The Concerted Action of Multiple Post-Translational Events Regulates the Trafficking and Function of Wild Type and Mutant Disaccharidases

University of Veterinary Medicine Hannover Department of Physiological Chemistry

The concerted action of multiple post-translational events regulates the trafficking and function of wild type and mutant disaccharidases

INAUGURAL DOCTORAL THESIS in partial fulfillment of the requirements of the degree of Doctor of Natural Sciences -Doctor rerum naturalium- (Dr. rer. nat.)

submitted by Lena Diekmann, M.Sc. Bünde, Germany

Hannover 2016

Supervisor: Prof. Dr. phil. nat. Hassan Y. Naim Department of Physiological Chemistry Institute for Biochemistry University of Veterinary Medicine Hannover, Germany

Supervision group: Prof. Dr. phil. nat. Hassan Y. Naim Department of Physiological Chemistry Institute for Biochemistry University of Veterinary Medicine Hannover, Germany

Prof. Dr. rer. nat. Georg Herrler Department of Infectious Diseases Institute of Virology University of Veterinary Medicine Hannover, Germany

1st Evaluation: Prof. Dr. phil. nat. Hassan Y. Naim Department of Physiological Chemistry Institute for Biochemistry University of Veterinary Medicine Hannover, Germany

2nd Evaluation: Prof. Dr. rer. nat. Rita Gerardy-Schahn Institute for Cellular Chemistry Hannover Medical School, Germany

Date of the final exam: 19.04.2016

Dedicated to my family

Table of contents I

Table of contents

Table of contents ...... I

List of publications ...... III

Abbreviations ...... IV

List of tables ...... VII

List of figures ...... VII

Abstract ...... VIII

Zusammenfassung ...... X

Introduction ...... 1

Types of lactase deficiencies ...... 2

Symptoms of lactose intolerance and secondary associated disorders ...... 7

Diagnosis of lactose malabsorption and lactose intolerance ...... 8

Treatment of lactose intolerance in infants, children and adults ...... 10

Lactase-phlorizin hydrolase (LPH) ...... 10

Biosynthesis and intracellular processing ...... 12

Polarized sorting ...... 14

Protein modifications, folding and quality control in the ER ...... 15

Aim of the dissertation ...... 22

Publications ...... 23

Congenital lactose intolerance is triggered by severe mutations on both alleles of the lactase gene ...... 25

The Diverse Forms of Lactose Intolerance and the Putative Linkage to Several Cancers ...... 27

Structural Determinants for transport of a multi-domain membrane glycoprotein in the early secretory pathway ...... 28 II Table of contents

Discussion ...... 66

Difficulties in the diagnosis and possible molecular causes of the low lactase activity in CLD patients ...... 66

Identification and molecular analysis of two novel mutations of the LCT gene causing CLD ...... 68

Characterization and implication of the subdomains of LPH, a multi-domain protein, on its function and folding ...... 74

Conclusion ...... 79

References ...... 80

Acknowledgements ...... 106

Eidesstattliche Erklärung ...... 107

List of publications III

List of publications

Parts of this thesis were already published/are under revision

Diekmann L., Pfeiffer K., and Naim H. Y., Congenital lactose intolerance is triggered by severe mutations on both alleles of the lactase gene. BMC Gastroenterol. 2015 Mar 21;15:36. DOI: 10.1186/s12876-015-0261-y.

Amiri M.*, Diekmann L.*, von Köckritz-Blickwede M. and Naim H. Y., The Diverse Forms of Lactose Intolerance and the Putative Linkage to Several Cancers. Nutrients. 2015 Aug 28;7(9):7209-30. DOI: 10.3390/nu7095332.

Diekmann L.*, Behrendt M.*, Amiri M. and Naim H. Y., Structural determinants for transport of a multi-domain membrane glycoprotein in the early secretory pathway, J Biol Chem., under revision

Publication (not relevant for this thesis)

Maria Henström*, Lena Diekmann*, … , Hassan Y. Naim° Mauro and D’Amato°, Functional variants in the sucrase-isomaltase gene associate with increased risk of irritable bowel syndrome, NEJM, in progress

*° Authors contributed equally

Conference contributions regarding this thesis

Lena Diekmann, Katrin Pfeiffer, and Hassan Naim, Compound heterozygous mutations elicit congenital lactase deficiency in a Japanese infant, FASEB J April 2015 29:596.5

IV Abbreviations

Abbreviations

ATH adult type of hypolactasia ATP adenosine triphosphate BiP binding immunoglobulin protein bp base pairs BSA bovine serum albumin °C degree Celsius cDNA complementary DNA CLD congenital lactase deficiency CNX calnexin COS-1 african green monkey kidney fibroblast-like cells CRT calreticulin CSID ongenital sucrase-isomaltase deficiency DEAE diethyle-amino-ethyle del deletion DMEM Dulbecco´s modified Eagle Medium DNA desoxyribonucleid acid DTT dithiothreitol e.g. (exempli gratia) for example EDEM ER degradation-enhancing α-mannosidase-like protein endo H endo-β-N-acetylglucosaminidase H ER endoplasmic reticulum ERAD ER-associated degradation et al. et alii (and others) FCS fetal calf serum fs frameshift x g acceleration of gravity GABA γ-aminobutyric acid GH glycoside hydrolase GlcNAc N-acetylglucosamine GPI glycosylphosphatidylinositol Abbreviations V

h hour/hours Hsp70 heat shock protein 70 IBS irritable bowel syndrome IP immunoprecipitation kbp kilobase pair kDa kilo Dalton KLD Kongenitale Laktase Defizienz LCT lactase gene LPH lactase-phlorizin hydrolase m milli (10-3) M molar mass µ micro (10-6) mAbs monoclonal antibodies MEM methionine-free minimum essential medium MGAM maltase-glucoamylase min minute/minutes mRNA messenger RNA NMD nonsense-mediated mRNA decay PDI protein disulfide isomerase PNGase F peptide-N-Glycosidase F RNA ribonucleic acid RT room temperature SDS sodium dodecyl sulfate SERCA sarco(endo)plasmic reticulum Ca2+ ATPase SI sucrase-isomaltase SDS-PAGE sodium dodecylsulfate-polyacrylamide gel electrophoresis sec seconds SGLT1 sodium/glucose co-transporter 1 SNPs single nucleotide polymorphisms TEMED tetramethylethylenediamine TGN trans-Golgi network VI Abbreviations

TRIS Tris(hydroxymethyl)aminomethan UGGT UDP-glucose:glycoprotein glucosyltransferase UPF1 up-frameshift protein 1 UPR unfolded protein response w/v weight/volume X stop codon

Amino acid Three letter code One letter code alanine ala A arginine arg R asparagine asn N aspartic acid asp D asparagine or aspartic acid asx B cysteine cys C glutamic acid glu E glutamine gln Q glutamine or glutamic acid glx Z glycine gly G histidine his H isoleucine ile I leucine leu L lysine lys K methionine met M phenylalanine phe F proline pro P serine ser S threonine thr T tryptophan trp W tyrosine tyr Y valine val V

List of tables VII

List of tables

Table 1: Different types of lactase deficiencies ...... 3 Table 2: Reported CLD patients with mutations in the LCT gene ...... 6

List of figures

Figure 1: Maturation steps of LPH in the intestinal epithelial cells...... 14 Figure 2: Structure of the N-linked core glycan...... 17 Figure 3: Quality control of newly synthesized proteins in the endoplasmic reticulum...... 19 Figure 4: Potential requirements for heterodimerization of LPH wild type with a pathogenic mutant...... 73

VIII Abstract

Abstract

Lena Diekmann The concerted action of multiple post-translational events regulates the trafficking and function of wild type and mutant disaccharidases Lactose is the main carbohydrate of mammalian milk. For its uptake into the cell previous hydrolysis into the monosaccharides glucose and galactose is required, which is mediated by lactase-phlorizin hydrolase (LPH). LPH, the only β- galactosidase of the brush border membrane in the small intestine, is a membrane glycoprotein, which is post-translationally modified along the secretory pathway by N- and O-glycosylation, dimerization and proteolytic cleavage steps. Defects of intestinal lactose digestion due to insufficient lactase activity result in gastrointestinal symptoms characteristic for lactose intolerance. Congenital lactase deficiency (CLD) is the severe form of lactose intolerance, which is caused by mutations in the coding region of the LPH gene. The first part of this thesis investigated two novel mutations in the gene of LPH, which were detected in a Japanese infant in a compound heterozygous inheritance pattern. The influence of both mutations, Y1473X and D1796fs, on the structure, biosynthesis and function of LPH was assessed by transient expression in COS-1 cells. Both mutants are mannose-rich N-glycosylated, misfolded and enzymatically inactive proteins, which are retained in the endoplasmic reticulum (ER). Interestingly, none of those anchorless pathogenic mutant forms undergo heterodimer formation with the wild type, concluding that the transmembrane domain might be one requirement for heterodimerization of LPH. The second part of this thesis elucidated structural determinants of the multi-domain membrane glycoprotein LPH for its transport and maturation along the secretory pathway. By utilizing deletion variants, the role of the stretch region in domain II of the ectodomain was determined as an important structural element. A possible interaction of a potential N-glycosylation site in this stretch region with the ER- resident chaperone calnexin (CNX) was confirmed by co-immunoprecipitation. The constructs containing the stretch in domain II show an increased interaction with CNX. The biochemical analyses of those constructs offered that domain I and III of Abstract IX

the ectodomain of LPH act as intramolecular chaperones, while domain II and IV are not essential for transport competence. Taken together, the present thesis provides insights into the pathophysiology of CLD causing LPH mutations and complements the knowledge of the structural determinants for post-translational events of the multi-domain glycoprotein LPH.

X Zusammenfassung

Zusammenfassung

Lena Diekmann Das Zusammenspiel von verschiedenen post-translationalen Ereignissen reguliert den Transport und die Funktion von Wildtyp und Mutanten Disaccharidasen Laktose ist das häufigste Kohlenhydrat in der Milch von Säugetieren. Für die Aufnahme in das Zellinnere ist eine vorherige Hydrolyse von Laktose in die Monosaccharide Glukose und Galaktose notwendig, welche durch das Enzym Laktase-Phlorizin Hydrolase (LPH) katalysiert wird. LPH ist die einzige β- Galaktosidase der Bürstensaummembran im Dünndarm und gehört zur Proteinklasse der membranständigen Glykoproteine. Während des Transports entlang des sekretorischen Weges innerhalb der Zelle wird LPH post-translational durch N- und O-Glykosylierung, Dimerisierung und proteolytische Spaltungsprozesse modifiziert. Defekte im intestinalen Laktoseverdau, die durch unzureichende Laktase-Aktivität ausgelöst werden, führen zu gastrointestinalen Symptomen, welche charakteristisch für eine Lactoseintoleranz sind. Kongenitale Laktase Defizienz (KLD) ist die schwerwiegendste Form von Laktoseintoleranz und wird durch Mutationen in der kodierenden Sequenz des LPH Gens ausgelöst. Im ersten Teil der vorliegenden Arbeit wurden zwei neue Mutationen im Gen von LPH untersucht, welche in einem kombinierten heterozygoten Vererbungsmuster bei einem japanischen Säugling entdeckt wurden. Der Einfluss von beiden Mutationen, Y1473X und D1796fs, auf die Struktur, die Biosynthese und die Funktion von LPH wurde mittels transienter Expression in COS-1 Zellen analysiert. Beide mutierten Proteine sind mannosereich N-glykosyliert, falsch gefaltet, enzymatisch inaktiv und werden im endoplasmatischen Retikulum (ER) zurückgehalten. Interessanterweise interagiert keines der mutierten Proteine mit dem Wildtyp-Protein. Daher kommt es nicht zur Bildung von Heterodimeren. Daraus lässt sich schließen, dass die Transmembrandomäne, welche bei beiden Mutanten fehlt, eine notwendige Voraussetzung für die Heterodimerisierung von LPH-Proteinen im ER darstellen könnte. Zusammenfassung XI

Im zweiten Teil der These wurden die strukturellen Determinanten, die für den Transport und die Reifung von LPH entlang des sekretorischen Weges in der Zelle wichtig sind, detaillierter untersucht. Durch Deletionsmutanten konnte gezeigt werden, dass die Stretchregion in Domäne II der Ektodomäne ein wichtiges Strukturelement darstellt. Eine mögliche Interaktion mit dem ER-ständigen Chaperon Calnexin (CXN) durch die N-Glykosylierungssequenz in exakt dieser Stretchregion konnte durch ein Co-Immunpräzipitationsexperiment (IP) bewiesen werden. Die eingesetzten Konstrukte, welche die Stretchregion in Domäne II enthalten, zeigten eine verstärkte Interaktion mit Calnexin (CXN). Mit Hilfe dieser verschiedenen Konstrukte konnte des Weiteren gezeigt werden, dass Domäne I und III der Ektodomäne von LPH als intramolekulare Chaperone dienen, während Domäne II und IV keine essentielle Rolle für die Transportkompetenz aufweisen. Die vorliegende Arbeit bietet fundamentale Einblicke in die Pathophysiologie von Mutationen im Gen von LPH, die KLD verursachen und komplementiert das Wissen über strukturelle Determinanten, die wichtig sind für post-translationale Ereignisse des Multidomänen-Glykoproteins LPH.

Introduction 1

Introduction

The primary distinguishing characteristic of the class Mammalia, to which humans belong, is the presence of the mammary glands on females, in order to secrete milk and nurse the offspring. Milk is composed of lactose, fat, proteins and crucial electrolytes (Brussow, 2013). In mammalian milk, the lactose concentration is 7.2 mg/100 ml, whereas cow´s milk only contains 4.7 mg/100 ml (Solomons, 2002). Dairy products made out of milk, like butter, yoghurt, cheeses and sour cream, contain lower amounts of lactose due to its manufacturing process. Nowadays lactose is also used as a commercial food additive, which is found in foods like processed meats, margarines, sliced bread, breakfast cereals, potato chips, medications or protein supplements. Lactose is the main energy source for infants and provides almost half of their total energy supply (Vesa et al., 2000). Despite this important role, lactose may enhance divalent cation uptake in the intestine, like calcium, and functions as an immune-stimulant through its role as a substrate for the gut microbiome (Kwak, 2012; Venema, 2012; Savaiano, 2014). Lactose also shows direct cellular effects on the generation of antimicrobial peptides (AMP) such as cathelicidins (Cederlund et al., 2013).

Lactose is a disaccharide that is formed in the mammary glands from the monosaccharides glucose and galactose by the action of lactase synthase (Kuhn and White, 2009). Glucose is the key source of energy for the human body. Through glycolysis or later in the reactions of the citric acid cycle or oxidative phosphorylation, glucose is needed to generate ATP. The availability of glucose also influences physiological processes by providing almost all energy for the brain (Pramoud, 1997). In eukaryotes, Galactose plays an important role in the biosynthesis of glycoproteins, glycolipids and complex carbohydrates (Varki et al., 2009). Due to its conversion to N-acetylgalactosamine, galactose is also used for the formation of gangliosides, which play a central role in the immunity and signal transduction (Wang and Brand- Miller, 2003). 2 Introduction

In order to digest and absorb lactose from the digestive system, it must be hydrolyzed by a β-D-galactosidase located at the enterocytes of the small intestine (Hauri et al., 1985; Naim et al., 1987). This β-galactosidase, called lactase-phlorizin hydrolase (LPH, EC 3.2.1.23/108/62), belongs to the class of disaccharidases, which are all located at the brush border membrane of enterocytes in the small intestine (Naim et al., 1987; Naim et al., 1988; Naim et al., 1988). LPH is responsible for the hydrolysis of lactose and the cleavage of glycosylceramides (Leese and Semenza, 1973; Semenza, 1986; Zecca et al., 1998). Besides the β-galactosidase, the two α- glucosidases sucrase-isomaltase (SI) and maltase-glucoamylase (MGAM) are required for the final hydrolysis of di- and oligosaccharides. While MGAM essentially cleaves maltose, SI is responsible for the breakdown of the disaccharides sucrose, isomaltose and partially maltose (Sim et al., 2010). The activities of the disaccharidases are not equally distributed along the small intestine. LPH and SI exhibit their highest activities in the proximal intestine, while MGAM reaches its maximal activity in the ileum (Triadou et al., 1983). The area of the small intestine of an adult human is 30 m2 (Helander and Fandriks, 2014). It is build up by microvilli which lead to an increase in the cell surface to fulfill its function by absorbing the digestive products into the blood stream. The hydrolysis of the di- and oligosaccharides is indispensable to the absorption of monosaccharides across the brush border membrane into the cell interior. The uptake of glucose and galactose is mediated through SGLT1 transporters in the membrane of the epithelial cells (Ferraris, 2001).

Absent or reduced activity of LPH leads to lactose malabsorption and in the presence of gastrointestinal symptoms to lactose intolerance.

Types of lactase deficiencies

Three different forms of lactase deficiencies are known in humans (Table 1). The primary lactase deficiency, also called adult type of hypolactasia (ATH) or lactase Introduction 3

non-persistence, is a normal, developmental downregulation of lactase activity after weaning (Sahi, 1994). The secondary or acquired lactase deficiency is induced by gastrointestinal diseases causing (partial) atrophy of the small bowel villi (Heyman, 2006). Congenital lactase deficiency is a rare, but severe disease with absent lactase activity in infants from birth on (Kuokkanen et al., 2006). Developmental lactase deficiency is a disorder in preterm infants due to the fact that lactase activity is not optimally developed before week 35-38 of gestation (Antonowicz and Lebenthal, 1977; Erasmus et al., 2002; Heyman, 2006).

Table 1: Different types of lactase deficiencies

Type Pathogenesis Prevalence

~ 60-70% worldwide (Holden and Primary lactase developmental downregulation of Mace, 1997); deficiency the lactase activity after weaning varies from less than 5% to almost 100% (Sahi, 1994)

Secondary variable; reduced lactase activity due to an lactase injury of the gastrointestinal tract e.g. ~ 60% of postinfectious IBS deficiency patients (Ruchkina et al., 2013)

really rare disease (Savilahti et al., Congenital absent lactase activity from birth 1983); lactase on deficiency 1:60000 in Finland (Kuokkanen et al., 2006)

Two-thirds of the world population is affected by the developmental downregulation of the lactase activity level to 5%-10% of the level at birth during childhood and adolescence (Sahi, 1994). The prevalence of adult type of hypolactasia (ATH) varies between different populations, but appears to be more frequent in populations with a history of dairying (Simoons, 1969; Simoons, 1970; Holden and Mace, 1997). In Europe the frequency is between 2% in Scandinavia and 70% in some regions of 4 Introduction

Italy, while in Asia the incidence of ATH is nearly 100% (Scrimshaw and Murray, 1988; Sahi, 1994; Ozdemir et al., 2009). Lactase persistence appears due to a polymorphism of a single autosomal gene, which leads to the failure to repress the synthesis of lactase (Sahi, 1994; Harvey et al., 1995). Initially, a genotype/phenotype study detected the two single nucleotide polymorphisms (SNPs) C/T−13910 and

G/A−22018 in the LCT gene, but nowadays other SNPs are known to be associated with lactase persistence (Enattah et al., 2002; Ingram et al., 2007; Tishkoff et al., 2007; Coelho et al., 2009; Ingram et al., 2009; Jensen et al., 2011). The molecular mechanism is not completely understood, but it is established that all SNPs activate the promotor of the LCT gene with a similar cis-acting effect (Olds and Sibley, 2003; Lewinsky et al., 2005; Ingram et al., 2007; Ingram et al., 2009; Jensen et al., 2011). Recently, Dzialanski et al. suggested an intermediate phenotype, because the heterozygote CT−13910 and homozygote TT−13910, determined as lactase persistent, differ in their physiological response to lactose intake (Dzialanski et al., 2015).

Secondary or acquired lactase deficiency is caused by a decrease in lactase production after a gastrointestinal disease, an injury or a surgery. Examples of such gastrointestinal diseases are gastroenteritis, celiac disease or inflammatory bowel disease (Usai-Satta et al., 2012). Clinically, secondary lactase deficiency occurs after small bowel injury, such as viral or parasitic infections. Giardia infections are described to be associated with lactose intolerance (Gendrel et al., 1992), as well as the human immunodeficiency virus (HIV) (Miller et al., 1991). Secondary lactase deficiency is only a temporally disorder, which can be completely overcome after a few months.

Congenital lactase deficiency (CLD) leads to a complete elimination of lactase activity from birth on and represents a very severe disorder in infants due to the life- threatening dehydration and loss of electrolytes (Holzel et al., 1962; Holzel, 1967). Un- or misdiagnosis of CLD can lead to developmental disorders and to defects of Introduction 5

the liver and the brain (Berg et al., 1969; Hoskova et al., 1980). The prevalence of CLD is very low. Until now, only a few cases are described so far (Savilahti et al., 1983; Kuokkanen et al., 2006; Torniainen et al., 2009; Uchida et al., 2012; Sala Coromina et al., 2014; Fazeli et al., 2015). Small intestinal biopsies reveal normal histological characteristics but low or completely absent lactase activity (Asp et al., 1973; Freiburghaus et al., 1976). The lack of lactase activity is associated with mutations in the coding region of LPH, which are inherited in an autosomal recessive way. The most common types of mutations result in a truncated protein as a result of frameshifts or stop codons (Kuokkanen et al., 2006; Torniainen et al., 2009; Uchida et al., 2012; Sala Coromina et al., 2014; Fazeli et al., 2015) (Table 2, 9 out of 13 belong to these types). The other mutations lead to an amino acid exchange, which affects the function of LPH (Kuokkanen et al., 2006; Torniainen et al., 2009). All of the mutations appear in a homozygous or compound heterozygous pattern of inheritance (Table 2). The origin of the genetic background is probably located in Finland, because five mutations were detected in a study with 32 Finnish patients and additional two mutations were also found in Finnish patients in another study (Kuokkanen et al., 2006). Out of the five mutations in the first study, the mutation

Y1390X, also called the Finmajor, had the highest prevalence with 84%. This result could be confirmed in a screening of 556 anonymous blood donors in Finland (Kuokkanen et al., 2006). The other four mutations were only detected in the first study, except the G1363S mutation, which was also found in another study in two siblings of Turkish origin (Enattah et al., 2008). This study also detected two mutations in an Italian patient. Recently, four other mutations were detected in patients from Japan, Spain and Turkey (Uchida et al., 2012; Sala Coromina et al., 2014; Fazeli et al., 2015).

