (p. Fig. energy. Reaction 4.2). (Tbl. products or more ends with one p. 96; 4.3) (p. Fig. energy-utilizing. are to endergonic reactions Metabolic pathways couple exergonic reactions. Energy in ATP. is stored for driving reactions endergonic measured as the change in concentration of products with time. of products as the change in concentration measured (p. 96) The energy in the chemical stored of a molecule and available bonds to perform energy is the free work of the molecule. • Practice-on-the-go with Dynamic Study Modules Study with Dynamic • Practice-on-the-go Flix A&P and Physiology important with Interactive Visualize processes • quizzes! and practice Tutors Video with understanding your • Check RING A&P WITH MASTE MASTER PHYSIOLOGY E, PRACTICE, AND VISUALIZ A

Chapter Summary 7. 8. 4. 3. 9. 5. 6. Chemical Reactions Energy in Biological Systems 1. 2. flow by separating functions. Glycolysis in the cytosol takes place of the separating functions. by flow requiring citric but the cycle acid is isolated within mitochondria, cell, - Modula mitochondrial the transport membrane. substrates of across of enzymetion activity and the separation of pathways into subcellu- essential for lar compartments organizing and separating metabolic are processes. The major theme of this chapterThe major theme of this is energy it and how in biological systems Energy is stored used to do biological and work. transferred, is acquired, from extracted is and suchglycogen and fats as biomolecules large in Extracted energy is often metabolism. of the processes them through - Reac temporarilystored in the high-energy of ATP. bonds phosphate energythe as energy require that often processes and tions ATP use about learn more as you will see repeated This is a pattern you source. the organ systems of the body. Molecular compartmentation. and interactions relationships: molecular abilitythe where enzyme an of important to are enzymes, in interactions activity syn or in protein - bind to its substrate influences the enzyme’s nucleicassembly the larger into where acids amino direct of acids thesis, molecules.

M04_SILV1226_07_SE_C04.indd 119 120 Chapter 4 Energy and Cellular Metabolism

23. In anaerobic metabolism, pyruvate is converted into lactate, with a 25. mRNA leaves the nucleus and goes to the cytosol where, with the net yield of 2 ATP for each glucose molecule. (p. 110; Fig. 4.15) assistance of transfer RNA and ribosomal RNA, it assembles 24. Protein synthesis is controlled by nuclear genes made of DNA. The amino acids into a designated sequence. This process is called code represented by the base sequence in a gene is transcribed into a translation. (p. 112; Fig. 4.21) complementary base code on RNA. Alternative splicing of mRNA 26. Posttranslational modification converts the newly synthesized in the nucleus allows one gene to code for multiple proteins. (pp. 112, protein to its finished form. (p. 116) 114; Figs. 4.18, 4.19, 4.20)

Review Questions

In addition to working through these questions and checking your answers on p. A-5, review the Learning Outcomes at the beginning of this chapter.

Level One Reviewing Facts and Terms one molecule to the carbon skeleton of another molecule (to form a different amino acid) is called ______. 1. List the three basic forms of work and give a physiological example of each. 13. In metabolism, ______reactions release energy and result in the breakdown of large biomolecules, and ______reactions 2. Explain the difference between potential energy and kinetic energy. require a net input of energy and result in the synthesis of large bio- 3. State the two laws of thermodynamics in your own words. molecules. In what units do we measure the energy of metabolism? 4. The sum of all chemical processes through which cells obtain and 14. Metabolic regulation in which the last product of a metabolic path- store energy is called ______. way (the end product) accumulates and slows or stops reactions 5. In the reaction CO2 + H2O S H2CO3, water and carbon dioxide earlier in the pathway is called ______. + are the reactants, and H2CO3 is the product. Because this reaction 15. Explain how H movement across the inner mitochondrial mem- is catalyzed by an enzyme, it is also appropriate to call water and brane results in ATP synthesis. carbon dioxide ______. The speed at which this reaction occurs is called the reaction ______, often expressed as molarity/ 16. List two carrier molecules that deliver high-energy electrons to the second. electron transport system. 6. ______are protein molecules that speed up chemical reactions Level Two Reviewing Concepts by (increasing or decreasing?) the activation energy of the reaction. 7. Match each definition in the left column with the correct term from 17. Create maps using the following terms. the right column (you will not use all the terms): Map 1: Metabolism 1. reaction that can run either direction (a) exergonic • acetyl CoA • glycolysis 2. reaction that releases energy (b) endergonic • ATP • high-energy electrons 3. ability of an enzyme to catalyze one (c) activation energy • citric acid cycle • lactate reaction but not another (d) reversible • CO2 • mitochondria 4. boost of energy needed to get a (e) irreversible • cytosol • NADH reaction started (f ) specificity • electron transport system • oxygen (g) free energy • FADH2 • pyruvate (h) saturation • glucose • water Map 2: Protein synthesis 8. Since 1972, enzymes have been designated by adding the suffix ______to their name. • alternative splicing • ribosome 9. Organic molecules that must be present in order for an enzyme to • base pairing • RNA polymerase function are called ______. The precursors of these organic • bases (A, C, G, T, U) • RNA processing molecules come from ______in our diet. • DNA • start codon 10. In an oxidation-reduction reaction, in which electrons are moved • exon • stop codon between molecules, the molecule that gains an electron is said to be ______, and the one that loses an electron is said to be • gene • template strand ______. • intron • transcription • promoter • transcription factors 11. The removal of H2O from reacting molecules is called ______. Using H2O to break down polymers, such as starch, is called • mRNA • translation ______. • tRNA

