Microbiome of Abandoned Agricultural and Mature Tundra Soils in Southern Yamal Region, Russian Arctic

Open Agriculture 2020; 5: 335–344

Research Article

Evgeny Abakumov*, Aleksei Zverev, Eugenia Morgun, Ivan Alekseev Microbiome of abandoned agricultural and mature tundra soils in southern Yamal region, Russian Arctic

https://doi.org/10.1515/opag-2020-0034 tundra soil showed less diﬀerentiated microbiome received April 23, 2020; accepted May 18, 2020 composition.

Abstract: Soil microbiome plays a significant role in the Keywords: Yamal region, microbiome, tundra, soil, high- development of the soil profile and the implementation throughput sequencing of key soil biochemical processes. Observed Arctic warming creates significant environmental risks, since permafrost soils contain a huge amount of organic matter, which is in potential risk to be released in the 1 Introduction form of greenhouse gases. This work is aimed to ffi – investigate the microbiomes in soils of mature tundra According to o cial sources, 30 40 million hectares of and anthropogenically affected areas of the Yamal region arable lands have now been removed from agricultural use using a high-throughput sequencing approach. The in Russia and are not used. They are transferred into the taxonomic analysis of the soil microbiomes revealed 33 state of abandoned lands and transformed under the fl bacterial and archaeal phyla, among which the domi- in uence of natural and anthropogenic processes of soil ’ - nant were Proteobacteria, Acidobacteria, Actinobacteria, formation, soil sselfdevelopment and degradation, forest ( Bacteroides, Chloroflexi, Cyanobacteria, Firmicutes, growth, and waterlogging Walker et al. 2009;Lyurietal. ) ’ Gematimonadetes, Patescibacteria, Plantomycetes, 2010; Ivanov et al. 2015a,b . In recent decades, the Earth s Thaumarchaeota, Verrucomicrobia, and WPS-2. The surface has been considerably altered by human, resulting ( analysis of alpha and beta diversities revealed that in noticeable change patterns in land cover Kandissounon ) ff undisturbed soil is completely different from anthro- et al. 2018 , which has consequent e ect on the water cycle ( ) pogenically affected ones in terms of microorganism Obianyo 2019 . biodiversity. Soils of the urban zone of Salekhard were Many regional governments of northern regions view found to be different with regard to the number of the increasingly favorable growing conditions as an ( operational taxonomic units and beta diversity. Herein opportunity to manage agricultural expansion Desyatkin the microbiome in the upper and lower layers of soil et al. 2012; Ivanov et al. 2015a,b; Hohle et al. 2016; ) developed under strong technogenic influence (M19) was Chapagain 2017; Government 2017 . For example, Siberia is ≤ unequal both in quality and in quantity. At the same currently at 50% of its estimated potential for food time, soils developed in the recreational zone of production, including recovery of formerly abandoned Salekhard showed less differentiation profile of micro- lands, and it is described as a dormant breadbasket ( ) biome (former crop field and former vegetable Swinnen et al. 2017; Elfernik and Schierhorn 2019 . garden soils). Microbial communities in the mature Despite the extreme natural and climatic conditions, the presence of cold weather and the frozen state of soils for 8–10 months a year, the focal nature of industrial and economic  development of the territory Yamalo-Nenets Autonomous * Corresponding author: Evgeny Abakumov, Department of Applied Okrug (YANAO) provides sufficient opportunity to the Ecology 199178, Saint Petersburg State University, 16th line of population with the main agricultural crops cultivated in Vasilevsky Island, Saint Petersburg, Russia, the Far North (vegetables, barley, and perennial herbs).An - e mail: [email protected] - Aleksei Zverev, Eugenia Morgun, Ivan Alekseev: Department of important factor in the development of agricultural produc Applied Ecology 199178, Saint Petersburg State University, 16th line tion in YANAO is the improvement in the agropotential of of Vasilevsky Island, Saint Petersburg, Russia natural and effective fertility of arable and abandoned soils in

