Mirna Detection Using a Rolling Circle Amplification and RNA

biosensors

Article MiRNA Detection Using a Rolling Circle Ampliﬁcation and RNA-Cutting Allosteric Deoxyribozyme Dual Signal Ampliﬁcation Strategy

Chenxin Fang, Ping Ouyang, Yuxing Yang, Yang Qing, Jialun Han, Wenyan Shang, Yubing Chen and Jie Du *

State Key Laboratory of Marine Resource Utilization in South China Sea, College of Materials Science and Engineering, Hainan University, Haikou 570228, China; [email protected] (C.F.); [email protected] (P.O.); [email protected] (Y.Y.); [email protected] (Y.Q.); [email protected] (J.H.); [email protected] (W.S.); [email protected] (Y.C.) * Correspondence: [email protected]

Abstract: A microRNA (miRNA) detection platform composed of a rolling circle amplification (RCA) system and an allosteric deoxyribozyme system is proposed, which can detect miRNA-21 rapidly and efficiently. Padlock probe hybridization with the target miRNA is achieved through complementary base pairing and the padlock probe forms a closed circular template under the action of ligase; this circular template results in RCA. In the presence of DNA polymerase, RCA proceeds and a long chain with numerous repeating units is formed. In the presence of single-stranded DNA (H1 and H2), multi-component nucleic acid enzymes (MNAzymes) are formed that have the ability to cleave substrates. Finally, substrates containing fluorescent and quenching groups and magnesium ions are added to the system to activate the MNAzyme and the substrate cleavage reaction, thus achieving fluorescence intensity amplification. The RCA–MNAzyme system has dual signal amplification and presents a sensing platform that demonstrates broad prospects in the analysis and detection of

Citation: Fang, C.; Ouyang, P.; Yang, nucleic acids. Y.; Qing, Y.; Han, J.; Shang, W.; Chen, Y.; Du, J. MiRNA Detection Using a Keywords: signal amplification; deoxyribozyme; rolling-circle amplification; miRNA detection Rolling Circle Amplification and RNA-Cutting Allosteric Deoxyribozyme Dual Signal Amplification Strategy. Biosensors 1. Introduction 2021 11 , , 222. https://doi.org/ The term “nucleic acids” is a general one covering both deoxyribonucleic acid (DNA) 10.3390/bios11070222 and ribonucleic acid (RNA). Nucleic acids are biological macromolecular compounds formed by the polymerization of many nucleotide monomers and form the building blocks Received: 21 May 2021 of all known forms of life. DNA plays an extremely important role in carrying genetic Accepted: 2 July 2021 Published: 4 July 2021 information, genetic mutations of organisms and the biosynthesis of proteins. RNA plays an important role in protein synthesis. MicroRNA (miRNA) is a class of non-coding, single-

Publisher’s Note: MDPI stays neutral stranded RNA with a length of approximately 22 nucleotides encoded for by endogenous with regard to jurisdictional claims in genes. miRNAs are involved in post-transcriptional gene expression regulation in animals published maps and institutional affil- and plants [1]. In terms of biological mechanisms, miRNA is actively secreted by tumor iations. cells and can act as a tumor marker. As tumor cells form and decay, miRNA expression varies [2]. Therefore, the expression level of each miRNA represents information about human health or disease at a certain time. Numerous miRNAs have been linked to various diseases in humans including cancer [3], human immunodeficiency viruses [4], diabetes [5] and Alzheimer’s disease [6]. Therefore, disease prediction can be achieved via Copyright: © 2021 by the authors. Licensee MDPI, Basel, Switzerland. miRNA detection. This article is an open access article There are many different miRNAs in the human body however, they are present in distributed under the terms and extremely low levels and accurate detection is challenging. Numerous miRNA detection conditions of the Creative Commons methods have been proposed and traditional methods include Northern blotting [7], mi- Attribution (CC BY) license (https:// croarrays [8] and real-time, fluorescence-based quantitative polymerase chain reaction creativecommons.org/licenses/by/ (RT-PCR) [9]. Although Northern blotting requires relatively simple equipment, the sensi- 4.0/). tivity and specificity is inadequate. Microarray-based methods usually require separation,

Biosensors 2021, 11, 222. https://doi.org/10.3390/bios11070222 https://www.mdpi.com/journal/biosensors Biosensors 2021, 11, 222 2 of 13

labeling and purification of samples prior to hybridization; therefore, the process is com- plicated and sample purification costs are high. The sensitivity and specificity of RT-PCR methods have been improved and operation is relatively simple; however, the reaction requires precise temperature control and expensive equipment. In recent years, increasing numbers of miRNA sensor systems have been reported. These new strategies have considerably improved the sensitivity and specificity of miRNA detection. Examples of such new strategies include colorimetric methods [10–12], electrochemical detection [13–15] and fluorescence-based detection. The advantages of fluorescence detection methods include high detection sensitivity, reduced influence of temperature and improved selectivity. Therefore, fluorescence detection is widely used for the detection of miRNA. The detection of miRNA is challenging as it is present in low concentrations; therefore, signal amplification strategies are required. Numerous signal amplification strategies have been introduced for miRNA detection such as hybridization chain reaction (HCR) [16,17], catalytic hairpin assembly (CHA) [18,19], strand displacement amplification reaction (SDA) [20,21] and rolling circle amplification reaction (RCA). The method reported herein utilizes RCA. RCA is an isothermal signal amplification technique. Generally, the reaction is initiated via hybridization of the primer and the padlock probe. Following hybridization, a ligase is added into the system to close the padlock probe into a loop and form a circular template. This short-stranded nucleic acid, which is complementary to the probe, serves as a primer to amplify the DNA reaction. After the polymerase and 20-deoxynucleotide-50-triphosphate (dNTPs) are added, the short-stranded nucleic acid is continuously amplified and the formation of a long, single-stranded DNA with repeat sequences is achieved. Due to the formation of several repeating units, RCA achieves the signal amplification effect [22]. Sig- nal amplification using RCA can, in theory, amplify the signal 109 times [23]. Zhuang et al. pioneered the combined use of RCA and CHA to form deoxyribozymes for the detection of miRNAs [24]. Deoxyribozymes are single-stranded DNA fragments with catalytic functions synthesized via in vitro molecular evolution. Joyce et al. reported that a synthetic deoxyribonu- cleotide catalyzed the cleavage of specific RNA sequences [25]. Compared with traditional RNases, deoxyribozymes have many advantages: (1) Traditional RNases are susceptible to temperature and lose their activity at high or low temperatures, but deoxyribozymes are not affected by temperature. (2) Deoxyribozyme synthesis is relatively simple and low cost. (3) The DNAzyme sensing system has good selectivity and can independently design sequences to catalyze specific units. Therefore, deoxyribozymes offer promise in biosensing applications for the detection of DNA [26], RNA [27] and proteins [28]. Usually, RNA-cutting DNAzymes include a catalytic core region and two substrate binding arms that bind to the substrate through complementary base pairing and in the presence of magnesium ions (Mg2+) substrate cleavage occurs. Mokany et al. modified the structure of a previously reported nucleic acid-cleaving DNAzyme to divide the original catalytic core into two parts and added an effector recognition arm. DNAzymes of this structure are called multi-component nucleic acid enzymes (MNAzymes) [29]. The addition of an effector recognition arm results in improved combination of the catalytic core area and effectors, ultimately leading to improved substrate cleavage efficiency. Such MNAzymes have been utilized in biosensor design and as nanomachine components [30–32]. In this study, a strategy combining RCA with MNAzymes is presented for the detection of miRNA-21 using dual signal amplification. The design strategy is as follows: miRNA-21 drives the RCA reaction and, once complete, this promotes the formation of MNAzymes. The subsequent addition of Mg2+ results in cleavage of the substrate and as the two sides of the substrate contain fluorescent and quenching groups, the fluorescence intensity increases following substrate cleavage. Biosensors 2021, 11, 222 3 of 13

