Insights Into Adenylate Kinase Mechanism and Evolution on the Molecular Level

Home , Adenylate kinase, Adenylate kinase 1

Insights into Adenylate Kinase Mechanism and Evolution on the Molecular Level

Master's Thesis

Presented to The Faculty of the Graduate School of Arts and Sciences Brandeis University Department of Biochemistry Dorothee Kern, Advisor

In Partial Fulfillment of the Requirements for

Master’s Degree

by Lien Phung May 2013

Lien Phung

Acknowledgement

I would like to, first and foremost, thank my wonderful advisor Professor

Dorothee Kern. Thank you for allowing me to work and learn beside you. I am eternally grateful for the opportunity you have given me to do some amazing scientific work. Most of all, thank you for being here. You are a spectacular role model for me; of whom I am so honored to have had the opportunity to work with.

Of course, I will remise if I did not thank my brilliant mentor Dr. Roman

Agafonov. Thank you for your guidance and insights about science and life in general with me. More specifically, thank you for patiently teaching me the technical skills. You have turned a clueless freshman into a scrupulous graduate. I truly appreciate the honesty in your teachings.

I would also like to thank everyone that contributed to the ADK project. I especially miss Young-Jin for his loving personality. I am thankful for his help in the crystallography work. I am equally as thankful for all current and past members of the

Kern lab, Professor Daniel Oprian's lab, and Professor Christopher Miller's lab. Thank you for sharing your wisdoms with me and providing me such a great learning environment.

To my family: thank you so much! Words cannot express how grateful I am for your understandings and supports. You have given me room to explore and grow at my own pace. To mom, dad and my brother Thanh, I apologize for not being there for you

iii often even though you are always there for me (with delicious food!). Please know that I love you unconditionally. I am proud to be your daughter and sister.

To my friends: thank you for being awesome people. You all have been an endless source of encouragement and inspiration for me. I am so happy to have met you all. Sonya and Lena, thank you for being so patience with me, listening to my random outbursts and putting up with my unconventional study habits. It has been a rough ride, but we did it!

I am also forever in debt to the Brandeis SSSP. You were a home away from home for me. Thank you for taking me in and nurtured me into a leader on campus, and blessing me with the confidence I need to become successful. To Gerardo: thanks so much for the support and advices you have given me over the years. I will keep them close to my ears for the rest of my journeys in life.

Lastly, I am pleased to dedicate this work to my mother and 盈姨. Your strong sisterhood bond serves as a light of guidance and inspiration for me to become the best I can be, in life and in education. Thank you.

I would not be where I am today without any one person above. I am grateful for everything you have done for me and be assured that my thanks for you will remain no matter where I go.

Abstract

Insights into Adenylate Kinase Mechanism and Evolution on the Molecular Level

A thesis presented to the Department of Biochemistry

Graduate School of Arts and Sciences Brandeis University Waltham, Massachusetts

By Lien Phung

As part of the essential cellular system that maintains energy homeostasis, adenylate kinases (ADK) catalyze the interconversion of AMP and ATP to 2 ADPs.

Fundamental work on the chemical process is done here to understand the mechanism and the energy associated with how the kinase catalyzes this specific reaction. The

Arg150 residue of A. aeolicus ADK is thought to be directly involved in the process of phosphoryl transfer and stabilization of the transition state. The point mutation R150K was made and its crystal structure was solved. The structure showed that the lysine does not have contacts with the bound nucleotides and thus most likely cannot take part in the catalysis. The rate of the phosphoryl transfer in the wild type enzyme was at least 1000 times faster than in the R150K mutant. This shows that the interactions between the nucleotides and this residue in the protein are important in the minimization of the activation energy for chemical step.

The second shell energy contribution to the phosphoryl transfer was explored through our studies of two ADK isoforms (thermophilic and mesophilic). They have

v significantly different phosphoryl transfer activities despite having identical active sites where the thermophile is 10 fold slower than the mesophile at 25°C. Through sequence and structural analysis of the two isoforms, we identified several residues in the second shell that may have significant contribution to ADK activity. We replaced one of the residues in question from the thermoADK with the corresponding residue from mesoADK. The resulting effect was explored through kinetic studies of the engineered mutant. We found that the mutant exhibited a 20% higher activity relative to the thermoADK. Although the effect of the mutation on the catalytic efficiency of ADK was in the direction we predicted, its magnitude was less than expected.

Additionally, the thermo-stability evolutionary factor was investigated with ADK by measuring the temperature dependence of their overall catalysis. Our preliminary data indicate that ADKs decrease their enthalpic contributions in the catalysis, consistent with the theory that enzymes become less dependent on temperature as they evolve with the earth cooling in time.

Table of Contents

Acknowledgment...... iii

Abstract...... v

Table of Contents...... vii

List of Tables...... ix

List of Figures...... x

List of Abbreviations...... xii

Introduction...... 1

Kinase...... 1

Adenylate Kinase...... 2

Phosphoryl Transfer Reaction...... 4

Essential Active Site Residues...... 6

Second Shell Effect on Enzyme Catalysis...... 8

Protein Evolution and Temperature...... 9

Results and Discussions...... 12

Energy Contributions from Active Site Residues and Mg2+ in Adenylate Kinase...... 12

Second Shell Residues Effect...... 19

Protein Evolutionary Path...... 28

vii Conclusions...... 33

Materials and Methods...... 35

Site Directed Mutagenesis...... 35

Protein Expression and Purifications...... 36

HPLC Analysis Method...... 36

Steady State Kinetics Measurements...... 37

Coupled Enzyme Continuous Spectroscopy Assays...... 37

Hand Quenched Kinetic Assays...... 38

X-ray Crystallography Structure Determination...... 39

AMP Titration Experiments...... 40

Temperature Dependence Assays...... 41

Structural Comparison of Second Shell Residues...... 41

Phylogenetic Tree Construction...... 41

References...... 43

viii

List of Tables

Tables

Table 1. Summary table of the ADK isoforms that will be used for the investigation of enzymatic rate dependence on temperature ...... 11

Table 2. The turnover rate of each enzyme in the presence or absence of Mg2+ at 25°C..13

Table 3. Crystals Refinement Statistics ...... 14

Table 4. Enthalpic and entropic heat of activation of each ADK homologue as extracted from the Eyring equation ...... 30

Table 5. The primers used in the polymerase chain reactions for each respective mutant 36