Open Access. © 2020 Evgeny Abakumov et al., published by De Gruyter. This work is licensed under the Creative Commons Attribution 4.0 Public License. 336  Evgeny Abakumov et al. accordance with their ecological–genetic status and particle In YANAO, dozens of farms were engaged in farming; size distribution, taking into account hydrothermal climatic most of them ceased to exist, and soils and lands turned indicators (precipitation, warm period duration, amount of into an abandoned state. There are also a number of cold period precipitations, regional features of their soil greenhouses, both active and abandoned, which present an genesis and metabolism). Back in 1933, academic I. G. interesting object for studying soil processes and fertility Eichfeld, in the book The Struggle for the Red North,wrote,“It parameters in closed soil conditions. would be necessary to critically review all old installations For the residents of the Far North which is character- with regard to agricultural possibilities in the Far North.” istic of short summers and very harsh, long winters with Based on the results, the normative yield of the main crops polar nights, fresh vegetable crops are urgently needed, cultivated in the harsh conditions of the Far North will allow given their high vitamin contents and the presence of other the cultivation of many varieties of vegetable crops, including biologically active substances (Kotelina et al. 2018).When nonviral potato seed material, which is in line with the main transporting vegetables from other regions, some valuable objectives set out in the Federal Scientific and Technical properties are lost. Therefore, the active cultivation of crops ProgrammefortheDevelopmentofAgriculturefor2017–2025 in the territory of YANAO is resumed again. (Ed. Resolution of the Government of the Russian Federation Previously, the microbiome of soils in agro landscapes No. 996 of August 25, 2017). of Yamalo-Nenets autonomous regions were not studied. The experience of successful agricultural practices, Therefore, this study is aimed to investigate the abandoned including vegetable and potato production in the Arctic agricultural lands as well as soils of current agricultural zone, is available, as evidenced by the regular consideration fields in terms of microbiology. of this issue at the Circumpolar Arctic Conferences, which In this regard, the scientific novelty of this research is have already taken place. These conferences are extremely that for the first time in the Yamal region the amount of soil poorly represented by analyses of farming work in the Far transferred to the abandoned state is critical for further North in Russia. However, vegetable production is common sustainable existence of the agro-industrial complex. A in Greenland, so the mainstreaming of farming practices in comprehensive study of the microbiome is carried out at YANAO is very relevant and likely. The Arctic region has various stages of post-anthropogenic evolution. The use of a alreadyprovedtobeagoodperspectiveforthedevelopment metagenomic approach in the study of soil genesis was of organic production, and the advantages of northern published only in two previous papers (Gladkov et al. 2019; farming are already used by the Scandinavian countries and Abakumov et al. 2020). Since soil genesis is largely Finland. Development of domestic horticulture and locally dependent on the physiological and metabolic activities of grown agricultural production should be prioritized when soil microbiota, its study is essential in understanding the evaluating the necessary investments in specific region’s general mechanisms of soil formation processes (Frouz et al. agriculture. Emphasis should also be placed on the 2016). However, so far, this analysis has been carried out development of facilities for processing, storage, and mainly using cultural methods of analysis, which allow only realization of agricultural good. a small part of the microbial community (1–10%) to be taken Despite the relatively long history of Siberian and into account, while most of the microbiocenosis consists of northern vegetable growing – about four centuries – growing uncultivable forms, which can be accounted and studied crops in northern part of Russia has progressed little to date. only using a metagenomic approach. The first references to the breeding of cabbages, onions, and Based on the analysis of the biodiversity of the cucumbers in the Tobol North (on the territory of the current community of microorganisms, it is intended to clarify and city of Salekhard) are found in 1907 in the works of A. A. expand our knowledge of the taxonomic and functional Dunin-Gorkavić. In 1932, the Yamal Zone Vegetable structure of microbiota at various stages of pedogenesis Experimental Station of the All-Union Lenin Academy of (Bates et al. 2010; Frouz et al. 2016; Harantova et al. 2017). Agricultural Sciences was