12. The removal of an amino group -NH2 from a molecule (such as an 18. When bonds are broken during a chemical reaction, what are the amino acid) is called ______. Transfer of an amino group from three possible fates for the potential energy found in those bonds?

M04_SILV1226_07_SE_C04.indd 120 14/11/14 12:51 AM CHAPTER 4

21/10/14 8:54 AM 121

D Review Questions Review he start codon in mRNA is AUG. AUG. is he startmRNA in codon Time t A+B Is this an endergonic or exergonic reaction? or exergonic Is this an endergonic Problem Solving .

Quantitative Problems

gy gy r ene ee r F S B + A If the protein-coding portion of a piece of processed mRNA is mRNA portion of a piece of processed If the protein-coding - will amino acids be in the correspond many how 450 bases long, startThe is translated codon into an amino ing polypeptide? (Hint: is not.) but the stop codon acid, Given the following strand of DNA: (1) Find (1) start the first codon the following strandGiven of DNA: Hint: sequence. in the DNA list the sequence the triplets that follow the start codon, (2) For that the amino acids (3) Give bases. mRNA of corresponding 4.17.) (See Fig. triplets. to those mRNA correspond CGCTACAAGTCACGTACCGTAACGACT DNA: acids: Amino energy the free The graph shows change for the reaction If ATP releases energy to drive a chemical reaction, would you you would energy releases to drive a chemical reaction, If ATP energyor small? to be large activation suspect the of that reaction Explain.

28. Level Three 26. mRNA: Level Four 27. 25. . i P + ADP → Glycolysis in takes place - phos oxidative the cytosol; phorylation in takes place mitochondria. in the modified are Proteins endoplasmic reticulum. of- are Metabolic reactions ten coupled to the reaction ATP Some proteins have S–S Some have proteins nonadjacent between bonds amino acids. Enzymes catalyze biological reactions. The electron transportThe electron system traps energyin a concentration ion hydrogen gradient.

O, and (b) the energy yield O, 2 1. 2. 3. 4. 5. 6. and H 2 Biological energy use Compartmentation

Molecular interactions a. b. c. Match the metabolic processes with the letter of the biological with Match metabolic processes the best describestheme that process: the from one glucose going through anaerobic glycolysis anaerobic with ending through glucose going one from What of each pathway? the advantages are lactate. Briefly describe the processes of transcription and translation. Briefly describe of transcription and translation. the processes Which in each process? involved organelles are of appear? Explain the role On what molecule does the anticodon synthesis. this molecule in protein an example of potential or bond phosphate Is the energy of ATP’s kinetic energy? Explain why it is advantageous for a cell to store or secrete an en- for or secrete a cell it is advantageous to store Explain why zyme form. in an inactive - (a) the energy break the aerobic the following: yield from Compare glucose to CO of one down

19. Answers to Concept Checks, FigureAnswers and end-of-chapter and Graph Questions, Review Questions can be found in Appendix A [A-1]. 22. 23. 24. 20. 21. M04_SILV1226_07_SE_C04.indd 121