Table 6. Data collection statistics for the R150K crystals ...... 40

List of Figures

Figures

Figure 1. The tertiary structure of E. coli ADK in cartoon representation ...... 3

Figure 2. The overall ADK reaction, minimal reaction scheme and the corresponding schematic of the catalytic energy landscape based on measured kinetics ...... 4

Figure 3. ADK burst kinetics to test the role of Mg2+ ...... 5

Figure 4. A 3D representation of the residues in eADK and aADK active site ...... 7

Figure 5. Expected variation with temperature of the rate enhancement (kcat) produced by two catalysts ...... 10

Figure 6. Sequence Alignment and Percent Identity of ADK from the isoforms ...... 11

Figure 7. Pre-steady state burst kinetics of mutant ADK in the presence and absence of

Mg2+ ...... 13

Figure 8. The superimposition of WT aADK and two R150K aADK crystal structures. 15

Figure 9. Comparison of the active site of R150K and WT aADK ...... 16

Figure 10. The rates of eADK and aADK steady-state enzyme turnover in the forward direction with varying AMP concentration, 4mM Mg2+ and 4mM ATP at 25°C...... 17

Figure 11. The rates of eADK and aADK steady-state enzyme turnover in the forward direction with varying AMP concentration, 50mM EDTA and 4mM ATP at 25°C...... 18

Figure 12. The phosphoryl transfer activities of eADK and aADK...... 20

Figure 13. The phosphoryl transfer rate determination of eADK and aADK with 8mM

ADP, 30mM EDTA at 25°C...... 20

Figure 14. Residue Y138 of aADK and residue F137 of eADK...... 24

x Figure 15. The phosphoryl transfer rate determination of WT aADK and its Y138F mutant ...... 25

Figure 16. Second shell residue eADK K157 and aADK E151 in context with the essential active site aADK R150 and eADK R156 ...... 27

Figure 17. The temperature dependent catalytic activities of the three ADK isoforms ... 29

Figure 18. Eyring plot of ADK homologues...... 30

Figure 19. The phylogenetic tree of ADK that highlights the evolution of human ADK in relation to bacterial ADK...... 32

Figure 20. The elution profile of the nucleotides ...... 37

Figure 21. Schematic of the coupled-enzyme reaction...... 38

List of Abbreviations

ATP = Adenosine Triphosphate

ADP = Adenosine Diphosphate

AMP = Adenosine Monophosphate

NADH = Nicotinamide Adenine Dinucleotide

ADK = Adenylate Kinase aADK = Aquifex isoform of Adenylate Kinase eADK = E. coli isoform of Adenylate Kinase cADK = Cowellia isoform of Adenylate Kinase

P-transfer = Phosphoryl Transfer

BSA = Bovine Serum Albumin

Mg2+ = Magnesium Ion

MgCl2 = Magnesium Chloride

Arg = Arginine Amino Acid

R150K = Arginine to Lysine mutant at residue 150

R156K = Arginine to Lysine mutant at residue 156

EDTA = Ethylenediaminetetraacetic A*cid

NMR = Nuclear Magnetic Resonance

MD = Molecular Dynamics

Apo = Free, unbound to any substrate form of protein

∆H‡ = Enthalpy of Activation

∆G‡ = Gibbs Free Energy of Activation

xii ∆S‡ = Entropy of Activation

MOPS = 3-(N-morpholino)propanesulfonic acid buffer

HEPES = 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid

TRIS = Trisaminomethane

KCl = Potassium Chloride

HPLC = High Pressure Liquid Chromatography

FPLC = Fast Protein Liquid Chromatography

WT = Wild Type

H-bond = Hydrogen Bond mM = milimolar

μM = micromolar

xiii

Introduction

Kinases

Of the many elements that an organism is composed of, phosphorus and oxygen have always been an important combination. That is because these two elements form a phosphate molecule where in a polymer it forms a kinetically stable but thermodynamically unstable molecule such as ATP. As reported, this ATP molecule is the energy currency of the cell where the breakage of the high energy phosphate bond between the γ and β phosphates releases high amount of energy that the cell incorporate into many different processes from signaling cascade to muscular contraction (1). This special high energy phosphate group can also be transferred from the ATP donor molecule to a lower energy substrate such as ADP, AMP, and serine or threonine residue in a process familiar by many as phosphorylation. This process is beneficial to the organisms in many different ways in that when the large amount of chemical energy is transferred or released, some enzymes are subsequently activated or deactivated depending on their functions. Phosphorylation is often facilitated by biocatalysts. The use of enzymes to aid this process has been advantageous for the cells since they lower the activation energy barriers so phosphorylation can proceed in a timely manner. The fundamental enzymes responsible for the efficient transfer of a high energy phosphate group from ATP to a substrate are named phosphotransferases or kinases. Given the essential nature of kinases, they therefore, are an interesting subject of study. By

1 demystifying the eluding dynamics, structure, and thus mechanism of action of kinases, we can further understand the factors that drive the cells at large.

Adenylate Kinase

Of the many kinases that have been identified, my particular interest is the ubiquitous adenylate kinase (ADK). This enzyme is part of the larger nucleoside monophosphate kinases family that are responsible for maintenance of the homeostatic cellular concentration of nucleotides. Specifically, this 23kDa globular protein catalyzes a reversible transfer of the γ-phosphate from ATP to AMP to produce two ADP in the presence of a magnesium ion (Mg2+). It has three domains: a core region that exhibits a

Rossmann fold, an ATP lid and an NMP lid (2) [Figure 1]. The core domain is composed of a five-stranded, parallel β-sheet surrounded by four α-helices. One of the key components of the core is the highly conserved G-X-P-G-X-G-K-G-T sequence that makes up the phosphate binding loop (P-loop), which plays an important role in the binding of nucleotide triphosphates (3-5). The ATP and NMP lids are the dynamic domains named according to the respective nucleotide they interact with. The phosphate receptor site is not as selective as the phosphate donor site.

Figure 1. The tertiary structure of E. coli ADK in cartoon representation. It shows the three domains of ADK: core (blue), ATP lid (green) and AMP lid (red). The gray sticks are the two ADP molecules that bind to the active site and participate in the P-transfer reaction. This figure was made using pymol version 1.3. (PDB 4JL6, Cho, Y.-J.)

In the absence of ADK, phosphoryl transfer (P-transfer) between the nucleotides takes about 8000 years to complete (6). In the presence of ADK, this reaction occurs on the time-scale of milliseconds. This remarkable acceleration is truly fascinating as it is prevalent to many species, which further highlights its importance in biological processes.