2. Materials and Methods 2.1. Reagents and Materials 2.1.1. Materials Tris buffer solution (1 mol L−1, pH 8.0), dNTP mixture (25 mmol L−1) and RNase inhibitor were purchased from Solarbio Life Sciences (China). Sodium chloride and magnesium chloride were purchased from Macklin Biochemical Co., Ltd (Shanghai, China). The microRNA, padlock probe and three oligonucleotides (Table1) were synthesized and HPLC-puriﬁed by Sanggon Biotech Co., Ltd. (Shanghai, China). Ultrapure water was purchased Dongsheng Biotech Co., Ltd. (Guangzhou, China). T4 DNA ligase, phi29 polymerase, exonuclease I (EXO I) and bovine serum albumin (BSA) were purchased from New England Biolabs (Ipswich, MA, USA).

Table 1. Sequences of the oligonucleotides used in this study.

Name Sequence(50-30) pCTGATAAGCTACGAATGGCGTTATGCCTCAATTAGAAGTC Padlock probe TTATGCGAAAGCGTGACGGCTAATGGACTGCAGTCAACATCAGT MiR-21 UAG CUU AUC AGA CUG AUG UUG A MiR-16 UAG CAG CAC GUA AAU AUU GGC G Mut-miR-21 UAG CUU AAC AGA CUG AUG UUG A H1 TC AAT TAG A AAG CAC CCA TGT TAC TCT H2 GAT ATC AGC GAT CTT AG TCT TATG Substrate BHQ-1-AGA GTA TrAG GAT ATC-FAM

2.1.2. Instrumentation Fluorescence measurements were performed using a Model RF-6000 fluorescence spectrophotometer (Shimadzu, Japan). A 5’6-fluorescein (FAM) fluorescence dye was used with excitation and emission wavelengths of 494 nm and 520 nm, respectively.

2.2. Experimental Procedures 2.2.1. Circular Probe Fabrication A 2.5 µL padlock probe (20 nmol L−1) was hybridized with miRNA (an appropriate amount, the dosage of miRNA-21 in the optimized test conditions was 50 pM)by heating at 95 ◦C for 5 min and then slowly cooling to room temperature for more than 15 min. Next, 1 µL of T4 DNA ligase buffer (10×), 200 U of T4 DNA ligase and 20 U of RNase inhibitor were added to the hybridization system and H2O was added to a ﬁnal volume of 10 µL. The system was held at 37 ◦C for 2 h and then the reaction was terminated using a temperature of 65 ◦C for 10 min. Finally, 1 µL of EXO I was added to the solution and the system was held at 37 ◦C for 1 h, then the reaction was terminated using a temperature of 80 ◦C for 15 min. Formation of the closed circular probe was then achieved.

2.2.2. RCA Reaction The RCA reaction system consisted of 11 µL of circular probe (using miRNA as primer to initiate rolling circle ampliﬁcation reaction and the dosage of miRNA-21 in the optimized test conditions was 50 pM), 2.5 µL of 10× phi29 DNA polymerase buffer, 12.5 U of phi29 −1 DNA polymerase, 5 µL of dNTPs (25 mmol L ) and 1 µL of BSA, H2O was added to a ﬁnal volume of 25 µL. The RCA reaction was conducted at 30 ◦C for 4 h. Finally, the reaction was terminated using a temperature of 65 ◦C for 10 min.

2.2.3. DNAzyme and Cleavage Reaction Two single-stranded oligonucleotides (2.5 µL of H1 and 2.5 µL of H2) and NaCl (60 nmol L−1) were added to the RCA reaction system. The reaction was performed at 95 °C Biosensors 2021, 11, 222 for 5 min and then at room temperature for 2 h. 4 of 13 Next, the final single-stranded oligonucleotide substrate (2.5 µL) and 15 µL of MgCl2 were added to the solution. Then, the cleavage reaction was performed at room temperature for 1.5 h. The product was stored in a refrigerator at 4 °C. Next, the final single-stranded oligonucleotide substrate (2.5 µL) and 15 µL of MgCl2 were added to3. the Results solution. and Then, Discussion the cleavage reaction was performed at room temperature for 1.5 h. The product was stored in a refrigerator at 4 ◦C. 3.1. Principle of the microRNA Detection Method 3. Results and DiscussionFigure 1 illustrates the design strategy for microRNA detection using Mg2+-depend- 3.1. Principle ofent the DNAzyme microRNA Detectionand RCA. Method Firstly, the target microRNA hybridizes with the padlock probe Figure1 illustratesvia complementary the design strategybase pairing for microRNA to achieve detection a closed using loop Mgin the2+-dependent presence of DNA ligase. DNAzyme andSecondly, RCA. Firstly, the RCA the targetreaction microRNA proceeds hybridizes when DNA with polymerase the padlock dNTPs probe are via added into the complementaryDNA base ligase pairing system to achieve to form a closedlong-stranded loop in the DNA presence chains of with DNA numerous ligase. Sec- repeating units. ondly, the RCAThirdly, reaction when proceeds single when-stranded DNA DNA polymerase (H1 and dNTPs H2) is are added added to intothe polymeric the DNA product, hy- ligase system tobridization form long-stranded with long-stranded DNA chains DNA with chains numerous forms the repeating DNAzyme. units. Following Thirdly, the addition when single-strandedof Mg2+ DNAand substrate (H1 and into H2) isthe added DNAzyme to the polymericsystem, a catalytic product, core hybridization is formed and the sub- with long-strandedstrateDNA cleavage chains reaction forms the begins. DNAzyme. As the Following substrate the contains addition fluorophore of Mg2+ and and quenching substrate intogroups, the DNAzyme the fluorescence system, a catalytic intensity core substantially is formed and increases the substrate following cleavage cleavage. The sub- reaction begins.strat Ase thesimultaneously substrate contains removes fluorophore the RCA andproducts quenching and drives groups, the the next fluores- cleavage reaction. cence intensityWhen substantially the target increases miRNA followingis mismatched, cleavage. the Theproperties substrate of T4 simultaneously DNA ligase mean that for- removes the RCAmation products of a andclosed drives loop the is next challenging: cleavage reaction. two adjacent When and the targetcompletely miRNA complementary is mismatched,DNA/RNA the properties strands of T4must DNA be ligasecatalyzed mean by thatDNA formation ligase to ofform a closed a phosphodiester loop is bond. If challenging: twothe adjacentclosed loop and is completely absent, the complementary nucleic acid amplification DNA/RNA reaction strands mustusing bea circular DNA catalyzed by DNAtemplate ligase does to formnot progress a phosphodiester and formation bond. of Ifthe the DNAzyme closed loop does is absent, not occur. the Following the nucleic acid amplificationaddition of Mg reaction2+, the usingnucleic a circularacid cleavage DNA templatereaction does not progressoccur and and the fluorescence formation of theintensity DNAzyme remains does relatively not occur. low. Following the addition of Mg2+, the nucleic acid cleavage reaction does not occur and the fluorescence intensity remains relatively low.

