Exponential Growth by Cross-Catalytic Cleavage of Deoxyribozymogens

Exponential growth by cross-catalytic cleavage of deoxyribozymogens Matthew Levy and Andrew D. Ellington* Department of Chemistry and Biochemistry, Institute for Cell and Molecular Biology, University of Texas, Austin, TX 78712 Edited by Gerald F. Joyce, The Scripps Research Institute, La Jolla, CA, and approved April 10, 2003 (received for review January 9, 2003) We have designed an autocatalytic cycle based on the highly efficient 10–23 RNA-cleaving deoxyribozyme that is capable of exponential amplification of catalysis. In this system, complementary 10–23 variants were inactivated by circularization, creating deoxyribozymogens. Upon linearization, the enzymes can act on their complements, creating a cascade in which linearized species accumulate exponentially. Seeding the system with a pool of linear catalysts resulted not only in amplification of function but in sequence selection and represents an in vitro selection experiment conducted in the absence of any protein enzymes. emonstrating molecular self-amplification is essential for Dunderstanding origins and can potentially foment biotech- nology applications, especially in diagnostics. In modern biology, molecular replication is dominated by cycles in which nucleic acids encode and are replicated by protein enzymes. However, the discovery and subsequent engineering of nucleic acid catalysts raises the possibility that nucleic acid-based, autocatalytic cycles might be designed. In this regard, von Kiedrowski (1) and Zielinski and Orgel (2) showed that oligonucleotide palindromes can serve as templates for the ligation of shorter oligonucleotide substrates, and thus for their own reproduction. Variations on this theme have led to proof that short oligonucleotide templates are capable of semi- Fig. 1. Design of linear and circular 10–23 deoxyribozymes. (a) Active linear conservative (cross-catalytic) replication (3), and that substrates deoxyribozymes LA and LB and inactive circular deoxyribozymes CA and CB. The as short as single nucleotides can be used (4–6). However, 10–23 catalytic core is shown in gray with substrate-binding arms shown in because of the strong interactions that exist between comple- black. Complementary arms are denoted by upper and lowercase letters. The mentary strands, the products formed in these ligation-based cleavage site, consisting of two ribose residues, is shown in outline. (b) systems bind strongly to one another and the reaction kinetics of Schematic for the autocatalytic 10–23 deoxyribozyme cleavase cycle. Cleavage of inactive C by active L produces active L , which can in turn cleave inactive these systems are limited to parabolic, rather than exponential, B A B CA to reproduce active LA. growth (7, 8). Various strategies have been implemented to avoid the problem of product inhibition. For example, Li and Nicolaou (9) used substrates by a linear, complementary 10–23 deoxyribozyme. cyclic pH changes and the addition of excess complementary Circularization of both complementary deoxyribozymes effec- oligonucleotide to ensure the release of ligated products from a tively eliminates catalytic activity, but poises the system so that template. The von Kiedrowski lab (10) facilitated product re- even a single ring-opening event can potentially result in a lease by template immobilization and denaturation. Cycles of cascade of cleavage reactions. As anticipated, the conforma- immobilization and denaturation resulted in the ‘‘SPREAD’’ (surface-promoted replication and exponential amplification) of tional change from circular substrate to linear catalyst does oligonucleotides beyond an initial, immobilized population. indeed drive exponential accumulation of products. This system Those experiments have yielded one of the first convincing most closely resembles protein-based proteolytic cascades such demonstrations of the possibility of primordial Darwinian se- as those involved in blood clotting (13, 14) and apoptosis (15), quence selection. Most recently, Paul and Joyce (11) designed an in which inactive zymogens, proenzymes, and procofactors are autocatalytic cycle based on the R3C RNA ligase ribozyme. The activated via cleavage. For this reason, the inactive deoxyri- self-reproducing ligase used ‘‘half-ribozymes’’ as substrates and bozyme circles have been dubbed ‘‘deoxyribozymogens.’’ Be- was capable of limited exponential growth. This replicator cause the autocatalytic cleavase cycle avoids the accumulation of appears to have neatly avoided the problem of product inhibition longer products with greater base-pairing potential, we hypoth- by refolding and forming more stable intramolecular contacts esized that it should be capable of robust exponential growth, within the newly ligated product. However, the replicator did not and thus might serve as a model system for exploring how nucleic show extensive exponential growth, as substrate self-association acid autocatalysis might lead to sequence evolution. As a dem- resulted in the accumulation of stable complexes that could not onstration, the cleavase cascade was used to select optimal bind to the ribozyme catalyst. deoxyribozymes from a random sequence population in the We have designed an autocatalytic deoxyribozyme cycle based complete absence of proteins. ϭϷ on cleavage rather than ligation (Fig. 1). The fast (kcat 0.1 Ϫ1 ͞ Ͼ 9 min ), highly efficient (kcat Km 10 ), and programmable 10–23 deoxyribozyme (12) was circularized, resulting in its This paper was submitted directly (Track II) to the PNAS office. inactivation. The inactive circles can nonetheless still be used as *To whom correspondence should be addressed. E-mail: [email protected]. 6416–6421 ͉ PNAS ͉ May 27, 2003 ͉ vol. 100 ͉ no. 11 www.pnas.org͞cgi͞doi͞10.1073͞pnas.1130145100 Downloaded by guest on September 24, 2021 Materials and Methods tained only 20 pml of each pool. The incubation times for each Oligonucleotide Synthesis and Circularization. All oligonucleotides round were 48, 72, 27, and 15 h. were synthesized on a expedite 8909 synthesizer (Perkin–Elmer) After each serial transfer, the remaining 9 ␮l from each round by using standard DNA and RNA phosphoramidite chemistry. was quenched by the addition of an equal volume of 95% All synthesis reagents were purchased from Glen Research formamide loading dye containing a 2-fold excess of EDTA. (Sterling, VA). Circular and linear species were separated on denaturing (7 M The linear deoxyribozymes LA (UCGGACAGGCTAGCTA- urea) 20% acrylamide gels, and the amounts of nucleic acid CAACGAGAGTGACA-p) and LB (UGTCCGAGGCTAGC- present in individual bands were quantitated via fluorescent TACAACGAGTCACTCA-p) were chemically synthesized with staining with SyberGold (Molecular Probes) and a Fluorimager terminal RNA residues (underlined) and a 3Ј phosphate (de- (Molecular Dynamics). noted p) to more closely mimic the product of the cleavage The linear species from round 4 were extracted from the gel reaction, which produces a 2Ј,3Ј cyclic phosphate. for cloning and sequencing. After gel extraction, linear DNA Circular deoxyribozymes were synthesized from linear per- molecules were treated with T4 polynucleotide kinase to remove Ј mutations of LA and LB bearing a 5 phosphate (denoted p) the 2Ј,3Ј cyclic phosphate (17) and then radiolabeled with an (pre.CA, p-AGCTACAACGAGAGTGACAUCGGACAG- excess of ␥-32ATP (Ͼ7,000 Ci͞mmol; ICN) in standard buffer. GCT; pre.CB p-AGCTACAACGAGTCACTCAUGTCCGAG- Primer binding sites were ligated to the 3Ј or 5Ј end of a portion GCT, where underlined residues are RNA). Circularization of the purified, radiolabeled pool by using T4 RNA ligase (L3, reactions were carried out with T4 DNA ligase (NEB, Beverly, p-UUUCTGAGACGTAGACAGCACGAT-c3; L5, TCGTAC- MA) and a splint oligonucleotide (splint.a TGTAGCTAGC- TACTAGCATCGTTATGGAAA; the underlined residues are CTGT; splint.b GCTCCGATCGATGT). The concentration of RNA; p, a 5Ј phosphate; and c3, a three-carbon alkyl blocking the linear substrate was 100 nM, and the splint oligonucleotide group). The ligated products were purified on denaturing (7 M was present in 1.2-fold molar excess. The reactions were allowed urea) 8% acrylamide gels and amplified by using primers specific to proceed for 16 h at room temperature and the circular for either C.E1 or C.E2 (for C.E1, P5.E1 CGTTATG- products (50–70%) were isolated on denaturing (7 M urea) 20% GAAATCGGACAGGC and P3.E1 ATCGTGCTGTC- polyacrylamide gels. After gel purification, C and C were A B TACGTCTCAG; for C.E2, P5.E2 CGTACTACTAGCATCGT- treated with exonuclease VII to remove any remaining linear TATGG and P3.E2 TGAGTGACTCGTTGTAGC). After nucleic acids. Where appropriate, the constructs were radiola- amplification, PCR products were cloned by using the Topo TA beled before circularization via an exchange reaction with T4 polynucleotide kinase and ␥-32ATP (Ͼ7,000 Ci͞mmol; ICN). cloning kit (Invitrogen) and sequences were acquired via stan- Circular pools C.E1 and C.E2 were synthesized from linear dard dideoxy, cycle sequencing methods on a CEQ 2000XL precursor pools bearing three randomized nucleotides, a 5Ј automated sequencer (Beckman Coulter). To obtain sequences phosphorylated ribouridine and a 3Ј riboadenosine (pre.CE1, from round 0, the circularized pools were treated with RNase U2 p-UCGGACAGGCTAGCTACAACGAGANNNACA; pre.ce2, before the ligation of primer binding sites, PCR amplification, p-UGNNNGAGGCTAGCTACAACGAGTCACTCA, where and sequencing. N denotes randomized positions). Circularization reactions were in this instance performed with T4 RNA ligase (Promega)

Load more