In human, the eight isoforms of ADK are found to be essential in muscle energy metabolism, cardiac contraction, tau phosporylation, sensorineural deafness, apoptosis, transcription regulation and neural development. (7-13) By studying ADK, we will be able to extrapolate our knowledge to other kinases, which in turn will allow us to gain understandings into other biochemical systems that utilize the efficient catalytic nature of these enzymes.

3 Phosphoryl Transfer Reaction

Even though kinases have central role in biology, there is still limited understanding on the specific energetic contributions to the total enzymatic rate acceleration of phosphoryl transfer reactions. While much work has been done on nonenzymatic phosphoryl transfer in solution, less is known about this chemical process in enzymes. Therefore, fundamental work on enzyme-catalyzed P-transfer is needed to quantify specific energy contribution from the enzyme. To do so, we must first dissect the energy contribution from each step in the enzymatic cycle (14).

Figure 2. The overall ADK reaction (bottom), minimal reaction scheme (above) and the corresponding schematic of the catalytic energy landscape based on measured kinetics. These relative energy barriers are deduced from the known rates of lid opening, closing and phosphoryltransfer steps in both the forward and reverse directions as defined. In comparison to the un-catalyzed reaction (dashed line), ADK lowers the energy barrier significantly for phosphoryltransfer.

ADK overall activity includes the binding of nucleotide substrates, a conformational change step of closing, a chemical reaction step of phosphoryltransfer, then again a conformational change step for lids opening and finally the release of nucleotide products [Figure 2]. With NMR spectroscopy and kinetic assay techniques, it

4 is possible to separate these processes from one another (15). This allows us to independently explore the energy contribution from each step in the enzymatic scheme.

Thus, ADK is a good system to use in the study of phosphoryl transfer reactions. While it was previously shown that opening of the ATP and AMP lids is rate-limiting in the presence of Mg2+ (15), it still leaves the question of how the enzyme dramatically lowers the energy barrier of P-transfer. In fact, the recent pre-steady state kinetics work by

Agafonov R. in our group demonstrated that in the presence of Mg2+, the P-transfer step is completed within the dead time of the quench flow instrument of 5μs. This leads to the observed non-zero intercept burst in ATP formation. This means the chemical step is, indeed, not rate limiting. In contrast, without Mg2+, the rate-limiting step becomes the P- transfer step in the reverse (2 ADP to ATP + AMP) direction [Figure 3]. Therefore, all subsequent kinetic experiments without Mg2+ will be beneficial to the study of the specific P-transfer reaction in ADK.

A B

Figure 3. ADK burst kinetics to test the role of Mg2+. These burst experiments were done with a quench flow instrument with 4mM ADP, 25°C in the presence [A] and absence of Mg2+ [B] respectively. In the presence of Mg2+, conformational change of ADK is rate limiting. When no Mg2+ is available, the rate limiting step becomes phosphoryltransfer. In [B], Mg2+ was removed by chelation with 50mM EDTA. The amount of ATP product generated was quantified using HPLC instrumentation. (6)

5 Essential Active Site Residues

An essential part in studying how ADK catalyzes phosphoryl transfer is to understand the structure-function relationships of this macromolecule. Through structural studies combined with kinetics and mutagenesis data, the mechanism a protein employs to accomplish its function can be determined. Crystal structures of ADK from multiple species have been solved. They are available in apo form and in the presence of various natural substrates (AMP, ATP, and ADP) or substrate analogs AMPPNP, AMPPCP, and

Ap5A. This illustrated the conformational differences between the substrate-free and substrate-bound state on an atomistic level (16-25). Yet, this still does not explain to how the kinase activates P-transfer. In probing the mechanism of this step, it is necessary to examine the active site of ADK, the location where P-transfer takes place. Figure 1 above shows that the nucleotide-binding pocket is formed at the interface of the three domains and is lined with several highly conserved arginine residues.

Of those active site arginines studied in E. coli ADK (eADK), mutation of R156 to K156 has previously been shown to be detrimental to the enzyme's turnover rate (6).

However, there has not been any evidence to explain the mechanism of how this mutation caused such loss in activity since crystallization attempts of this mutant with natural substrate were fruitless. One approach is to create this mutation in the extremely stable A. aeolicus ADK (aADK) isoform in hope that a successful crystal structure of it will capture the enzyme-substrate complex of this mutant, which will offer additional information in regards to the specific interactions among active site components during the P-transfer reaction. This is a feasible approach because all the essential active site residues and their 3D spatial arrangement are identical between the two ADK [Figure 4].

6 The effect of the mutation on one species will be indicative of the effect experienced by the other species. From this, we will be able to determine the key residues involved in the

P-transfer reaction and characterize their contributions to the catalytic efficiency of kinase.

Figure 4. A 3D representation of the residues in eADK (blue) and aADK (red) active site. The ADP nucleotides are in yellow. The residues are numbered based on aADK sequence.

7 Second Shell Effects on Enzyme Catalysis

While addressing the fundamental question of how enzymes work, it is important to consider the influence remote residues have on enzyme catalysis. The remote residues in the protein are those that are far away from the active site residues and have no direct contact with the active metal cofactor or substrate in the active site. These residues are appropriately referred as second shell residues throughout this report. It is widely accepted that second shell residues have the capacity to affect the catalytic activity of an enzyme but the mechanism of how they do so is still not well understood. In different enzymes, mutations made to residues located far from the active site reduced enzyme catalytic rate while other resulted in proteins with enhanced catalytic rate (26-28).

There are two evolutionary schemes that could have give rise to the differences in the second shell residues between two proteins and cause them to have two intrinsically different reaction rates despite having identical active sites. One being gradualism where there are many mutations in residues but each one has only a small effect on the catalysis.

The other is known as saltation. This lather method describes the state in which there are few mutations in residues as the enzyme evolves but they each have a large affect on the catalysis. Having the ability to examine the absolute difference in P-transfer rates of eADK and aADK isoforms allow us to use them in the study of different mechanisms second shell residues use to affect the active site of a protein. The initial goal is to identify the second shell residues that contribute to the overall catalytic efficiency in

ADK. Moreover, through this study, it will help elucidate the possible evolutionary path

ADK has chosen.