On the protein level only the G1363S-, the Y1473X- and D1796fs-mutant were analyzed in more detail. The G1363S-mutant resulted in a misfolded protein that was blocked in the ER and was enzymatically inactive (Behrendt et al., 2009).

6 Introduction

Table 2: Reported CLD patients with mutations in the LCT gene

Ethnic Inheritance Author/year Mutation Effect Domain origin pattern

Kuokkanen Finland homozygous c.4170T > A p.Y1390X III 2006

compound Finland c.4998_5001delTGAG p.S1666KfsX58 IV heterozygous

compound Finland c.653_654delCT p.S218CfsX6 I heterozygous

compound Finland c.804G > C p.Q268H I heterozygous

compound Finland c.4087G > A p.G1363S III heterozygous

Torniainen compound Italian c.2062T > C p.S688P II 2009 heterozygous

compound Italian c.4834G > T p.E1612X IV heterozygous

compound Finland c.1692_1696delAGTGG p.V565LfsX3 II heterozygous

compound Finland c.4760G > A p.R1587H IV heterozygous

Turkish homozygous c.4087G > A p.G1363S III

Uchida compound Japanese c.4419C > G p.Y1473X IV 2012 heterozygous

compound Japanese c.5387delA p.D1796AfsX18 IV heterozygous

Coromina Spanish homozygous c.2232 2253dup22 p.L752KfsX18 II 2015

Fazeli Turkish homozygous c.3448delT p.1150PfsX19 III 2015 Introduction 7

Symptoms of lactose intolerance and secondary associated disorders

Typical symptoms are generated by the undigested and non-absorbed lactose, which is fermented by the gastrointestinal microbiota. Products of the fermentation are short fatty acid, hydrogen, carbon dioxide and methane (Matthews et al., 2005). Typical gastrointestinal symptoms of lactose intolerance are abdominal pain, cramps, borborygmi, bloating and flatulence, watery and acidic diarrhea, nausea and vomiting (Vesa et al., 2000). The pathophysiological mechanisms causing these symptoms are the production of gas and the osmotic change due to the undigested lactose in the colon. The severity of the symptoms due to lactose intolerance is dependent on whether small intestinal lactase activity is present (Swallow, 2003), the ingested lactose load, the distribution of lactose intake across the day (Lomer et al., 2008), associated food and nutrient properties (Shaukat et al., 2010), intestinal microbiota (Zhong et al., 2004) and gut motility (Wahlqvist, 2015). Furthermore prior infection, the usage of antibiotics and other gastrointestinal disorders (Zhao et al., 2010) such as irritable bowel syndrome (Yang et al., 2013) have to be taken under consideration in regard to the origin of the gastrointestinal symptoms. Due to these different factors affecting the appearance of symptoms, it might be explicable, why the association of self-reported lactose intolerance and the occurrence of symptoms after lactose ingestion is very poor (Suarez et al., 1995) even in patients with lactase deficiency (Zheng et al., 2015). One possible explanation for this lack of symptoms may be the adaptation of the colonic microbiome in lactose intolerant persons or as a result of the inheritance pattern of pathogenic mutations in CLD.

Reduced consumption of dairy products in lactose intolerant persons may lead to higher risk of secondary disorders due to the reduced intake of milk and dairies ingredients. Some studies reported that the risk of bone loss might be increased due to the restriction of dairy products, which are the major source of calcium in many individuals (Obermayer-Pietsch et al., 2004; Laaksonen et al., 2009). Calcium absorption in the intestine and the incorporation of calcium into the bones are facilitate by casein, a prominent component of the milk (Scholz-Ahrens and Schrezenmeir, 2000). Conversely, another study could not detect any evidence of a 8 Introduction

detrimental effect of lactase deficiency on adult bone mass, but they suggested changes in the activity of bacterial anaerobes in the intestine (Slemenda et al., 1991).

Lactose and milk consumption is reported to have a protective effect on the risk of developing colon or colorectal cancer (Jarvinen et al., 2001). One possible explanation for this phenomenon is that butyrate, a product of the lactose fermentation in the colon, reduces the central cell proliferation of cancer cells in culture (Jarvinen et al., 2001). Another explanation is that galactose, a product of the lactose hydrolysis in the intestine, can bind and thereby block lectins, which stimulate monolayer proliferation (Evans et al., 2002). The effect of milk and dairy products on the development of ovarian cancer has not yet been conclusively determined. While some studies support the view that high doses of lactose and dairy products lead to an increased risk of ovarian cancer (Rock, 2011; Lerchbaum et al., 2012), others do not advocate the correlation of milk consumption and ovarian cancer (Herrinton et al., 1995).

Diagnosis of lactose malabsorption and lactose intolerance

Nowadays, there are various methods available to diagnose lactose malabsorption and lactose intolerance (Misselwitz et al., 2013). Testing of lactase activity in duodenal biopsies is regarded as the reference standard (Newcomer et al., 1975). Thereby the minimal normal lactase activity in infants is defined to 11 U/g (Nichols et al., 2002). The advantage of this method is the direct testing of the enzymatic activity per se without any influencing factors, like the intestinal microbiota. Limitations of the biopsy activity measurement include the inhomogeneous expression of lactase (Maiuri et al., 1994) and the invasiveness of the procedure, which is especially problematic for infants with suspected CLD. Another possibility to test lactose malabsorption is the genetic test, which is useful for identifying the known polymorphisms that are connected to lactase non-persistence (Rasinpera et al., Introduction 9

2004). In case of CLD, the genetic test is really useful because it is most harmless for the infant who suffer from severe gastrointestinal symptoms.

Lactose maldigestion and the associated symptoms can be assessed by the lactose tolerance test (Arola, 1994) and the hydrogen-breath test (Metz et al., 1975). During the lactose tolerance test the changes of glucose levels in the blood are monitored after ingestion of lactose. The test principle is based on an increase of blood sugar after lactose challenge due to its hydrolysis in the intestine. Logically, individuals who maldigest lactose do not have an increase in their blood glucose levels. The disadvantage of this method is the fluctuations of postprandial blood sugar, which can lead to false-negative outcomes. The hydrogen breath test displays the changes in the H2-levels in the exhaled air after lactose intake. The test principle is the increase of H2-levels in respiratory air after lactose challenge due to bacterial degradation of lactose in the colon. Individuals who maldigest lactose have an increase in H2-levels of the exhaled air, while lactose tolerant persons lack this increase due to normal lactose hydrolysis. False-negative tests may occur due to the presence of hydrogen non-producing bacteria in the colon (2%-43%) (Gasbarrini et al., 2009). Both test principles, the lactose tolerance test and the hydrogen-breath test, may lead to false-negative results due to the increased rapid gastrointestinal transit triggered by the lactose intolerance.

Other methods to prove if lactose intolerance is the reason for gastrointestinal symptoms are the fecal reducing substances test, which relies on the presence of undigested lactose in the stool due to the failed hydrolysis (Caballero et al., 1983) and the fecal pH test, which measures the changes in the pH due to fermentation of lactose (Maffei et al., 1984). Individuals who maldigest lactose are identified by a colour change in the fecal reducing substances test or by a decrease in the stool pH of 6 or lower in the fecal pH test (Tomar, 2014).

10 Introduction

Treatment of lactose intolerance in infants, children and adults

The treatment strategy is based on the form of lactase deficiency, the age and the general state of health of the patient. Milk containing lactose is the major source of energy and nutrients of infants, which is the reason why lactose intolerance has such severe consequences for the patients, if it remains mis- or undiagnosed. The treatment of these patients is a lactose-free diet. Later in life, dairy products form an essential component of the human diet in many cultures. Children who are lactose intolerant should not avoid milk and dairy products, because of the recommended amount of calcium needed for normal calcium accretion and bone mineralization especially during their development (Stallings et al., 1994). In general it is recommended not to restrict milk and dairy products completely from the diet, because of their calcium and vitamin D contents. Otherwise supplementation of those components is required. Patients with self-reported lactose intolerance can digest up to 12 g lactose without any symptoms (Savaiano et al., 2006). One approach in the management of lactose intolerance is therefore the steadily increase of the lactose load in the diet, giving the colon time to adapt, which in turn may lead to a reduction in symptoms. To avoid high contents of lactose there is lactose-hydrolyzed or lactose-reduced milk available or simply milk-derived products containing less lactose, such as yoghurt. Other main pharmacological approaches are the use of lactase replacement supplements and the involvement of probiotics. Lactase obtained from Kluyveromyces lactis represents a valid therapeutic strategy (Montalto et al., 2005), while in the choice of probiotics Lactobacillus casei Shirota and Bifidobacterium breve Yakult reach the best effects (Almeida et al., 2012).

Lactase-phlorizin hydrolase (LPH)

LPH is a β-galactosidase of the brush border membrane, which comprises two main catalytic activities: the lactase activity in domain IV at position Glu1749 and the phlorizin hydrolase activity in domain III at position Glu1273 (Zecca et al., 1998). Due Introduction 11

to its lactase activity, LPH is able to cleave lactose, the main carbohydrate in mammalian milk and based on its phlorizin hydrolase activity LPH has a wide specificity of substrates like glycosyl-N-acylspingosines, phlorizin and flavonoid glycosides, which are present in many fruits and vegetables and are known for their anticarcinogenic and antiantherogenic activities (Day et al., 2000; Nemeth et al., 2003). The expression of LPH is barely detectable in the crypts, but its expression reaches its maximum between the lower and midvilli and decreases at the villus tip (Hauri et al., 1985; Rings et al., 1992). During development, the expression of LPH follows a similar pattern at the protein and mRNA levels (Fajardo et al., 1994). The gene of human LPH is located on chromosome 2, is approximately 55 kb in size and comprises 17 exons (Kruse et al., 1988; Boll et al., 1991). Furthermore, the gene contains binding sites for transcription factors such as CTF/NF-1 and AP2 (Boukamel and Freund, 1992; Troelsen et al., 1994). The regulation of lactase levels within the cell is probably due to a nuclear protein (NF-LPH1) that binds upstream from the transcription site (Troelsen et al., 1992; Troelsen et al., 1994; Troelsen et al., 1997). Another regulatory mechanism of lactase levels at the cell surface is glycosylation. LPH is highly N- and O-glycosylated, which is important for correct folding of the protein and thereby for its enzymatic activity. It is known that reduced glycosylation leads to reduced lactase activity and reduced levels of LPH at the cell surface (Naim and Lentze, 1992; Jacob et al., 2000). These co-and post-translational events are discussed in more detail in the paragraphs about biosynthesis and intracellular processing and protein modification, folding and quality control in the ER. The cDNA of LPH is built of 6274 bp and encodes a 1927 amino acid long protein (Mantei et al., 1988). LPH, as a type I membrane glycoprotein, consists of an N-terminal extracellular domain and a C-terminal cytosolic domain. LPH is composed of different protein domains and is therefore a multi-domain protein, but the role of each single domain has not been determined so far. The N-terminal domain consists of a 19 amino acid long signal sequence that is needed for the translocation of newly synthesized LPH proteins into the ER-lumen, followed by an ectodomain that consists of four homologous domains with 38% - 55% identity to each other (Mantei et al., 1988). Those four domains are highly conserved, which led to the hypothesis 12 Introduction

that LPH might have arisen from two subsequent duplications (Wacker et al., 1992). Domains I and II are described as the profragment that is cleaved off during the transport of LPH to the cell surface. The mature LPH consists only of domains III and IV, which comprise the catalytic sites of LPH. The anchoring of LPH is mediated through 19 hydrophobic amino acids, while the cytosolic domain is built of 26 amino acids, which are highly hydrophilic (Mantei et al., 1988).

Biosynthesis and intracellular processing

LPH is synthesized as a monomeric pro-LPH molecule with a molecular weight of 215 kDa in the ER (Naim et al., 1991). In this organelle, the first co- and post- translational modifications take place before LPH is further transported to the Golgi apparatus along the secretory pathway. In the ER, during its synthesis, LPH is cotranslationally modified by N-glycosylation, which leads to the formation of the mannose-rich N-glycosylated form of the protein. This modification of proteins is experimentally detectable by the usage of endo-β-N-acetylglucosaminidase H (endo H), that only cleaves mannose-rich and some hybrid N-glycans between the two N- acetylglucosamines. The N-glycosylation in the ER plays an indispensable role in the folding of LPH, which consists of 15 potential N-glycosylation sites. The correct folding of the protein is monitored by the quality control system of the ER, which is explained in more detail in the paragraph about protein modification, folding and quality control in the ER. Before LPH is further transported, another requirement, that is important for its function has to be fulfilled. This is the dimerization step of two pro- LPH molecules, which is mediated through the presence of the transmembrane domain and is dependent on a stretch of 87 amino acids in the ectodomain between position 1646 and position 1559 at the C-terminus of domain IV (Danielsen, 1990; Naim and Naim, 1996; Panzer et al., 1998). After successful exit out of the ER, LPH is transported to the Golgi apparatus, where complex N-glycosylation and O- glycosylation occur. Thereby a pro-LPH molecule with a molecular weight of 230 kDa is generated (Hauri et al., 1985; Naim et al., 1991). Complex N-glycans are Introduction 13

experimentally detectable by the usage of Peptide-N-Glycosidase F (PNGase F), which cleaves all forms of N-glycans, except the fucosylated ones. This post- translational modification is crucial for the correct folding, the transport and the enzymatic activity of LPH (Naim, 1992; Naim and Lentze, 1992; Jacob et al., 2000). The importance of O-glycosylation for its enzymatic function was shown in a previous study due to the 4-fold increased activity of the N-and O-glycosylated form compared to the N-glycosylated form of the protein (Naim and Lentze, 1992).

The intracellular processing of LPH is mediated through two proteolytic cleavage steps, which take place in the trans-Golgi network (TGN) and at the cell surface (Naim et al., 1987; Jacob et al., 1996; Wuthrich et al., 1996). The first cleavage at position Arg734/Leu735 leads to the conversion of pro-LPH to LPHβinitial by the cut-off of domain I and most of domain II that, together, form the profragment LPHα (Figure 1). After further transport of LPH to the apical membrane of the epithelial cell, the second proteolytic cleavage occur by a pancreatic trypsin at position Arg868/Ala869 leading to the mature form of LPH, called LPHβfinal. The molecular weight LPHβfinal is 160 kDa (Danielsen et al., 1984; Naim et al., 1987).

The profragment LPHα is directly involved in the folding of the protein and functions thereby as an intramolecular chaperone (Jacob et al., 2002). LPHα, despite its five potential N-glycosylation sites, is neither N- nor O-glycosylated and is directly degraded after the cleavage (Naim et al., 1994). Another intramolecular chaperone of LPH is domain III, which is important for the correct folding of LPH. Its deletion leads to a misfolded protein in the ER, which is probably degraded (Behrendt et al., 2010).

14 Introduction

Figure 1: Maturation steps of LPH in the intestinal epithelial cells. (A) The protein is synthesized as a monomeric pro-LPH molecule by translocation in the ER. LPH consists of a luminal C-terminus, a membrane anchor and an ectodomain with four highly-conserved structural and functional domains and an extracellular N-terminus. (B) Prior to its exit from the ER, pro-LPH molecules form homodimers. (C) In the Golgi apparatus, pro-LPH is cleaved in the trans-Golgi network, which leads to the removal of LPHα, leaving LPHβinitial.

(D) After proper sorting of the protein to the apical membrane, LPHβinitial is cleaved by pancreatic trypsin in the intestinal lumen to generate the mature form of the protein, called

LPHβfinal, consisting only of domains III and IV (Taken from Amiri and Diekmann et al. (Amiri et al., 2015)).

Polarized sorting

LPH has to be transported to the apical membrane of epithelial cells to fulfill its physiological functions. This sorting process is achieved by a number of sorting signals within the protein or by cellular components, which interact with those signals. One example of such a signal is the glycophosphatidylinositol (GPI) anchor, which mediates apical sorting by interacting with membrane microdomains enriched in glycospingolipids and cholesterol (Brown and Rose, 1992; Danielsen, 1995; Simons and Ikonen, 1997). LPH does not interact with these membrane microdomains (Naim, 1994; Danielsen, 1995; Jacob et al., 1999). Another common sorting signal of apical sorting is mediated through N- and O-glycans by interacting with cellular components. One example for this mechanism is SI, which requires O-glycosylation Introduction 15

for its association with membrane microdomains and thereby for correct apical sorting (Alfalah et al., 1999; Jacob et al., 2000). Previous studies have shown that N- and O-glycosylation are not required for correct sorting of LPH (Naim, 1994; Danielsen, 1995; Jacob et al., 1999) and that neither the proteolytic cleavage step is implicated into the sorting nor does the profragment contain any sorting signals (Grunberg et al., 1992; Jacob et al., 1994). One requirement for correct sorting of LPH is the presence of the transmembrane domain and it is strongly suggested that domain IV contains a sorting signal for apical sorting (Jacob et al., 1997; Panzer et al., 1998).

In general the transport of apical membrane proteins after the TGN is mediated by distinct vesicles called SI-associated vesicels and LPH-associated vesicles (Jacob and Naim, 2001; Jacob et al., 2003). In the past, research had unravelled interactions of different galectins with lipids and glycoproteins in in the secretory pathway of cells. They stabilize transport platforms for apical trafficking or sort apical glycoproteins into specific vesicle populations (Delacour et al., 2009). Galactin-3 has been identified to play an important role in this process by functioning as a sorting receptor (Delacour et al., 2006; Delacour et al., 2007; Delacour et al., 2009).

Protein modifications, folding and quality control in the ER

The biosynthesis of proteins is comprised of a complex set of cellular events that are strictly regulated to ensure the functionality of the end products. In eukaryotic cells up to 30% of all proteins are targeted to the secretory pathway (Lemus and Goder, 2014). The folding status of nascent polypeptides is indicated by multiple post- translational modifications that are added to the primary structure. Currently, more than 200 forms of post-translational modifications are known, ranging from chemical modifications such as phosphorylation or acetylation, to the addition of saccharides in case of glycosylation or the addition of complete proteins like ubiquitin in the process of ubiquitylation (Minguez et al., 2012). The biological role of glycans can be divided 16 Introduction

into two groups: I) the recognition of glycans by other molecules, which is important for cell-cell interaction, detection of microbial adhesions, agglutinins or toxins and II) the structural and modulatory properties, which are crucial for protective, stabilizing, organizational and barrier functions e.g. proteoglycans in the maintenance of tissue structure, porosity and integrity (Varki and Lowe, 2009).

The most common modification of proteins is the glycosylation (Apweiler et al., 1999). During this process certain oligosaccharides are co- or post-translationally attached to the polypeptide or later modified by trimming or adding further oligosaccharides (Varki and Lowe, 2009). These glycans can be detected by chaperones and other proteins that assist in their folding and transport to their final intra- and extracellular destinations. In the ER, glycoproteins are modified by mannose-rich N-glycosylation and later, along the secretory pathway, further complex N-glycosylation and O-glycosylation in the Golgi apparatus take place. Changes in the glycosylation state of proteins can lead to several genetic and chronic diseases, like cancer (Saldova et al., 2011; Miwa et al., 2012; Bull et al., 2013; Balmana et al., 2016), inflammation (Gornik and Lauc, 2008), Alzheimer’s disease (Schedin-Weiss et al., 2014), diabetes (Thanabalasingham et al., 2013; Zurawska- Plaksej et al., 2015) and metabolic disorders such as cystic fibrosis (Rhim et al., 2004).

Membrane glycoproteins, like LPH, or secretory glycoproteins are synthesized at the ribosomes and translocated into the ER. During the translocation, N-linked glycosylation may cotranslationally occur on the nascent protein if the tripeptide sequence Asn-X-Ser or Asn-X-Thr is present (Kornfeld and Kornfeld, 1985; Petrescu et al., 2004). The asparagine residue of this consensus sequence is rapidly modified through a pre-assembled oligosaccharide, which is built on a dolichol phosphate, a lipid anchor in the membrane of the ER. The pre-assembled oligosaccharide is composed of three glucose residues, nine mannoses and two N-acetylglucosamines (Glc3Man9GlcNAc2) ((Ferris et al., 2014), Figure 2). The oligosaccharides attached to glycoproteins seem to play an important role in the correct folding and the stability of many proteins in the ER (Helenius and Aebi, 2004). The transfer of the pre- Introduction 17

assembled oligosaccharide on the newly synthesized protein is catalyzed by an oligosaccharyltransferase, an ER-membrane bound protein complex (Dejgaard et al., 2010; Mohorko et al., 2011; Pfeffer et al., 2014). Further modifications by trimming the oligosaccharides are mediated through two glucosidases: glucosidase I, a type II membrane glycoprotein, which cleaves the terminal glucose residue and glucosidase II, a soluble heterodimeric enzyme, which removes sequentially the next two glucose residues ((Hirschberg and Snider, 1987; Shailubhai et al., 1991; Pelletier et al., 2000), Figure 2). During these modifications an important quality control of the newly synthesized protein takes place.

Figure 2: Structure of the N-linked core glycan. The triantennary tetradecaoligosaccharide is assembled on the ER membrane and is covalently linked to the Asn side chains in the context of the N-glycosylation consensus sequence of newly translocated proteins. The 14-sugar form, starting from the Asn residue, contains two N- acetylglucosamine (GlcNAc, squares), nine mannose (circles) and three glucose (triangles) residues (modified from (Ferris et al., 2014)).

After the first trimming step of glucosidase II, the Ca2+-dependent lectin chaperones calnexin (CNX) and calreticulin (CRT) recognize the maturing polypeptide by its monoglucosylated glycans (Hammond et al., 1994). Calnexin is a type I membrane protein and calreticulin is its soluble paralog that is localized in the ER-lumen. Both proteins function in conjunction with ERp57, an ER-resident oxireductase, as the major chaperone complex in the CNX/CRT cycle (Williams, 2006). The N-terminal 18 Introduction

domain of calnexin or calreticulin interacts with the monoglucosylated glycans on the nascent protein, while ERp57 builds transient mixed disulfide bonds with the polypeptide to improve its folding (Hebert and Molinari, 2007).