established in the city of Salekhard The use of methagenomic and bioinformatic approaches for (since 1938 it has been renamed the Salekhard Complex investigation of soil biota become quite requred in modern Zone Experimental Station of the Institute of Polar soil science and reclamation technologies. In Russia, such an Agriculture, Livestock and Fisheries). The station carried integrated approach has not yettakenaproperplace,sothis out experimental works in the field of crop production: study is the first domestic study of the microbiome of development of agricultural activities, selection, and produc- abandoned soils of agroecosystems. In addition, it is planned tion of new valuable varieties of cereals, vegetables, and to carry out an evaluation and cost assessment of soil fodder crops until 2007, when scientificworkswere development in time, which will allow to reach the solution gradually phased out. of the new application problem of agricultural science, Microbiomes of agricultural and benchmark soils of Yamal region  337 agroecology, and agricultural economy – monetization of of days with snow cover is 233 per year. Winter lasts 7–7.5 ecosystemservicesofcomponentsofagroecosystemsin months; the average temperature of January is −23 to 25°C. connection with the need to introduce systems of effective Spring is usually short (35 days) and cold, with a sharp environmental management into the agro-industrial change in weather, with frequent returns of cold and frost. complex. The vegetation season consists of 70 days. Average Previously, Arctic abandoned soils were investigated temperature in the warmest month is +5°C. The average mainly through classical methods of soil chemistry and annual temperature is −5.8°C. Autumn is short, with a physics (Archegova 2007; Alekseev et al. 2016; Alekseev and maximal volatility of the pressure gradient, an abrupt Abakumov 2018), with no metagenomic studies of the change in temperature, and frequent early frosts. The site is microbiome of northern soils conducted in exception of two in a zone of excessive moisture. recent works (Gladkov et al. 2019; Abakumov et al. 2020). The soil cover of natural environments in the The following objectives were formulated: surroundings of Salekhard is characterized by the pre- – To conduct metagenomic studies of soils of agrocryo- dominance of Histic Gleysols and Aquiturbic Cryosols in genic ecosystems for understanding the microbiome hydromorphic positions of the landscape and podzols in structure. autonomous positions (Alekseev et al. 2017; Alekseev et al. – To understand key drivers of soil formation under 2019; Ji et al. 2019). Soils in this region are characterized by various agricultural practices. the low fertility level (low amount of nitrogen, phosphorus, and potassium). They have a low cation exchange capacity, base saturation and acid intervals of pH, and highly exchangeable and hydrolytic acidity. Soil diagnostics were performed using both the Russian 2 Material and methods soil classification system (RSCs)(Shishov et al. 2004) and theWorldReferenceBaseforSoilResources(WRB; FAO ) fi 2.1 Regional setting and soils 2014 . However, issues of soil pro le morphology and classification have been discussed more detailed in the scope of RSCs. This study was conducted in different locations of the Objects of investigation are presented in Figure 2. Salekhard (Yamal autonomous region, Russia; Table 1 and Objects are presented by agricultural soils from various Figure 1). Site 1 mature tundra soil (G10) is located in the functionals zones of Salekhard and one soil from mature northern direction from Salekhard and presented by mature tundra. tundra without evidences of anthropogenic transformation. RSCs divide soils affected by agricultural influence into Site 2 is located on the experiment field of the former zonal two orders (both are referred to the trunk of postlithogenic station. Site 3 is attributed to the field for potato cultivation soils).Thefirst order is agrozems. It unites soils having (the right bank of Shaitanka river). Site 4 is located in the topsoil consisting of an agrohorizon (humus agrohorizon, “Angalsky mys” area near the existing cowshed. gray humus agrohorizon, peaty agrohorizon, or peaty- The climate of Salekhard is characterized by severity mineral agrohorizon).Inthesoilprofile, such a topsoil and continentality. Throughout the year, relative humidity should be changed by the natural diagnostic horizon (B) or is high (70–90%). It is caused by low air temperatures and parent material (C) very sharply. The authors of the proximity to the cold waters of the Kara Sea. Annual classification system also notice that soils from the above- precipitation is about 350–400 mm in the southern part. mentioned order can be developed in any conditions and The annual evaporation rate is about 250 mm. The number any natural zone. The types of agrozems are determined by