8 Protein Evolution and Temperature

In terms of protein evolution, there is a widely agreed on but not universally accepted theory that they evolved from a hot to cold environment; there is no direct biological evidence to support this theory. It is hypothesized that life originated on a warm earth and as the environment cools, the rate enhancement functionality of enzymes increased in response (29). Based on the first law of thermodynamics [eq. 1],

Equation 1. there are two ways that an enzyme can lower its Gibbs free energy of activation (∆G‡), which will increase its catalytic rate: by lowering the heat of activation (∆H‡) or by raising the entropy of activation (∆S‡) or both. The contribution from each parameter can be quantified by manipulating the Eyring equation and the first law [eq. 2,3] as the slope and y-intercept of a curve on the ln(rate) versus 1/temperature plot.

Equation 2.

Equation 3.

In the above equations, k is the turnover rate, T is temperature, h is the Plank's constant, kB is the Boltzman's constant and R is the gas constant with other symbols representing the same meaning as in equation 1.

If the rate of the reaction is entropically driven, then the resulting rate enhancement will be negligible when changing temperature. On the other hand, if the process is enthalpically driven, then there will be a change in the rate dependence on temperature in each evolved enzyme. This would result in a greater rate enhancement from the enzyme as the environment cools [Figure 5]. Therefore, it is hypothesized that

9 the rate enhancement resulted from protein evolution is achieved through the enthalpy- lowering mechanisms as previously suggested (29).

Figure 5. Expected variation with temperature of the rate enhancement (kcat) produced by two catalysts, acting (A) by enhancing a reaction’s entropy of activation, or (B) by reducing a reaction’s enthalpy of activation. With the same change in temperature, the rate enhancement resulted from decreasing ∆H‡ is significantly greater than increasing ∆S‡. Figure was reproduced from (29) with permission of Dr. Stockbridge. With ADK being so prevalent among species, we now have a system that can be used to address the theory directly. We have three ADK isoforms from different bacterial species that can help demonstrate the effect temperature has on rate. Examining the isoforms' rates in terms of temperature will further elucidate the thermodynamic nature of their turnover efficiency. Each isoform is from a different type of bacteria who thrives at different temperature; hence they each have a different temperature dependence on their

10 catalytic activity [Table 1]. All the active site residues are conserved among the species as well [Figure 6].

Organism Type Temperature Optimum Temperature Optimum Gram (Abbreviation) Range of Growth Range of Activity Growth Temperature Activity Temperature E. coli mesophile 10-45°C 37°C ≤ 54°C 50°C (-) (eADK)(15) A. aeolicus hyperthermophile 67-95°C 85°C ≤ 107°C 92°C (-) (aADK)(15, 30) C. psychrophile -15°C - 19°C 8°C ≤ 30°C 28°C (-) psychrerythraea (cADK)(31) Table 1. Summary table of the ADK isoforms that will be used for the investigation of enzymatic rate dependence on temperature.

Figure 6. Sequence Alignment and Percent Identity of ADK from the isoforms. In the sequence alignment, green indicates residues that are 100% identical across all sequences and blue residues have 60-80% similarity. The alignment was prepared using MUSCLE software package and visualized in Genenious 6.0 program.

Results and Discussions

Energy Contributions from Active Site Residues and Mg2+ in Adenylate Kinase

Among the several active site residues of ADK, R156 of eADK has been shown to be important for the overall turnover. We wanted to measure the energy contribution to individual steps in the enzymatic cycle, specifically the chemical step. To accomplish the goal of explaining the observed severe effect with mechanism on the atomistic level, the

R150K mutant of the aADK homologue was made via site-directed mutagenesis. The mutant DNA was successfully expressed in E. coli (BL21 strain) and purified using the

AKTA FPLC system. The fractions that contained the highest purity of protein were combined and used to perform kinetic assays and set up crystal trays.

While previous studies were not aware of the many catalytic steps Mg2+ influences (15), we have the ability to offer some insights to the energy contribution of this metal ion to the different steps. Through pre-steady state kinetics and NMR methods, we were able to differentiate between the different microscopic steps. The specific focus of this work is on the phosphoryl transfer step of the overall reaction. Since Mg2+ has a significant role in the catalysis and P-transfer efficiency of the WT ADK (6), a pre-steady state kinetic assay was performed to address the effect the metal has on the mutant ADK as well. Interestingly, there is no burst in ATP production for the mutant enzyme in the presence or the absence of Mg2+ [Figure 7]. This indicates that the replacement of Arg with Lys in the 150 position causes the P-transfer reaction to slow down severely such that it is the rate limiting step regardless of metal presence, unlike the case with WT

12 ADK. Our pre-steady state kinetics experiments show that Arg150 drastically accelerates the P-transfer step.

A B

Figure 7. Pre-steady state burst kinetics of mutant ADK in the presence (orange) and absence (green) of Mg2+ (6). These burst experiments were done with a quench flow instrument with 4mM ADP, 25°C in the presence [A] and absence of Mg2+ [B] respectively. The single amino acid substitution from Arg to Lys showed a significant effect in the catalytic efficiency of ADK. The observed rates of nucleotide turnovers for WT aADK and eADK with their respective mutants are tabulated in Table 2 below.

Compared to the mutants, the arginine residue in the WT alone accelerated the overall turnover by 44 times in aADK and 220 times in eADK. Coupled with the loss of Mg2+, the overall turnover rate of the arginine mutants are more than 6 orders of magnitudes less than that of the WT enzyme. This shows that this single residue is extremely important in the rate acceleration of ADK.

aADK WT aADK R150K eADK WT eADK R156K (-) Mg2+ (2.9 ± 0.1)E-04 s-1 (8.1 ± 0.7)E-06 s-1 (50 ± 30)E-04 s-1 (9.2 ± 0.9)E-06 s-1 (+) Mg2+ 71 ± 2 s-1* 1.64 ± 0.16 s-1 131.9 ± 1.5 s -1* 0.64 ± 0.13 s-1 Table 2. The turnover rate of each enzyme in the presence or absence of Mg2+ at 25°C. *Note: these kcat are lid-opening rates.