The second trimming step of glucosidase II releases the protein from the lectin chaperones due to their low affinity to glycans lacking the terminal glucose residue and leads to the exit of the native glycoprotein from the ER and its transit through the secretory pathway. The UDP-glucose:glycoprotein glucosyltransferase (UGGT), which can re-attach the last glucose of the N-linked glycan of improperly folded glycoproteins and allows the re-entering into the CNX/CRT cycle, plays an essential role in the quality control (Trombetta and Parodi, 2003; Hebert et al., 2005).

Besides calnexin and calreticulin, there are additional ER-resident chaperones involved in protein folding, including an immunoglobulin binding protein (BiP) and a protein disulfide isomerase (PDI) (Fink, 1999; Braakman and Hebert, 2013). BiP, a member of the Hsp70 family, consists of a C-terminal substrate-binding domain and an N-terminal nucleotide-binding domain (Munro and Pelham, 1986; Flynn et al., 1991). BiP can either increase or decrease the protein folding rate in an ATP- dependent way (Bukau et al., 2006). While BiP binds the substrate to allow accomplishment of the native confirmation, other chaperones like PDI may generate or rearrange disulfide bonds within the substrate that are properly paired (Freedman et al., 1989).

The accumulation of misfolded proteins leads to the activation of the unfolded protein response (UPR) (Zhang and Kaufman, 2006). The activation of the UPR results in reduced total protein expression, upregulated expression of ER chaperones and increased ER-associated degradation (Travers et al., 2000; Schroder, 2008). In case the homeostasis situation is not restored or if the conditions become more severe, UPR can lead to the induction of apoptosis (Oyadomari et al., 2002; Briant et al., 2015; Lobo et al., 2016). Several transmembrane proteins are involved in UPR, such as activating transcription factor 6, protein-kinase RNA-like ER kinase and inositol- requiring protein 1 (Cox et al., 1993; Harding et al., 1999; Ye et al., 2000; Ron and Walter, 2007). Unsurprisingly, many human diseases like lysosomal storage Introduction 19

diseases, myelination diseases, cystic fibrosis, systemic amyloidoses such as light chain myeloma, and neurodegenerative diseases including Alzheimer's disease have recently been linked to ER stress or to misfolding and/or misassembly of membrane proteins (Hutt et al., 2009; Ng et al., 2012). The accumulation of misfolded proteins leads to a disruption of the ER function. Therefore it is essential that those misfolded proteins are quickly and efficiently removed from the ER.

Figure 3: Quality control of newly synthesized proteins in the endoplasmic reticulum. Glycoproteins first enter the CNX/CRT cycle after removal of the two terminal glucose residues of the attached N-glycan by glucosidases I and II. The resulting monoglucosylated N-glycan binds to the ER-resident chaperones CNX and CRT, which associate with ERp57 supporting the catalysis of disulfide-bond formation. The substrate dissociates from CNX/CRT upon glucosidase II-mediated removal of the terminal glucose residue from the N- 20 Introduction

glycan. At this point, the folding status of the glycoprotein is controlled by the UGGT, which specifically binds nearly-native folding forms and reglucosylates them. Correctly folded proteins are allowed to exit the ER. Reglucosylated substrates enter again the CNX/CRT cycle. Substrates eventually exit the CNX/CRT cycle upon demannosylation of N-glycans. The mechanism for permanent removal of misfolded proteins from the cycle involves active recognition of demannosylated forms by ERAD components for proteasomal degradation (adapted by (Ellgaard and Helenius, 2003)).

The removal of misfolded proteins from the ER occurs via the ER-associated degradation (ERAD) (Olzmann et al., 2013). ERAD is initiated by the ER degradation-enhancing α-mannosidase-like protein (EDEM) that is able to recognize and modify the misfolded proteins by trimming the mannose residue of the core glycan (Ninagawa et al., 2014). Mannose removal requires several proteins, including ER-α1,2-mannosidase, EDEM 1,2,3 and Golgi-resident mannosidase I (Hosokawa et al., 2003; Hosokawa et al., 2007; Avezov et al., 2008; Aikawa et al., 2012). ERAD is a process whereby misfolded proteins are retranslocated back to the cytosol where they undergo ubiquitination and later degradation by the 26S proteasome (Vembar and Brodsky, 2008; Christianson and Ye, 2014). These steps are mediated by a variety of ER and cytoplasmic factors which are organized around the membrane- embedded E3 ubiquitin ligase complex (Ruggiano et al., 2014). It has been shown that the location of the folding defect determines the initial site of ubiquitination and thereby the specific ERAD-degradation pathway (Briant et al., 2015). Currently, three different ERAD pathways are described, depending on the ligases and the chaperone requirements that are necessary during the retranslocation and the degradation of the misfolded domain (Carvalho et al., 2006).

Correctly folded glycoproteins that pass the ER quality control system, are able to exit the ER and are further transported to the Golgi apparatus. This process is mediated by the Golgi-resident mannosidases: Golgi mannosidase I and Golgi mannosidase II demannosylate the arriving glycoproteins (Moremen, 2002). Only natively folded glycoproteins are further glycosylated and transported to their final destinations. Misfolded glycoproteins are recognized by the quality control system of Introduction 21

the Golgi apparatus and degraded through lysosomal degradation (Arvan et al., 2002).

The complex N-glycosylation in the Golgi apparatus is initiated by the demannosylation of up to 3 mannoses, followed by defined elongation and branching of the core glycan by using N-acetylglucosamine, galactose and sialic acid monomers (Stanley et al., 2009). In the Golgi apparatus, O-glycosylation may also take place. Generally, mucin and mucin-like glycoproteins are heavily O- glycosylated, but there are also several types of nonmucin O-glycans, including α- linked O-fucose, β-linked O-xylose, α-linked O-mannose, β-linked O-GlcNAc (N- acetylglucosamine), α- or β-linked O-galactose, and α- or β-linked O-glucose glycans (Brockhausen et al., 2009). LPH belongs to the class of mucin or mucin-like glycoprotein. Mucin O-glycans start with a covalently α-linked N-acetylgalactosamine residue linked to serine or threonine of the nascent protein. In contrast to the N- glycosylation, the target sites for O-glycosylation are not located in a determinate consensus sequence (Jensen et al., 2010). This reaction is catalyzed by a polypeptide-N-acetyl-galactosaminyltransferase. The N-acetylgalactosamine may be extended with sugars including galactose, N-acetylglucosamine, fucose, or sialic acid in a non-specified way and form thereby, in contrast to the N-glycosylation, a very heterogeneous population by the different branching and different sequences of the monosaccharides (Brockhausen et al., 2009). In contrast to the initial reactions of N- glycosylation, no pre-assembled core oligosaccharide is involved in the O-glycan biosynthesis, and no glucosidases appear to be involved in the processing of O- glycans within the Golgi apparatus.

22 Aim of the dissertation

Aim of the dissertation

The first aim of this dissertation is the biochemical analysis of two novel mutations in the LCT gene, which were found in a Japanese infant with suspected CLD. Both mutations, c.4419C>G (p.Y1473X) in exon 10 and c.5387delA (p.D1796fs) in exon 16, are located in domain IV of the extracellular domain of LPH. Furthermore, the determination of the influence of these pathogenic mutations concerning to the wild type is of great interest, because the parents of the Japanese infant, suffering from severe gastrointestinal symptoms, were described as symptom-free.

The second aim is to analyze the structural features of LPH in more detail, because LPH is a multi-domain protein and the specific function of each domain is not known yet. This structural analysis is also important in regard to the pathogenesis of certain mutations, which are associated with CLD. If the role of each domain regarding function and processing of LPH is understood, it would be much easier to estimate the severity of certain mutations.

The specific aims of this dissertation are the following two points:

1) Investigation of the influence of two novel mutations in the coding region of LPH found in a CLD patient on the structure, biosynthesis and function of LPH. 2) Elucidation of the structural determinants for the transport of the multi-domain membrane glycoprotein LPH in the early secretory pathway.

Publications 23

Publications

This thesis was prepared as a cumulative dissertation comprising two original articles and one review article.

Authors´contributions

1) Diekmann, L., Pfeiffer, K., and Naim, H. Y., Congenital lactose intolerance is triggered by severe mutations on both alleles of the lactase gene. BMC Gastroenterol. 2015 Mar 21;15:36. DOI: 10.1186/s12876-015-0261-y.

LD and KP performed the experiments and analyzed the data. LD drafted a first version of the manuscript. HYN designed the study, analyzed the data and wrote the final version of the manuscript. All authors read and approved the final manuscript.

2) Amiri M.†, Diekmann L.†, von Köckritz-Blickwede M. and Naim H. Y., The Diverse Forms of Lactose Intolerance and the Putative Linkage to Several Cancers. Nutrients. 2015 Aug 28;7(9):7209-30. DOI: 10.3390/nu7095332. †These authors contributed equally to this work

MA, LD and MKB drafted a first version of the manuscript. HYN wrote the final version of the manuscript. All authors read and approved the final manuscript.

3) Diekmann L.+, Behrendt M.+, Amiri M. and Naim H. Y., Structural determinants for transport of a multi-domain membrane glycoprotein in the early secretory pathway, J Biol Chem., under revision. +Authors contributed equally

24 Publications

LD and MB performed the experiments, analyzed the data and drafted a first version of the manuscript. MA designed the study, analyzed the data and contributed to drafting the manuscript. HYN designed the study, analyzed the data and wrote the final version of the manuscript. All authors read and approved the final manuscript.

Publications 25

Congenital lactose intolerance is triggered by severe mutations on both alleles of the lactase gene

Diekmann, L., Pfeiffer, K., and Naim, H. Y., Congenital lactose intolerance is triggered by severe mutations on both alleles of the lactase gene. BMC Gastroenterol. 2015 Mar 21;15:36. DOI: 10.1186/s12876-015-0261-y.

Abstract

Background: Congenital lactase deficiency (CLD) is a rare severe autosomal recessive disorder, with symptoms like watery diarrhea, meteorism and malnutrition, which start a few days after birth by the onset of nursing. The most common rationales identified for this disorder are missense mutations or premature stop codons in the coding region of the lactase-phlorizin hydrolase (LPH) gene. Recently, two heterozygous mutations, c.4419C>G (p.Y1473X) in exon 10 and c.5387delA (p.D1796fs) in exon 16, have been identified within the coding region of LPH in a Japanese infant with CLD.

Methods: Here, we investigate the influence of these mutations on the structure, biosynthesis and function of LPH. Therefore the mutant genes were transiently expressed in COS-1 cells.

Results: We show that both mutant proteins are mannose-rich glycosylated proteins that are not capable of exiting the endoplasmic reticulum. These mutant proteins are misfolded and turnover studies show that they are ultimately degraded. The enzymatic activities of these mutant forms are not detectable, despite the presence of lactase and phlorizin active sites in the polypeptide backbone of LPH-D1796fs and LPH-Y1473X respectively. Interestingly, wild type LPH retains its complete enzymatic activity and intracellular transport competence in the presence of the pathogenic mutants suggesting that heterozygote carriers presumably do not show symptoms related to CLD. 26 Publications

Conclusions: Our study strongly suggests that the onset of severe forms of CLD is elicited by mutations in the LPH gene that occur in either a compound heterozygous or homozygous pattern of inheritance.

Publications 27

The Diverse Forms of Lactose Intolerance and the Putative Linkage to Several Cancers

Amiri M.†, Diekmann L.†, von Köckritz-Blickwede M. and Naim H. Y., The Diverse Forms of Lactose Intolerance and the Putative Linkage to Several Cancers. Nutrients. 2015 Aug 28;7(9):7209-30. DOI: 10.3390/nu7095332. †These authors contributed equally to this

Abstract

Lactase-phlorizin hydrolase (LPH) is a membrane glycoprotein and the only β- galactosidase of the brush border membrane of the intestinal epithelium. Besides active transcription, expression of the active LPH requires different maturation steps of the pro-peptide through the secretory pathway, including N- and O-glycosylation, dimerization and proteolytic cleavage steps. The inability to digest lactose due to insufficient lactase activity results in gastrointestinal symptoms known as lactose intolerance. In this review, we will concentrate on the structural and functional features of LPH protein and summarize the cellular and molecular mechanism required for its maturation and trafficking. Then, different types of lactose intolerance are discussed, and the molecular aspects of lactase persistence/non-persistence phenotypes are investigated. Finally, we will review the literature focusing on the lactase persistence/non-persistence populations as a comparative model in order to determine the protective or adverse effects of milk and dairy foods on the incidence of colorectal, ovarian and prostate cancers.

28 Publications

Structural Determinants for transport of a multi-domain membrane glycoprotein in the early secretory pathway

Lena Diekmann+, Marc Behrendt+, Mahdi Amiri and Hassan Y. Naim*

Department of Physiological Chemistry, University of Veterinary Medicine Hannover,

Hannover, Germany.

+Authors contributed equally.

*To whom correspondence should be addressed: Department of Physiological Chemistry, University of Veterinary Medicine Hannover, Bünteweg 17, D-30559 Hannover, Germany,

Tel.: 49 511 9538780, Fax: 49 511 9538585, E-mail: Hassan.Naim@tiho- hannover.de

Abstract

LPH is a membrane anchored type I glycoprotein of the intestinal epithelium that is composed of four homologous structural domains. The role of each distinct domain in the intramolecular organization and function of LPH is not completely understood. Here, we analyzed the early events of LPH biosynthesis and trafficking by directed restructuring of the domain compositions. Removal of domain I (LPH∆1) results in a malfolded ER-localized protein. By contrast, LPH without domain II (LPH∆2) is normally transported along the secretory pathway, but does not dimerize nor is enzymatically active. Interestingly a polypeptide stretch in domain II between L735- R868 exerts an intriguing role in modulating the trafficking behavior of LPH and its biological function. In fact, association of this stretch with transport-competent LPH chimeras results in their ER-arrest or aberrant trafficking. This stretch harbors a unique N-glycosylation site that is responsible for LPH retention in the ER via association with calnexin and facilitates proper folding of domains I and III before ER Publications 29

exit of LPH. Notably, a similar N-glycosylation site is also found in domain IV with comparable effects on the trafficking of LPH-derived molecules. Our study provides novel insights into the intramolecular interactions and the sequence of events involved in the folding, dimerization and transport of LPH. Furthermore, these findings can explain the phenotypic diversity of clinical symptoms in congenital lactase deficiency, particularly in the heterozygote cases where heterodimerization can influence the trafficking and function of LPH.

Introduction

Many secreted and membrane proteins are synthesized with prodomains that appear as clearly outlined regions with distinct boundaries (1,2). Prodomains can be compact globule modules or linking domains (3) and are proteolytically cleaved along the secretory pathway, oftentimes in the Golgi apparatus (1). The removal of the prodomains can be implicated in the functional activation, intracellular trafficking and sorting of the final mature protein product (2). In addition, it has been postulated that they can also act as intramolecular chaperones (4), which support or regulate the folding process of other domains (5,6). Prodomains with assigned intramolecular chaperone function can be part of the mature protein (7) or can be cleaved from the maturing protein to yield the final functionally active form of the protein (4) The immature form of human small intestinal lactase-phlorizin hydrolase (LPH), an essential brush border enzyme, comprises an N-terminal cleavable signal peptide, four homologous domains, a transmembrane domain and a cytoplasmic domain ((8) and Fig. 1A). The pro-peptide Ser20-Arg734 (LPHα) comprising the entire homologous domain I and more than two thirds of domain II is proteolytically removed in the trans-Golgi network (TGN) by a trypsin-like protease (9) LPHα is subsequently degraded (6) and the remaining protein, indicated LPHβinitial, is targeted to the apical surface of intestinal epithelial cells. In the intestinal lumen pancreatic trypsin generates the mature form of the polypeptide (LPHβfinal) via removal of the polypeptide stretch Leu735-Arg868 (indicated LPHstretch) (10). 30 Publications

LPHα is devoid of sorting signals and catalytic activity (11,12) as well as detectable complex N- or O-glycans (6); however it is rich in cysteine and hydrophobic amino acid residues suggesting a rapid folding to a compact globular domain that is stabilized by disulfide bonds (13) and facilitates the formation of a correctly folded

LPHβinitial domain. The chaperone function of LPHα is a particular event in the folding events of LPH that cannot be compensated by ER-molecular chaperones such as calnexin or BiP (13). Together with LPHα it can be postulated that the LPHstretch (Leu735-Arg868) exerts an important role in the correct folding of the pro-LPH.

Recently, we analyzed the roles of homologous domains comprised by mature

LPHβfinal (domains III and IV) (14). Surprisingly, domain III per se revealed transport- and sorting-competence without the need for the remaining domains. By contrast, homologous domain IV is neither properly transported nor enzymatically active per se. Nevertheless, open questions remain to be answered concerning the role of the synthesized part of nascent LPH, its profragment, in the context of topological organization, folding cooperativity, and function of the whole protein (15). Moreover, the fact that the theoretical boundary between homologous domains I and II revealed by intramolecular sequence alignment and in silico analysis does not correspond to the cleavage site between LPHα and LPHβinitial (Arg734/Leu735) (8) suggests that the folding of the LPH profragment is not a simple linear process. Therefore, we set forth to decipher the impact of homologous domains I and II on the generation of a transport-competent and enzymatically active configuration of LPH as well as to study the contribution of each domain to the folding process.

Experimental procedures

Materials and Reagents – DEAE-dextran, pepstatin, leupeptin, antipain, aprotinin, trypsin inhibitor, phenylmethanesulfonyl fluoride, trypsin, Triton X-100, sodium dodecyl sulfate (SDS), molecular weight standards for SDS-PAGE, Dulbecco’s modified Eagle’s medium (DMEM), minimum essential medium (MEM), streptomycin, penicillin, glutamine, fetal calf serum (FCS), and trypsin-EDTA were acquired from Publications 31

Sigma-Aldrich (Munich, Germany). Isis DNA polymerase was purchased from Qbiogene (Heidelberg, Germany). Tissue culture dishes were obtained from Sarstedt (Nümbrecht, Germany). L-[35S] methionine (>1000 Ci/mmol) and protein A- Sepharose were obtained from Amersham Biosciences Inc. (Freiburg, Germany). Acrylamide, N,N’-methylenebisacrylamide, TEMED, ammonium persulfate, and dithiothreitol were purchased from Carl Roth GmbH (Karlsruhe, Germany). Restriction enzymes, secondary horseradish peroxidase-conjugated anti-mouse antibody/Streptavidin were purchased from Thermo Fisher Scientific (Bonn, Germany). The secondary antibodies coupled to Alexa Fluor® dyes were obtained from Invitrogen (Karlsruhe, Germany).

Construction of cDNA clones – pΔ1, pΔ2, pLPHβinitial, pLPHβfinal, pDomain-3stretch, pLPH-N821Q, pLPH-N1340Q and pLPH-N1814Q were generated by loop- out/mutagenesis PCR using pSG5-LPH and pcDNA3-LPH (14) plasmids as the template. LPH domains were dissected as described previously (14). The applied oligonucleotides were obtained from Sigma-Aldrich and are listed in Table 1.

Transient Transfection of COS-1 Cells, Metabolic Labeling, Immunoprecipitation and SDS-PAGE – COS-1 cells were cultured and transfected using DEAE-dextran as described previously (14). When indicated the cells were biosynthetically labeled with [35S] methionine as described previously (14). Immunoprecipitation and Western Blotting of LPH or the deletion variants from detergent extracts of the cells was performed according to Naim et al. (16). Co- immunoprecipitation of LPH with calnexin was performed as reported previously (17). A panel of monoclonal antibodies (mAbs) against human intestinal LPH (HBB 1/909 (18) and mLac1, mLac2, mLac4, mLac6 and mLac10 (19) was used to detect different conformations of LPH (6). Where indicated treatment with endoglycosydase H (endo H) or Peptide -N-Glycosidase F (PNGase F) (both from Roche Diagnostics, Mannheim, Germany) was performed according to Naim et al. (16), and followed by 32 Publications

SDS-PAGE analysis. The protein bands were visualized using BioRad Molecular Imager® FX facility. Tryptic protein structure analysis was performed as described previously (20).

Cell Lysate Fractionation on Sucrose Density Gradients – In order to investigate the quaternary structure of wild type and variants LPH, fractionation of cell lysates on sucrose gradients was performed as described previously (14). Transiently transfected COS-1 cells expressing wild type LPH or chimeric variants were labeled with [35S] methionine for 6 h, solubilized in 50 mM Tris-HCl buffer pH 7.5 containing 6 mM n-Dodecyl β-D-maltoside, 150 mM NaCl, and protease inhibitors. After pre- centrifugation, the supernatant was loaded on a 10-30% (w/v) continuous sucrose gradient and subjected to ultracentrifugation at 100000 x g for 18 h at 4°C. Afterwards 18 fractions were collected, LPH was immunoprecipitated and analyzed by SDS-PAGE.

Immunofluorescence and Confocal Fluorescence Microscopy – Subcellular localization of LPH in transiently transfected COS-1 cells was determined using indirect immunofluorescence as described previously (21). The primary antibody was HBB 1/909 for LPH. Detection of the cell surface localized LPH was achieved by treatment of the live cells with the primary antibody on 4°C, followed by extensive wash, fixation and exposure to the Alexa Fluor® -coupled secondary antibody. Confocal laser microscopy was performed with the Leica TCS SP5 microscope using the 63x oil planachromat lens (Leica Microsystems, Germany).

Biotin assay – Transiently transfected COS-1 cells were treated with Sulfo-NHS-LC- Biotin (1.5 mg/ ml) for 30 min at 4°C and quenched two times with 0.1% BSA for 10 min at 4°C. The cells were then solubilized with 1% Triton X-100 and LPH was immunoprecipitated. Each immunoprecipitate was equally splitted into two parts, one Publications 33

for immunoblotting against total LPH and the other for immunoblotting in non- reducing conditions followed by detection of the biotin-labeled LPH by the horseradish peroxidase-conjugated streptavidin. The amount of quantified biotinylated LPH was related to the amount of total LPH on the corresponding blot.