Table 1: The main characteristics of investigated sites

Site Geographical coordinates Functional zone Soil type (WRB/RSCs)

1 N67°26′ 39,3″; E 67°22′35,7″ Mature tundra Cambic podzol/podbur 2 N 66°31′02,3″; E 66°39′22,3″ Recreational functional zone (former crop ﬁeld) Spodic anthrosol/Al–Fe humic agrozem 3 N 66°32′56,8″; E 66°36′43,4″ Recreational functional zone (former vegetable Spodic anthrosol/Al–Fe humic agrozem garden) 4 N 66°33′31,9″; E 66°34′07,2″ Recreational functional zone (urbanized ecosystem) Spodic anthrosol/Al–Fe humic podzol 338  Evgeny Abakumov et al.

Figure 1: The map of the study area. Sites: 1 – Mature tundra, 2 – recreational functional zone (former crop field);3– recreational functional zone (former vegetable garden);4– recreational functional zone (urbanized ecosystem). features of the agrohorizon and its combination with the Data on the soil chemical state have been published underlying natural horizons. earlier (Alekseev and Abakumov 2018).Briefly, these soils The second order is Agroabrazems. Soils from this order are acids, with low total and nitrogen content in middle are deprived of the topsoils and in some cases diagnostic (B) horizons of the profile and accumulation of these elements in horizons of natural soil due to erosion, deflation, mechanical the topsoil. These soils have increased portion of exchange- cutting, etc. The specific feature of Agroabrazems is the able nutrients. It was suggested that the presence of presence of a specific agroabraded horizon formed due to permafrost table and low biological activity during the transformation of the diagnostic (B) horizon or the parent abundance save the agrochemical state of the previously material (C). The types of Agroabrazems are determined by amended soils for longer time than in the case of leached the horizon features underlying the arable horizons. In the soils (podzol) of more south (boreal) environments. studied soil profiles, we have not found any feature of Agroabrazems and agroabraded horizons. 2.1.1 Metagenomic studies It should be noticed that the character of the parent material described in studied soil profiles and that prevailed 2.1.1.1 DNA isolation within the Salekhard city area (sandy material) was one of the main reasons for favorable agricultural using of land in DNA was isolated using the MN NucleoSpin kit (MN, the north of Western Siberia. Germany). A Precellus 24 homogenizer (Bertin, USA) was At the same time, in the WRB system, it is determined used as a destructive mechanical action. The quality of the that only one reference soil group soil the soil affected by resulting preparation was checked electrophoretically (1% agricultural activities – anthrosols. This reference soil group agarose gel; Bio-Rad, USA) and by PCR (Bio-Rad T100 is characterized by the soils that have been formed or heavily Thermal Cycler). modified by the long-term human activities (addition of organic materials or household wastes, irrigation, cultivation, etc.). Anthrosols often can occur in association with a 2.1.1.2 DNA sequencing variety of reference soil groups. It should be noticed that these linkages have been mainly studied for nonpermafrost DNA sequencing was performed via the Illumina MiSEQ landscapes. So in the zones with a predominance of wetland sequencing system (USA),withprimersF515(GTGCCAGCM soils such as fluvisols, gleysols, histosols, and podzols and GCCGCGTAA) and R806 (GGACTACVSGGGTATCTAAT) for presence of agricultural activity, terric anthrosols are usually theV4variableregionofthe16srDNAgeneaccordingto observed. the manufacturer’smanual. Microbiomes of agricultural and benchmark soils of Yamal region  339

Figure 2: Studied site and respective soil proﬁles (explanations given in Table 1).