13 How it exerts its importance to the reaction is explored through the high resolution crystal structures of R150K aADK. The crystals were successfully harvested and analyzed as described in the methods section. The two best crystal structures were solved to the resolution of 1.73Å and 1.43Å. The complete crystal refinement data is presented below.

aADK R150K 1 aADK R150K 2 Resolution (Å) 42.42-1.73 36.06-1.43 Completeness (%) 100 100 No. of Reflections 43853 74936 No. of refined atoms (Protein and ligand, water) 3993 (3475, 518) 4176 (3473, 703)

R/Rfree 0.1609/0.2105 0.1530/0.1952 Angles RMSD (°) 1.2217 1.2536 Bonds RMSD (Å) 0.0060 0.0053 Average B factors (Protein, 22.6 (21.3, 15.6, 22.3 (20.1, 14.9, ligand, and water) 32.7) 33.6) PDB ID 4JLO 4JLP Ramachandran outliers (%) 0.0 0.0 Ramachandran favored (%) 99.52 99.76 Rotamer outlier (%) 1.36 0.82 Clashscore 5.47 5.0 Table 3. Refinement Statistics

Figure 8. The superimposition of WT aADK (gray) and two R150K aADK (green and blue) crystal structures. As seen in the figure above, the single amino acid substitution did not affect the folding and the conformation of the protein overall. The 3D arrangement of the other amino acids beside the R150K residue are not disturbed either [Figure 9]. With the substituted residue shorter in length than the original, the distance (~4.5Å) between the amine group on lysine and the beta phosphate of the donor phosphoryl group is longer than the distance (~2.8Å) observed for the original arginine. The lysine replacement of arginine disrupted the hydrogen bonds that existed between the phosphate and Arg150.

Coupled with the drastic rate deceleration data, we can confidently assess that while the

Lys side-chain satisfies the charge balance in the active-site, it is the bidentate guanidinium group of the Arg side-chain that specifically coordinates the phosphoryl group and helps position the reactants for catalysis. Since the values of the WT rates in the presence of Mg2+ [Table 2] reflect the lid-opening rate [Figure 3], the P-transfer rate

2+ for WT ADK with Mg is even greater than the measured kcat. A lower limit for the P-

15 transfer of 500 sec-1 was derived from the quench flow instrument dead time of 5 μs. The loss of the ability to coordinate the phosphoryl group alone increased the relative energy barrier of the P-transfer reaction by at least 103 fold. This allows us to assign the total rate of P-transfer acceleration from Mg2+ and Arg together to be larger than 108 fold.

Figure 9. Comparison of the active site of R150K and WT aADK. The two molecules in the asymmetric unit of R150K 2 (A molecule, marine); R150K (B molecule, green), R150K 1 (A molecule, orange) and R150K 1 (B molecule, red) are superimposed with the WT aADK (B molecule, grey).

The rate acceleration from the presence of Mg2+ not only changed the rate limiting step of catalysis, it may also be a contributing factor in the inhibitory characteristic observed in the forward (starting from ATP/AMP substrate complex) nucleotide conversion. This behavior is largely the reason why accurate measurements of

16 the P-transfer with Mg2+ cannot be done in this direction. The AMP titration effect on the catalytic rates of reaction with Mg2+ for both eADK and aADK are shown in Figure 11.

For eADK, it has been shown before that the forward reaction with Mg2+ shows substrate inhibition by AMP (32). This is due to the slow release of the MgADP-AMP complex. In this state, the substrate formation inhibits the enzyme activity since the active site cannot catalyze the P-transfer reaction of this complex, decreasing its efficiency. The work on aADK shows similar behavior where the activity of the enzyme decreases with increasing concentration of MgAMP after reaching an initial maximum turnover (Murphy N.P., unpublished). The non-zero plateaus observed in both scenarios suggest that at high AMP concentration, the MgADP-AMP complex is released at a rate limiting frequency.

A B 140

120

)

1 - 100

20 Enzyme Enzyme Turnover (s 0 0 5 10 15 [AMP] (mM) Figure 10. The rates of eADK (A) and aADK (B) steady-state enzyme turnover in the forward direction with varying AMP concentration, 4mM Mg2+ and 4mM ATP at 25°C. To address the contribution of Mg2+ to this observed behavior, we resolve to examine the relative activities of each homologue through measuring the enzyme turnover rate in the forward direction with increasing AMP concentration and saturating concentration of 4mM ATP. This experiment also allowed us to gain deeper insights into the comparable behaviors of the homologues active sites. As shown below, in the absence of Mg2+, the turnover of both enzymes are well characterized by simple Michaelis-

17 Menten binding kinetics. Substrate inhibition was not observed in either protein. We cannot conclude that the inhibitory complexes do not form in the absence of Mg2+. It is more likely that the rate deceleration of the chemical step due to the lack of Mg2+ is so significant that the release step of the ADP-AMP complex is no longer the slowest step in both ADK isoforms.

A B

0.009 0.00065

)

1 - - 0.008 0.0006 0.007 0.00055 0.006 0.0005 0.005 0.00045 0.004 0.0004 0.003 0.00035 0.002 0.0003

0.001 0.00025 Enzyme Turnover (s Turnover Enzyme

Enzyme Turnover (s Turnover Enzyme 0 0.0002 0 2 4 6 8 10 0 2 4 6 8 10 [AMP] (mM) [AMP] (mM)

Figure 11. The rates of eADK (A) and aADK (B) steady-state enzyme turnover in the forward direction with varying AMP concentration, 50mM EDTA and 4mM ATP at 25°C.

Through the experiments with R150K and Mg2+, we have highlighted two factors that contribute tremendously to the dramatic catalytic efficiency of ADK. The similar

AMP inhibition characteristics between the two ADK homologues strongly demonstrate that the two active sites exhibit similar behaviors.

18 Second Shell Residues Effect

Based on the data presented above, we hypothesize that the catalytic efficiency of the chemical step between the two homologues are similar. Much to our surprise, metal free steady state kinetic assays revealed that the P-transfer rate of WT eADK is an order of magnitude greater than WT aADK despite having the identical active sites. The plateau of ATP produced in the 5 hours time course steady state experiment without Mg2+ indicates that eADK has already reached equilibrium in this reversible reaction. In the same time frame, ATP production by aADK was still in the linear portion of the logarithmic trend of product formation curves. The reaction in aADK has yet to reach equilibrium and ATP formation is still favored over the backward reaction. At the first time point of one-half hour, eADK has already formed a significant amount of product and reached the end of the linear phase [Figure 12]. This qualitatively shows that the P- transfer activity of eADK is significantly faster than that of aADK. To quantify the P- transfer rate of each respective homologue, additional steady state kinetic assays in smaller time courses were conducted [Figure 13]. The P-transfer rate approximated from the first order linear fit for eADK is (50 ± 30) E-04 s-1 and aADK is (2.9 ± 0.1) E-04 s-1.