Figure 1. Schematic illustration of the ﬂuorescence assay for the detection of miR-21 using RCA Figure 1. Schematic illustration of the fluorescence assay for the detection of miR-21 using RCA and DNAzyme. and DNAzyme.

3.2. Method Feasibility3.2. Method Feasibility During the ﬁrstDuring stage of the the first reaction, stage theof the concentrations reaction, the of concentrations microRNA and of the microRNA reactants and the reac- involved in thetants ligation involved reaction in the areligation different. reaction The are more different. reactants The more present, reactants the more present, the more generation ofgeneration circular templates of circular increases. templates In theincreases. second In stage, the second an increased stage, numberan increased of number of cyclic templates are involved in the polymerization reaction generating more long chains. In the third stage, the longer the chains present, the easier DNAzyme formation is; therefore, the substrate cleavage reaction is more likely to occur and an increase in ﬂuorescence intensity follows. Biosensors 2021, 11, x FOR PEER REVIEW 5 of 14

cyclic templates are involved in the polymerization reaction generating more long chains. Biosensors 2021, 11, 222 In the third stage, the longer the chains present, the easier DNAzyme formation is; there-5 of 13 fore, the substrate cleavage reaction is more likely to occur and an increase in fluorescence intensity follows. As theAs reaction the reaction in this in study this study results results in increased in increased fluorescence fluorescence intensity, intensity, a feasibility a feasibility analysisanalysis was conducted was conducted based basedon fluorescence on fluorescence intensity intensity changes. changes. Figure 2 Figure shows2 theshows flu- the orescencefluorescence spectra spectrain the absence in the absence of sensing of sensingsystem systemcomponents. components. It can be It seen can from be seen the from figurethe that, figure except that, for except the control for the group, control at group,520 nm at the 520 fluorescence nm the fluorescence intensity of intensity any com- of any ponentcomponent is relatively is relatively low. This low. confirms This confirms the feasibility the feasibility of the proposed of the proposed reaction reactionsystem. system.

Figure 2. Fluorescence spectra in the absence of sensing system components: (A) without miRNA, Figure(B 2.) without Fluorescence padlock spectra probes, in (theC) withoutabsence dNTPs,of sensing (D )system without components: H1 and H2, ( (AE) withoutwithout MgmiRNA,2+,(F) with- (B) withoutout polymerase, padlock probes, (G) without (C) without ligase dNTPs, and (H )(D control) without sample H1 and (experimental H2, (E) without system Mg in2+, which (F) all the withoutabove polymerase, components (G) exist). without ligase and (H) control sample (experimental system in which all the above components exist). 3.3. Experimental Parameter Optimization 3.3. ExperimentalThe subsequent Parameter optimization Optimizationexperiment was carried out by changing the concentra- Thetion subsequent of one substance optimization (the concentration experiment ofwas the carried other substancesout by changing remains the unchanged)concentra- on tion theof one basis substance of Section (the 2.2 concentration. of the other substances remains unchanged) on the basis of section 2.2. 3.3.1. Padlock Probe 3.3.1. PadlockThe padlockProbe probe hybridizes with the target microRNA and becomes an amplifica- tionThe template.padlock probe Therefore, hybridizes the concentration with the target of the microRNA padlock probeand becomes is an important an amplifica- parameter tion template.that influences Therefore, fluorescence the concentration intensity. As of shown the padlock in Figure probe3A, is the an fluorescence important parame- intensity in- −1 −1 −1 ter thatcreases influences from 0 fluorescence nmol L to 20intensity. nmol L As andshown is maximal in Figure at 3A, a concentration the fluorescence of 20 inten- nmol L , sity increasesall other from concentrations 0 nmol L−1 to result 20 nmol in lower L−1 and fluorescence is maximal intensityat a concentration values. Figureof 20 nmol3B illus- −1 trates the rate of fluorescence intensity change with that observed at a concentration L , all other concentrations−1 result in lower fluorescence intensity values. Figure 3B illus- tratesof the20 rate nmol of Lfluorescencebeing the intensity highest change value (1409.474with that observed a.u.). Therefore, at a concentration a concentration of 20 of 20 nmol L−1 was selected for the padlock probe. nmol L−1 being the highest value (1409.474 a.u.). Therefore, a concentration of 20 nmol L−1 was selected3.3.2. DNA for Ligasethe padlock probe. The padlock probe hybridizes with the target RNA via base pairing and the probe then forms a closed loop within the presence of T4 DNA ligase. The ligase catalyzes the formation of phosphodiester bonds between the adjacent 50-phosphate end and the 30-hydroxyl end of double-stranded DNA or RNA as well as catalyzing the reaction between blunt and sticky ends. The ligase dosage has a significant influence on fluorescence intensity. The fluorescence spectra in Figure4A shows a gradual increase in fluorescence intensity up to a maximum (1213.365 a.u.) dosage of 200 U followed by a reduction in intensity at concentration higher than 200 U. Figure4B also indicates the same trend, clearly indicating a dosage of 200 U is optimal.

Biosensors 2021, 11, x FOR PEER REVIEW 6 of 14

Biosensors 2021, 11, 222 6 of 13 Biosensors 2021, 11, x FOR PEER REVIEW 6 of 14

Figure 3. (A) Fluorescence spectra and (B) Fluorescence intensity ratio (△F/F0) at different concentrations of padlock probe.

3.3.2. DNA Ligase The padlock probe hybridizes with the target RNA via base pairing and the probe then forms a closed loop within the presence of T4 DNA ligase. The ligase catalyzes the formation of phosphodiester bonds between the adjacent 5'-phosphate end and the 3'-hydroxyl end of double-stranded DNA or RNA as well as catalyzing the reaction between blunt and sticky ends. The ligase dosage has a significant influence on fluorescence intensity. The fluorescence spectra in Figure 4A shows a gradual increase in fluorescence intensity up to a maximum (1213.365 a.u.) dosage of 200 U followed by a reduction in intensity at concentration higher than 200 U. Figure 4B also indicates the same trend, clearly

FigureFigure 3. 3.( (AA)) FluorescenceFluorescence spectra spectraindicating and and ( B(B )a) Fluorescence dosageFluorescence of 200 intensity intensity U is optimal. ratio ratio (4 (△F/F F/F00)) at different concentrationsconcentrations ofof padlockpadlock probe. probe.

Figure 4. (A) Fluorescence spectra and (B) Fluorescence intensity ratio (4F/F0) in the presence of different ligase dosages. Figure 4. (A) Fluorescence spectra and (B) Fluorescence intensity ratio (△F/F0) in the presence of different ligase dosages.