2.1.1.3 Bioinformatic data processing were combined using the fastq-join software of expression analysis (Aronesty 2013).TheVSEARCHopen-source tool Sequence trimming was performed using the Trimmomatic (Rognes et al. 2016) was used to search and filter the program (Bolger et al. 2014). Forward and reverse reads chimeric sequences. Operational taxonomic units (OTUs) 340  Evgeny Abakumov et al. were determined using the close reference method based on 3 Results and discussion the SILVA database (Yilmaz et al. 2014; Rognes et al. 2016). OTUs, attributed as chloroplast/mitochondria, were re- Data of alpha biodiversity of the soil microbiomes (Figure 3) moved. Alpha- and beta-diversity analyses were also showed that undisturbed soil is completely different from performed using the QIIME package (Caporaso et al. anthropogenically affected one in terms of microorganism 2010), and the mantel test from the QIIME package with biodiversity. Thus, the highest number of OTUs was in the 999 permutations. soil of the former crop field (site 2).Thiscanbeduetothe fact that soil was intensively involved in agricultural practices during many years, which is in line with the 2.1.1.4 Real-time PCR results from post-anthropogenic soils reported by Pershina For quantitative PCR, we used primers against the three et al. (2020). The lowest number of OTUs was found in the groups of microorganisms: bacteria – EUB338 (ACTCCTACG soil of the urbanized ecosystem (site 4).Thiscouldbedueto GGAGGCAGCAG) and EUB518 (ATTACCGCGGCTGCTGG); the fact that this soil is located in a strongly technogenically archaea – ARC915f (AGGAATTGGCGGGGGAGCAC) and affected part of the Salekhard city. The OTUs of the soil of the ARC1059r (GCCATGCACCWCCTCT);andfungi– ITS1f (TCC potato field (site 3) were intermediate between the former GTAGGTGAACCTGCGG) и 5.8S (CGCTGCGTTCTTCATCG).To crop field and the urbanized ecosystem soils. No trends were prepare the reaction mixture, the qPCRmix-HS SYBR kit observed in the distribution of number of OTUs within the (Eurogen, Russia) was used according to the manufacturer’s soil profiles. It could be caused by the intensive processes of instructions. A series of 10-fold dilutions of 16S (Escherichia cryogenic mass exchange well pronounced in soils investi- coli and Helicobacter pylori) and ITS1 (Saccharomyces gated (Ji et al. 2019). The Shannon indexes, normally, were cerevisiae) fragmentswereusedasstandards.ACFX96 higher in the top layer of mature soil, while they were not thermocycler (BioRad, Germany) was used to perform PCR homogenously distributed within the profiles of anthropo- using the cycling parameters: 95°C for 3 min, 40 cycles of genically affected soils. The values of Shannon indexes 95°Cfor20s,50°Cfor20s,and72°Cfor20s. obtained are comparable with those in soils of abandoned For beta diversity, the weighted Unifrac metric post-anthropogenic soils of Yamal (Pershina et al. 2020) and (Lozupone and Knight 2005) was used to calculate the Yakutsk (Abakumov et al. 2020) but higher while the topsoil amount of dissimilarity (distance) between the bacterial of the remainder pastures of Yamal are compared (Laishev et communities to be compared. The results were presented al. 2020). As for Simpson indexes, they were comparable in the principal component analyse (PCoA) analysis between all the soils investigated. using “Emperor” implemented in QIIME. All estimates A total of 30 phyla of bacteria were identified in all were measured for the normalized data (normalization soils studied. The main phyla of the soil microorganism in was carried out to the smallest number of sequences all samples investigated are as follows: Proteobacteria present in the sample). (23.41% on average), Acidobacteria (8.18% on average),