These values are recorded in Table 2 above.

Since ADK have selective preference for Mg2+ as the metal cofactor in rate acceleration (32), we can compare the P-transfer rates by over saturating the enzyme with

Ca2+ instead of chelating the reaction. Ca2+ will maintain the charge balance yet it will not accelerate the P-transfer step as significantly as Mg2+ would. The measured P-transfer rate from similar steady state kinetic assays yielded 2.53±0.94 s-1 for aADK and 19±4s-1

19 for eADK. The same magnitude of difference in P-transfer activity is observed between the two isoforms.

2500

2000

1500

1000 [ATP] (µM) [ATP]

500 eADK aADK 0 0 1 2 3 4 5 Time (Hr)

Figure 12. The phosphoryltransfer activities of eADK and aADK. Both reactions were conducted in the presence of 30mM EDTA, 8mM ADP in 50mM Tris and 80mM KCl at 25°C with 100μM of ADK.

A eADK B aADK 1400 1300 1200 1200

1100

1000 M)

M) 1000 μ 800 μ 900 600

800

[ATP] ( [ATP] [ATP] ( [ATP] 400 700 200 600 0 500 0 500 1000 1500 2000 4000 9000 14000 19000 Time (sec) Time (sec) Figure 13. The phosphoryltransfer rate determination of eADK (A) and aADK (B) with 8mM ADP, 30mM EDTA at 25°C.

20 All throughout our discussion above, we focused on the contributing factors to the

P-transfer reaction efficiency in the ADK active site. However, it is important to note that second shell residues are known to have contributing effects to enzymes' efficiency too

(26, 27). That is, the interactions of the second shell residues may have led to a more efficient catalysis in one enzyme compared to the other. The interactions may be among the remote residues themselves or they may be between the remote residues and the active site residues. The perturbation of one residue may lead to a change in movement of another residue downstream, which eventually would influence the trajectory of the active site residues. Depending on the effect these second shell residues have on the active site, it may help the active site residues to be more coordinated and thus become a relatively better catalyst.

For the P-transfer reaction to happen, the orbital in the terminal phosphates of each substrate must overlap with each other. To achieve this, the active site must bring the substrates closer together. In the crystal structures, the substrates are 2 Å too far apart for a reaction to take place. Therefore, a dynamic change in the conformation of the crystallized active site must occur so that the nucleotides can achieve the optimum distance apart. Dynamic conformational change is key to the understanding of the second shell effect because the second shell does not cause a static change in the active site. This is illustrated through the crystal structures of eADK and aADK since we do not observe a difference in the super-imposable active sites conformations [Figure 4].

Furthermore, the crystal structures only capture one state of the protein even though there is an ensemble of conformations that the protein can exist in. The average positions of the molecules solved from the crystal structure do not accurately show the

21 range of positions when the entire protein is in dynamic motion. In the course of a reaction, a protein can interchange among many different states but there is only one productive state when the bound substrates are close enough to each other and at the right orientation. At each different state, the probability of substrates achieving the optimum reaction distance changes accordingly.

The second shell residues can affect the ability to be in the right conformation to react through long range conformational dynamics. That is, the motion of these distant residues will affect the movement of the active site thus changing the positions of the substrates, bringing them closer so they can undergo P-transfer. The transition state distance needed will result from the increase in energy that is contributed by the second shell. There are two independent but not mutually exclusive methods whereby long range conformational dynamics can affect the catalytic efficiency of the active site. The interactions of the second shell residues can result in different probabilities of states or conformational ensemble between the isoforms. Thus, the probability of being in the productive state for each enzyme will differ. The other possibility is that the second shell coordination causes the rate of interconversion between states in the two homologues to be different, without affecting the probability to be in each state. This will cause the number of productive states to be different between the isoforms as well.

Since some amino acid residues are charged, the long-range electrostatic effects can also have an important role in the active site activities. The relative electrostatic intensity that surrounds the active site can contribute to the stabilization of the charges the nucleotides feel within the active site. A difference between the long-range electrostatic charges can lead to the different observed P-transfer rates. Even with an

22 optimized active site, a protein can still further improve its catalytic efficiency by evolving its second shell residues. Thus, the idea of second shell influence is feasible because it is the only difference between the two homologues in all experiments.

However, not the entire second shell is different between these two enzymes.

Looking at the primary sequence of the proteins, it is hard to distinguish which amino acids are in the second shell. Therefore, the tertiary structures of the proteins were used in conjunction with their sequences to identify other differing second shell residues.

Detailed structural comparison of the two enzymes reveals several satellite residues that may contribute to the difference in rates observed between the two homologous enzymes.

Of the ones identified, we have particular interest in aADK Y138/eADK F137 [Figure

14]. While both are aromatic residues, Phe lacks the hydroxyl group that allows for side chain polarity and H-bonding ability as with Tyr. For aADK, Tyr138 is situated at one of the three main points of contact the upper ATP domain has with the core. This Tyr can make an ionic bridge with the Arg 120 and form a stacking configuration with the ATP bound nucleotide. This residue also exhibits different kinds of fluctuations in Molecular

Dynamics (MD) simulations of the closed, opened and partially opened states of aADK based on some metrics (33). All of the above reasons may lead aADK to place the ATP nucleotide in a conformation that is not as stable as eADK, which would lead to a relatively lower catalytic efficiency. To investigate the specific contribution of this difference to the observed rate discrepancy, we will need to make an aADK Y138F mutant. Then through steady state kinetics studies, we will be able to determine the rate acceleration due to this difference in the two homologues.

Figure 14. Residue Y138 (red) of aADK and residue F137 (blue) of eADK. The resulting P-transfer rate of the aADK Y138F mutant is 20% higher in comparison to the WT aADK [Figure 15]. While this increase in rate is in the expected direction, it was not sufficiently significant to assess its contribution to the 10 fold difference between the aADK and eADK P-transfer rate. This suggests that it is likely to be a large number of effective second shell residues that work together to affect the active site catalytic efficiency. It is thus necessary to search for and test other second shell residues to determine their contributions to the P-transfer rate.

24 160

140

120 (3.56±0.01)E-04 s-1

100

[ATP] (µM) [ATP] 60 aADK WT 40 (2.88±0.12)E-04 s-1 aADK Y138F 20

0 0 10 20 30 40 50 60 Time (min)

Figure 15. The phosphoryl transfer rate determination of WT aADK and its Y138F mutant. 100μM of each ADK were reacted with 8mM ADP, 50mM EDTA at 25°C.

