IntroductionIntroduction toto MolecularMolecular TestingTesting

Susan M. Tanksley, Ph.D. Texas Department of State Health Services Laboratory Services Section OutlineOutline

„ BasicBasic geneticsgenetics „ DNA „ Genes & Gene Structure „ Mutations

„ BasicBasic molecularmolecular techniquestechniques „ Nucleic Acid Extraction „ Electrophoresis „ Hybridization „ Restriction Digestion „ Polymerase Chain Reaction „ DNA sequencing 75 trillion ~25,000 genes

23 pairs

3.2 billion bp TheThe basicsbasics ofof inheritanceinheritance „ InheritInherit oneone chromosomechromosome fromfrom eacheach parentparent „ twotwo completecomplete setssets ofof chromosomeschromosomes „ chromosomechromosome == DNADNA ++ proteinsproteins „ DNADNA -- DeoxyribonucleicDeoxyribonucleic acidacid „ UniqueUnique geneticgenetic blueprintsblueprints forfor eacheach individualindividual „ DoubleDouble helixhelix ofof complementarycomplementary nucleotidesnucleotides „ NucleotideNucleotide == basebase ++ sugarsugar ++ phosphatephosphate „ DNADNA nucleotidesnucleotides -- adenineadenine (A),(A), cytosinecytosine (C),(C), guanineguanine (G),(G), && thyminethymine (T)(T) „ RNARNA –– RibonucleicRibonucleic AcidAcid „ RNARNA nucleotidesnucleotides –– adenineadenine (A),(A), cytosinecytosine (C),(C), guanineguanine (G)(G) && uraciluracil (U)(U) BaseBase PairingPairing RulesRules

„ NucleotideNucleotide == basebase ++ sugarsugar ++ phosphatephosphate

„ DNADNA „ AdenineAdenine pairspairs withwith ThymineThymine (A(A –– T)T) „ CytosineCytosine pairspairs withwith GuanineGuanine (C(C –– G)G)

„ RNARNA „ AdenineAdenine pairspairs withwith UracilUracil (A(A –– U)U) „ CytosineCytosine pairspairs withwith GuanineGuanine (C(C –– G)G) GeneGene StructureStructure

5’ Promoter UTR Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 UTR 3’

„ ExonExon –– containscontains partpart ofof thethe openopen readingreading frameframe ofof thethe completecomplete proteinprotein „ IntronIntron –– notnot translatedtranslated intointo proteinprotein „ RegulatoryRegulatory RegionsRegions „ PromoterPromoter –– facilitatesfacilitates transcriptiontranscription ofof aa genegene „ UntranslatedUntranslated RegionRegion (UTR)(UTR) –– importantimportant forfor efficientefficient translationtranslation andand forfor controllingcontrolling thethe raterate ofof translationtranslation GenesGenes

„ AverageAverage size:size: 3,0003,000 bpbp „ LargestLargest knownknown humanhuman gene:gene: DystrophinDystrophin „ 2.42.4 millionmillion bpbp „ EstimatedEstimated 25,00025,000 genesgenes „ FunctionFunction isis notnot yetyet knownknown forfor >50%>50% ofof discovereddiscovered genesgenes „ ~2%~2% ofof genomegenome isis codingcoding sequencesequence ββ--GlobinGlobin GeneGene

E1 IVS-I E2 IVS-II E3

Hb S/C Hb E Hb D ƒ Mutations lead to clinically significant hemoglobinopathies ƒ sickle cell anemia ƒ sickle beta-thalassemia ƒ homozygous beta0-thalassemia ƒ 1,600 base pairs, 3 exons, 146 amino acids ƒ > 700 known mutations PhenylalaninePhenylalanine HydroxylaseHydroxylase

1 2 3 4 5 6 7 8 9 10 11 12 13

„ 99%99% ofof mutationsmutations causingcausing PKUPKU occuroccur inin PhenylalaninePhenylalanine HydroxylaseHydroxylase (PAH)(PAH) „ ~90,000~90,000 bpbp,, 1313 exons,exons, 452452 aminoamino acidsacids „ >> 500500 reportedreported mutationsmutations CysticCystic FibrosisFibrosis TransmembraneTransmembrane ConductanceConductance RegulatorRegulator

„ MutationsMutations inin CFTRCFTR maymay causecause CysticCystic FibrosisFibrosis „ ~250,000~250,000 basebase pairspairs „ 14801480 aminoamino acidsacids „ 2727 exonsexons „ >1600>1600 knownknown mutationsmutations FromFrom aa genegene toto aa protein:protein: TheThe CentralCentral DogmaDogma

Figure: http://en.wikipedia.org/wiki/Central_dogma_of_molecular_biology TheThe GeneticGenetic CodeCode 2

3 1 * Methionine Threonine Glutamic Acid Leucine Arginine Serine * Stop

Figures: http://en.wikipedia.org/wiki/Genetic_code MutationsMutations

„ HumanHuman genomegenome isis 99.9%99.9% identicalidentical acrossacross peoplepeople „ MutationMutation == AnyAny changechange inin thethe DNADNA sequencesequence „ MutationsMutations areare thethe sourcesource ofof differencesdifferences betweenbetween individualsindividuals MutationsMutations cancan be....be....