3.3.3.3.3.3. DNA DNA Polymerase Polymerase The polymerase has unique chain replacement and continuous synthesis properties The polymerase has unique chain replacement and continuous synthesis properties and is able to continuously synthesize DNA fragments as long as 70 kb. In the RCA and is able to continuously synthesize DNA fragments as long as 70 kb. In the RCA reac- reaction, the phi29 DNA polymerase plays a key role. In the presence of dNTPs and phi29 tion, the phi29 DNA polymerase plays a key role. In the presence of dNTPs and phi29 polymerase buffer, the closed loop synthesizes long-stranded DNA numerous repeating polymerase buffer, the closed loop synthesizes long-stranded DNA numerous repeating units. The polymerase is active in mild conditions; thus, the ampliﬁcation of short-stranded DNA to long-stranded DNA is possible at room temperature. Figure5 shows the relationship between ﬂuorescence intensity and polymerase dosage. Figure5A indicates an initially increasing trend followed by a decrease. Among the

dosages analyzed, 12.5 U resulted in the highest ﬂuorescent intensity (1204.544 a.u.) for

the polymerization system. Figure5B illustrates the relationship more clearly. At dosages Figure 4. (A) Fluorescence betweenspectra and 0and (B) F 10luorescence U, the ﬂuorescence intensity ratio intensity (△F/F0 ratio) in the gradually presence increasesof different and ligase between dosages. 12.5 U and 15 U, the intensity clearly diminishes. It is apparent that a dosage of 12.5 U is optimal. 3.3.3. DNA Polymerase The polymerase has unique chain replacement and continuous synthesis properties and is able to continuously synthesize DNA fragments as long as 70 kb. In the RCA reaction, the phi29 DNA polymerase plays a key role. In the presence of dNTPs and phi29 polymerase buffer, the closed loop synthesizes long-stranded DNA numerous repeating

Biosensors 2021, 11, x FOR PEER REVIEW 7 of 14

units. The polymerase is active in mild conditions; thus, the amplification of short- stranded DNA to long-stranded DNA is possible at room temperature. Figure 5 shows the relationship between fluorescence intensity and polymerase dosage. Figure 5A indicates an initially increasing trend followed by a decrease. Among the dosages analyzed, 12.5 U resulted in the highest fluorescent intensity (1204.544 a.u.) for the polymerization system. Figure 5B illustrates the relationship more clearly. At dosages between 0 and 10 U, the fluorescence intensity ratio gradually increases and between 12.5 Biosensors 2021, 11, 222 U and 15 U, the intensity clearly diminishes. It is apparent that a dosage of 12.5 U7 is of opti- 13 mal.

Figure 5. (A) Fluorescence spectra in the presence of different polymerase dosages. (B) The relationship between fluorescence Figure 5. (A) Fluorescence spectra in the presence of different polymerase dosages. (B) The relationship between intensity ratio (4F/F0) and polymerase dosage. fluorescence intensity ratio (△F/F0) and polymerase dosage. 3.3.4. dNTPs Concentration 3.3.4. dNTPs Concentration The dNTP mixture contains four deoxynucleotides (dATP, dCTP, dGTP and dTTP), The dNTP mixture contains four deoxynucleotides (dATP, dCTP, dGTP and dTTP), with each nucleotide able to assemble into long chains with a specific sequence during DNAwith polymerization. each nucleotide Inable the to presence assemble of into DNA long polymerase, chains with primer a specific DNA, sequence polymerase during bufferDNA and polymerization. dNTPs, the reaction In the system presence begins of DNA at an polymerase, increased pace primer and eventually DNA, polymerase forms a long-strandedbuffer and dNTPs, chain. the Thus, reaction demonstrating system begins that at thean increased dNTPs influence pace and the eventuall outcomey forms of thea reaction.long-stranded chain. Thus, demonstrating that the dNTPs influence the outcome of the reaction.Figure 6 illustrates the fluorescence intensity with respect to dNTP concentration. The fluorescenceFigure intensity 6 illustrates at a concentrationthe fluorescence of 0.05intensity mmol with L−1 correspondsrespect to dNTP to the concentration. maximum valueThe (1148.926fluorescence a.u.) intensity and the at fluorescence a concentration intensity of 0.05 of themmol other L−1 concentrationscorresponds to is the lower maxi- thanmum that value for 0.05 (1148.926 mmol L −a.u.)1. This and relationship the fluorescence is more intensity clearly illustrated of the other in Figure concentrations6B where is thelower fluorescence than that intensity for 0.05 ratiommol at L an−1. This emission relationship wavelength is more of 520 clearly nm inillustrated the presence in Figure of different6(B) where dNTPs the concentrations fluorescence intensity is shown. ratio Hence, at an a concentrationemission wavelength of 0.05 mmolof 520 L nm−1 wasin the Biosensors 2021, 11, x FOR PEER REVIEW 8 of 14 selectedpresence as theof different optimal dNTPs concentration. concentrations is shown. Hence, a concentration of 0.05 mmol L−1 was selected as the optimal concentration.

FigureFigure 6. 6.( A(A)) Fluorescence Fluorescence spectra spectra in in the the presence presence of of different different concentrations concentrations of of dNTPs. dNTPs. ( B(B)) Fluorescence Fluorescence intensity intensity ratio ratio 4 ((△F/FF/F0)) at at an an emission emission wavelength wavelength of of 520nm 520 nm in in the the presence presence of of different different concentrations concentrations of of dNTPs. dNTPs.

3.3.5. H1 and H2 Concentration H1 and H2 are single-stranded DNA fragments composed of different sequences. The base sequences of H1 and H2 are composed of three parts: the substrate binding region, the catalytic core region and the assembly promoting region. In this study, following completion of the RCA reaction, H1 and H2 were added. The two single-stranded assembly-promoting regions (H1 and H2) and the amplified long single-strand hybridized to successfully form a deoxyribozyme with a catalytic core region. Once the addition of the substrate occurs, the substrate binding area and the substrate hybridize and the substrate cleavage reaction occurs under the action of Mg2+, thereby separating the fluorescent group from the quenching group and resulting in the generation of a fluorescent signal. It follows that the concentration of H1 and H2 has a substantial influence on fluorescence intensity. Figure 7A shows the fluorescence spectra obtained at different H1 and H2 concentrations and Figure 7B shows the fluorescence intensity ratio of the system with different H1 and H2 concentrations at an emission wavelength of 520 nm. It is clear that the maximum fluorescence intensity (1216.699 a.u.) is achieved at H1 and H2 concentrations of 8 nmol L−1; therefore, a concentration of 8 nmol L−1 was used for H1 and H2 in subsequent experiments.

Biosensors 2021, 11, 222 8 of 13

3.3.5. H1 and H2 Concentration H1 and H2 are single-stranded DNA fragments composed of different sequences. The base sequences of H1 and H2 are composed of three parts: the substrate binding region, the catalytic core region and the assembly promoting region. In this study, following completion of the RCA reaction, H1 and H2 were added. The two single-stranded assembly-promoting regions (H1 and H2) and the amplified long single-strand hybridized to successfully form a deoxyribozyme with a catalytic core region. Once the addition of the substrate occurs, the substrate binding area and the substrate hybridize and the substrate cleavage reaction occurs under the action of Mg2+, thereby separating the fluorescent group from the quenching group and resulting in the generation of a fluorescent signal. It follows that the concentration of H1 and H2 has a substantial influence on fluorescence intensity. Figure7A shows the fluorescence spectra obtained at different H1 and H2 concentrations and Figure7B shows the fluorescence intensity ratio of the system with different H1 and H2 concentrations at an emission wavelength of 520 nm. It is clear that the maximum fluorescence intensity (1216.699 a.u.) is achieved at H1 and H2 concentrations of 8 nmol L−1; therefore, a concentration of 8 nmol L−1 was used for H1 and H2 in subse- Biosensors 2021, 11, x FOR PEER REVIEW 9 of 14 quent experiments.