Figure 3: Alpha biodiversity of investigated soils. Microbiomes of agricultural and benchmark soils of Yamal region  341

Figure 4: Taxonomic composition of soil microbiomes.

Actinobacteria (15.45% on average), Bacteroides (7.79% on accounted for more than 98% of all identified classes in average), Chloroflexi (9.45% on average), Cyanobacteria each of the investigated soil samples. However, the (0.36% on average), Firmicutes (26.86% on average), taxonomical diversity of soil microbiomes (Figure 4) is Gematimonadetes (1.23% on average), Patescibacteria completely different while one comparing mature and (0.46% on average), Plantomycetes (3.32% on average), agricultural soils. Firmicutes were dominant in post- Thaumarchaeota (0.73% on average), Verrucomicrobia arable soils that are more dry and aerated (Chodak et al. (1.66% on average),andWPS-2 (0.45% on average).They 2015; Pajares et al. 2018), while Proteobacteria was more

Figure 5: Beta biodiversity of soils investigated. 342  Evgeny Abakumov et al. typical for mature soils. The presence of Acidobacteria is community along the soil profile, which suggests that typical for acids pedoenvironments and has been mature tundra soils are different from their urbanized described previously by Pershina et al. (2020) and Chira analogues because of the more stable microbiome, which et al. (2013) for polar and boreal ecosystems correspond- is in line with the previous research (Chodak et al. 2015; ingly. Acidobacteria has been previously shown to be Pajares et al. 2018). strongly correlated with soil pH, which is in agreement Numerous natural and anthropogenic factors influence with the findings of Jones et al. (2009).Thestudyareais soil fertility and microbial community and have to be located in the southern Yamal, which is relatively warm considered when interpreting the soil microbiome para- and humid compared to the northern parts of the Yamal meters (Yan et al. 2015;Lietal.2017). In our work, we region; so the abundance of Actinobacteria could be discuss only some of them. However, climatic parameters explained by the presence of essential portion of organic (such as temperature, precipitation, and other climatic remnants in topsoil layers. Some similarities between events),whichcansignificantly affect the soil microbial the mature tundra soil and soils from Salekhard are the community, probably do not have a significant effect on presence of the Actinobacteria phyla, bacteria from the microbial diversity since the soil samples were collected phylum Chloroflexi and WPS-2, which have been reported from the same bioclimatic region and thus were exposed to to be typical microbial taxa for permafrost environments similar weather conditions. (Jansson and Tas 2014). Fierer and Jackson (2006) did not Arctic warming may significantly change the func- succeed in classifying the Firmicutes phyla as either tional diversity of microbial communities in permafrost oligo- or copiotrophs. Firmicutes were previously de- soils. At the moment, the deficiency of observation and scribed as one of the main drought-sensitive bacteria analytical data on the microbiome of Arctic soils leads to (Zhang et al. 2019). the necessity to intensification of scientificresearchinthis Beta biodiversity (Figure 5) of the investigated soils was area. It is of particular interest the issues of investigation assessed by the weighted Unifrac metric (Lozupone and of mutual relationship between microbial diversity and Knight 2005) to calculate the amount of dissimilarity environmental parameters associated with soil func- (distance) between bacterial communities with all tioning, namely, nutrient dynamics controlled by micro- weighted, unweighted, and Bray–Curtis distance measures. biome, soil organic matter mineralization, and significance All the samples formed separate clusters. At the same time, of changing environmental conditions for the soil upper and lower layers from the urbanized ecosystem (site microbiome. 4) form different clusters (in both weighted and unweighted Unifrac), while upper and lower layers from the mature tundra soil, former crop field (site 2),andformervegetable garden (site 3) soils can be clustered together. Nonmetric 4 Conclusions multidimensional scaling with Bray–Curtis distance showed that microbial communities of upper and lower layers in This study is one of the first attempts to describe soil each mature tundra soil (site 1),formercropfield, and microbial communities in mature tundra and anthro- former vegetable garden soil are clustered together, while pogenically affected sites of the Yamal region by the use urbanized ecosystem soil forms two different clusters in of modern molecular methods for the qualitative and upper and lower layers. quantitative analyses of biodiversity. Former crop field (site 2) and former vegetable garden Of the 30 identified phyla, 13 explain more than 99% (site 3) soils have similar bacterial communities along the of all microbial diversity. This investigation reveals such soil profile, which suggests that bacterial community most abundant phyla of soil microorganism in samples structures are quite the same in the recreational collected from natural and anthropogenically affected functional zone of Salekhard. This has been previously soils: Firmicutes (26.86% on average), Proteobacteria reported for post-anthropogenic soils (Pershina et al. (23.41% on average), and Actinobacteria (15.45% on 2020). At the same time, qualitative and quantitative average). It was revealed that Firmicutes phyla are structuring and differences in upper and lower layers of mostly abundant in post-arable soils, which are the the microbial community reveal the role of anthropogenic driest and more aerated. Proteobacteria was mostly disturbance in the urbanized ecosystem (site 4) soil. This described in mature tundra soil, while the presence of could be caused by mechanical disturbance and mixing Actinobacteria is explained by the location of the study of soil layers due to the maintenance of the cowshed. area in a relatively humid part of the Yamal peninsula. Mature tundra soil shows the most similar microbial The highest number of OTUs is in spodic anthrosol from Microbiomes of agricultural and benchmark soils of Yamal region  343