In silico analysis, quantifications and statistical analysis – Homology-based multiple sequence alignment of the primary structure of LPH domain was performed with PRALINE (22). The quantification of the protein bands was performed by Quantity One® software (BioRad, Munich, Germany). Statistical significance was determined according to student’s t-test, paired, one-directional with * p ≤ 0.05, ** p ≤ 0.01 and *** p ≤ 0,001. Error bars are represented as SEM.

Results

The presence of homologous domain I is crucial for the attainment of transport competence - To investigate the role of LPH pro-fragment on its folding and transport events we aimed to construct a deletion variant by removing this part from the wild-type LPH (Fig. 1). To achieve this purpose, an in silico analysis was conducted to determine the potential domain boundaries as basis for site-directed loop-out PCR. cDNA constructs, each lacking the coding region of one homologous domain (LPHΔ1 and LPHΔ2), were generated (Fig. 2A) and expressed in COS-1 cells. The contribution of each of the two homologous domains was then deciphered by comparing the outcome of their deletion on the structure, enzymatic function and trafficking of the truncated protein forms (Fig. 2). The trafficking competence of the variants from ER to Golgi was assessed by the acquisition insensitivity towards endo H. As shown in Fig. 2B, LPHΔ2 acquired endo H-resistance indicating that this deletion variant is properly transported from ER to the Golgi apparatus with a processing rate comparable to the wild type. Likewise the turnover rates of both LPH forms were similar as demonstrated in pulse-chase experiments up to 42h (Fig. 2C). By contrast, truncation of the homologous domain I (LPHΔ1) elicited substantial 34 Publications

effects on the trafficking kinetics and behavior of the variant, which persisted as an endo H-sensitive ER arrested and transport-incompetent form (Fig. 2B-2C). To substantiate the biochemical data we addressed the cellular localization of the LPH variants by indirect immunofluorescence under permeabilized and non-permeabilized conditions. Fluorescence images obtained by confocal microscopy shown in Fig. 3A demonstrate an exclusive intracellular localization of LPHΔ1, while LPHΔ2 was detected intracellularly as well as at the cell surface. We further compared the level of cell surface expression of the deletion variants versus that of the wild type protein by cell surface biotinylation of COS-1 cells expressing these proteins. Western blotting revealed that LPHΔ2 was found at almost similar expression levels at the cell surface as its wild type counterpart, while LPH∆1 was not detected at the cell surface (Fig. 3B). Collectively, these data indicate that the presence of the homologous domain I is essential for the trafficking of LPH, since its deletion resulted in a transport-incompetent ER-arrested immature protein. On the other hand, domain II is neither rate-limiting along the early secretory pathway nor decisive in the maturation of LPH in the Golgi apparatus.

Altered quaternary structure and folding of LPHΔ1 and LPHΔ2 relative to wild type LPH - We have previously shown that homodimerization of LPH takes place before LPH exits the ER and matures in the Golgi apparatus (20). Given that the trafficking and maturation of the truncated form LPHΔ2 are essentially similar to those of wild type LPH (vide supra), we asked whether LPHΔ2 acquires a quaternary structure similar to the wild type. For this purpose, cell lysates from transiently expressing COS-1 cells were subjected to sucrose density gradient followed by immunoprecipitation and SDS-PAGE analysis and the band intensities were quantified. As shown in Fig. 4A the mannose-rich form of LPHΔ2 was detected predominantly as a monomeric form which apparently does not require dimerization prior to ER egress, where the majority of the complex glycosylated molecules were mainly found in the denser gradient fractions. The control wild type LPH displayed two major peaks revealing the mannose-rich form in both of them, while the complex Publications 35

glycosylated protein was found mainly in the peak that corresponds to the denser fractions of the gradient. This is in accordance with previous data (20,23). LPHΔ1, which persists as a mannose-rich glycoprotein in the ER, was found to be exclusively detected in the lighter fractions of the gradient consistent with its retention in the ER as a monomeric protein.

Assessment of the folding and functional structure of the deletion variants were compared to the wild type protein using tryptic structural analysis and measurement of the enzymatic activities. In tryptic analysis properly folded wild type LPH presents normally two cleavage sites for trypsin at R734/L735 and R868/A869 positions (Fig. 1) which are subjected to sequential cleavage events during LPH maturation and cell surface expression. (12,24). As shown in Fig. 4B the digestion profile of LPHΔ2 with trypsin differed from that of the wild type during the early digestion time points. Here, a smear of bands appeared that gradually converted to a predominant double band. Given that both exposed trypsin-cleavage sites in the wild type LPH are located within the homologous domain II and are thus eliminated in LPHΔ2 (compare Fig. 2A) we conclude that the new trypsin cleavage sites presented in LPHΔ2 are concomitant with an altered folding pattern than the wild type LPH. Persistence of a trypsin-resistant domain in both wild type and LPHΔ2 may indicate presence of an autonomously folded region in both forms, fitting the most to the properties of the domain III of LPH (14). LPHΔ1, by contrast to wild type LPH and LPHΔ2, was completely degraded by trypsin already after 1 min of treatment reflecting exposure of multiple trypsin cleavage sites and causal altered folding in comparison to wild type LPH and LPHΔ2 (Fig. 4B).

We further determined the enzymatic activities of the immunoprecipitated variants towards lactose and phlorizin in comparison to the wild type activities. The lactase activity was not detectable in LPHΔ1 and LPHΔ2. Phlorizin hydrolase activity was only detectable in LPHΔ2, albeit at substantially reduced levels of 4.3% (Fig. S1, supplementary data). Since both catalytic sites are present in LPHΔ1 and LPHΔ2, absence of the enzyme activities in line with the tryptic structural analyses indicate 36 Publications

altered folding of these two isoforms in such a way that affects the functional domains.

Influence of LPHstretch on the transport competence of LPHβ and domain III - The transport-competence of LPHΔ2 clearly indicates that domain II of pro-LPH is not an essential component in the context of trafficking and efficient maturation of LPH. However, the persistence of LPHΔ2 as a monomeric protein in its mannose-rich and mature glycoforms, proposes a role for domain II in the dimerization event of LPH. Of particular interest is a small domain that is composed of 134 amino acids, later referred to as stretch that corresponds to the difference between LPHβinitial and

LPHβfinal and spans residues L735 to R868. The first of these two forms, LPHβinitial, is generated from pro-LPH by proteolytic cleavage in the Golgi apparatus after its complete maturation. The second form, LPHβfinal, is cleaved from LPHβinitial by trypsin at the apical surface and represents the enzymatic active form of LPH that is implicated in its digestive function. The role and the requirement for the 134 residues stretch in the trafficking and function of LPH has not been resolved yet. We compared the biosynthesis and processing of LPHβinitial, with LPHβfinal (Fig. 5A). As shown in Fig. 5B, LPHβfinal acquires endo H-resistant complex glycosylated form in a similar way compared to its wild type counterpart indicating that it is trafficked at nearly the same rate. However, LPHβinitial appears exclusively as a mannose-rich protein (see also (13)). Immunofluorescence labeling revealed exclusive localization of LPHβinitial in the ER and cell surface biotinylation confirmed that LPHβinitial is not expressed the cell surface (Fig. 6A, 6B). LPHβfinal on the other hand was additionally localized in the Golgi apparatus and at the cell surface (Fig. 6A, 6B), yet to a lesser extent as compared to pro-LPH. Interestingly, the cell surface form of LPHβfinal had a higher molecular weight than expected and even higher than the wild type (Fig. 6B). The dimerization of pro-LPH has been shown to precede its exit from the ER (20). We therefore investigated the potential dimerization of these LPH variants as a potential mechanism responsible for their different trafficking behavior. Fig. 7 demonstrates that the mannose-rich forms of both LPHβinitial and LPHβfinal were Publications 37

predominantly retained in gradient fractions that peaked in fractions 9. Besides the peak of the band intensities for the dimeric LPH at fraction 12 (Fig. 4A), identification of another peak for mature LPH at fraction 14 suggests presence of LPHβfinal in oligomeric form at the cell surface (Fig. 6B). Overall, the results demonstrate that both forms do not dimerize in the ER excluding therefore dimerization as a prerequisite for ER exit of LPH. Given that the sequence difference between the two LPH forms is limited to the L735-R868 stretch we assumed that this stretch contains signals that retain LPHβinitial in the ER. To address this possibility we fused the stretch to the transport-competent and autonomously folded core domain of LPH (LPH-D3) (14) and examined the trafficking and functional properties of this chimera (LPH-

D3stretch)(Fig. 8A). As demonstrated in Fig. 8B the presence of the LPHstretch in LPH-

D3stretch resulted in a substantial reduction in the trafficking and maturation behavior of this chimera. In fact, only a small proportion of a mature endo H-resistant LPH-

D3stretch was secreted into the cell culture medium.

The trafficking competence of LPH forms lacking domain II, such as LPH∆2, LPHβfinal and LPH-D3 supports the view that this domain contains proteinaceous signals that lead to the retention of LPH or its trafficking delay when made accessible. On the other hand, wild type LPH and LPH∆4 (14) contain domain II and yet both of them are transport-competent. We assumed therefore that domain I and domain II could form pseudodimers within the LPH molecule that mask potential retention signals in domain II enabling thus LPH to exit the ER. This can explain why those LPH forms or chimeras that contain domains I and II (wild type LPH, LPH∆3, LPH∆4 (14) or those that are devoid of domain II (LPH∆2, LPHβfinal) are trafficking-competent. However, the transport-competence of LPHβfinal is slightly reduced compared to the wild type, despite the absence of domain II. It is likely that domain IV itself is rate-limiting in the trafficking of this chimera, given that domain III per se is transport-competent and its deletion elicits transport block of LPH (14). Moreover, deletion of domain IV generates a protein that is more rapidly trafficked from the ER (14). Previous studies have shown that deletion of the membrane domain while keeping the entire homologous domains results in a transport-incompetent LPH (20). 38 Publications

Influence of LPHstretch on the interaction of different LPH variants with the ER- localized chaperone calnexin - The observed ER retention led us to explore the potential retention signal within the stretch of LPH and its counterpart in domain IV. In silico analysis and sequence alignments predicted a unique and highly potent N- glycosylation site at Asn821 of domain II and Asn1814 of domain IV that is present in a conserved region between these two domains (Fig. 9A). Based on the homological sequence alignment, the equivalent position in domain III is Asp1338. N-glycosylation at these sites can potentially trigger association of ER chaperone calnexin with domains II and IV, providing a specific checkpoint for the quality control of the LPH folding state before leaving the ER. To assess this hypothesis, LPH in wild type or chimeric forms was immunoprecipitated from transiently transfected COS-1 cell lysate and the ratio of co-immunoprecipitated calnexin in each sample was determined by Western blot analysis. As shown in Fig. 9B, LPHβinitial that lacks domain I and a major part of domain II except the stretch region associates with calnexin to a comparable extent as the wild type LPH. On the other hand, the absence of the stretch region in LPH∆2 and LPHβfinal results in a clear reduction in the association with calnexin in these variants supporting the notion that at least one calnexin binding site does exist within this stretch region. Altogether, the association with calnexin reveals an immediate reverse correlation with the maturation rate of the LPH-derived molecules, so that less transport-competent LPH forms associate more avidly with calnexin (Fig. 9B). A similar experiment was performed using LPH-N821Q and LPH-N1814Q variants which lack the hypothesized N-glycosylation site in the domains II and IV respectively as well as LPH-N1340Q in which the closest potential N-glycosylation site to Asp1338 is removed. The results clearly indicate that both mutants, LPH-N821Q and LPH-N1814Q, interact to a lesser extent with calnexin compared to the wild type, but yet are blocked in the ER likely due to misfolding (Fig. 9C). The mutation N1340Q in domain III results in a similar interaction of LPH with calnexin compared to the wild type, indicating that this position is not implicated in the interaction of LPH with calnexin (Fig. 9C).

These findings establish a hierarchical trafficking pattern between wild type LPH and several non-trafficked chimeras. Thus, wild type LPH, LPH∆2, and LPH-D3 are Publications 39

transport-competent proteins in contrast to LPH∆1 and LPHβinitial, while only a small proportion of LPH-D3stretch is transported and secreted into the external medium. Together with the data on the association of wild type LPH wild type and the various LPH chimeras with calnexin, we can conclude that exposure or masking of certain N- glycosylation sites within the LPH act as a quality control measure and can regulate further trafficking. In the partially folded wild type LPH these glycosylation sites in domains II and IV are accessible for association with calnexin in order to ensure proper folding of the entire protein. In the correctly folded protein these sites are possibly masked by the neighboring domain.

Discussion

Folding of multi-domain proteins is achieved by synchronized interactions established among different structural domains with each other and with the molecular chaperones in order to obtain the native functional conformation (14). The capability of actual advanced methods including ultrafast NMR (25) for studying the structure and dynamics of nascent proteins is restricted to small soluble proteins and cannot be applied to multi-domain gross proteins. Therefore, other approaches are needed to elucidate early events in the biosynthesis of more complex proteins.

With its unique β-galactosidase function, LPH has an indispensable role in the maintenance of the normal intestinal function. This protein is a multi-domain membrane anchored glycoprotein for which functional expression at the intestinal lumen requires proper post-translational modifications, including N- and O- glycosylation, dimerization and proteolytic cleavage, a complex intramolecular organization and a targeted apical sorting. Intracellular maturation of LPH illustrates a high order of domain-domain interactions. Firstly, two domains (LPHα and domain III) act as intramolecular chaperones for the folding of the entire protein (13,14). Secondly, the membrane anchor, the cytoplasmic domain and a stretch in domain IV contribute to attainment of a transport-competent enzyme by contributing to the dimer formation in the ER (19,20). And thirdly, despite a very high homology to the 40 Publications

functional domains, LPHα consisting of domain I and a major part of domain II has no enzymatic activity, is cleaved off and ultimately is degraded in the Golgi apparatus.

With the lack of three dimensional structural analysis of LPH we generated a library of LPH-derived proteins with the ultimate goal of elucidating the domains interaction and identification of key elements in the overall LPH structure. A central piece of knowledge that came out of these studies is that domain II contains potential retention signals that prevent LPH from exiting the ER until it has acquired its proper folding. This notion is supported by the observations that fusion of domain II or the

LPHstretch to any transport-competent LPH domain renders the generated chimeras either transport-incompetent (e.g. LPHβinitial) or reduces substantially their trafficking efficiency (LPH-D3stretch). Along supportive lines is that elimination of domain II from LPH (LPHΔ2) has no marked effects on the transport of this LPH form out of the ER. A similar retention mechanism is also detectable for domain IV, so that the single expressed fully transport competent domain III has a substantially higher trafficking rate in comparison to the domain III-domain IV chimera. When expressed collaterally, domain I has the capability to suppress potential retention signals in domain II. The presence of domain I is sufficient to restore trafficking of chimeras that contained domain II and are arrested in the ER. Domain I is a part of the intramolecular chaperone LPHα and its deletion in LPHΔ1 results in a malfolded protein that has lost its enzymatic activity and is not transported out of the ER. A scenario of the trafficking of pro-LPH proposes that (a) the correct folding of homologous domain I is an early and crucial step for the attainment of the profragment chaperone function and (b) homodimerization, the late ER event, is a crucial step in acquisition of the functional capacity of LPH. Interestingly, LPHΔ2 is trafficked with almost similar efficiency to the cell surface as wild type pro-LPH, but without acquisition of a dimeric form in the ER clearly indicating that this event in contrast to pro-LPH is not required for ER-exit. Furthermore, it proposes that domain II, perhaps in association with domain I, contributes to the dimeric formation, otherwise LPHΔ2 would also form dimers as pro-LPH. Indeed none of the transport-competent deletion variants or chimeras acquires a dimeric structure. However, neither one of these monomeric and Publications 41

transport-competent LPH forms are enzymatically-active. In light of all these findings a new role of dimerization in the function and life cycle of LPH can be proposed.

The view that dimerization is a necessary and sufficient condition for pro-LPH to exit the ER (20,26) is absolutely valid when the membrane anchoring domain, domain I, domain II and domain IV are present to establish the dimerization event (14,20). In fact, deletion of domain II or IV leads to an increased trafficking rate of the LPH chimera without dimerization in the ER. Higher order multimeric forms can be detected for the mature LPH (14). It is obvious therefore that these forms which all are correctly trafficked and folded require all three domains for dimerization. Despite the strong structural homologies and the anticipated autonomous nature of each of the domains, their interaction creates a trafficking behavior of the various chimeras that can be accommodated within a hierarchical concept. Our results suggest that Asn821 in domain II and Asn1814 in domain IV are potential interaction sites of LPH with the ER chaperone calnexin. These interactions promote folding of the partially folded pro-LPH molecule on the expense of a longer processing and residence time in the ER. We propose a model in which the folding and assembly of pro-LPH occurs through two similar phases implicating domains I and II on one hand and III and IV on the other (Fig. 10). Along this, domains II and IV through their potential retention signals retain pro-LPH until domains I and III have properly folded and are thereafter capable of interacting simultaneously with domains II and IV. Domains II and IV, now in their proper conformation facilitate together with the membrane anchoring domain the dimerization of pro-LPH.

Elucidation of the structural-functional relevance of the domains in pro-LPH is crucial in unravelling and understanding the molecular basis of carbohydrate malabsorption disorders that are associated with lactase deficiency or lactase malfunction. Nevertheless, the concept that emerges from these studies is that the unique structural arrangement of the homologous domains in pro-LPH may be immediately associated with the pathogenesis of congenital lactase deficiency. The requirements for the formation of homodimerization of LPH wild type molecules in the ER are important to further investigate the possibility of heterodimer formation in a 42 Publications

heterozygote inheritance trait. Thus, the elucidation of the early events in the biosynthesis of nascent LPH is not only of crucial relevance to intestinal cell physiology, but it also provides an example on how the interaction of homologous and autonomous domains affects the functional and trafficking properties of multi- domain membrane-anchored proteins.

Acknowledgments

The authors thank Dr. Hans-Peter Hauri, formerly University of Basel, Switzerland, Dr. Erwin Sterchi, formerly University of Bern, Switzerland, and Dr. Dallas Swallow, University College London, UK, for generous gifts of monoclonal anti-LPH antibodies. This work has been supported by SFB 621 (HYN).

Conflict of interest

The authors confirm that they have no conflict of interest.

Author contribution

Publications 43

References

1. Reines, A., Bernier, L. P., McAdam, R., Belkaid, W., Shan, W., Koch, A. W., Seguela, P., Colman, D. R., and Dhaunchak, A. S. (2012) N-cadherin prodomain processing regulates synaptogenesis. J Neurosci 32, 6323-6334

2. Ozawa, M., and Kemler, R. (1990) Correct proteolytic cleavage is required for the cell adhesive function of uvomorulin. J Cell Biol 111, 1645-1650

3. Brunger, A. T. (2001) Structure of proteins involved in synaptic vesicle fusion in neurons. Annu Rev Biophys Biomol Struct 30, 157-171

4. Inouye, M. (1991) Intramolecular chaperone: the role of the pro-peptide in protein folding. Enzyme 45, 314-321

5. Oberholzer, T., Mantei, N., and Semenza, G. (1993) The pro sequence of lactase-phlorizin hydrolase is required for the enzyme to reach the plasma membrane. An intramolecular chaperone? FEBS Lett 333, 127-131

6. Naim, H. Y., Jacob, R., Naim, H., Sambrook, J. F., and Gething, M. J. (1994) The pro region of human intestinal lactase-phlorizin hydrolase. J Biol Chem 269, 26933-26943

7. Jacob, R., Purschel, B., and Naim, H. Y. (2002) Sucrase is an intramolecular chaperone located at the C-terminal end of the sucrase-isomaltase enzyme complex. J Biol Chem 277, 32141-32148

8. Mantei, N., Villa, M., Enzler, T., Wacker, H., Boll, W., James, P., Hunziker, W., and Semenza, G. (1988) Complete primary structure of human and rabbit lactase-phlorizin hydrolase: implications for biosynthesis, membrane anchoring and evolution of the enzyme. Embo J 7, 2705-2713

9. Naim, H. Y. (1992) Processing of human pro-lactase-phlorizin hydrolase at reduced temperatures: cleavage is preceded by complex glycosylation. Biochem J 285 ( Pt 1), 13-16 44 Publications

10. Jacob, R., Radebach, I., Wuthrich, M., Grunberg, J., Sterchi, E. E., and Naim, H. Y. (1996) Maturation of human intestinal lactase-phlorizin hydrolase: generation of the brush border form of the enzyme involves at least two proteolytic cleavage steps. Eur J Biochem 236, 789-795

11. Jacob, R., Brewer, C., Fransen, J. A., and Naim, H. Y. (1994) Transport, function, and sorting of lactase-phlorizin hydrolase in Madin-Darby canine kidney cells. J Biol Chem 269, 2712-2721

12. Grunberg, J., Luginbuhl, U., and Sterchi, E. E. (1992) Proteolytic processing of human intestinal lactase-phlorizin hydrolase precursor is not a prerequisite for correct sorting in Madin Darby canine kidney (MDCK) cells. FEBS Lett 314, 224-228

13. Jacob, R., Peters, K., and Naim, H. Y. (2002) The prosequence of human lactase-phlorizin hydrolase modulates the folding of the mature enzyme. J Biol Chem 277, 8217-8225

14. Behrendt, M., Polaina, J., and Naim, H. Y. (2010) Structural hierarchy of regulatory elements in the folding and transport of an intestinal multidomain protein. J Biol Chem 285, 4143-4152

15. Wu, L., Li, W. F., Liu, F., Zhang, J., Wang, J., and Wang, W. (2009) Understanding protein folding cooperativity based on topological consideration. J Chem Phys 131, 065105

16. Naim, H. Y., Sterchi, E.E., Lentze, M.J. (1987) Biosynthesis and maturation of lactase-phlorizin hydrolase in the human small intestinal epithelial cells. Biochemical Journal 241, 427-434

17. Amiri, M., and Naim, H. Y. (2014) Long term differential consequences of miglustat therapy on intestinal disaccharidases. J. Inherit. Metab. Dis. 37, 929- 937 Publications 45

18. Ouwendijk, J., Peters, W. J., van de Vorstenbosch, R. A., Ginsel, L. A., Naim, H. Y., and Fransen, J. A. (1998) Routing and processing of lactase-phlorizin hydrolase in transfected Caco-2 cells. J Biol Chem 273, 6650-6655

19. Panzer, P., Preuss, U., Joberty, G., and Naim, H. Y. (1998) Protein domains implicated in intracellular transport and sorting of lactase-phlorizin hydrolase. J Biol Chem 273, 13861-13869

20. Naim, H. Y., and Naim, H. (1996) Dimerization of lactase-phlorizin hydrolase occurs in the endoplasmic reticulum, involves the putative membrane spanning domain and is required for an efficient transport of the enzyme to the cell surface. Eur J Cell Biol 70, 198-208

21. Behrendt, M., Keiser, M., Hoch, M., and Naim, H. Y. (2009) Impaired trafficking and subcellular localization of a mutant lactase associated with congenital lactase deficiency. Gastroenterology 136, 2295-2303

22. Simossis, V. A., and Heringa, J. (2005) PRALINE: a multiple sequence alignment toolbox that integrates homology-extended and secondary structure information. Nucleic Acids Res 33, W289-294

23. Jacob, R., Weiner, J. R., Stadge, S., and Naim, H. Y. (2000) Additional N- glycosylation and its impact on the folding of intestinal lactase-phlorizin hydrolase. J Biol Chem 275, 10630-10637

24. Jacob, R., Bulleid, N. J., and Naim, H. Y. (1995) Folding of human intestinal lactase-phlorizin hydrolase. J Biol Chem 270, 18678-18684

25. Hsu, S. T., Fucini, P., Cabrita, L. D., Launay, H., Dobson, C. M., and Christodoulou, J. (2007) Structure and dynamics of a ribosome-bound nascent chain by NMR spectroscopy. Proc Natl Acad Sci U S A 104, 16516-16521

26. Danielsen, E. M. (1990) Biosynthesis of intestinal microvillar proteins. Dimerization of aminopeptidase N and lactase-phlorizin hydrolase. Biochemistry 29, 305-308 46 Publications

Footnotes

This work was funded by the German Research Foundation (DFG) (SFB 621 to HYN).