Figure 7. (A) Fluorescence spectra in the presence of different concentrations of H1 and H2. (B) Fluorescence intensity ratio Figure 7. (A) Fluorescence spectra in the presence of different concentrations of H1 and H2. (B) Fluorescence in- (4F/F ) at an emission wavelength of 520 nm in the presence of different concentrations of H1 and H2. tensity0 ratio (△F/F0) at an emission wavelength of 520nm in the presence of different concentrations of H1 and H2.

2+ 3.3.6.3.3.6. Mg Mg2+ ConcentrationConcentration 2+ WhenWhen present present at physiological at physiological concentrations concentrations within cells, within Mg cells,is an important Mg2+ is an factor im- inportant maintaining factor genome in maintaining stability. It genome stabilizes stability. the structure It stabilizes of DNA and the chromatin structure and of isDNA an essentialand chromatin cofactor forand the is enzymatic an essential system cofactor supporting for the DNA enzymatic synthesis system and decomposition. supporting ItDNA is also synthesis used as a cofactorand decomposition. during nucleoside It is excisionalso used repair, as a basecofactor excision during repair nucleoside and mis- 2+ matchexcision repair. repair, In this base study, excision Mg promoted repair and the mismatch assembly of repair. DNAzyme In this and study, drove Mg substrate2+ pro- cleavagemoted the reactions. assembly When of theDNAzyme cleavage and reaction drove was substrate complete, cleavage the originally reactions. quenched When fluorophorethe cleavage regained reaction its fluorescentwas complete, properties; the originally hence, it qu is anenched important fluorophore component regain in theed processits fluorescent of fluorescence properties; intensity hence, changes it is an within important this reaction component system. in the process of flu- 2+ orescenceFigure8 intensity showed thechanges relationship within between this reaction fluorescence system. intensity and Mg concentration. In Figure8A, the fluorescence intensity reached a maximum (1179.511 a.u.)2+ cor- Figure 8 showed the relationship between−1 fluorescence intensity and Mg con- respondingcentration. to In a Figure concentration 8A, the of fluorescence0.12 mmol L intensity. Figure reache8B showedd a maximum a scatter plot (1179.511 that illustrates the same trend more distinctly. At concentrations between 0 and 0.12 mmol L−1, a.u.) corresponding to a concentration of 0.12 mmol L−1. Figure 8B showed a scatter the rate of changed gradually increases and then gradually decreased at concentrations plot that illustrates the same trend more distinctly. At concentrations between 0 higher than 0.12 mmol L−1. Thus, the selection of a concentration of 0.12 mmol L−1 and 0.12 mmol L−1, the rate of changed gradually increases and then gradually de- is reasonable. creased at concentrations higher than 0.12 mmol L−1. Thus, the selection of a concentration of 0.12 mmol L−1 is reasonable.

Biosensors 2021, 11, x FOR PEER REVIEW 9 of 14

Figure 7. (A) Fluorescence spectra in the presence of different concentrations of H1 and H2. (B) Fluorescence intensity ratio (△F/F0) at an emission wavelength of 520nm in the presence of different concentrations of H1 and H2.

3.3.6. Mg2+ Concentration When present at physiological concentrations within cells, Mg2+ is an important factor in maintaining genome stability. It stabilizes the structure of DNA and chromatin and is an essential cofactor for the enzymatic system supporting DNA synthesis and decomposition. It is also used as a cofactor during nucleoside excision repair, base excision repair and mismatch repair. In this study, Mg2+ promoted the assembly of DNAzyme and drove substrate cleavage reactions. When the cleavage reaction was complete, the originally quenched fluorophore regained its fluorescent properties; hence, it is an important component in the process of fluorescence intensity changes within this reaction system. Figure 8 showed the relationship between fluorescence intensity and Mg2+ concentration. In Figure 8A, the fluorescence intensity reached a maximum (1179.511 a.u.) corresponding to a concentration of 0.12 mmol L−1. Figure 8B showed a scatter plot that illustrates the same trend more distinctly. At concentrations between 0 and 0.12 mmol L−1, the rate of changed gradually increases and then gradually de- Biosensors 2021, 11, 222 creased at concentrations higher than 0.12 mmol L−1. Thus, the selection of9 of a 13 concentration of 0.12 mmol L−1 is reasonable.

Biosensors 2021, 11, x FOR PEER REVIEW 10 of 14

Figure 8. The impact of Mg2+ concentration on fluorescence intensity. (A) Fluorescence spectra and (B) scatter plot of Mg2+ concentration versus fluorescence intensity.

Figure 8. 2+ A B 2+ The impact of3.3.7. Mg Substrateconcentration Concentration on fluorescence intensity. ( ) Fluorescence spectra and ( ) scatter plot of Mg concentration versus fluorescence intensity. With the addition of magnesium ions and the substrate, the cleavage deoxyribozyme was activated and the substrate cleavage reaction began. Since the two 3.3.7. Substrate Concentration ends of the substrate were respectively labeled with a fluorescent group and a quenchingWith group, the addition the fluorescence of magnesium intensity ions and of the substrate,system should the cleavage be low deoxyribozyme when it was activated and the substrate cleavage reaction began. Since the two ends of the sub- was not cut. The cleavage reaction would cause the fluorescent group and the strate were respectively labeled with a fluorescent group and a quenching group, the quenching group to separate and, finally, fluorescence recovered. fluorescence intensity of the system should be low when it was not cut. The cleavage Figure 9 showed the fluorescence intensity ratio at different concentration of reaction would cause the fluorescent group and the quenching group to separate and, substrate, the △F/F0 reached the maximum when the substrate was 10 nmol L−1. finally, fluorescence recovered. Thus, it is reasonable to choose this concentration to conduct follow-up experi- Figure9 showed the fluorescence intensity ratio at different concentration of sub- ments. −1 strate, the 4F/F0 reached the maximum when the substrate was 10 nmol L . Thus, it is reasonable to choose this concentration to conduct follow-up experiments.

Figure 9. Fluorescence intensity ratio (4F/F0) at an emission wavelength of 520 nm in the presence Figureof 9. different Fluorescence concentrations intensity of ratio substrate. (△F/F0) at an emission wavelength of 520nm in the presence of different concentrations of substrate. 3.3.8. Sensor Selectivity 3.3.8. SensorBiosensors Selectivity generally require high selectivity. In this study, miRNA-16 (similar to BiosensorsmiRNA-21) generally and mismatch require miRNA-21, high selectivity. which differs In this by onlystudy, one miRNA base pair,-16 were(similar selected. to miRNAAs the- combination21) and mismatch of miRNA miRNA and- padlock21, which probe differs occured by only during one thebase initial pair, stage were of the selected.reaction, As the theoretically, combination in the of absencemiRNA ofand miRNA-21 padlock orprobe miRNA occured with aduring base pair the sequence initial stmismatch,age of the the reaction, ligation theoretically, reaction will notin the occur absence and the of subsequentmiRNA-21 RCAor miRNA will not with proceed. a baseTherefore, pair sequence the ﬂuorescence mismatch, intensity the ligation of miRNAs reaction with will different not occur base pair and sequences the subse- existed quentgreat RCA differences. will not proceed. Therefore, the fluorescence intensity of miRNAs with different base pair sequences existed great differences. From the information shown in Figure 10, it can be seen that fluorescence intensity signals for the target miRNA-21 detected at a concentration of 5 pmol L−1 were substantially higher than those for miRNA-16 and mut-miRNA-21 at concentrations of 5 nmol L−1. This indicated that the sensor is highly selective.