the former crop field, since this site was intensively [7] Aronesty E. Comparison of sequencing utility programs. Open involved in agricultural practices during last decades. At Bioinform J. 2013;7:1–8. [ ] - the same time, the lowest number of OTUs was found 8 Bates ST, Berg Lyons D, Caporaso JG, Walters WA, Knight R, Fierer N. Examining the global distribution of dominant in the most technogenically affected part of the archaeal populations in soil. ISME J. 2010;5:908–17. Salekhard city. doi: 10.1038/ismej.2010.171. The analysis of beta diversity of microbial commu- [9] Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible nities revealed that mature tundra soil shows less trimmer for illumina sequence data. Bioinformatics. differentiated microbiome composition along the soil 2014;30:2114–20. doi: 10.1093/bioinformatics/btu170. [ ] profile, while soils from anthropogenically affected areas 10 Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, et al. QIIME allows analysis of high- ff of Salekhard could di er in microbiome composition throughput community sequencing data. Nat Methods. when comparing upper and lower soil layers. The 2010;7(5):335–6. described soil microbial community in mature soil [11] Chapagain T. Farming in northern Ontario: untapped potential exhibits many common bacterial taxa for the Arctic for the future. Agronomy. 2017;7:59. doi: 10.3390/ region. So our results could be used as a vital agronomy7030059. [12] Chirak EV, Pershina EL, Dol’nik AS, Kutovaya OV, contribution to the comprehensive study of the soil Vasilenko ES, Kogut BM, et al. Taxonomic structure of microbiome in Arctic soils. This, in turn, is crucial for microbial association in different soils by high-throughput better understanding of ecosystem responses to global sequencing of 16-rRNA gene library. Sel’skokhozyaistvennaya climate change. Biologiya. 2013;3:100–9. [13] Chodak M, Gołębiewski M, Morawska-Płoskonka J, Kudek K, ń ff Acknowledgments: This work was supported by the Nikli ska M. Soil chemical properties a ect the reaction of forest soil bacteria to drought and rewetting stress. Ann - Russian Foundation for Basic Research, project no. 19 Microbiol. 2015;65:1627–37. doi: 10.1007/s13213-014-1002-0. 416-890002 “Microbiome of abandoned soils of agro [14] Desyatkin RV, Desyatkin AR, Fyodorov PP. Temperature regime landscapes Yamal-Nenets autonomous region: diversity, of frozen-tag soils of Central Yakutia. Earth Cryosphere. features, biology and dynamics.” 2012;16(2):70–8. [15] Elferink M, Schierhorn F. The Dormant Breadbasket of the Asia-Pacific. The promise of Siberian agriculture for Asia’s Conflict of interest: Authors declare no conflict of growing demand for food. The Diplomat. 2019, February 12. interest. [16] Fierer N, Jackson RB. The diversity and biogeography of soil bacterial communities. Proc Natl Acad Sci USA. 2006;103:626–31. [17] Frouz J, Toyota A, Mudrak O, Jilkov V, Filipov A, Cajthaml T. References Effects of soil substrate quality, microbial diversity and community composition on the plant community during primary succession. Soil Biol Biochem. 2016;99:75–84. [1] Abakumov E, Kimeklis A, Kichko A, Andronov E, Petrov A, doi: 10.1016/j.soilbio.2016.04.024. Abakumov E. Microbiomes of the initial soils of mining areas [18] Gladkov G, Kimeklis A, Zverev A, Pershina E, Ivanova E, of Yakutsk City (Eastern Siberia, Russia). Czech Polar Rep. Kichko A, et al. Soil microbiome of the postmining areas in 2020;2, [in print]. polar ecosystems in surroundings of Nadym, Western Siberia, [2] Alekseev I, Abakumov E. Permafrost-affected former agricul- Russia. Open Agric. 2019;4(1):684–96. doi: 10.1515/opag- tural soils of the Salekhard city (Central part of Yamal region). 2019-0070. Czech Polar Rep. 2018;8(1):119–31. [19] Government of Newfoundland and Labrador; Department of [3] Alekseev I, Abakumov E, Shamilishvili G, Lodygin E. Heavy Fisheries Forestry and Agrifoods. (http://www.releases.gov. metals and hydrocarbons content in soils of settlements of the nl.ca/releases/2017/exec/0216n01.aspx, 2017). Yamal-Nenets autonomous region. Gigiyena i Sanitariya. [20] Harantova L, Mudrak O, Kohout P, Elhottova D, Frouz J, 2016;9:818–21, (in Russian). Baldrian P. Development of microbial community during [4] Alekseev I, Kostecki J, Abakumov E. Vertical electrical primary succession in areas degraded by mining activities. resistivity sounding (VERS) of tundra and forest tundra soils of Land Degrad Develop. 2017;28:2574–84. doi: 10.1002/ Yamal region. Int Agrophys. 2017;31(1):1–8. doi: 10.1515/ ldr.2817. intag-2016-0037. [21] Hohle EE et al. Agriculture and climate change. Working group [5] Alekseev I, Shamilishvilly G, Abakumov E. Content of trace report (Landbruk og klimaendringer. Rapport fra arbeids- elements in selected permafrost-affected soils of Yamal gruppe). Ministry of Agriculture and Food, Norway. region with different functional load. Polarforschung. Landbruks- og matdepartementet. 2016. 2019;88(2):125–33. doi: 10.2312/polarforschung.88.2.125. [22] Ivanov IV, Alexandrovskiy AL, Makeev AO, Bulgakov DS, [6] Archegova IB. Thermal regime of tundra soils in conditions of Abakumov EV, Arkhangelsskaya TA, et al. Soil and soil cover development and restoration of natural vegetation. Eurasian evolution. Theory, diversity of natural evolution and anthropogenic Soil Sci. 2007;40:954–60. soil transformations. Moscow: Geos; 2015a, (in Russian). 344  Evgeny Abakumov et al.