If the differences in the second shell residues between the two homologues were the result of evolutionary pressures, and the effect on catalytic efficiency contributed by each remote residue is negligible, then this is a demonstration of gradualism at work.

While we are cautious of drawing such conclusion from one observation, it is important to note that the potential to validate this hypothesis acts as another motivation in pursuing the issue of how second shell residues affect the active site further.

Upon closer inspection of Table 2, we see that when the Arg residue was removed, the P-transfer rate of the eADK mutant and the aADK mutant were of the same magnitude. Yet, WT eADK and aADK were 10 fold different. This suggests that in the removal of Arg, we also removed a second shell effect. Through this logic, the acting second shell residues must be near the Arg of the WT enzymes, yet do not have direct contact with Arg or the nucleotides in the active site. A survey of the environment around

25 the Arg and the other residues it interacts with revealed a difference of E151 for aADK and the corresponding K157 of eADK. These residues are in the loop region on the ATP lid. As shown in Figure 16, the side chain of K157 points down toward the Arg while the side chain of E151 points outward to the solution interface. From where they are, neither residue has the capacity to have direct contact with the Arg residue. However, K157 can

H-bond with the neighboring D158, which does have the capacity to H-bond with the active site R156 in eADK. E151 of aADK lacks this ability. It is possible that the additional coordination from K157 in eADK can help stabilize the Arg and help exclude more water from the active site. Additionally, the effect could be due to long-range electrostatic effects since E151 is negatively-charged and K157 is positively-charged.

The positive charge around the active site may help balance the negatively-charged nucleotides inside. Thus, the P-transfer in eADK would be more efficient than it is in aADK as observed. To investigate the specific contribution of this difference to the observed rate discrepancy, we will need to mutate the E151 in aADK to a Lys. Then through steady state kinetics studies, we will be able to determine the rate acceleration due to this difference in the two homologues.

26 A E151

K157

D158 D152

R156 R150

B C E151

K157

D152 D158

R150 R156

Figure 16. (A) Second shell residue eADK K157 (cyan) and aADK E151 (orange) in context with the essential active site aADK R150 and eADK 156. The interaction among the residues in eADK (B) and aADK (C) are also shown.

27 Protein Evolutionary Path

Gradualism and saltation describe the possible adaptation mechanisms that an evolving protein may have used. A broader question in regards to protein evolution still remains, that is: which path did they take? How did they response to different evolutionary pressures throughout the history of time? The particular influence of temperature on protein adaptation was explored using ADK as the model system for other biocatalysts. This will further allow us to determine if the earth did evolve from a hot to cold environment in biological contexts.

In our ADK system, we used three homologues: thermophilic aADK, mesophilic eADK and psychrophilic cADK. Their respective turnover activities dependence on temperature was measured and the activity profile of each homologue is produced in

Figure 17. The profile accurately reflects that aADK is indeed the most thermodynamically stable isoform out of the three. For all ADK, their activities started to waiver near their respective reported melting temperature [Table 1].

Figure 17. The temperature dependent catalytic activities of the three ADK isoforms. 2+ Each measurement was collected at saturating ADP concentration with 4mM Mg .

The turnover rate and absolute temperature relationship was transformed using the Eyring equation so that the enthalpic and entropic contributions to the enzymes' catalytic efficiency can be calculated. The resulting Eyring plot is shown below. While eADK and cADK log(rate) values are linearly correlated to the inverse of absolute temperature, aADK is not. Instead, there seem to be two distinct linear segments on the aADK curve and the segments intersect at 25°C. The unexpected curvature behavior may be due to a change in the rate limiting step of the catalysis. Reflecting upon the movement of the enzyme during catalysis as demonstrated by NMR spectroscopy and MD simulations at

25°C (15), we often see both lids on the enzyme open to release the product at about the same rate. However, it is possible that towards the extreme temperatures, they no longer open at the same rate. This hypothesis can be tested with NMR spectroscopy techniques, which will be a subject of future experiments.

29 -170

-180

) 1

- -190

K y = -45760x - 44.377

1 - R² = 0.9439 -200

] (J mol (J ] -210

-220

h/kBT y = -28745x - 109.74

cat R² = 0.9479 -230 eADK

R*ln[k -240 aADK y = -122007x + 200.84 cADK -250 R² = 0.9888

-260 0.0028 0.003 0.0032 0.0034 0.0036 0.0038 0.004 -1 1/T (K )

Figure 18. Eyring plot of ADK homologues.

∆H‡ (kJ/mol) ∆S‡ (J/mol K) aADK 122±8* 200±27* eADK 46±4 -44±14 cADK 29±3 -110±12 Table 4. Enthalpic and entropic heat of activation of each ADK homologue as extracted from the Eyring equation. *Note: these values were calculated using the slope and intercept from the rates at lower temperature. Since the linear fit of the eADK and cADK curves were calculated from the lower temperature range, a similar estimation can be done for aADK as well so that a preliminary understanding of enzyme evolution can be inference from. Fitting the curves in the same temperature range will allow for more accurate analysis of the ∆H‡ and ∆S‡ values for each isoform. The values of H‡ and S‡ were extracted as the slope and intercept from each respective curve on the Eyring plot [Table 4]. These data strongly suggests that the earth did evolve from a hot to cold environment in time. The enzyme adapted in a way that it became less dependent on the thermal energy from the high

30 temperature surroundings as the earth cools. This is the first time such conclusion can be made from a direct measurement of the temperature effect on enzyme evolution.

The evolutionary path of ADK has led it to become a prominent protein in the highest hierarchal organism that is human. We were made aware that there are 8 human

ADK isoforms. To extend our understanding of the evolution trajectory of this enzyme, we constructed a phylogeny tree [Figure 19] that focused on the ubiquity of ADK in bacteria and vertebrae. It is interesting to note that the enzyme evolved such that the isoforms that share the same branch is localized in the same cell organelle. The comparison of their kinetic parameters shows that even within the same branch and thus same cell localization, they have significantly different catalytic efficiency (11, 34, 35).

Why human needs such a rather large number of isoforms of the same protein is the question that will need further research efforts in. We hope to extent our knowledge of the ADK from bacterial cellular environment to those in human in the future, where

ADK is shown to be pertinent to several health issues. Understanding the phosphoryltransfer mechanism in human ADK can further the evolution studies of how this ubiquitous protein evolves throughout the earth’s history.