Biosensors 2021, 11, 222 10 of 13

From the information shown in Figure 10, it can be seen that ﬂuorescence intensity signals for the target miRNA-21 detected at a concentration of 5 pmol L−1 were substantially Biosensors 2021, 11, x FOR PEER REVIEW 11 of 14 higher than those for miRNA-16 and mut-miRNA-21 at concentrations of 5 nmol L−1. This indicated that the sensor is highly selective.

Figure 10. Selective detection of miRNA using the sensing system. The concentration of miRNA-16 Figureand 10. mut-miRNA Selective detection was 5 nmol of miRNA L−1, while using the concentrationthe sensing system. of miRNA-21 The concentration was 5 pmol L −of1. miRNA-16 and mut-miRNA was 5 nmol L−1, while the concentration of miRNA-21 was 5 pmol 3.3.9.L−1. Analytical Performance of the Sensing System for miRNA-21 Detection The purpose of this study was to detect miRNA-21; therefore, following completion of 3.3.9. theAnalytical above optimization Performance experiments of the Sensing the System detection for of miRNA different-21 concentrations Detection of miRNA-21 Theunder purpose the optimized of this study conditions was wasto detect performed miRNA to determine-21; therefore, the sensitivity following and com- quanti- pletiontative of the detection above performanceoptimization of experiments the sensor. Figure the detection 11A showed of different that as the concentra- concentration tions ofof miRNA miRNA increases,-21 under the the fluorescence optimized intensity conditions gradually was performed increases. Figureto determine 11B showed the sensitivitya linear relationship and quantitative between detection miRNA concentration performance and of fluorescencethe sensor. Figure intensity. 11A As the −1 −1 showedmiRNA that concentrationas the concentration increased of from miRNA 10 pmol increases, L to 50 the pmol fluorescence L , the fluorescence intensity inten- graduallysity also increases. gradually Figu increased.re 11B showed Figure 11 aB linear served relationship as the calibration between curve miRNA for concentration con- centrationand fluorescence and fluorescence intensity. intensity. The calibration As the miRNA curve indicated concentration a linear increased relationship from between −1 −1 10 pmol10 pmol L−1 to L 50 andpmol 50 L pmol−1, the L fluorescence. The linear regressionintensity also equation gradually is F = 1173.9566increased. + Fig- 3.10523C 2 ure 11(B)(R = served 0.9972), as where the calibration F and C represent curve the for fluorescence concentration intensity and fluorescence at a wavelength inten- of 520 nm sity. Theand miRNAcalibration concentration curve indicated (pmol L-1), a linear respectively. relationship The limit between of detection 10 pmol (LOD) L−1 wasand calculated as 4 pmol L−1, estimated to be three times the blank (without miRNA-21) standard 50 pmol L−1. The linear regression equation is F = 1173.9566 + 3.10523C (R2 = 0.9972), deviation divided by the slope. This LOD value indicates that the reported method may be where F and C represent the fluorescence intensity at a wavelength of 520 nm and applied for the detection of miRNA in amounts as low as 4 pmol L−1. miRNA concentration (pmol L-1), respectively. The limit of detection (LOD) was Table2 shows that the LOD calculated using the proposed method is competitive calculated as 4 pmol L−1, estimated to be three times the blank (without miRNA-21) with respect to similar strategies for the detection of miRNA based on RCA or DNAzymes. standard deviation divided by the slope. This LOD value indicates that the reported Next, 1% serum samples were spiked with different concentrations of miRNA and ana- method may be applied for the detection of miRNA in amounts as low as 4 pmol lyzed. The results in Figure 12A,B indicated that from concentrations of 10 pmol L−1 to L−1. 50 pmol L−1, the fluorescence intensity gradually increased. A linear regression analysis of the fluorescence intensity at different concentrations of miRNA using a wavelength of 520 nm was performed to obtain a calibration curve of concentration and fluorescence intensity. The linear regression equation is F = 1106.88387 + 3.20306C (R2 = 0.97712), the LOD in serum is 6.255 pmol L−1, which is similar to the LOD value obtained for miRNA in the buffer solution. Therefore, it is possible to quantitatively analyze the target miRNA in the concentration range 10–50 pmol L−1.

Biosensors 2021, 11, x FOR PEER REVIEW 11 of 14

Figure 10. Selective detection of miRNA using the sensing system. The concentration of miRNA-16 and mut-miRNA was 5 nmol L−1, while the concentration of miRNA-21 was 5 pmol L−1.

3.3.9. Analytical Performance of the Sensing System for miRNA-21 Detection The purpose of this study was to detect miRNA-21; therefore, following completion of the above optimization experiments the detection of different concentrations of miRNA-21 under the optimized conditions was performed to determine the sensitivity and quantitative detection performance of the sensor. Figure 11A showed that as the concentration of miRNA increases, the fluorescence intensity gradually increases. Figure 11B showed a linear relationship between miRNA concentration and fluorescence intensity. As the miRNA concentration increased from 10 pmol L−1 to 50 pmol L−1, the fluorescence intensity also gradually increased. Fig- ure 11(B) served as the calibration curve for concentration and fluorescence intensity. The calibration curve indicated a linear relationship between 10 pmol L−1 and 50 pmol L−1. The linear regression equation is F = 1173.9566 + 3.10523C (R2 = 0.9972), where F and C represent the fluorescence intensity at a wavelength of 520 nm and miRNA concentration (pmol L-1), respectively. The limit of detection (LOD) was calculated as 4 pmol L−1, estimated to be three times the blank (without miRNA-21)

Biosensors 2021, 11, x FOR PEER REVIEWstandard deviation divided by the slope. This LOD value indicates that the reported12 of 14 Biosensors 2021, 11, 222 method may be applied for the detection of miRNA in amounts as low as 411 pmol of 13 Figure 11. (A) FluorescenceL−1. spectra in the presence of different concentrations of miRNA (in buffer). (B) The relationship between fluorescence intensity in the buffer solution and the miRNA concentration. The error bars represent the standard deviation of three repeat experiments.

Table 2 shows that the LOD calculated using the proposed method is competitive with respect to similar strategies for the detection of miRNA based on RCA or DNAzymes. Next, 1% serum samples were spiked with different concentrations of miRNA and analyzed. The results in Figure 12A,B indicated that from concentrations of 10 pmol L−1 to 50 pmol L−1, the fluorescence intensity gradually increased. A linear regression analysis of the fluorescence intensity at different concentrations of miRNA using a wavelength of 520 nm was performed to obtain a calibration curve of concentration and fluorescence intensity. The linear regression equation is F = 1106.88387 + 3.20306C (R2 = 0.97712), the LOD in serum is 6.255 pmol L−1, which is similar to the LOD value obtained for miRNA in the buffer solution. Therefore, it is possible to quantitatively analyze the target miRNA in the concentration range 10–50 pmol L−1.