Abbreviations: PNGase F, Peptide -N-Glycosidase F; endo H, endoglycosidase H; ER, endoplasmic reticulum; LPH, lactase-phlorizin hydrolase (all forms); LPHh, mannose-rich precursor; LPHc, complex glycosylated precursor; TGN, trans-Golgi network

Figure legends

Fig. 1: Schematic presentation of wild type and LPH deletion variants. A) Main features of intestinal LPH structure. pro-LPH consists of a cleavable signal sequence (SS; Met1-Gly19) and an extracellular region comprising homologous domains I–IV (Ser20-Thr1882). The initial cleavage step takes place between Arg734 and Leu735 generating LPHβinitial; removal of the polypeptide stretch Leu735/Arg868 occurs by luminal trypsin creating LPHβfinal. Cleavage sites are indicated by asterisks; location of the phlorizin hydrolase (E1273) and lactase (E1749) activities, respectively, are indicated by triangles. MA refers to the membrane anchor and Cyt refers to the cytoplasmic tail.

Fig. 2: Glycosylation pattern and trafficking of LPH wild type and domain deletion variants in COS-1 cells. A) Schematic representation of the domain deletion variants generated by loop-out mutagenesis. B) Transiently transfected COS-1 cells were biosynthetically labeled for 6 h, LPH was immunoprecipitated and treated with/without endo H. Quantification of four independent experiments is Publications 47

presented. C) Turnover of LPH variants determined by biosynthetic labelling of transiently expressing COS-1 cells for 2 h (pulse) followed by chase time points as indicated periods (in hours) with cold methionine.

Fig. 3: Subcellular distribution and cell surface localization of LPH wild type and domain deletion variants in COS-1 cells. A) Indirect immunofluorescence for transiently transfected COS-1 cells with permeabilization for intracellular staining or without permeabilization for extracellular staining. B) COS-1 cells transiently expressing LPH were treated with biotin, lysed and immunoprecipitated. Immunoprecipitates were divided into two equal aliquots and used for LPH or Streptavidin blotting.

Fig. 4: Structural features of LPH deletion variants in COS-1 cells. A) For assessment of the quaternary structure of LPH, transiently transfected COS-1 cells were biosynthetically labeled for 6 h and solubilized by n-Dodecyl β-D-maltoside. Cell lysates were fractionated on a sucrose density gradient, immunoprecipitated and analyzed by SDS-PAGE. For quantification the intensities of all bands of one gradient were set as 100% and each band is diagrammed as a percentage value compared to the total protein amount. B) Trypsin sensitivity assay of wild type and LPH variants from transiently transfected COS-1 cells after biosynthetic labelling and immunoprecipitation. 100 BAEE units of trypsin were used for different time points.

Fig.5: Glycosylation pattern, structural features and subcellular distribution of

LPH wild type, LPHβinitial and LPHβfinal in COS-1 cells. A) Schematic presentation of the LPHβfinal and LPHβinitial generated by loop-out mutagenesis. B) Transiently transfected COS-1 cells were biosynthetically labeled for 6 h, immunoprecipitated and resolved on SDS-PAGE. Intensities of mannose-rich and complex N- and O- glycosylated forms are calculated from three independent experiments. C) Turnover 48 Publications

of LPH variants determined by biosynthetic labelling of transiently expressing COS-1 cells for 2 h (pulse) followed by chase time points (in hours) as indicated with cold methionine.

Fig. 6: Subcellular distribution and cell surface localization of LPHβinitial and

LPHβfinal in COS-1 cells. A) Indirect immunofluorescence for transiently transfected COS-1 cells with permeabilization for intracellular staining or without permeabilization for extracellular staining. B) COS-1 cells transiently expressing LPH were treated with biotin, lysed and immunoprecipitated. Immunoprecipitates were divided into two equal aliquots and used for LPH or Streptavidin blotting.

Fig. 7: Structural features of LPHβinitial and LPHβfinal in COS-1 cells. For assessment of the quaternary structure of LPH, transiently transfected COS-1 cells were biosynthetically labeled for 6 h and solubilized by n-Dodecyl β-D-maltoside. Cell lysates were fractionated on a sucrose density gradient, immunoprecipitated and analyzed by SDS-PAGE. For quantification, intensities of all bands of one gradient were set as 100% and each band is diagrammed as a percentage value compared to the total protein amount.

Fig. 8: Expression of LPH-D3 and LPH-D3stretch in COS-1 cells. A) Schematic representation of the LPH-D3 and LPH-D3stretch constructs. B) COS-1 cells were biosynthetically labeled for 6 h, proteins were immunoprecipitated from cell lysates and - where indicated - from cell culture media, treated with endo H or PNGase F, or not treated and analyzed by SDS-PAGE.

Fig. 9: Comparison of a potential calnexin binding motif within different domains of LPH. A) Homology-extended multiple sequence alignment of domains II, Publications 49

III and IV of LPH. The arrow shows the position of Asn821 in domain II and Asn1814 in domain IV of LPH. Asn1340 in domain III is indicated by an asterisk. B) To determine the ratio of calnexin association with different LPH variants, COS-1 cells transiently expressing LPH-WT, LPH∆2, LPHβinitial and LPHβfinal were lysed, LPH was immunoprecipitated and subjected to anti-LPH and anti-Calnexin immunoblotting. The ratio of calnexin association with each variant was rated by the amount of co- immunoprecipitated calnexin versus the mannose-rich glycosylated ER form of LPH. Quantification is presented from three independent experiments. C) Calnexin associated with LPH-N821Q, LPH-N1340Q and LPH-N1814Q was similarly detected. As a control untransfected COS-1 cells were used. The ratio of calnexin association with each mutant was rated by the amount of co-immunoprecipitated calnexin versus the mannose-rich glycosylated ER form of LPH. Quantification is presented from four independent experiments.

Fig. 10: Proposed model for the folding events of nascent LPH. In the ER, partially folded LPH is interacting with calnexin/calreticulin chaperone system at domains II and IV. This interaction promotes functional folding of the whole protein which can then be arranged in a dimeric conformation mediated by regions in cytoplasmic and transmembrane sections as well as domains II and IV. The dimeric structure will then leave the ER to the Golgi apparatus.

50 Publications

Tables

Table I. A list of the wild type and variant constructs used in this study

Protein Plasmid for Oligonucleotides 5’-3’ biochemical/

confocal analysis

LPH-WT pcDNA3-LPH - (Behrendt et al., 2010)

LPHΔ1 pΔ1 ctaagtttttcatgctgggggttcctgcaggatactttccctg*

LPHΔ2 pΔ2 gtccagggcggaaagggatgccttctaccacgggacgtttcgg*

LPHβfinal pJB20-LPHβfinal - (Jacob et al., 2002)

LPHβinitial pLPHβinitial gctaagtttttcatgctgggggtcactgttgcagtttgtatccctgg*

LPH-D3 pD3 (Behrendt et - al., 2010)

LPH- pDomain-3stretch gctaagtttttcatgctgggggtcactgttgcagtttgtatccctgg*

D3stretch

LPH-D123 pDomain-123 gccactggccagggaggatgagtgagaattctttctgtacggacggtttcctg*

LPH-D1234 pDomain-1234 ggcaccacagaagcacagacatgaattcgctttgtacgttctcttttctc*

LPH-D23 pDomain-23 gccactggccagggaggatgagtgagaattctttctgtacggacggtttcctg*

*Forward mutagenesis primer. The reverse primer is the complementary sequence of the forward primer.

Publications 51

Figures

Figure 1

Figure 2A

Figure 2B

52 Publications

100

60 complex 40 mannose-rich

20 relative relative protein amount%

0 LPH-WT LPH∆1 LPH∆2

Figure 2C

Publications 53

Figure 3A

Figure 3B

54 Publications

Figure 4A

Publications 55

LPH-WT

15 mannose-rich 10 complex-glycosylated

5 percentage percentage % 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 fractions

LPH∆1 30

25 20 15 mannose-rich 10

percentage percentage % 5 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 fractions

LPH∆2 30

25 20 mannose-rich 15 10 complex glycosylated

percentage percentage % 5 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 fractions

56 Publications

Figure 4B

Publications 57

Figure 5A

Figure 5B

58 Publications

100

60 complex 40 mannose-rich

20 relative relative protein amount%

0 LPH-WT LPHβinital LPHβfinal

Figure 5C

Publications 59

Figure 6A

Figure 6B

60 Publications

Figure 7A

LPHβinitial 25 20 15 mannose-rich 10

percentage percentage % 5 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 fractions

LPHβfinal

10 mannose-rich complex glycosylated

5 percentage percentage % 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 fractions

Publications 61

Figure 8A

Figure 8B

62 Publications

Figure 9A

Figure 9B

Publications 63

Figure 9C

64 Publications

Publications 65

Figure 10

66 Discussion

Discussion

Difficulties in the diagnosis and possible molecular causes of the low lactase activity in CLD patients

Congenital lactase deficiency is an autosomal recessive inherited disease of infants. The patients suffer from severe gastrointestinal symptoms, due to the lack of lactase activity (0-10 U/g) shortly after breast-feeding or the introduction of lactose-containing formulas (Holzel, 1968; Savilahti et al., 1983). Un- or misdiagnosis of CLD is life- threatening, because the osmotic diarrhea leads to dehydration, acidosis and weight loss after a few weeks of life. However, duodenal biopsies could show that the histological characteristics such as microvilli morphology and the activities of the other disaccharidases, SI and MGAM, are totally normal (Savilahti et al., 1983). After correctly diagnosis, infants get a lactose-free diet and the children are able to follow their normal developmental processes (Launiala et al., 1966; Savilahti et al., 1983). One possible disease that might be associated with CLD is nephrocalcinosis, which is characterized by elevated calcium concentrations in the blood and low excretion with urine (Saarela et al., 1995; Fazeli et al., 2015). After the correction of dehydration and beginning of lactose-free diet it takes months until the problems fully disappear.

The diagnosis of CLD is difficult, because the gastrointestinal symptoms in infants can have other causes. Different bacterial infections of the gastrointestinal tract can cause similar symptoms or the infection with rotavirus or adenovirus. Such gastrointestinal symptoms can also be caused by cow’s milk protein allergy or by congenital diarrheal disorders.

There are several congenital diarrheal disorders that manifest in the first few weeks of life with chronic diarrhea after ingestion. The etiology of these disorders is diverse including dysregulation of the intestinal immune response, defects in the enteroendocrine cells or in the predominant intestinal epithelial cells, the enterocytes (Canani et al., 2015). Examples for the last type are the microvillus inclusion disease, Discussion 67

congenital tufting enteropathy, familial hemophagocytic lymphohistiocytosis type 5 and trichohepatoenteric syndrome (Muller et al., 2008; Sivagnanam et al., 2008; zur Stadt et al., 2009; Hartley et al., 2010; Fabre et al., 2012; Wiegerinck et al., 2014). Those congenital diarrheal disorders are caused by autosomal recessive mutations in genes of the brush-border enzymes, like LPH or SI in case of CLD/CSID (Ritz et al., 2003; Kuokkanen et al., 2006) or in genes of transporter proteins, like SLGT1 that encodes the Na+/glucose cotransporter, which is responsible for the uptake of the monosaccharides glucose and galactose (Martin et al., 1996). Other mutations causing congenital diarrhea lead to defects in the intracellular protein or lipid transport, the lipid metabolism and intestinal barrier function (Overeem et al., 2016).

The identification of these mutations, which are all autosomal recessive inherited, is important for genetic counseling and prenatal diagnosis for heterozygote carriers. Most of the diseases causing congenital diarrhea are diagnosed by an intestinal biopsy to determine the histological characteristics and the enzymatic activities of the brush border membrane disaccharidases. Such a surgery is an invasive event for an infant, who suffers from severe gastrointestinal symptoms. Therefore the identification of genetic defects by sequencing assays is a better and faster differential diagnostic tool, because the result of the genetic test describes the basic defect and excludes secondary effects. This test should be used generously in suspected cases by gastroenterologists, neonatologists and pediatricians. Basic research is needed to identify further mutations which are associated with the development of congenital diarrheal disorders.

The origin of CLD is most likely in Finland, because until now 7 out of the 13 known mutations causing CLD were detected in Finnish patients (Kuokkanen et al., 2006; Torniainen et al., 2009) and Finland has the highest incidence of CLD with 1:60000 (Peltonen et al., 1999; Norio, 2003; Norio, 2003). In the last few years also cases of CLD have been reported somewhere else in the world (Uchida et al., 2012; Sala Coromina et al., 2014; Fazeli et al., 2015), indicating that CLD is not only a Finnish disease, despite it is one of the rare monogenic disorders, which are enriched in the Finnish population (Peltonen et al., 1999). Besides CLD, there is another lactase 68 Discussion

deficiency, called adult-type of hypolactasia (ATH), which is also a recessively inherited disorder and is related to DNA variants affecting the LCT gene. The molecular mechanisms are very different. CLD is caused by mutations in the LCT gene, which lead to low activity. One possible explanation for the low or absent lactase activity is the effect of the mutation on the protein itself by e.g. resulting in misfolded protein that is ultimately degraded. Another explanation is the nonsense- mediated mRNA decay (NMD), a surveillance pathway leading to degradation of mRNA, induced by premature termination codons, to eliminate the production of harmful truncated proteins (Maquat, 2005). Previous studies could show that the NMD modulates human disease phenotypes (Baserga and Benz, 1988; Frischmeyer and Dietz, 1999; Inoue et al., 2004; Gorbenko del Blanco et al., 2012). In contrast the molecular mechanism of ATH phenotype is caused by nucleotide variants representing distal enhancer polymorphisms, which down-regulate developmentally the transcript levels of the LCT gene. One known polymorphism leading to the developmental down-regulation of lactase levels is C/T−13910 (Enattah et al., 2002;

Rasinpera et al., 2005). The C−13910 allele typically accounts for 8% of expressed LCT mRNA (Kuokkanen et al., 2003). Interestingly, one study could show in a duodenal biopsy from a patient, who was heterozygous for the CLD nonsense mutation

Y1390X and also heterozygous for the ATH SNP C−13910, that both alleles had the same levels of LCT transcripts (Kuokkanen et al., 2003), confirming the idea that mRNA, induced by premature termination codons, leads to NMD. This discovery facilitates a direct genetic test as the best diagnosis of suspected CLD patients. Previously the diagnosis based on the symptoms and low lactase activity in enzyme assays from duodenal biopsies.

Identification and molecular analysis of two novel mutations of the LCT gene causing CLD

The two novel mutations in the LCT gene c.4419C>G (p.Y1473X) in exon 10 transmitted from the mother and c.5387delA (p.D1796fs) in exon 16 transmitted from Discussion 69

the father were found in a Japanese female infant. Both mutations are located in domain IV of the extracellular domain of LPH and result in a truncation of domain IV and complete elimination of the transmembrane domain and the cytosolic tail. The girl suffered from severe watery diarrhea from the age of two days on breast feeding and lactose containing cow´s milk formula and lost 13% of her birth weight during two days. After the implementation of a lactose-free diet, the diarrhea stopped and her overall condition improved remarkably. At the age of 4 month a lactose challenge test was performed. The blood glucose level showed no increase during 120 min, indicating that the suspected CLD could be confirmed (Uchida et al., 2012).

The biochemical analysis of the two mutations in the LCT gene discovered two mutated proteins, which are blocked in the ER. Determination of the type of N- glycosylation indicated that both mutants are mannose-rich N-glycosylated and exclusively endo H-sensitive. The cellular localization was confirmed by immunofluorescent analysis. Both mutants are predominantly localized in the ER as assessed by the ER net-like structures. Further, it could be proven that the mutated proteins are enzymatically inactive, despite of the presence of the lactase activity site in the mutant LPH-D1796fs and both are degraded in the ER, probably due to the ERAD pathway. These results support the view that the lack of lactase activity in CLD patients is due to the effect of the mutation of the protein itself and disagree with the opinion that NMD is responsible for the absent lactase activity. Previous studies suggested that the mutation Finmajor (Y1390X) induces NMD and lead thereby to a decrease of ~90% of the transcript levels of LCT (Kuokkanen et al., 2006). It is known that intron-less cDNA normally used in in vitro systems is insensitive to NMD (Gorbenko del Blanco et al., 2012), therefore biopsy samples from patients would be needed to clarify the role of NMD in the pathogenesis of CLD. Recently, one study could prove NMD as a mechanism for protein C deficiency caused by two nonsense mutations (Luan et al., 2015). Surprisingly, they used recombinant plasmids expressing the cDNA of the mutant or wild type protein in a transient transfection system. The increased mRNA levels of the mutants after treatment with UPF1 siRNA, 70 Discussion

which should inhibit NMD, lead to the conclusion that NMD is involved in this process. These results disagree with previous findings that intron-less cDNA normally used in in vitro systems is insensitive to NMD (Gorbenko del Blanco et al., 2012). The biochemical results of the two mutants LPH-Y1473X and LPH-D1796fs show that the transcriptional products are detectable by immunoprecipitation. Fluctuations might be possible due to the different binding affinities of the proteins to the monoclonal antibodies or the utilized transient transfection method. The pulse chase experiment clearly indicates that the mutants are ultimately degraded in the ER mostly within the first 4 h of chase, while the wild type is still detectable after 12 h of chase. The intensity of the fluorescent signal 48 h post transfection confirm that the mutant proteins have similar protein levels within the cell compared to the wild type. To definitely prove the hypothesis that the protein levels of the mutants and the wild type are comparable, it would need the generation of stable cell lines to avoid the overexpression system in COS-1 cells. One possible experiment to clarify if degradation takes place via the ERAD pathway would be the usage of a proteasomal inhibitor.

The results of the biochemical analysis of the two mutants are similar to a previous study, which analyzed the mutation G1363S that was found in two cases of CLD with Finnish and Turkish origin (Kuokkanen et al., 2006; Torniainen et al., 2009). This mutation results also in an ER-blocked and mannose-rich N-glycosylated protein, which has no detectable lactase activity (Behrendt et al., 2009). The LPH-G1363S mutant is a temperature-sensitive protein, which exits the ER to the Golgi apparatus by lowering the temperature to 20°C (Behrendt et al., 2009). This effect could be detected in several protein folding diseases that are caused by mutations in the respective proteins (Cheng et al., 1990; Propsting et al., 2003). The mutants LPH- Y1473X and LPH-D1796fs are also blocked in the ER by 20°C, which usually leads to a accumulation of the proteins in the Golgi apparatus (Mottet et al., 1986). Interestingly, the protein amounts of the mutated proteins are detectable after 18 h of Discussion 71

chase. This result can be a result of improved folding of the mutants in the ER via chaperones or due to a reduced degradation ratio at lower temperatures.

In general, it is strikingly that 9 out of 13 known mutations in the LCT gene causing CLD are either frameshift- or nonsense-mutations, which introduce a premature truncation of the protein (Table 2). Taken together with the results of the biochemical analysis of the mutation Y1390X, it can be hypothesized that premature truncation of LPH leads to a mannose-rich N-glycosylated protein that is enzymatically inactive. A previous study could define the presence of the transmembrane domain as a crucial criterion for the maturation of LPH. While the construct containing the transmembrane domain was normally glycosylated and transported along the secretory pathway, its anchorless counterpart was blocked in the ER as a monomeric mannose-rich N-glycosylated protein (Panzer et al., 1998). Not only mutations in the lactase gene lead to gastrointestinal disorders by disrupting the normal trafficking and function of an enzyme of the brush border membrane. CLD belongs to the congenital diarrheal disorders, a group of enteropathies with a typical onset early in life and with similar gastrointestinal symptoms, often caused by autosomal recessive mutations. Besides the brush border membrane enzymes, transporter proteins, proteins which are important for protein or lipid transport, lipid metabolism or intestinal barrier function can be affected (Overeem et al., 2016). Among the brush border membrane enzymes, sucrase-isomaltase (SI) and maltase-glucoamylase (MGAM) are well-characterized proteins that are associated to congenital sucrase- isomaltase deficiency and congenital maltase-glucoamylase deficiency, respectively (Terrin et al., 2012). Pathogenic mutations causing CSID have been analyzed in more detail and one of the identified phenotypes, phenotype 1, also lead to a retention of SI in the ER (Naim et al., 2012). These results are in line with the biochemical results for the mutants LPH-Y1473X and LPH-D1796fs.