[23] Ivanov VA, Terentyev VV, Ponomareva AS. Main directions for [33] Obianyo J. Effect of salinity on evaporation and the water accelerating modernization in the agricultural sector in the cycle. Emerg Sci J. 2019;3(4):255–62. doi: 10.28991/esj-2019- rural periphery of the north (Case Study of the Komi Republic). 01188. Econ Soc Changes Facts Trends Forecast. 2015b;3:163–78. [34] Pajares S, Campo J, Brendan J, Bohannan J, Etchevers J. [24] Jansson JK, Tas N. The microbial ecology of permafrost. Nat Environmental controls on soil microbial communities in a Rev Microbiol. 2014;12:414–25. doi: 10.1038/nrmicro3262. seasonally dry tropical forest. Appl Environ Microbiol. [25] Ji X, Abakumov E, Antcibor Y, Tomashunas V, Knoblauch C, 2018;84(1):e00342. doi: 10.1128/AEM.00342-18. Zubrzycki S, et al. Influence of anthropogenic activities on metals [35] Pershina E, Ivanova E, Kimeklis A, Zverev A, Kichko A, in Arctic Permafrost: a characterization of benchmark soils on the Aksenova A, et al. Soil microbiomes of reclaimed and YamalandGydanPeninsulasinRussia.ArchEnvironContaminat abandoned mines of the Yamal region. Polish Polar Rep. Toxicol. 2019;76(4):540–53. doi: 10.1007/s00244-019-00607-y. 2020;41(1):95–114. [26] Jones RT, Robeson MS, Lauber CL, Hamady M, Knight R, [36] Rognes T, Flouri T, Nichols B, Quince C, Mahe F. VSEARCH: a Fierer N. A comprehensive survey of soil acidobacterial versatile open source tool for metagenomics. Peer J. diversity using pyrosequencing and clone library analyses. 2016;4:e2584. doi: 10.7717/peerj.2584. ISME J. 2009;3:442–53. [37] Shishov LL, Tonkonogov VD, Lebedeva II, Gerasimova MI. [27] Kandissounon G, Kalra A, Ahmad S. Integrating system Classification and diagnostics for Russian soils. Smolensk: dynamics and remote sensing to estimate future water usage Oykumena; 2004, (in Russian). and average surface runoff in Lagos, Nigeria. Civil Eng J. [38] Swinnen J, Burkitbayeva S, Schierhorn F, Prishchepov AV, 2018;4(2):378–93. doi: 10.28991/cej-030998. Müller D. Production potential in the “bread baskets” of [28] Kotelina NS, Archegova IB, Romanov GG, Turubanov LP. Eastern Europe and Central Asia. Global Food Security. Peculiarities of nature management and prospects of nature 2017;14:38–53. recovery in the Far North of Russia. Yekaterinburg: Uro RAS; [39] Walker DA, Forbes BC, Leibman MO, Epstein HE, Bhatt US, 1998, (in Russian). Comiso JC, et al. Cumulative effects of rapid land-cover and [29] Laishev K, Ilina L, Filippova V, Dunyashev T, Laptev G, land-use changes on the Yamal Peninsula, Russia. In: Abakumov E. Rumen bacterial community of young and adult Gutman G, Reissell A, editors. Eurasian Arctic Land Cover and of reindeer (rangifer tarandus) from Yamalo-Nenets Land Use in a Changing Climate. Chapter 9. New York: Autonomous District of Russia. Open Agric. 2020;5:10–20. Springer; 2009. p. 207–36. [30] Li F, Chen L, Zhang JB, Yin J, Huang SM. Bacterial community [40] World reference base for soil resources. Rome: FAO; 2014. structure after long-term organic and inorganic fertilization [41] Yan Y, Kuramae EE, Klinkhamer PG, van Veen JA. Revisiting the reveals important associations between soil nutrients and dilution procedure used to manipulate microbial biodiversity specific taxa involved in nutrient transformations. Front in terrestrial systems. Appl Environ Microbiol. Microbiol. 2017;8:187. doi: 10.3389/fmicb.2017.00187. 2015;81:4246–52. doi: 10.1128/AEM.00958-15. [31] Lozupone C, Knight R. UniFrac: a new phylogenetic method for [42] Yilmaz P, Parfrey LW, Yarza P, Gerken J, Pruesse E, Quast C, comparing microbial communities. Appl Environ Microbiol. et al. The SILVA and “All-species Living Tree Project (LTP)” 2005;71:8228–35. taxonomic frameworks. Nucl Acids Res. 2014;42:D643–8. [32] Lyuri DI, Goryachkin SV, Karavayeva NA, Denisenko EA, [43] Zhang R, Chen L, Niu Z, Song S, Zhao Y. Water stress affects Nefedova TG. Dynamics of Russian agricultural lands in the the frequency of Firmicutes, Clostridiales and Lysobacter in 20th century and postagro agrogenic restoration of vegetation rhizosphere soils of greenhouse grape. Agric Water Manage. and soils. Moscow: Geos; 2010, (in Russian). 2019;226:105776.