Table 2. Comparison of the proposed method with similar strategies for the detection of miRNA based on RCA or Figure 11. (A) Fluorescence spectra in the presence of different concentrations of miRNA (in buffer). (B) The relationship DNAzymes. between ﬂuorescence intensity in the buffer solution and the miRNA concentration. The error bars represent the standard deviation of three repeat experiments.Detection Strategy LOD R2 Reference RNA-cleaving DNAzymes 0.2 nM 0.996 [32] Table 2. Comparison of theRCA proposed and CHA method with similar strategies for the87 detectionfM of0.9908 miRNA based on[24] RCA or DNAzymes.Autonomous catalytic assembly of DNAzymes 10 pM 0.984 [33] Target-primedDetection and branched Strategy RCA 10 fM LOD 0.9994 R2 Reference[34] Peroxidase-mimicking system composed of trimeric G-triplex and he- RNA-cleaving DNAzymes37 fM 0.2 nM0.999 0.996[35] [32 ] minRCA DNAzyme and CHA 87 fM 0.9908 [24] RCA Autonomousand triple-helix catalytic molecular assembly switch of DNAzymes-actuation 1.1 aM 10 pM0.9997 0.984[36] [33 ] ExonucleaseTarget-primed III-propelled and integrated branched RCADNAzyme 100 fM 10 fM0.998 0.9994[37] [34 ] Peroxidase-mimickingRCA and systemmulti- composedcomponent of trimericnucleic G-triplexacid enzymes and hemin DNAzyme4 pM 37 fM0.9972 0.999This work [35] RCA and triple-helix molecular switch-actuation 1.1 aM 0.9997 [36] Exonuclease III-propelled integrated DNAzyme 100 fM 0.998 [37] RCA and multi-component nucleic acid enzymes 4 pM 0.9972 This work

FigureFigure 12. 12.(A )(A Fluorescence) Fluorescence spectra spectra in the in presence the presence of different of different concentrations concentrations of miRNA of (inmiRNA serum). (in (B serum).) Calibration (B) Calibra- curve oftion ﬂuorescence curve of intensityfluorescence and miRNAintensity concentration and miRNA in concentration serum. The error in serum. bars represent The error the bars standard represent deviation the standard of three repeatdeviation experiments. of three repeat experiments.

4.4. Conclusions Conclusions InIn conclusion, conclusion, a novel, a novel, ﬂuorescent fluorescent miRNA miRNA biosensor biosensor is presented. is presented The operating. The operat- prin- cipleing ofprinciple the miRNA of the biosensor miRNA is biosensor based on RCAis based and on MNAzyme RCA and dual MNAzyme signal ampliﬁcation. dual signal Thisamplification. sensing strategy This offerssensing a simple strategy and offers highly a sensitive simple methodand highly with sensitive a LOD as method low as −1 4with pmol a L LOD. Furthermore, as low as 4 thepmol biosensor L−1. Furthermore, is extremely the selective biosensor and is is extremely able to distinguish selective

Biosensors 2021, 11, 222 12 of 13

between miRNAs with one base pair mismatch. Therefore, the proposed biosensor offers a novel and effective strategy for the detection of miRNA using a combination of RCA and DNAzymes.

Author Contributions: C.F. and J.D. performed the experiments and wrote the paper; C.F., P.O., Y.Q., Y.Y., J.H., W.S. and Y.C. analyzed the data and J.D. conceived and designed the experiments. All authors have read and agreed to the published version of the manuscript. Funding: This work was financially supported by the National Natural Science Foundation of China (Grant Nos. 21763009) and the Graduate Students Innovation Research Project of Hainan Province (Hys2020-41). Institutional Review Board Statement: Not applicable. Informed Consent Statement: Not applicable. Data Availability Statement: Not applicable. Conflicts of Interest: The authors declare no conflict of interest.

References 1. Ambros, V. microRNAs: Tiny regulators with great potential. Cell 2001, 107, 823–826. [CrossRef] 2. Perge, P.; Nagy, Z.; Igaz, I.; Igaz, P. Suggested roles for microRNA in tumors. Biomol. Concepts 2015, 6, 149–155. [CrossRef] 3. Lu, J.; Getz, G.; Miska, E.A.; Alvarez-Saavedra, E.; Lamb, J.; Peck, D.; Sweet-Cordero, A.; Ebert, B.L.; Mak, R.H.; Ferrando, A.A.; et al. MicroRNA expression profiles classify human cancers. Nature 2005, 435, 834–838. [CrossRef] 4. Sun, G.; Li, H.; Wu, X.; Covarrubias, M.; Scherer, L.; Meinking, K.; Luk, B.; Chomchan, P.; Alluin, J.; Gombart, A.F.; et al. Interplay between HIV-1 infection and host microRNAs. Nucleic Acids Res. 2012, 40, 2181–2196. [CrossRef][PubMed] 5. Poy, M.N.; Eliasson, L.; Krutzfeldt, J.; Kuwajima, S.; Ma, X.; Macdonald, P.E.; Pfeffer, S.; Tuschl, T.; Rajewsky, N.; Rorsman, P.; et al. A pancreatic islet-specific microRNA regulates insulin secretion. Nature 2004, 432, 226–230. [CrossRef][PubMed] 6. Dong, Z.; Gu, H.; Guo, Q.; Liang, S.; Xue, J.; Yao, F.; Liu, X.; Li, F.; Liu, H.; Sun, L.; et al. Profiling of Serum Exosome MiRNA Reveals the Potential of a MiRNA Panel as Diagnostic Biomarker for Alzheimer’s Disease. Mol. Neurobiol. 2021.[CrossRef] 7. Varallyay, E.; Burgyan, J.; Havelda, Z. Detection of microRNAs by Northern blot analyses using LNA probes. Methods (San Diego Calif.) 2007, 43, 140–145. [CrossRef] 8. Liu, C.-G.; Calin, G.A.; Volinia, S.; Croce, C.M. MicroRNA expression profiling using microarrays. Nat. Protoc. 2008, 3, 563–578. [CrossRef] 9. Zhang, H.-H.; Wang, X.-J.; Li, G.-X.; Yang, E.; Yang, N.-M. Detection of let-7a microRNA by real-time PCR in gastric carcinoma. World J. Gastroenterol. 2007, 13, 2883–2888. [CrossRef][PubMed] 10. Persano, S.; Guevara, M.L.; Wolfram, J.; Blanco, E.; Shen, H.F.; Ferrari, M.; Pompa, P.P. Label-Free Isothermal Amplification Assay for Specific and Highly Sensitive Colorimetric miRNA Detection. ACS Omega 2016, 1, 448–455. [CrossRef][PubMed] 11. Wu, H.; Liu, Y.L.; Wang, H.Y.; Wu, J.; Zhu, F.F.; Zou, P. Label-free and enzyme-free colorimetric detection of microRNA by catalyzed hairpin assembly coupled with hybridization chain reaction. Biosens. Bioelectron. 2016, 81, 303–308. [CrossRef] [PubMed] 12. Fakhri, N.; Abarghoei, S.; Dadmehr, M.; Hosseini, M.; Sabahi, H.; Ganjali, M.R. Paper based colorimetric detection of miRNA-21 using Ag/Pt nanoclusters. Spectroc. Acta Pt. A Molec. Biomolec. Spectr. 2020, 227, 7. [CrossRef] 13. Cui, Y.; Fan, S.J.; Yuan, Z.; Song, M.H.; Hu, J.W.; Qian, D.; Zhen, D.S.; Li, J.H.; Zhu, B.D. Ultrasensitive electrochemical assay for microRNA-21 based on CRISPR/Cas13a-assisted catalytic hairpin assembly. Talanta 2021, 224, 7. [CrossRef] 14. Rafiee-Pour, H.A.; Behpour, M.; Keshavarz, M. A novel label-free electrochemical miRNA biosensor using methylene blue as redox indicator: Application to breast cancer biomarker miRNA-21. Biosens. Bioelectron. 2016, 77, 202–207. [CrossRef][PubMed] 15. Ren, Y.Q.; Deng, H.M.; Shen, W.; Gao, Z.Q. A Highly Sensitive and Selective Electrochemical Biosensor for Direct Detection of MicroRNAs in Serum. Anal. Chem. 2013, 85, 4784–4789. [CrossRef] 16. Rana, M.; Balcioglu, M.; Kovach, M.; Hizir, M.S.; Robertson, N.M.; Khan, I.; Yigit, M.V. Reprogrammable multiplexed detection of circulating oncomiRs using hybridization chain reaction. Chem. Commun. 2016, 52, 3524–3527. [CrossRef][PubMed] 17. Liu, G.X.; Chai, H.; Tang, Y.G.; Miao, P. Bright carbon nanodots for miRNA diagnostics coupled with concatenated hybridization chain reaction. Chem. Commun. 2020, 56, 1175–1178. [CrossRef][PubMed] 18. Li, Y.; Yu, C.F.; Zhao, C.S.; Ren, C.N.; Zhang, X.R. Catalytic hairpin assembly induced dual signal enhancement for rapid detection of miRNA using fluorescence light-up silver nanocluster. Anal. Chim. Acta 2019, 1084, 93–98. [CrossRef] 19. Liu, J.T.; Du, P.; Zhang, J.; Shen, H.; Lei, J.P. Sensitive detection of intracellular microRNA based on a flowerlike vector with catalytic hairpin assembly. Chem. Commun. 2018, 54, 2550–2553. [CrossRef] 20. Shi, C.; Liu, Q.; Ma, C.P.; Zhong, W.W. Exponential Strand-Displacement Amplification for Detection of MicroRNAs. Anal. Chem. 2014, 86, 336–339. [CrossRef] Biosensors 2021, 11, 222 13 of 13