The final experimental setup for the complete biochemical analysis was the investigation of the potential effects of the pathogenic mutants LPH-Y1473X and LPH-D1796fs on the function of the wild type LPH in a heterozygote background, 72 Discussion

mimicking the situation in the parents of the compound heterozygous CLD patient. The above mentioned study only obtained a monomeric mannose-rich N- glycosylated protein in case of anchorless expressed protein (Panzer et al., 1998). The question is whether the fulfillment of minimal folding requirements, such as correct folding of the domains, which are important for dimerization, is sufficient for the formation of heterodimers. The dimerization step of LPH takes place in the ER and it is known that the presence of the transmembrane domain and the stretch region of 87 amino acids in the ectodomain between position 1646 and position 1559 in domain IV are required for the formation of homodimers (Danielsen, 1990; Naim and Naim, 1996; Panzer et al., 1998). The mutant LPH-Y1473X does not contain any of these criteria, but the mutant LPH-D1786fs includes the stretch region in domain IV. The results of the co-immunoprecipitation experiments offered that neither the mutant LPH-Y1473X nor the mutant LPH-D1796fs interact with the wild type in a co- transfection setup. The enzymatic activity of the wild type does not differ in the single or the co-transfected samples indicating that no interaction has taken place and that the wild type retains unaffected also in the presence of the pathogenic mutants. These data support the hypothesis that dimerization only happens if both criteria are fulfilled or at least that those criteria play an important role in the process of heterodimerization. To further prove if heterodimerization per se is possible, the mutant form should contain the transmembrane domain and the stretch region in domain IV. Adequate candidates for this experiment would be e.g. the LPH-G1363S, LPH-R1587H or LPH-Q268H mutant. Figure 4 summaries the knowledge about heterodimerization of LPH wild type and a mutant form. The criteria for homodimerization (Figure 4A) will be taken under closer consideration in the next paragraph of the discussion.

Discussion 73

Figure 4: Potential requirements for heterodimerization of LPH wild type with a pathogenic mutant. A) LPH normally forms homodimers in the ER before the further transport along the secretory pathway to the Golgi apparatus. Mutant forms of LPH (orange circles), which are anchorless due to the missing transmembrane domain and with B) the lacking or C) consisting the stretch region in domain IV (light blue balk). Possible heterodimers of the wild type LPH (blue circles) and mutated forms of LPH build of the full length pro-LPH D) only missing the stretch region in domain IV or E) consisting both the transmembrane region and the stretch region in domain IV.

The potential heterodimerization could lead to protein complexes with altered functional or trafficking characteristics of either one of them and could thereby explain the wide range of normal enzymatic activity levels. Previous studies have shown that the maximum levels of enzymatic activities of the disaccharidases in the intestine are often two-fold higher than the minimal recognized normal levels (Alfalah et al., 2009; Naim et al., 2012). A recent study identified an intermediate physiological phenotype of lactose intolerance caused by nucleotide variants influencing the transcript levels of the LCT gene, which may explain the range of normal lactase activity (Dzialanski et al., 2015). This intermediate physiological phenotype is caused by the heterozygous state CT−13910, while the homozygotes either lead to lactose intolerance in case of CC−13910 or to lactose tolerance in case of 74 Discussion

TT−13910 (Dzialanski et al., 2015) Those heterodimeric interactions have been described already for many proteins, such as connexin, G-protein-coupled receptors or GABA receptors (Doms et al., 1987; Jordan and Devi, 1999; Maza et al., 2003). In case LPH would exclusively forms homodimers in the presence of other pathogenic mutations, which fulfill the known requirements for dimerization, this could be one possible explanation why heterozygous carriers of one mutation underlying CLD are symptom-free and show normal lactase activity levels. Another possible theory why heterozygous carriers of certain diseases are symptom-free is a translation-coupled mechanism (NMD) that eliminates mRNA containing premature termination codons and thus limiting the synthesis of abnormal proteins (Palacios, 2013). NMD accounts for genotypic/phenotypic differences and has a protective function, which sometimes benefits for heterozygous carriers. Recently, a group could show that the phenotypic variability in heterozygous carriers of mutations causing growth hormone insensitivity syndrome (GHIS) is moderated by NMD (Gorbenko del Blanco et al., 2012).

Characterization and implication of the subdomains of LPH, a multi-domain protein, on its function and folding

Proteins have to fulfill a wide spectrum of functions, ranging from binding molecules (from simple ions to large molecules like fats, sugars, nucleic acids and other proteins) to catalyzing an extraordinary range of chemical reactions, providing structural rigidity to the cell, controlling flow of material through membranes, regulating the concentrations of metabolites, acting as sensors and switches, causing motion and controlling gene function (Lodish H, 2000). The three-dimensional structures of proteins have been identified to play a crucial role for these functions and their precise control. The spatial organization is a key player in the understanding of protein structure and functioning.

Proteins are constructed from only 20 different amino acids, which form single, unbranched polypeptide chains. Their unique spatial confirmation arises from Discussion 75

noncovalent interactions between regions in the linear amino acid sequence. Only correctly folded proteins are able to fulfill their physiological functions. Besides the class of cell signaling and ligand binding, proteins may act as structural elements or enzymes by catalyzing chemical reactions.

In general, the International Union of Biochemistry and Molecular Biology (IUBMB) has developed a nomenclature for enzymes, containing oxireductases (EC 1), transferases (EC 2), hydrolases (EC 3), lysases (EC 4), isomerases (EC 5) and ligases (EC 6). One class of hydrolases, the glycoside hydrolases (GHs, EC 3.2.1) are a widespread group of enzymes that hydrolase glycosidic linkages between two or more carbohydrates. LPH is grouped with other β-galactosidases in a few families of GHs, which are responsible for the hydrolysis of terminal non-reducing β-D- galactose residues in β-D-galactosides (Henrissat and Davies, 2000). Human lactase-phlorizin hydrolase belongs to the protein family GH 1. While most members of the GH 1 family consist of only a single domain, LPH is synthesized in the ER as a multi-domain pro-LPH (Naim et al., 1991). While the three-dimensional structure for many members of the GH 1 family is identified, the one for LPH is still undiscovered. The first three-dimensional structure solved for the GH 1 family is those of a cyanogenic β-glucosidase from the white clover (Trifolium repens), a single-domain protein (Barrett et al., 1995). The actual advanced method using NMR spectroscopy for determining membrane protein structures, has the limitation that only small soluble proteins can be analysed (Hong, 2006). For large multi-domain membrane proteins electron crystallography represents the best approach to understand membrane protein structures in the context of a lipid bilayer (Ubarretxena-Belandia and Stokes, 2010). Another approach for extraction and purification of functional protein is the X-ray crystallization, which was used to solve the first crystal structures of mammalian proteins e.g. the rabbit Ca2+-ATPase SERCA1a (Jidenko et al., 2005) and the rat voltage-dependent potassium ion channel Kv1.2 (Long et al., 2005). Nevertheless, all these methods cannot display the structural changes during the biosynthesis of the protein and therefore it is important to use other approaches as well. 76 Discussion

During its transport along the secretory pathway, LPH is post-translationally modified by N- and O-glycosylation, it dimerizes in the ER, is proteolytically cleaved in the Golgi apparatus and at the apical membrane (Naim and Lentze, 1992; Jacob et al., 1996; Wuthrich et al., 1996). The mature LPH consists only of domain III and domain IV of the extracellular domain, which comprise the phlorizin hydrolase activity and the lactase activity, respectively (Zecca et al., 1998). Domains I and II are defined as the profragment LPHα, which acts as an intramolecular chaperone for the rest of the protein (Jacob et al., 2002). Domain III also fulfills an intramolecular chaperone function (Behrendt et al., 2010).

Previous studies could give first insights into the intramolecular organization of LPH. The membrane anchor and the 87 amino acid long sequence in domain IV are crucial for the attainment of a transport-competent homodimer in the ER (Naim and Naim, 1996; Panzer et al., 1998). Further studies identified the function of each domain of the extracellular domain by utilizing deletion mutants of each domain. The deletion of domain IV, which contains the lactase activity site, leads to the formation of a transport-competent, correctly folded protein, which fails to dimerize in the ER and reveals slightly reduced phlorizin hydrolase activity. In contrast, the deletion of domain III, which harbors the phlorizin hydrolase activity site, results in a mannose- rich N-glycosylated misfolded monomeric protein with absent lactase activity. Interestingly, the same study disclosed that domain III alone expressed is transport- competent per se, despite it neither dimerizes nor acquires complete phlorizin hydrolase activity (Behrendt et al., 2010), indicating that dimerization is not, as previously described (Naim and Naim, 1996), essential for transport competence and acquisition of enzymatic activity. These data revealed an intramolecular chaperone function of domain III besides the profragment LPHα (Naim et al., 1994). LPHα, consisting of domain I and part of domain II, is proteolytically cleaved off during the first cleavage step in the Golgi apparatus before LPH is further transported to the apical membrane where it is finally cleaved to the mature form (Wuthrich et al., 1996). These cleavage steps are not essential for the acquisition of an enzymatically active molecule, because expressed pro-LPH in COS-1 cells does not undergo Discussion 77

intramolecular proteolytic cleavage, but is enzymatic as active as the isolated LPH from the brush border membrane (Naim et al., 1991).

The role of each domain of the profragment LPHα on the function of LPH was determined by utilizing again deletion mutants. Deletion of domain II leads to a transport-competent protein, which fails to dimerize in the ER and its enzymatic activities are substantially reduced. On the other hand, the deletion of domain I results in a mannose-rich N-glycosylated misfolded monomeric molecule, which is enzymatically inactive (Behrendt, 2010). These results underline the hypothesis that LPH might have arisen from two subsequent duplications (Wacker et al., 1992), because the function of domain I is similar to that of domain III by acting as an intramolecular chaperone and their deletion lead to a malfolded protein, which is blocked in the ER and degraded. Comparably, domain II and domain IV are not essential for the acquisition of transport competence or the correct folding of LPH, but influencing partially the dimerization step in the ER.

A previous study could detect an 87 amino acid long sequence in domain IV to be essential for the dimerization step in the ER in addition to the presence of the transmembrane domain (Naim and Naim, 1996; Panzer et al., 1998). Interestingly, domain II also contains a stretch region of 134 amino acids in its C-terminal region, which distinguishes LPHβinitial from LPHβfinal. The intramolecular role of these stretches is conflictive. The presence of the stretch in domain IV leads to transport competence and dimerization of LPH in the ER (Panzer et al., 1998), while the stretch in domain II leads to a retention of the protein in the ER as a monomer even if it is linked to the autonomous domain III (Behrendt et al., 2010). The data presented here assign that the presence of the stretch in domain II, either in LPH∆1 or in

LPHβinitial, results in a failure of the protein to dimerize in the ER, while its deletion in

LPHβfinal leads to the formation of oligomeric structures, which are probably build later along the secretory pathway in the Golgi apparatus. The formation of higher oligomeric structures like tetramers is confirmed by a cell surface biotinylation experiment, which shows a band for LPHβfinal with a definitely higher molecular weight compared to the wild type. One possible explanation of the ER retention of 78 Discussion

LPHβinitial is the misfolding of the protein due to the missing domain I. Domain I is normally responsible for the correct folding of the protein and especially of domain II, because LPHβfinal is transport competent without domain I and domain II.

Closer sequence analysis of this stretch region offered a unique N-glycosylation site at position Asn821, which could be responsible for the retention of LPH in the ER by interacting with an ER-resident chaperone. Notably, a similar N-glycosylation site was also found in domain IV at position Asn1814. The ER-resident chaperone BiP has been identified to interact with LPH and thereby to improve the folding of LPH (Jacob et al., 1995). To prove if the different LPH variants also interact with calnexin, a co- immunoprecipitation experiment was performed, because the mono-glycosylated N- glycans at the above mentioned N-glycosylation sites may serve as sites for the association with calnexin. Interestingly, the constructs containing the stretch region in domain II, like LPH wild type or LPHβinitial, show increased association with calnexin compared to those constructs lacking the stretch like LPH∆2 or LPHβfinal. The fact that both, LPH wild type or LPHβinitial, interact more intensive with the ER chaperone, but LPH wild type is completely transport-competent, while LPHβinitial is mannose-rich N-glycosylated and degraded in the ER. These results confirm the hypothesis that domain I is required for the folding of domain II and due to its absence in LPHβinitial the protein is misfolded and thereby degraded during the ERAD pathway. Possibly, the wild type is able to mask this interaction site with calnexin by its correct folding and the formation of homodimers, while LPHβinitial remains as a monomer. The distinct role of individual N-linked glycans in CNX/CRT binding and in co- and post- translational folding was also established in a previous study using influenza virus hemagglutinin as a model protein (Hebert et al., 1997).

Conclusion 79

Conclusion

To sum up: I) Domain I and domain III of the extracellular domain of LPH act as intramolecular chaperones, while domain II and domain IV are not essential for the transport competence. II) LPH interacts with calnexin due to its possible N- glycosylation sites in domain II and domain IV. III) The transmembrane domain, domain II and the stretch region in domain IV are essential for the homodimerization of LPH in the ER (Naim and Naim, 1996; Panzer et al., 1998). IV) The homodimerization of LPH in the ER is required for the acquisition of enzymatic lactase activity (Naim and Naim, 1996), but not for the attainment of transport competence.

All of these structural requirements, which need to be fulfilled to obtain a transport- competent and functional protein, are important in regard to the complete understanding of the development of severe pathogenic mutations in the gene of LPH causing CLD. The best experimental setup would be either protein crystallization or the use of 3D protein structure prediction tools to unravel the spatial confirmation of LPH to determine the influence of specific mutations. The results from this dissertation give insights into the function of each single domain and the situation in heterozygote carriers. The first part of this dissertation analyzed two pathogenic mutants in the coding region of LPH causing CLD. Both are located in domain IV of the extracellular domain of LPH, resulting in a premature truncation of LPH. Those anchorless mutants do not interact with the wild type and thereby leading to the formation of full functional wild type homodimers in a co-transfection setup. The presence of the transmembrane domain seems to be one requirement for the formation of heterodimers. The presence of the stretch in domain IV, which is necessary for homodimerization, has to be taken under closer consideration for the formation of heterodimers. The second part of this dissertation detected the stretch region in domain II of the extracellular domain of LPH as an important structural element and showed that LPH interacts due to possible N-glycosylation site in this stretch region with calnexin.

80 References

References

Aikawa J., Matsuo I.,Ito Y. (2012). "In vitro mannose trimming property of human ER alpha-1,2 mannosidase I." Glycoconj J 29(1): 35-45.

Alfalah M., Jacob R., Preuss U., Zimmer K.P., Naim H.,Naim H.Y. (1999). "O-linked glycans mediate apical sorting of human intestinal sucrase-isomaltase through association with lipid rafts." Curr Biol 9(11): 593-6.

Alfalah M., Keiser M., Leeb T., Zimmer K.P.,Naim H.Y. (2009). "Compound heterozygous mutations affect protein folding and function in patients with congenital sucrase-isomaltase deficiency." Gastroenterology 136(3): 883-92.

Almeida C.C., Lorena S.L., Pavan C.R., Akasaka H.M.,Mesquita M.A. (2012). "Beneficial effects of long-term consumption of a probiotic combination of Lactobacillus casei Shirota and Bifidobacterium breve Yakult may persist after suspension of therapy in lactose-intolerant patients." Nutr Clin Pract 27(2): 247-51.

Amiri M., Diekmann L., von Kockritz-Blickwede M.,Naim H.Y. (2015). "The Diverse Forms of Lactose Intolerance and the Putative Linkage to Several Cancers." Nutrients 7(9): 7209-30.

Antonowicz I.,Lebenthal E. (1977). "Developmental pattern of small intestinal enterokinase and disaccharidase activities in the human fetus." Gastroenterology 72(6): 1299-303.

Apweiler R., Hermjakob H.,Sharon N. (1999). "On the frequency of protein glycosylation, as deduced from analysis of the SWISS-PROT database." Biochim Biophys Acta 1473(1): 4-8.

Arola H. (1994). "Diagnosis of hypolactasia and lactose malabsorption." Scand J Gastroenterol Suppl 202: 26-35.

References 81

Arvan P., Zhao X., Ramos-Castaneda J.,Chang A. (2002). "Secretory pathway quality control operating in Golgi, plasmalemmal, and endosomal systems." Traffic 3(11): 771-80.

Asp N.G., Dahlqvist A., Kuitunen P., Launiala K.,Visakorpi J.K. (1973). "Complete deficiency of brush-border lactase in congenital lactose malabsorption." Lancet 2(7824): 329-30.

Avezov E., Frenkel Z., Ehrlich M., Herscovics A.,Lederkremer G.Z. (2008). "Endoplasmic reticulum (ER) mannosidase I is compartmentalized and required for N-glycan trimming to Man5-6GlcNAc2 in glycoprotein ER- associated degradation." Mol Biol Cell 19(1): 216-25.

Balmana M., Gimenez E., Puerta A. et al (2016). "Increased alpha1-3 fucosylation of alpha-1-acid glycoprotein (AGP) in pancreatic cancer." J Proteomics 132: 144- 54.

Barrett T., Suresh C.G., Tolley S.P., Dodson E.J.,Hughes M.A. (1995). "The crystal structure of a cyanogenic beta-glucosidase from white clover, a family 1 glycosyl hydrolase." Structure 3(9): 951-60.

Baserga S.J.,Benz E.J., Jr. (1988). "Nonsense mutations in the human beta-globin gene affect mRNA metabolism." Proc Natl Acad Sci U S A 85(7): 2056-60.

Behrendt M. (2010). "Characterization of natural and artificial mutants of human intestinal lactase phlorizin hydrolase." Gottfried Wilhelm Leibniz Universität Hannover.

Behrendt M., Keiser M., Hoch M.,Naim H.Y. (2009). "Impaired trafficking and subcellular localization of a mutant lactase associated with congenital lactase deficiency." Gastroenterology 136(7): 2295-303.

Behrendt M., Polaina J.,Naim H.Y. (2010). "Structural hierarchy of regulatory elements in the folding and transport of an intestinal multidomain protein." J Biol Chem 285(6): 4143-52. 82 References

Berg N.O., Dahlqvist A., Lindberg T.,Studnitz W. (1969). "Severe familial lactose intolerance--a gastrogen disorder?" Acta Paediatr Scand 58(5): 525-7.

Boll W., Wagner P.,Mantei N. (1991). "Structure of the chromosomal gene and cDNAs coding for lactase-phlorizin hydrolase in humans with adult-type hypolactasia or persistence of lactase." Am J Hum Genet 48(5): 889-902.

Boukamel R.,Freund J.N. (1992). "The rat LPH gene 5' region: comparative structure with the human gene." DNA Seq 3(2): 119-21.

Braakman I.,Hebert D.N. (2013). "Protein folding in the endoplasmic reticulum." Cold Spring Harb Perspect Biol 5(5): a013201.

Briant K., Koay Y.H., Otsuka Y.,Swanton E. (2015). "ERAD of proteins containing aberrant transmembrane domains requires ubiquitylation of cytoplasmic lysine residues." J Cell Sci 128(22): 4112-25.

Brockhausen I., Schachter H.,Stanley P. (2009). O-GalNAc Glycans. Essentials of Glycobiology. A. Varki, R. D. Cummings, J. D. Eskoet al., Cold Spring Harbor Laboratory Press.

Brown D.A.,Rose J.K. (1992). "Sorting of GPI-anchored proteins to glycolipid- enriched membrane subdomains during transport to the apical cell surface." Cell 68(3): 533-44.

Brussow H. (2013). "Nutrition, population growth and disease: a short history of lactose." Environ Microbiol 15(8): 2154-61.

Bukau B., Weissman J.,Horwich A. (2006). "Molecular chaperones and protein quality control." Cell 125(3): 443-51.

Bull C., Boltje T.J., Wassink M. et al (2013). "Targeting aberrant sialylation in cancer cells using a fluorinated sialic acid analog impairs adhesion, migration, and in vivo tumor growth." Mol Cancer Ther 12(10): 1935-46. References 83

Caballero B., Solomons N.W.,Torun B. (1983). "Fecal reducing substances and breath hydrogen excretion as indicators of carbohydrate malabsorption." J Pediatr Gastroenterol Nutr 2(3): 487-90.

Canani R.B., Castaldo G., Bacchetta R., Martin M.G.,Goulet O. (2015). "Congenital diarrhoeal disorders: advances in this evolving web of inherited enteropathies." Nat Rev Gastroenterol Hepatol 12(5): 293-302.

Carvalho P., Goder V.,Rapoport T.A. (2006). "Distinct ubiquitin-ligase complexes define convergent pathways for the degradation of ER proteins." Cell 126(2): 361-73.

Cederlund A., Kai-Larsen Y., Printz G. et al (2013). "Lactose in human breast milk an inducer of innate immunity with implications for a role in intestinal homeostasis." PLoS One 8(1): e53876.

Cheng S.H., Gregory R.J., Marshall J. et al (1990). "Defective intracellular transport and processing of CFTR is the molecular basis of most cystic fibrosis." Cell 63(4): 827-34.

Christianson J.C.,Ye Y. (2014). "Cleaning up in the endoplasmic reticulum: ubiquitin in charge." Nat Struct Mol Biol 21(4): 325-35.

Coelho M., Sequeira F., Luiselli D., Beleza S.,Rocha J. (2009). "On the edge of Bantu expansions: mtDNA, Y chromosome and lactase persistence genetic variation in southwestern Angola." BMC Evol Biol 9: 80.

Cox J.S., Shamu C.E.,Walter P. (1993). "Transcriptional induction of genes encoding endoplasmic reticulum resident proteins requires a transmembrane protein kinase." Cell 73(6): 1197-206.

Danielsen E.M. (1990). "Biosynthesis of intestinal microvillar proteins. Dimerization of aminopeptidase N and lactase-phlorizin hydrolase." Biochemistry 29(1): 305-8.

