Introduction to Molecular Testing

Introduction to Molecular Testing

IntroductionIntroduction toto MolecularMolecular TestingTesting Susan M. Tanksley, Ph.D. Texas Department of State Health Services Laboratory Services Section OutlineOutline BasicBasic geneticsgenetics DNA Genes & Gene Structure Mutations BasicBasic molecularmolecular techniquestechniques Nucleic Acid Extraction Electrophoresis Hybridization Restriction Digestion Polymerase Chain Reaction DNA sequencing 75 trillion ~25,000 genes 23 pairs 3.2 billion bp TheThe basicsbasics ofof inheritanceinheritance InheritInherit oneone chromosomechromosome fromfrom eacheach parentparent twotwo completecomplete setssets ofof chromosomeschromosomes chromosomechromosome == DNADNA ++ proteinsproteins DNADNA -- DeoxyribonucleicDeoxyribonucleic acidacid UniqueUnique geneticgenetic blueprintsblueprints forfor eacheach individualindividual DoubleDouble helixhelix ofof complementarycomplementary nucleotidesnucleotides NucleotideNucleotide == basebase ++ sugarsugar ++ phosphatephosphate DNADNA nucleotidesnucleotides -- adenineadenine (A),(A), cytosinecytosine (C),(C), guanineguanine (G),(G), && thyminethymine (T)(T) RNARNA –– RibonucleicRibonucleic AcidAcid RNARNA nucleotidesnucleotides –– adenineadenine (A),(A), cytosinecytosine (C),(C), guanineguanine (G)(G) && uraciluracil (U)(U) BaseBase PairingPairing RulesRules NucleotideNucleotide == basebase ++ sugarsugar ++ phosphatephosphate DNADNA AdenineAdenine pairspairs withwith ThymineThymine (A(A –– T)T) CytosineCytosine pairspairs withwith GuanineGuanine (C(C –– G)G) RNARNA AdenineAdenine pairspairs withwith UracilUracil (A(A –– U)U) CytosineCytosine pairspairs withwith GuanineGuanine (C(C –– G)G) GeneGene StructureStructure 5’ Promoter UTR Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 UTR 3’ ExonExon –– containscontains partpart ofof thethe openopen readingreading frameframe ofof thethe completecomplete proteinprotein IntronIntron –– notnot translatedtranslated intointo proteinprotein RegulatoryRegulatory RegionsRegions PromoterPromoter –– facilitatesfacilitates transcriptiontranscription ofof aa genegene UntranslatedUntranslated RegionRegion (UTR)(UTR) –– importantimportant forfor efficientefficient translationtranslation andand forfor controllingcontrolling thethe raterate ofof translationtranslation GenesGenes AverageAverage size:size: 3,0003,000 bpbp LargestLargest knownknown humanhuman gene:gene: DystrophinDystrophin 2.42.4 millionmillion bpbp EstimatedEstimated 25,00025,000 genesgenes FunctionFunction isis notnot yetyet knownknown forfor >50%>50% ofof discovereddiscovered genesgenes ~2%~2% ofof genomegenome isis codingcoding sequencesequence ββ--GlobinGlobin GeneGene E1 IVS-I E2 IVS-II E3 Hb S/C Hb E Hb D Mutations lead to clinically significant hemoglobinopathies sickle cell anemia sickle beta-thalassemia homozygous beta0-thalassemia 1,600 base pairs, 3 exons, 146 amino acids > 700 known mutations PhenylalaninePhenylalanine HydroxylaseHydroxylase 1 2 3 4 5 6 7 8 9 10 11 12 13 99%99% ofof mutationsmutations causingcausing PKUPKU occuroccur inin PhenylalaninePhenylalanine HydroxylaseHydroxylase (PAH)(PAH) ~90,000~90,000 bpbp,, 1313 exons,exons, 452452 aminoamino acidsacids >> 500500 reportedreported mutationsmutations CysticCystic FibrosisFibrosis TransmembraneTransmembrane ConductanceConductance RegulatorRegulator MutationsMutations inin CFTRCFTR maymay causecause CysticCystic FibrosisFibrosis ~250,000~250,000 basebase pairspairs 14801480 aminoamino acidsacids 2727 exonsexons >1600>1600 knownknown mutationsmutations FromFrom aa genegene toto aa protein:protein: TheThe CentralCentral DogmaDogma Figure: http://en.wikipedia.org/wiki/Central_dogma_of_molecular_biology TheThe GeneticGenetic CodeCode 2 3 1 * Methionine Threonine Glutamic Acid Leucine Arginine Serine * Stop Figures: http://en.wikipedia.org/wiki/Genetic_code MutationsMutations HumanHuman genomegenome isis 99.9%99.9% identicalidentical acrossacross peoplepeople MutationMutation == AnyAny changechange inin thethe DNADNA sequencesequence MutationsMutations areare thethe sourcesource ofof differencesdifferences betweenbetween individualsindividuals MutationsMutations cancan be....be.... HarmfulHarmful -- DiseaseDisease causingcausing Sickle cell anemia Phenylketonuria (PKU) Cystic fibrosis HelpfulHelpful –– AdaptabilityAdaptability Color patterns for camouflage disease resistance NeutralNeutral –– ‘‘silentsilent’’ oror polymorphicpolymorphic useful as markers Identification, Forensics, Paternity Gene mapping Population studies SingleSingle NucleotideNucleotide PolymorphismsPolymorphisms ((SNPSNP’’ss)) SilentSilent –– dodo notnot alteralter aminoamino acidacid GGCCCC