21. Chen, A.Y.; Gui, G.F.; Zhuo, Y.; Chai, Y.Q.; Xiang, Y.; Yuan, R. Signal-off Electrochemiluminescence Biosensor Based on Phi29 DNA Polymerase Mediated Strand Displacement Amplification for MicroRNA Detection. Anal. Chem. 2015, 87, 6328–6334. [CrossRef] 22. Neubacher, S.; Arenz, C. Rolling-Circle Amplification: Unshared Advantages in miRNA Detection. Chembiochem 2009, 10, 1289–1291. [CrossRef][PubMed] 23. Gusev, Y.; Sparkowski, J.; Raghunathan, A.; Ferguson, H., Jr.; Montano, J.; Bogdan, N.; Schweitzer, B.; Wiltshire, S.; Kingsmore, S.F.; Maltzman, W.; et al. Rolling circle amplification: A new approach to increase sensitivity for immunohistochemistry and flow cytometry. Am. J. Pathol. 2001, 159, 63–69. [CrossRef] 24. Zhuang, J.Y.; Lai, W.Q.; Chen, G.N.; Tang, D.P. A rolling circle amplification-based DNA machine for miRNA screening coupling catalytic hairpin assembly with DNAzyme formation. Chem. Commun. 2014, 50, 2935–2938. [CrossRef] 25. Breaker, R.R.; Joyce, G.F. A DNA enzyme that cleaves RNA. Chem. Biol. 1994, 1, 223–229. [CrossRef] 26. Wang, F.; Elbaz, J.; Orbach, R.; Magen, N.; Willner, I. Amplified Analysis of DNA by the Autonomous Assembly of Polymers Consisting of DNAzyme Wires. J. Am. Chem. Soc. 2011, 133, 17149–17151. [CrossRef][PubMed] 27. Hong, C.; Kim, D.-M.; Baek, A.; Chung, H.; Jung, W.; Kim, D.-E. Fluorescence-based detection of single-nucleotide changes in RNA using graphene oxide and DNAzyme. Chem. Commun. 2015, 51, 5641–5644. [CrossRef] 28. Du, H.; Yang, P.; Hou, X.; Hou, X.D.; Chen, J.B. Accelerating DNA nanomotor by branched DNAzyme for ultrasensitive optical detection of thrombin. Microchem. J. 2018, 139, 260–267. [CrossRef] 29. Mokany, E.; Bone, S.M.; Young, P.E.; Doan, T.B.; Todd, A.V. MNAzymes, a Versatile New Class of Nucleic Acid Enzymes That Can Function as Biosensors and Molecular Switches. J. Am. Chem. Soc. 2010, 132, 1051–1059. [CrossRef] 30. Hanpanich, O.; Oyanagi, T.; Shimada, N.; Maruyama, A. Cationic copolymer-chaperoned DNAzyme sensor for microRNA detection. Biomaterials 2019, 225, 12. [CrossRef] 31. Nedorezoya, D.D.; Fakhardo, A.F.; Molden, T.A.; Kolpashchikov, D.M. Deoxyribozyme-Based DNA Machines for Cancer Therapy. ChemBioChem 2020, 21, 607–611. [CrossRef] 32. Xiang, L.; Zhang, F.; Chen, C.; Cai, C. A general scheme for fluorometric detection of multiple oligonucleotides by using RNA-cleaving DNAzymes: Application to the determination of microRNA-141 and H5N1 virus DNA. Microchim. Acta 2019, 186. [CrossRef][PubMed] 33. Yang, L.; Wu, Q.; Chen, Y.Q.; Liu, X.Q.; Wang, F.; Zhou, X. Amplified MicroRNA Detection and Intracellular Imaging Based on an Autonomous and Catalytic Assembly of DNAzyme. ACS Sens. 2019, 4, 110–117. [CrossRef] 34. Cheng, Y.Q.; Zhang, X.; Li, Z.P.; Jiao, X.X.; Wang, Y.C.; Zhang, Y.L. Highly Sensitive Determination of microRNA Using Target-Primed and Branched Rolling-Circle Amplification. Angew. Chem. Int. Edit. 2009, 48, 3268–3272. [CrossRef] 35. Li, R.Y.; Liu, Q.; Jin, Y.; Li, B.X. Sensitive colorimetric determination of microRNA let-7a through rolling circle amplification and a peroxidase-mimicking system composed of trimeric G-triplex and hemin DNAzyme. Microchim. Acta 2020, 187, 8. [CrossRef] [PubMed] 36. Zhao, Y.H.; Wang, Y.; Liu, S.; Wang, C.L.; Liang, J.X.; Li, S.S.; Qu, X.N.; Zhang, R.F.; Yu, J.H.; Huang, J.D. Triple-helix molecular- switch-actuated exponential rolling circular amplification for ultrasensitive fluorescence detection of miRNAs. Analyst 2019, 144, 5245–5253. [CrossRef] 37. Zhou, Y.J.; Yu, S.S.; Shang, J.H.; Chen, Y.Y.; Wang, Q.; Liu, X.Q.; Wang, F.A. Construction of an Exonuclease III-Propelled Integrated DNAzyme Amplifier for Highly Efficient microRNA Detection and Intracellular Imaging with Ultralow Background. Anal. Chem. 2020, 92, 15069–15078. [CrossRef][PubMed]