84 References

Danielsen E.M. (1995). "Involvement of detergent-insoluble complexes in the intracellular transport of intestinal brush border enzymes." Biochemistry 34(5): 1596-605.

Danielsen E.M., Skovbjerg H., Noren O.,Sjostrom H. (1984). "Biosynthesis of intestinal microvillar proteins. Intracellular processing of lactase-phlorizin hydrolase." Biochem Biophys Res Commun 122(1): 82-90.

Day A.J., Canada F.J., Diaz J.C. et al (2000). "Dietary flavonoid and isoflavone glycosides are hydrolysed by the lactase site of lactase phlorizin hydrolase." FEBS Lett 468(2-3): 166-70.

Dejgaard K., Theberge J.F., Heath-Engel H., Chevet E., Tremblay M.L.,Thomas D.Y. (2010). "Organization of the Sec61 translocon, studied by high resolution native electrophoresis." J Proteome Res 9(4): 1763-71.

Delacour D., Cramm-Behrens C.I., Drobecq H., Le Bivic A., Naim H.Y.,Jacob R. (2006). "Requirement for galectin-3 in apical protein sorting." Curr Biol 16(4): 408-14.

Delacour D., Greb C., Koch A. et al (2007). "Apical sorting by galectin-3-dependent glycoprotein clustering." Traffic 8(4): 379-88.

Delacour D., Koch A.,Jacob R. (2009). "The role of galectins in protein trafficking." Traffic 10(10): 1405-13.

Doms R.W., Keller D.S., Helenius A.,Balch W.E. (1987). "Role for adenosine triphosphate in regulating the assembly and transport of vesicular stomatitis virus G protein trimers." J Cell Biol 105(5): 1957-69.

Dzialanski Z., Barany M., Engfeldt P., Magnuson A., Olsson L.A.,Nilsson T.K. (2015). "Lactase persistence versus lactose intolerance: Is there an intermediate phenotype?" Clin Biochem.

References 85

Ellgaard L.,Helenius A. (2003). "Quality control in the endoplasmic reticulum." Nat Rev Mol Cell Biol 4(3): 181-91.

Enattah N.S., Jensen T.G., Nielsen M. et al (2008). "Independent introduction of two lactase-persistence alleles into human populations reflects different history of adaptation to milk culture." Am J Hum Genet 82(1): 57-72.

Enattah N.S., Sahi T., Savilahti E., Terwilliger J.D., Peltonen L.,Jarvela I. (2002). "Identification of a variant associated with adult-type hypolactasia." Nat Genet 30(2): 233-7.

Erasmus H.D., Ludwig-Auser H.M., Paterson P.G., Sun D.,Sankaran K. (2002). "Enhanced weight gain in preterm infants receiving lactase-treated feeds: a randomized, double-blind, controlled trial." J Pediatr 141(4): 532-7.

Evans R.C., Fear S., Ashby D. et al (2002). "Diet and colorectal cancer: an investigation of the lectin/galactose hypothesis." Gastroenterology 122(7): 1784-92.

Fabre A., Charroux B., Martinez-Vinson C. et al (2012). "SKIV2L mutations cause syndromic diarrhea, or trichohepatoenteric syndrome." Am J Hum Genet 90(4): 689-92.

Fajardo O., Naim H.Y.,Lacey S.W. (1994). "The polymorphic expression of lactase in adults is regulated at the messenger RNA level." Gastroenterology 106(5): 1233-41.

Fazeli W., Kaczmarek S., Kirschstein M.,Santer R. (2015). "A novel mutation within the lactase gene (LCT): the first report of congenital lactase deficiency diagnosed in Central Europe." BMC Gastroenterol 15(1): 90.

Ferraris R.P. (2001). "Dietary and developmental regulation of intestinal sugar transport." Biochem J 360(Pt 2): 265-76.

86 References

Ferris S.P., Kodali V.K.,Kaufman R.J. (2014). "Glycoprotein folding and quality- control mechanisms in protein-folding diseases." Dis Model Mech 7(3): 331- 41.

Fink A.L. (1999). "Chaperone-mediated protein folding." Physiol Rev 79(2): 425-49.

Flynn G.C., Pohl J., Flocco M.T.,Rothman J.E. (1991). "Peptide-binding specificity of the molecular chaperone BiP." Nature 353(6346): 726-30.

Freedman R.B., Bulleid N.J., Hawkins H.C.,Paver J.L. (1989). "Role of protein disulphide-isomerase in the expression of native proteins." Biochem Soc Symp 55: 167-92.

Freiburghaus A.U., Schmitz J., Schindler M. et al (1976). "Protein patterns of brush- border fragments in congenital lactose malabsorption and in specific hypolactasia of the adult." N Engl J Med 294(19): 1030-2.

Frischmeyer P.A.,Dietz H.C. (1999). "Nonsense-mediated mRNA decay in health and disease." Hum Mol Genet 8(10): 1893-900.

Gasbarrini A., Corazza G.R., Gasbarrini G. et al (2009). "Methodology and indications of H2-breath testing in gastrointestinal diseases: the Rome Consensus Conference." Aliment Pharmacol Ther 29 Suppl 1: 1-49.

Gendrel D., Richard-Lenoble D., Kombila M. et al (1992). "Influence of intestinal parasitism on lactose absorption in well-nourished African children." Am J Trop Med Hyg 46(2): 137-40.

Gorbenko del Blanco D., de Graaff L.C., Visser T.J.,Hokken-Koelega A.C. (2012). "Growth hormone insensitivity syndrome caused by a heterozygous GHR mutation: phenotypic variability owing to moderation by nonsense-mediated decay." Clin Endocrinol (Oxf) 76(5): 706-12.

Gornik O.,Lauc G. (2008). "Glycosylation of serum proteins in inflammatory diseases." Dis Markers 25(4-5): 267-78. References 87

Grunberg J., Luginbuhl U.,Sterchi E.E. (1992). "Proteolytic processing of human intestinal lactase-phlorizin hydrolase precursor is not a prerequisite for correct sorting in Madin Darby canine kidney (MDCK) cells." FEBS Lett 314(3): 224-8.

Hammond C., Braakman I.,Helenius A. (1994). "Role of N-linked oligosaccharide recognition, glucose trimming, and calnexin in glycoprotein folding and quality control." Proc Natl Acad Sci U S A 91(3): 913-7.

Harding H.P., Zhang Y.,Ron D. (1999). "Protein translation and folding are coupled by an endoplasmic-reticulum-resident kinase." Nature 397(6716): 271-4.

Hartley J.L., Zachos N.C., Dawood B. et al (2010). "Mutations in TTC37 cause trichohepatoenteric syndrome (phenotypic diarrhea of infancy)." Gastroenterology 138(7): 2388-98, 98.e1-2.

Harvey C.B., Wang Y., Hughes L.A. et al (1995). "Studies on the expression of intestinal lactase in different individuals." Gut 36(1): 28-33.

Hauri H.P., Sterchi E.E., Bienz D., Fransen J.A.,Marxer A. (1985). "Expression and intracellular transport of microvillus membrane hydrolases in human intestinal epithelial cells." J Cell Biol 101(3): 838-51.

Hebert D.N., Garman S.C.,Molinari M. (2005). "The glycan code of the endoplasmic reticulum: asparagine-linked carbohydrates as protein maturation and quality- control tags." Trends Cell Biol 15(7): 364-70.

Hebert D.N.,Molinari M. (2007). "In and out of the ER: protein folding, quality control, degradation, and related human diseases." Physiol Rev 87(4): 1377-408.

Hebert D.N., Zhang J.X., Chen W., Foellmer B.,Helenius A. (1997). "The Number and Location of Glycans on Influenza Hemagglutinin Determine Folding and Association with Calnexin and Calreticulin." J Cell Biol 139(3): 613-23.

Helander H.F.,Fandriks L. (2014). "Surface area of the digestive tract - revisited." Scand J Gastroenterol 49(6): 681-9. 88 References

Helenius A.,Aebi M. (2004). "Roles of N-linked glycans in the endoplasmic reticulum." Annu Rev Biochem 73: 1019-49.

Henrissat B.,Davies G.J. (2000). "Glycoside hydrolases and glycosyltransferases. Families, modules, and implications for genomics." Plant Physiol 124(4): 1515- 9.

Herrinton L.J., Weiss N.S., Beresford S.A. et al (1995). "Lactose and galactose intake and metabolism in relation to the risk of epithelial ovarian cancer." Am J Epidemiol 141(5): 407-16.

Heyman M.B. (2006). "Lactose intolerance in infants, children, and adolescents." Pediatrics 118(3): 1279-86.

Hirschberg C.B.,Snider M.D. (1987). "Topography of glycosylation in the rough endoplasmic reticulum and Golgi apparatus." Annu Rev Biochem 56: 63-87.

Holden C.,Mace R. (1997). "Phylogenetic analysis of the evolution of lactose digestion in adults." Hum Biol 69(5): 605-28.

Holzel A. (1967). "Sugar malabsorption due to deficiencies of disaccharidase activities and of monosaccharide transport." Arch Dis Child 42(224): 341-52.

Holzel A. (1968). "Defects of sugar absorption. Sugar malabsorption and sugar intolerance in childhood." Proc R Soc Med 61(11 Part 1): 1095-9.

Holzel A., Mereu T.,Thomson M.L. (1962). "Severe lactose intolerance in infancy." Lancet 2(7270): 1346-8.

Hong M. (2006). "Oligomeric structure, dynamics, and orientation of membrane proteins from solid-state NMR." Structure 14(12): 1731-40.

Hoskova A., Sabacky J., Mrskos A.,Pospisil R. (1980). "Severe lactose intolerance with lactosuria and vomiting." Arch Dis Child 55(4): 304-5. References 89

Hosokawa N., Tremblay L.O., You Z., Herscovics A., Wada I.,Nagata K. (2003). "Enhancement of endoplasmic reticulum (ER) degradation of misfolded Null Hong Kong alpha1-antitrypsin by human ER mannosidase I." J Biol Chem 278(28): 26287-94.

Hosokawa N., You Z., Tremblay L.O., Nagata K.,Herscovics A. (2007). "Stimulation of ERAD of misfolded null Hong Kong alpha1-antitrypsin by Golgi alpha1,2- mannosidases." Biochem Biophys Res Commun 362(3): 626-32.

Hutt D.M., Powers E.T.,Balch W.E. (2009). "The proteostasis boundary in misfolding diseases of membrane traffic." FEBS Lett 583(16): 2639-46.

Ingram C.J., Elamin M.F., Mulcare C.A. et al (2007). "A novel polymorphism associated with lactose tolerance in Africa: multiple causes for lactase persistence?" Hum Genet 120(6): 779-88.

Ingram C.J., Raga T.O., Tarekegn A. et al (2009). "Multiple rare variants as a cause of a common phenotype: several different lactase persistence associated alleles in a single ethnic group." J Mol Evol 69(6): 579-88.

Inoue K., Khajavi M., Ohyama T. et al (2004). "Molecular mechanism for distinct neurological phenotypes conveyed by allelic truncating mutations." Nat Genet 36(4): 361-9.

Jacob R., Alfalah M., Grunberg J., Obendorf M.,Naim H.Y. (2000). "Structural determinants required for apical sorting of an intestinal brush-border membrane protein." J Biol Chem 275(9): 6566-72.

Jacob R., Brewer C., Fransen J.A.,Naim H.Y. (1994). "Transport, function, and sorting of lactase-phlorizin hydrolase in Madin-Darby canine kidney cells." J Biol Chem 269(4): 2712-21.

Jacob R., Bulleid N.J.,Naim H.Y. (1995). "Folding of human intestinal lactase- phlorizin hydrolase." J Biol Chem 270(31): 18678-84.

90 References

Jacob R., Heine M., Alfalah M.,Naim H.Y. (2003). "Distinct cytoskeletal tracks direct individual vesicle populations to the apical membrane of epithelial cells." Curr Biol 13(7): 607-12.

Jacob R.,Naim H.Y. (2001). "Apical membrane proteins are transported in distinct vesicular carriers." Curr Biol 11(18): 1444-50.

Jacob R., Peters K.,Naim H.Y. (2002). "The prosequence of human lactase-phlorizin hydrolase modulates the folding of the mature enzyme." J Biol Chem 277(10): 8217-25.

Jacob R., Preuss U., Panzer P. et al (1999). "Hierarchy of sorting signals in chimeras of intestinal lactase-phlorizin hydrolase and the influenza virus hemagglutinin." J Biol Chem 274(12): 8061-7.

Jacob R., Radebach I., Wuthrich M., Grunberg J., Sterchi E.E.,Naim H.Y. (1996). "Maturation of human intestinal lactase-phlorizin hydrolase: generation of the brush border form of the enzyme involves at least two proteolytic cleavage steps." Eur J Biochem 236(3): 789-95.

Jacob R., Weiner J.R., Stadge S.,Naim H.Y. (2000). "Additional N-glycosylation and its impact on the folding of intestinal lactase-phlorizin hydrolase." J Biol Chem 275(14): 10630-7.

Jacob R., Zimmer K.P., Naim H.,Naim H.Y. (1997). "The apical sorting of lactase- phlorizin hydrolase implicates sorting sequences found in the mature domain." Eur J Cell Biol 72(1): 54-60.

Jarvinen R., Knekt P., Hakulinen T.,Aromaa A. (2001). "Prospective study on milk products, calcium and cancers of the colon and rectum." Eur J Clin Nutr 55(11): 1000-7.

Jensen P.H., Kolarich D.,Packer N.H. (2010). "Mucin-type O-glycosylation--putting the pieces together." FEBS J 277(1): 81-94.

References 91

Jensen T.G., Liebert A., Lewinsky R., Swallow D.M., Olsen J.,Troelsen J.T. (2011). "The -14010*C variant associated with lactase persistence is located between an Oct-1 and HNF1alpha binding site and increases lactase promoter activity." Hum Genet 130(4): 483-93.

Jidenko M., Nielsen R.C., Sorensen T.L. et al (2005). "Crystallization of a mammalian membrane protein overexpressed in Saccharomyces cerevisiae." Proc Natl Acad Sci U S A 102(33): 11687-91.

Jordan B.A.,Devi L.A. (1999). "G-protein-coupled receptor heterodimerization modulates receptor function." Nature 399(6737): 697-700.

Kornfeld R.,Kornfeld S. (1985). "Assembly of asparagine-linked oligosaccharides." Annu Rev Biochem 54: 631-64.

Kruse T.A., Bolund L., Grzeschik K.H. et al (1988). "The human lactase-phlorizin hydrolase gene is located on chromosome 2." FEBS Lett 240(1-2): 123-6.

Kuhn N.J.,White A. (2009). "The topography of lactose synthesis. 1975." J Mammary Gland Biol Neoplasia 14(3): 213-20.

Kuokkanen M., Enattah N.S., Oksanen A., Savilahti E., Orpana A.,Jarvela I. (2003). "Transcriptional regulation of the lactase-phlorizin hydrolase gene by polymorphisms associated with adult-type hypolactasia." Gut 52(5): 647-52.

Kuokkanen M., Kokkonen J., Enattah N.S. et al (2006). "Mutations in the translated region of the lactase gene (LCT) underlie congenital lactase deficiency." Am J Hum Genet 78(2): 339-44.

Kwak H.L., WJ.; Lee, MR. (2012). "Revisiting lactose as an enhancer of calcium absorption." International Dairy Journal 22(2): 147-51.

Laaksonen M.M., Impivaara O., Sievanen H. et al (2009). "Associations of genetic lactase non-persistence and sex with bone loss in young adulthood." Bone 44(5): 1003-9. 92 References

Launiala K., Kuitunen P.,Visakorpi J.K. (1966). "Disaccharidases and histology of duodenal mucosa in congenital lactose malabsorption." Acta Paediatr Scand 55(3): 257-63.

Leese H.J.,Semenza G. (1973). "On the identity between the small intestinal enzymes phlorizin hydrolase and glycosylceramidase." J Biol Chem 248(23): 8170-3.

Lemus L.,Goder V. (2014). "Regulation of Endoplasmic Reticulum-Associated Protein Degradation (ERAD) by Ubiquitin." Cells 3(3): 824-47.

Lerchbaum E., Giuliani A., Gruber H.J., Pieber T.R.,Obermayer-Pietsch B. (2012). "Adult-type hypolactasia and calcium intake in polycystic ovary syndrome." Clin Endocrinol (Oxf) 77(6): 834-43.

Lewinsky R.H., Jensen T.G., Moller J., Stensballe A., Olsen J.,Troelsen J.T. (2005). "T-13910 DNA variant associated with lactase persistence interacts with Oct-1 and stimulates lactase promoter activity in vitro." Hum Mol Genet 14(24): 3945-53.

Lobo G.P., Ebke L.A., Au A.,Hagstrom S.A. (2016). "TULP1 Missense Mutations Induces the Endoplasmic Reticulum Unfolded Protein Response Stress Complex (ER-UPR)." Adv Exp Med Biol 854: 223-30.

Lodish H B.A., Zipursky SL, et al. (2000). "Molecular Cell Biology." 4th edition.

Lomer M.C., Parkes G.C.,Sanderson J.D. (2008). "Review article: lactose intolerance in clinical practice--myths and realities." Aliment Pharmacol Ther 27(2): 93- 103.

Long S.B., Campbell E.B.,Mackinnon R. (2005). "Crystal structure of a mammalian voltage-dependent Shaker family K+ channel." Science 309(5736): 897-903.

Luan C.J., Shen W., Yu Z. et al (2015). "Two nonsense mutations cause protein C deficiency by nonsense-mediated mRNA decay." Thromb Res 135(4): 733-8. References 93

Maffei H.V., Daher S.R.,Moreira F.L. (1984). "Carbohydrate malabsorption in infants with diarrhea: diagnostic and evolutive aspects." Arq Gastroenterol 21(3): 136- 42.

Maiuri L., Rossi M., Raia V. et al (1994). "Mosaic regulation of lactase in human adult-type hypolactasia." Gastroenterology 107(1): 54-60.

Mantei N., Villa M., Enzler T. et al (1988). "Complete primary structure of human and rabbit lactase-phlorizin hydrolase: implications for biosynthesis, membrane anchoring and evolution of the enzyme." EMBO J 7(9): 2705-13.

Maquat L.E. (2005). "Nonsense-mediated mRNA decay in mammals." J Cell Sci 118(Pt 9): 1773-6.

Martin M.G., Turk E., Lostao M.P., Kerner C.,Wright E.M. (1996). "Defects in Na+/glucose cotransporter (SGLT1) trafficking and function cause glucose- galactose malabsorption." Nat Genet 12(2): 216-20.

Matthews S.B., Waud J.P., Roberts A.G.,Campbell A.K. (2005). "Systemic lactose intolerance: a new perspective on an old problem." Postgrad Med J 81(953): 167-73.

Maza J., Mateescu M., Das Sarma J.,Koval M. (2003). "Differential oligomerization of endoplasmic reticulum-retained connexin43/connexin32 chimeras." Cell Commun Adhes 10(4-6): 319-22.

Metz G., Jenkins D.J., Peters T.J., Newman A.,Blendis L.M. (1975). "Breath hydrogen as a diagnostic method for hypolactasia." Lancet 1(7917): 1155-7.

Miller T.L., Orav E.J., Martin S.R., Cooper E.R., McIntosh K.,Winter H.S. (1991). "Malnutrition and carbohydrate malabsorption in children with vertically transmitted human immunodeficiency virus 1 infection." Gastroenterology 100(5 Pt 1): 1296-302.

94 References

Minguez P., Parca L., Diella F. et al (2012). "Deciphering a global network of functionally associated post-translational modifications." Mol Syst Biol 8: 599.

Misselwitz B., Pohl D., Fruhauf H., Fried M., Vavricka S.R.,Fox M. (2013). "Lactose malabsorption and intolerance: pathogenesis, diagnosis and treatment." United European Gastroenterol J 1(3): 151-9.

Miwa H.E., Song Y., Alvarez R., Cummings R.D.,Stanley P. (2012). "The bisecting GlcNAc in cell growth control and tumor progression." Glycoconj J 29(8-9): 609-18.

Mohorko E., Glockshuber R.,Aebi M. (2011). "Oligosaccharyltransferase: the central enzyme of N-linked protein glycosylation." J Inherit Metab Dis 34(4): 869-78.

Montalto M., Nucera G., Santoro L. et al (2005). "Effect of exogenous beta- galactosidase in patients with lactose malabsorption and intolerance: a crossover double-blind placebo-controlled study." Eur J Clin Nutr 59(4): 489- 93.

Moremen K.W. (2002). "Golgi alpha-mannosidase II deficiency in vertebrate systems: implications for asparagine-linked oligosaccharide processing in mammals." Biochim Biophys Acta 1573(3): 225-35.

Mottet G., Tuffereau C.,Roux L. (1986). "Reduced temperature can block different glycoproteins at different steps during transport to the plasma membrane." J Gen Virol 67 ( Pt 9): 2029-35.

Muller T., Hess M.W., Schiefermeier N. et al (2008). "MYO5B mutations cause microvillus inclusion disease and disrupt epithelial cell polarity." Nat Genet 40(10): 1163-5.

Munro S.,Pelham H.R. (1986). "An Hsp70-like protein in the ER: identity with the 78 kd glucose-regulated protein and immunoglobulin heavy chain binding protein." Cell 46(2): 291-300.

References 95

Naim H.Y. (1992). "Processing of human pro-lactase-phlorizin hydrolase at reduced temperatures: cleavage is preceded by complex glycosylation." Biochem J 285 ( Pt 1): 13-6.

Naim H.Y. (1994). "Processing and transport of human small intestinal lactase- phlorizin hydrolase (LPH). Role of N-linked oligosaccharide modification." FEBS Lett 342(3): 302-7.

Naim H.Y., Heine M.,Zimmer K.P. (2012). "Congenital sucrase-isomaltase deficiency: heterogeneity of inheritance, trafficking, and function of an intestinal enzyme complex." J Pediatr Gastroenterol Nutr 55 Suppl 2: S13-20.

Naim H.Y., Jacob R., Naim H., Sambrook J.F.,Gething M.J. (1994). "The pro region of human intestinal lactase-phlorizin hydrolase." J Biol Chem 269(43): 26933- 43.