GGCCGG MissenseMissense –– substitutionsubstitution ofof anan aminoamino acidacid AAAAAA AAAACC NonsenseNonsense –– createscreates aa stopstop codoncodon andand causescauses prematurepremature terminationtermination ofof translationtranslation TTAATT TTAAGG RNARNA processingprocessing –– affectsaffects processingprocessing ofof RNARNA transcripttranscript Includes splice-site mutations RegulatoryRegulatory –– occursoccurs inin promoterpromoter oror otherother regulatoryregulatory regionregion DeletionsDeletions && InsertionsInsertions DeletionsDeletions –– lossloss ofof nucleotidesnucleotides TTAAGGTT TTTT InsertionsInsertions –– gaingain ofof nucleotidesnucleotides AAAAAA AAGGAAAA DuplicationDuplication –– copycopy TTAATT TTAATTTTAATT Small – one to a few nucleotides Generally caused by mispairing in DNA replication Large – 20 to thousands of nucleotides Likely caused by unequal crossing over in replication Can cause frame-shift mutations Will change reading frame ChromosomalChromosomal RearrangementsRearrangements InversionsInversions –– largelarge segmentsegment ofof aa chromosomechromosome TranslocationsTranslocations –– betweenbetween nonnon--homologoushomologous chromosomechromosome BasicBasic MolecularMolecular TechniquesTechniques DNADNA ExtractionExtraction ElectrophoresisElectrophoresis HybridizationHybridization RestrictionRestriction DigestionDigestion PolymerasePolymerase ChainChain ReactionReaction DNADNA SequencingSequencing NucleicNucleic AcidAcid ExtractionExtraction LyseLyse cellscells PurifyPurify nucleicnucleic acidacid ElectrophoresisElectrophoresis SeparateSeparate nucleicnucleic acid/proteinacid/protein inin anan electricelectric fieldfield MigrationMigration controlledcontrolled byby sizesize andand chargecharge ofof moleculemolecule HybridizationHybridization UtilizesUtilizes basebase pairingpairing ofof complementary,complementary, singlesingle-- strandedstranded nucleicnucleic acidsacids intointo aa doubledouble--strandedstranded moleculemolecule probe CTAGG | | | | | Target nucleic acid GCAACCGATCCTTAGCAGCTT NucleicNucleic acidacid (DNA(DNA oror RNA)RNA) isis denatureddenatured SingleSingle--strandedstranded probeprobe isis addedadded ProbeProbe hybridizeshybridizes toto complementarycomplementary DNADNA PolymerasePolymerase ChainChain ReactionReaction PPolymeraseolymerase CChainhain RReactioneaction -- PCRPCR Make millions of copies of target DNA from a very small amount of DNA PCRPCR Steps:Steps: DenaturationDenaturation –– TwoTwo DNADNA strandsstrands areare separatedseparated AnnealingAnnealing -- ‘‘PrimersPrimers’’ targettarget aa regionregion onon aa chromosomechromosome ExtensionExtension –– TargetTarget DNADNA isis copiedcopied View web demo: http://www.sumanasinc.com/webcontent/animations/content/pcr.html LimitationsLimitations ofof PCRPCR UnilateralUnilateral amplificationamplification lookslooks homozygoushomozygous ActuallyActually hemizygoushemizygous CausedCaused byby mutationsmutations inin thethe primerprimer sitesite oror largelarge deletionsdeletions thatthat containcontain thethe primerprimer sitesite SensitiveSensitive toto contaminationcontamination BeBe carefulcareful toto useuse properproper precautionsprecautions && carecare QA/QCQA/QC forfor molecularmolecular testingtesting toto bebe discusseddiscussed byby Dr.Dr. CordovadoCordovado RestrictionRestriction DigestionDigestion Restriction enzyme recognizes DNA sequence and cleaves the DNA strand Bsu36 I recognition site: 5’…C C T N A G G…3’ 3’…G G A N T C C... 5’ Normal ATG GTG CAC CTG ACT CCT GAG GAG AAG Hb S allele ATG GTG CAC CTG ACT CCT GTG GAG AAG RestrictionRestriction FragmentFragment LengthLength PolymorphismPolymorphism AnalysisAnalysis Combines PCR, restriction digestion and electrophoresis Controls Specimens +/+ +/S SS +/C CC SC SS +/S +/C SC +/S CAGTGACAAT |||||||||| Double-Stranded DNA GTCACTGTTA Heat to denature CAGTGACAAT Single-Stranded DNA GTCACTGTTA Sequencing Primer CAGTGACAAT |||| GTTA Taq, dNTPs, ddNTPs CAGTGACAAT DNA Sequencing DNA Sequencing *ddGTTA *ddTGTTA *ddCTGTTA Electrophoresis *ddACTGTTA DNADNA CycleCycle SequencingSequencing View web demo: http://www.dnalc.org/ddnalc/resources/shockwave/cycseq.html http://trc.ucdavis.edu/biosci10v/bis10v/media/ch11/sequencer_v2.html DNA Sequencing to identify SNP SummarySummary BasicsBasics ofof inheritanceinheritance DNADNA toto proteinsproteins VariousVarious typestypes ofof mutationsmutations BasicBasic molecularmolecular techniquestechniques thatthat serveserve asas thethe buildingbuilding blocksblocks forfor moremore complexcomplex proceduresprocedures.

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    28 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us