„ HarmfulHarmful -- DiseaseDisease causingcausing „ Sickle cell anemia „ Phenylketonuria (PKU) „ Cystic fibrosis „ HelpfulHelpful –– AdaptabilityAdaptability „ Color patterns for camouflage „ disease resistance „ NeutralNeutral –– ‘‘silentsilent’’ oror polymorphicpolymorphic „ useful as markers „ Identification, Forensics, Paternity „ Gene mapping „ Population studies SingleSingle NucleotideNucleotide PolymorphismsPolymorphisms ((SNPSNP’’ss))

„ SilentSilent –– dodo notnot alteralter aminoamino acidacid GGCCCC GGCCGG „ MissenseMissense –– substitutionsubstitution ofof anan aminoamino acidacid AAAAAA AAAACC „ NonsenseNonsense –– createscreates aa stopstop codoncodon andand causescauses prematurepremature terminationtermination ofof translationtranslation TTAATT TTAAGG „ RNARNA processingprocessing –– affectsaffects processingprocessing ofof RNARNA transcripttranscript „ Includes splice-site mutations „ RegulatoryRegulatory –– occursoccurs inin promoterpromoter oror otherother regulatoryregulatory regionregion DeletionsDeletions && InsertionsInsertions

„ DeletionsDeletions –– lossloss ofof nucleotidesnucleotides TTAAGGTT TTTT „ InsertionsInsertions –– gaingain ofof nucleotidesnucleotides AAAAAA AAGGAAAA „ DuplicationDuplication –– copycopy TTAATT TTAATTTTAATT „ Small – one to a few nucleotides „ Generally caused by mispairing in DNA replication „ Large – 20 to thousands of nucleotides „ Likely caused by unequal crossing over in replication „ Can cause frame-shift mutations „ Will change reading frame ChromosomalChromosomal RearrangementsRearrangements

InversionsInversions –– largelarge segmentsegment ofof aa chromosomechromosome

TranslocationsTranslocations –– betweenbetween nonnon--homologoushomologous chromosomechromosome BasicBasic MolecularMolecular TechniquesTechniques

„„DNADNA ExtractionExtraction „„ElectrophoresisElectrophoresis „„HybridizationHybridization „„RestrictionRestriction DigestionDigestion „„PolymerasePolymerase ChainChain ReactionReaction „„DNADNA SequencingSequencing NucleicNucleic AcidAcid ExtractionExtraction „ LyseLyse cellscells „ PurifyPurify nucleicnucleic acidacid

ElectrophoresisElectrophoresis „ SeparateSeparate nucleicnucleic acid/proteinacid/protein inin anan electricelectric fieldfield „ MigrationMigration controlledcontrolled byby sizesize andand chargecharge ofof moleculemolecule HybridizationHybridization

„ UtilizesUtilizes basebase pairingpairing ofof complementary,complementary, singlesingle-- strandedstranded nucleicnucleic acidsacids intointo aa doubledouble--strandedstranded

moleculemolecule probe CTAGG | | | | | Target nucleic acid GCAACCGATCCTTAGCAGCTT „ NucleicNucleic acidacid (DNA(DNA oror RNA)RNA) isis denatureddenatured „ SingleSingle--strandedstranded probeprobe isis addedadded „ ProbeProbe hybridizeshybridizes toto complementarycomplementary DNADNA PolymerasePolymerase ChainChain ReactionReaction

„ PPolymeraseolymerase CChainhain RReactioneaction -- PCRPCR „ Make millions of copies of target DNA from a very small amount of DNA PCRPCR Steps:Steps: „ DenaturationDenaturation –– TwoTwo DNADNA strandsstrands areare separatedseparated „ AnnealingAnnealing -- ‘‘PrimersPrimers’’ targettarget aa regionregion onon aa chromosomechromosome „ ExtensionExtension –– TargetTarget DNADNA isis copiedcopied

View web demo: http://www.sumanasinc.com/webcontent/animations/content/pcr.html LimitationsLimitations ofof PCRPCR

UnilateralUnilateral amplificationamplification lookslooks homozygoushomozygous „ ActuallyActually hemizygoushemizygous „ CausedCaused byby mutationsmutations inin thethe primerprimer sitesite oror largelarge deletionsdeletions thatthat containcontain thethe primerprimer sitesite „ SensitiveSensitive toto contaminationcontamination „ BeBe carefulcareful toto useuse properproper precautionsprecautions && carecare „ QA/QCQA/QC forfor molecularmolecular testingtesting toto bebe discusseddiscussed byby Dr.Dr. CordovadoCordovado RestrictionRestriction DigestionDigestion

Restriction enzyme recognizes DNA sequence and cleaves the DNA strand Bsu36 I recognition site:  5’…C C T N A G G…3’ 3’…G G A N T C C... 5’   Normal ATG GTG CAC CTG ACT CCT GAG GAG AAG

Hb S allele ATG GTG CAC CTG ACT CCT GTG GAG AAG RestrictionRestriction FragmentFragment LengthLength PolymorphismPolymorphism AnalysisAnalysis

Combines PCR, restriction digestion and electrophoresis

Controls Specimens +/+ +/S SS +/C CC SC SS +/S +/C SC +/S DNADNA SequencingSequencing CAGTGACAAT GTCACTGTTA CAGTGACAAT CAGTGACAAT GTCACTGTTA |||||||||| CAGTGACAAT * * ddACTGTTA * ddCTGTTA * ddTGTTA ddGTTA GTTA |||| Taq, dNTPs, ddNTPs Sequencing Primer Heat todenature Single-Stranded DNA Double-Stranded DNA Electrophoresis DNADNA CycleCycle SequencingSequencing

View web demo: http://www.dnalc.org/ddnalc/resources/shockwave/cycseq.html http://trc.ucdavis.edu/biosci10v/bis10v/media/ch11/sequencer_v2.html DNA Sequencing to identify SNP SummarySummary

„ BasicsBasics ofof inheritanceinheritance „ DNADNA toto proteinsproteins „ VariousVarious typestypes ofof mutationsmutations „ BasicBasic molecularmolecular techniquestechniques thatthat serveserve asas thethe buildingbuilding blocksblocks forfor moremore complexcomplex proceduresprocedures