Naim H.Y., Lacey S.W., Sambrook J.F.,Gething M.J. (1991). "Expression of a full- length cDNA coding for human intestinal lactase-phlorizin hydrolase reveals an uncleaved, enzymatically active, and transport-competent protein." J Biol Chem 266(19): 12313-20.

Naim H.Y.,Lentze M.J. (1992). "Impact of O-glycosylation on the function of human intestinal lactase-phlorizin hydrolase. Characterization of glycoforms varying in enzyme activity and localization of O-glycoside addition." J Biol Chem 267(35): 25494-504.

Naim H.Y.,Naim H. (1996). "Dimerization of lactase-phlorizin hydrolase occurs in the endoplasmic reticulum, involves the putative membrane spanning domain and is required for an efficient transport of the enzyme to the cell surface." Eur J Cell Biol 70(3): 198-208.

Naim H.Y., Sterchi E.E.,Lentze M.J. (1987). "Biosynthesis and maturation of lactase- phlorizin hydrolase in the human small intestinal epithelial cells." Biochem J 241(2): 427-34.

96 References

Naim H.Y., Sterchi E.E.,Lentze M.J. (1988). "Biosynthesis of the human sucrase- isomaltase complex. Differential O-glycosylation of the sucrase subunit correlates with its position within the enzyme complex." J Biol Chem 263(15): 7242-53.

Naim H.Y., Sterchi E.E.,Lentze M.J. (1988). "Structure, biosynthesis, and glycosylation of human small intestinal maltase-glucoamylase." J Biol Chem 263(36): 19709-17.

Nemeth K., Plumb G.W., Berrin J.G. et al (2003). "Deglycosylation by small intestinal epithelial cell beta-glucosidases is a critical step in the absorption and metabolism of dietary flavonoid glycosides in humans." Eur J Nutr 42(1): 29- 42.

Newcomer A.D., McGill D.B., Thomas P.J.,Hofmann A.F. (1975). "Prospective comparison of indirect methods for detecting lactase deficiency." N Engl J Med 293(24): 1232-6.

Ng D.P., Poulsen B.E.,Deber C.M. (2012). "Membrane protein misassembly in disease." Biochim Biophys Acta 1818(4): 1115-22.

Nichols B.L., Avery S.E., Karnsakul W. et al (2002). "Congenital maltase- glucoamylase deficiency associated with lactase and sucrase deficiencies." J Pediatr Gastroenterol Nutr 35(4): 573-9.

Ninagawa S., Okada T., Sumitomo Y. et al (2014). "EDEM2 initiates mammalian glycoprotein ERAD by catalyzing the first mannose trimming step." J Cell Biol 206(3): 347-56.

Norio R. (2003). "Finnish Disease Heritage I: characteristics, causes, background." Hum Genet 112(5-6): 441-56.

Norio R. (2003). "Finnish Disease Heritage II: population prehistory and genetic roots of Finns." Hum Genet 112(5-6): 457-69.

References 97

Obermayer-Pietsch B.M., Bonelli C.M., Walter D.E. et al (2004). "Genetic predisposition for adult lactose intolerance and relation to diet, bone density, and bone fractures." J Bone Miner Res 19(1): 42-7.

Olds L.C.,Sibley E. (2003). "Lactase persistence DNA variant enhances lactase promoter activity in vitro: functional role as a cis regulatory element." Hum Mol Genet 12(18): 2333-40.

Olzmann J.A., Kopito R.R.,Christianson J.C. (2013). "The mammalian endoplasmic reticulum-associated degradation system." Cold Spring Harb Perspect Biol 5(9).

Overeem A.W., Posovszky C., Rings E.H., Giepmans B.N.,van I.S.C. (2016). "The role of enterocyte defects in the pathogenesis of congenital diarrheal disorders." Dis Model Mech 9(1): 1-12.

Oyadomari S., Araki E.,Mori M. (2002). "Endoplasmic reticulum stress-mediated apoptosis in pancreatic beta-cells." Apoptosis 7(4): 335-45.

Ozdemir O., Mete E., Catal F.,Ozol D. (2009). "Food intolerances and eosinophilic esophagitis in childhood." Dig Dis Sci 54(1): 8-14.

Palacios I.M. (2013). "Nonsense-mediated mRNA decay: from mechanistic insights to impacts on human health." Brief Funct Genomics 12(1): 25-36.

Panzer P., Preuss U., Joberty G.,Naim H.Y. (1998). "Protein domains implicated in intracellular transport and sorting of lactase-phlorizin hydrolase." J Biol Chem 273(22): 13861-9.

Pelletier M.F., Marcil A., Sevigny G. et al (2000). "The heterodimeric structure of glucosidase II is required for its activity, solubility, and localization in vivo." Glycobiology 10(8): 815-27.

Peltonen L., Jalanko A.,Varilo T. (1999). "Molecular genetics of the Finnish disease heritage." Hum Mol Genet 8(10): 1913-23. 98 References

Petrescu A.J., Milac A.L., Petrescu S.M., Dwek R.A.,Wormald M.R. (2004). "Statistical analysis of the protein environment of N-glycosylation sites: implications for occupancy, structure, and folding." Glycobiology 14(2): 103- 14.

Pfeffer S., Dudek J., Gogala M. et al (2014). "Structure of the mammalian oligosaccharyl-transferase complex in the native ER protein translocon." Nat Commun 5: 3072.

Pramoud D. (1997). "Blood Brain Barrier and Cerebral Metabolism." Neuroscience Online(4).

Propsting M.J., Jacob R.,Naim H.Y. (2003). "A glutamine to proline exchange at amino acid residue 1098 in sucrase causes a temperature-sensitive arrest of sucrase-isomaltase in the endoplasmic reticulum and cis-Golgi." J Biol Chem 278(18): 16310-4.

Rasinpera H., Kuokkanen M., Kolho K.L. et al (2005). "Transcriptional downregulation of the lactase (LCT) gene during childhood." Gut 54(11): 1660- 1.

Rasinpera H., Savilahti E., Enattah N.S. et al (2004). "A genetic test which can be used to diagnose adult-type hypolactasia in children." Gut 53(11): 1571-6.

Rhim A.D., Stoykova L.I., Trindade A.J., Glick M.C.,Scanlin T.F. (2004). "Altered terminal glycosylation and the pathophysiology of CF lung disease." J Cyst Fibros 3 Suppl 2: 95-6.

Rings E.H., de Boer P.A., Moorman A.F. et al (1992). "Lactase gene expression during early development of rat small intestine." Gastroenterology 103(4): 1154-61.

Ritz V., Alfalah M., Zimmer K.P., Schmitz J., Jacob R.,Naim H.Y. (2003). "Congenital sucrase-isomaltase deficiency because of an accumulation of the mutant enzyme in the endoplasmic reticulum." Gastroenterology 125(6): 1678-85. References 99

Rock C.L. (2011). "Milk and the risk and progression of cancer." Nestlé Nutrition workshop series. Paediatric programme 67: 173-85.

Ron D.,Walter P. (2007). "Signal integration in the endoplasmic reticulum unfolded protein response." Nat Rev Mol Cell Biol 8(7): 519-29.

Ruchkina I.N., Fadeeva N.A., Parfenov A.I. et al (2013). "[The role of small bowel microflora in the development of secondary lactase deficiency and the possibilities of its treatment with probiotics]." Ter Arkh 85(2): 21-6.

Ruggiano A., Foresti O.,Carvalho P. (2014). "Quality control: ER-associated degradation: protein quality control and beyond." J Cell Biol 204(6): 869-79.

Saarela T., Simila S.,Koivisto M. (1995). "Hypercalcemia and nephrocalcinosis in patients with congenital lactase deficiency." J Pediatr 127(6): 920-3.

Sahi T. (1994). "Genetics and epidemiology of adult-type hypolactasia." Scand J Gastroenterol Suppl 202: 7-20.

Sahi T. (1994). "Hypolactasia and lactase persistence. Historical review and the terminology." Scand J Gastroenterol Suppl 202: 1-6.

Sala Coromina J., Vinaixa Verges A.,Garcia Puig R. (2014). "[Congenital lactase deficiency: Identification of a new mutation.]." An Pediatr (Barc).

Saldova R., Reuben J.M., Abd Hamid U.M., Rudd P.M.,Cristofanilli M. (2011). "Levels of specific serum N-glycans identify breast cancer patients with higher circulating tumor cell counts." Ann Oncol 22(5): 1113-9.

Savaiano D.A. (2014). "Lactose digestion from yogurt: mechanism and relevance." Am J Clin Nutr 99(5 Suppl): 1251S-5S.

100 References

Savaiano D.A., Boushey C.J.,McCabe G.P. (2006). "Lactose intolerance symptoms assessed by meta-analysis: a grain of truth that leads to exaggeration." J Nutr 136(4): 1107-13.

Savilahti E., Launiala K.,Kuitunen P. (1983). "Congenital lactase deficiency. A clinical study on 16 patients." Arch Dis Child 58(4): 246-52.

Schedin-Weiss S., Winblad B.,Tjernberg L.O. (2014). "The role of protein glycosylation in Alzheimer disease." Febs j 281(1): 46-62.

Scholz-Ahrens K.E.,Schrezenmeir J. (2000). "Effects of bioactive substances in milk on mineral and trace element metabolism with special reference to casein phosphopeptides." Br J Nutr 84 Suppl 1: S147-53.

Schroder M. (2008). "Endoplasmic reticulum stress responses." Cell Mol Life Sci 65(6): 862-94.

Scrimshaw N.S.,Murray E.B. (1988). "The acceptability of milk and milk products in populations with a high prevalence of lactose intolerance." Am J Clin Nutr 48(4 Suppl): 1079-159.

Semenza G. (1986). "Anchoring and biosynthesis of stalked brush border membrane proteins: glycosidases and peptidases of enterocytes and renal tubuli." Annu Rev Cell Biol 2: 255-313.

Shailubhai K., Pukazhenthi B.S., Saxena E.S., Varma G.M.,Vijay I.K. (1991). "Glucosidase I, a transmembrane endoplasmic reticular glycoprotein with a luminal catalytic domain." J Biol Chem 266(25): 16587-93.

Shaukat A., Levitt M.D., Taylor B.C. et al (2010). "Systematic review: effective management strategies for lactose intolerance." Ann Intern Med 152(12): 797- 803.

References 101

Sim L., Willemsma C., Mohan S., Naim H.Y., Pinto B.M.,Rose D.R. (2010). "Structural basis for substrate selectivity in human maltase-glucoamylase and sucrase-isomaltase N-terminal domains." J Biol Chem 285(23): 17763-70.

Simons K.,Ikonen E. (1997). "Functional rafts in cell membranes." Nature 387(6633): 569-72.

Simoons F.J. (1969). "Primary adult lactose intolerance and the milking habit: a problem in biological and cultural interrelations. I. Review of the medical research." Am J Dig Dis 14(12): 819-36.

Simoons F.J. (1970). "Primary adult lactose intolerance and the milking habit: a problem in biologic and cultural interrelations. II. A culture historical hypothesis." Am J Dig Dis 15(8): 695-710.

Sivagnanam M., Mueller J.L., Lee H. et al (2008). "Identification of EpCAM as the gene for congenital tufting enteropathy." Gastroenterology 135(2): 429-37.

Slemenda C.W., Christian J.C., Hui S., Fitzgerald J.,Johnston C.C., Jr. (1991). "No evidence for an effect of lactase deficiency on bone mass in pre- or postmenopausal women." J Bone Miner Res 6(12): 1367-71.

Solomons N.W. (2002). "Fermentation, fermented foods and lactose intolerance." Eur J Clin Nutr 56 Suppl 4: S50-5.

Stallings V.A., Oddleifson N.W., Negrini B.Y., Zemel B.S.,Wellens R. (1994). "Bone mineral content and dietary calcium intake in children prescribed a low-lactose diet." J Pediatr Gastroenterol Nutr 18(4): 440-5.

Stanley P., Schachter H.,Taniguchi N. (2009). N-Glycans. Essentials of Glycobiology. A. Varki, R. D. Cummings, J. D. Eskoet al., Cold Spring Harbor Laboratory Press.

102 References

Suarez F.L., Savaiano D.A.,Levitt M.D. (1995). "A comparison of symptoms after the consumption of milk or lactose-hydrolyzed milk by people with self-reported severe lactose intolerance." N Engl J Med 333(1): 1-4.

Swallow D.M. (2003). "Genetics of lactase persistence and lactose intolerance." Annu Rev Genet 37: 197-219.

Terrin G., Tomaiuolo R., Passariello A. et al (2012). "Congenital diarrheal disorders: an updated diagnostic approach." Int J Mol Sci 13(4): 4168-85.

Thanabalasingham G., Huffman J.E., Kattla J.J. et al (2013). "Mutations in HNF1A result in marked alterations of plasma glycan profile." Diabetes 62(4): 1329-37.

Tishkoff S.A., Reed F.A., Ranciaro A. et al (2007). "Convergent adaptation of human lactase persistence in Africa and Europe." Nat Genet 39(1): 31-40.

Tomar B.S. (2014). "Lactose intolerance and other disaccharidase deficiency." Indian J Pediatr 81(9): 876-80.

Torniainen S., Freddara R., Routi T. et al (2009). "Four novel mutations in the lactase gene (LCT) underlying congenital lactase deficiency (CLD)." BMC Gastroenterol 9: 8.

Travers K.J., Patil C.K., Wodicka L., Lockhart D.J., Weissman J.S.,Walter P. (2000). "Functional and genomic analyses reveal an essential coordination between the unfolded protein response and ER-associated degradation." Cell 101(3): 249-58.

Triadou N., Bataille J.,Schmitz J. (1983). "Longitudinal study of the human intestinal brush border membrane proteins. Distribution of the main disaccharidases and peptidases." Gastroenterology 85(6): 1326-32.

Troelsen J.T., Mehlum A., Olsen J. et al (1994). "1 kb of the lactase-phlorizin hydrolase promoter directs post-weaning decline and small intestinal-specific expression in transgenic mice." FEBS Lett 342(3): 291-6. References 103

Troelsen J.T., Mitchelmore C., Spodsberg N., Jensen A.M., Noren O.,Sjostrom H. (1997). "Regulation of lactase-phlorizin hydrolase gene expression by the caudal-related homoeodomain protein Cdx-2." Biochem J 322 ( Pt 3): 833-8.

Troelsen J.T., Olsen J., Mitchelmore C., Hansen G.H., Sjostrom H.,Noren O. (1994). "Two intestinal specific nuclear factors binding to the lactase-phlorizin hydrolase and sucrase-isomaltase promoters are functionally related oligomeric molecules." FEBS Lett 342(3): 297-301.

Troelsen J.T., Olsen J., Noren O.,Sjostrom H. (1992). "A novel intestinal trans-factor (NF-LPH1) interacts with the lactase-phlorizin hydrolase promoter and co- varies with the enzymatic activity." J Biol Chem 267(28): 20407-11.

Trombetta E.S.,Parodi A.J. (2003). "Quality control and protein folding in the secretory pathway." Annu Rev Cell Dev Biol 19: 649-76.

Ubarretxena-Belandia I.,Stokes D.L. (2010). "Present and future of membrane protein structure determination by electron crystallography." Adv Protein Chem Struct Biol 81: 33-60.

Uchida N., Sakamoto O., Irie M. et al (2012). "Two novel mutations in the lactase gene in a Japanese infant with congenital lactase deficiency." Tohoku J Exp Med 227(1): 69-72.

Usai-Satta P., Scarpa M., Oppia F.,Cabras F. (2012). "Lactose malabsorption and intolerance: What should be the best clinical management?" World J Gastrointest Pharmacol Ther 3(3): 29-33.

Varki A., Freeze H.H.,Manzi A.E. (2009). "Overview of glycoconjugate analysis." Curr Protoc Protein Sci Chapter 12: Unit 12 1 1 1-8.

Varki A.,Lowe J.B. (2009). Biological Roles of Glycans. Essentials of Glycobiology. A. Varki, R. D. Cummings, J. D. Eskoet al. Cold Spring Harbor (NY), Cold Spring Harbor Laboratory Press, The Consortium of Glycobiology Editors, La Jolla, California.

104 References

Vembar S.S.,Brodsky J.L. (2008). "One step at a time: endoplasmic reticulum- associated degradation." Nat Rev Mol Cell Biol 9(12): 944-57.

Venema K. (2012). "Intestinal fermentation of lactose and prebiotic lactose derivatives, including human milk oligosaccharides." International Dairy Journal 22(2): 123-40.

Vesa T.H., Marteau P.,Korpela R. (2000). "Lactose intolerance." J Am Coll Nutr 19(2 Suppl): 165s-75s.

Wacker H., Keller P., Falchetto R., Legler G.,Semenza G. (1992). "Location of the two catalytic sites in intestinal lactase-phlorizin hydrolase. Comparison with sucrase-isomaltase and with other glycosidases, the membrane anchor of lactase-phlorizin hydrolase." J Biol Chem 267(26): 18744-52.

Wahlqvist M.L. (2015). "Lactose nutrition in lactase nonpersisters." Asia Pac J Clin Nutr 24 Suppl 1: S21-5.

Wang B.,Brand-Miller J. (2003). "The role and potential of sialic acid in human nutrition." Eur J Clin Nutr 57(11): 1351-69.

Wiegerinck C.L., Janecke A.R., Schneeberger K. et al (2014). "Loss of syntaxin 3 causes variant microvillus inclusion disease." Gastroenterology 147(1): 65- 8.e10.

Williams D.B. (2006). "Beyond lectins: the calnexin/calreticulin chaperone system of the endoplasmic reticulum." J Cell Sci 119(Pt 4): 615-23.

Wuthrich M., Grunberg J., Hahn D. et al (1996). "Proteolytic processing of human lactase-phlorizin hydrolase is a two-step event: identification of the cleavage sites." Arch Biochem Biophys 336(1): 27-34.

Yang J., Deng Y., Chu H. et al (2013). "Prevalence and presentation of lactose intolerance and effects on dairy product intake in healthy subjects and patients with irritable bowel syndrome." Clin Gastroenterol Hepatol 11(3): 262-8 e1. References 105

Ye J., Rawson R.B., Komuro R. et al (2000). "ER stress induces cleavage of membrane-bound ATF6 by the same proteases that process SREBPs." Mol Cell 6(6): 1355-64.

Zecca L., Mesonero J.E., Stutz A. et al (1998). "Intestinal lactase-phlorizin hydrolase (LPH): the two catalytic sites; the role of the pancreas in pro-LPH maturation." FEBS Lett 435(2-3): 225-8.

Zhang K.,Kaufman R.J. (2006). "Protein folding in the endoplasmic reticulum and the unfolded protein response." Handb Exp Pharmacol(172): 69-91.

Zhao J., Fox M., Cong Y. et al (2010). "Lactose intolerance in patients with chronic functional diarrhoea: the role of small intestinal bacterial overgrowth." Aliment Pharmacol Ther 31(8): 892-900.

Zheng X., Chu H., Cong Y. et al (2015). "Self-reported lactose intolerance in clinic patients with functional gastrointestinal symptoms: prevalence, risk factors, and impact on food choices." Neurogastroenterol Motil 27(8): 1138-46.

Zhong Y., Priebe M.G., Vonk R.J. et al (2004). "The role of colonic microbiota in lactose intolerance." Dig Dis Sci 49(1): 78-83.

zur Stadt U., Rohr J., Seifert W. et al (2009). "Familial hemophagocytic lymphohistiocytosis type 5 (FHL-5) is caused by mutations in Munc18-2 and impaired binding to syntaxin 11." Am J Hum Genet 85(4): 482-92.

Zurawska-Plaksej E., Kratz E.M., Ferens-Sieczkowska M., Knapik-Kordecka M.,Piwowar A. (2015). "Changes in glycosylation of human blood plasma chitotriosidase in patients with type 2 diabetes." Glycoconj J.

106 Acknowledgements

Acknowledgements

First, I thank my supervisor Prof. Dr. Hassan Y. Naim who offered me the opportunity to work on very challenging projects during my Master studies and my doctoral time. Furthermore, I appreciate his support and guidance as well as his demanding attitude. I learned a lot from you, not only as a scientist but also for life.

Secondly, I thank Prof. Dr. Rita Gerardy-Schahn who kindly agreed to review my doctoral thesis.

Special thanks are addressed to my second supervisor Prof. Dr. Georg Herrler for his contribution as a member of my supervision group.

I thank all present and former members of the Department of Physiological Chemistry, but especially Gabriele Wetzel, Birthe Gericke and Friederike Reuner. Gabi, thank you for teaching me a lot of techniques and making daily lab work so easy. Birthe and Rike, thank you for having always open ears and making the last years to such a good time in my life.

Finally, I thank my family for their never ending mental support, their love and confidence. Thank you, Mum and Dad, for always being there for me and believing in me in every stage of my life. Special big thanks to Stefan for being my haven of peace. I am grateful for your confidence and love.

Eidesstattliche Erklärung 107

Eidesstattliche Erklärung

Hiermit erkläre ich, dass ich die Dissertation „The concerted action of multiple post- translational events regulates the trafficking and function of wild type and mutant disaccharidases” selbstständig verfasst habe. Ich habe keine entgeltliche Hilfe von Vermittlungs- bzw. Beratungsdiensten (Promotionsberater oder anderer Personen) in Anspruch genommen. Niemand hat von mir unmittelbar oder mittelbar entgeltliche Leistungen für Arbeiten erhalten, die im Zusammenhang mit dem Inhalt der vorgelegten Dissertation stehen.

Ich habe die Dissertation an folgenden Institutionen angefertigt:

Stiftung Tierärztliche Hochschule Hannover

Institut für Physiologische Chemie

Bünteweg 17/218, 30559 Hannover

Die Dissertation wurde bisher nicht für eine Prüfung oder Promotion oder für einen ähnlichen Zweck zur Beurteilung eingereicht. Ich versichere, dass ich die vorstehenden Angaben nach bestem Wissen vollständig und der Wahrheit entsprechend gemacht habe.

Hannover, den 3. März 2016 ______

(Lena Diekmann)