31 Cytosolic

Nuclear

Mitochondrial

Figure 19. The phylogenetic tree of ADK that highlights the evolution of human ADK in relation to bacterial ADK.

Conclusions

Several key players in ADK P-transfer activity were identified by kinetic assays and structural analysis. Point mutant and homologous enzymes were compared to A. aeolicus adenylate kinase. We found that Arg150 in aADK is important in the kinases’ catalysis. This loss of Arg150 resulted in a decrease in the enzyme’s phosphoryl transfer rate by at least 103 times. Mg2+ also significantly increases the efficiency of the P-transfer reaction, such that it is much faster than the release of the inhibitory ADP-AMP complex.

Together with the loss of Mg2+ and Arg150, the kinase’s phosphoryl transfer activity is decreased by more than 8 orders of magnitude!

In comparing the two homologues with identical active sites, we found that the rate of phosphoryl transfer of WT eADK is (50±30) E-04 s-1, which is faster than

(2.9±0.1) E-04 s-1 for WT aADK. With Ca2+ (instead of Mg2+), aADK rate (2.53±0.94 s-1) was also slower than eADK rate (19±4s-1) by the same factor. This indicates that long range conformational dynamic interactions among the second shell residues contribute to the phosphoryl transfer rate. The point mutation on the aromatic residue 138 in the ATP lid of the enzyme demonstrates that residue Y138 is not the only effective second shell residue in ADK. It is likely that a cohort of residues work together, each contributing a small amount, to affect the active site catalytic efficiency. It is thus necessary to search for and test other second shell residues, such as E151, to determine their contributions to the phosporyl transfer rate.

Having different activities may be an evolutionary response to the enzyme’s natural environment as well. Our temperature dependent catalytic activities experiments show that the thermoADK has the highest melting temperature than other studied homologues. Prior to its melting temperature, the mesoADK exhibits higher activity than other ADK homolog in this study. The enthalpy and entropy of activation of each ADK were determined using the Eyring relations. Temperature dependence data provide biological support that the earth transitioned from a hot to cold environment. The organisms adapted to this directional change by altering their enthalpy of activation so that their rate dependence on temperature is lessen. In summary, experimental data obtained from the ADK homologues and the molecular phylogenetic tree provide some information about the forces responsible for barriers in conformational transitions and gave hints about ADK evolution.

The findings presented here laid a foundation for future progress in the study of

ADK. We have yet to have the full understanding of how the second shell residues influence the active site of the enzyme. Therefore, other second shell residues also need to be tested for their contribution to the catalytic efficiency of ADK. Other computational approaches can be explored to further the goal as well. Moreover, to be convinced that the earth progressed from a hot to cold environment, it is necessary to resolve the curvature observed in aADK Eyring plot. Possible approaches would be to do CPMG,

NMR methods to determine if there is change in rate limiting opening. The answers to these puzzles will be essential in the understanding of how enzymes and biological processes work at large. They will also help in the understanding of - and thus improving

- human health globally.

Materials and Methods

All nucleotides (ATP, ADP, and AMP) were supplied by Sigma-Aldrich at 99%

+ purity. HEPES, NAD , D-(+)-Glucose and IPTG were acquired from Sigma-Aldrich.

TRIS, Potassium Phosphate, EDTA, MgCl were acquired from Fisher. All buffer solutions were made by solvating the crystal form of the buffer to the required concentration. BSA, Glucose-6-phosphate Dehydrogenase and Hexokinase were obtained from Sigma-Aldrich. All other proteins were expressed and purified in Kern's laboratory at Brandeis University.

Site Directed Mutagenesis

The wild-type aADK plasmid was obtained as described (15) and used as the template for the generation of mutant plasmids which have 1-3 base pairs changed in the

DNA sequence. All primers used were ordered from IDT [Table 5]. All mutants were engineered using the polymerase chain reaction technique (36) and transformed into the

DH5α strain of E. coli. The resulting mutants' DNA were extracted using the BIONEER

Plasmid Mini Extraction Kit K-3111 and their sequences were confirmed at Genewiz. aADK Mutant Primers Forward: CCGCCTCCCGGTGTGAAGGTTATTCAAAAAGAAGACGACAAACCCG R150K Reverse: CGGGTTTGTCGTCTTCTTTTTGAATAACCTTCACACCGGGAGGCGG Forward: CCGGTGAAGTGTATCACGTTAAATTCAATCCGCCGCCGCCGGGCG Y138F Reverse: CGCCCGGCGGCGGCGGATTGAATTTAACGTGATACACTTCACCGG

35 Table 5. The primers used in the polymerase chain reactions for each respective mutant. The annealing temperature for the arginine mutant was 60°C and 62°C for the tyrosine mutant. Protein Expression and Purifications

Wild-type A. aeolicus ADK, E. coli ADK, C. psychrerythraea ADK and the

R150K mutant were overexpressed and purified as described (15, 37) with a few modifications. The cells were grown in the presence of 100 μg/mL ampicillin. aADK were not incubated in 80°C bath after cell lysis as previously done (15). The buffers used during the purifications were pH 7.0. The final purified and concentrated proteins were stored in -80°C with 1mM TCEP.

HPLC Analysis Method

The amount of product resulted from hand-quenched steady-state kinetic measurements were quantified using high-pressure liquid chromatography (HPLC).

Protein precipitated by quench was separated using Spin-X centrifugal tube filters

(Costar), filtered supernatant was diluted to avoid HPLC detector saturation, and pH was brought to 6.0 to achieve optimal separation. The samples were analyzed on an HPLC system (Agilent Infinity 1260) with a high precision autosampler (injection error <0.1

µL), analytical HPLC column ACE (i.d. 2.4mm, length 250mm, C18-AR, 5Å pore-size) and separated using isocratic elution with potassium phosphate mobile phase (100 µM, pH 6.0). [Figure 20] Control experiments were performed to determine residual contamination in the commercially purchased ADP, ATP and AMP stocks.

Figure 20. The elution profile of the nucleotides. The area under the peak corresponds to the concentration of each respective nucleotide for each sample.

Steady-State Kinetics Measurements

Coupled Enzyme Continuous Spectroscopy Assays

The experiments were done in the ADP to AMP and ATP direction in the presence of Mg2+. [Figure 21] The 50mM TRIS, 80mM KCl pH 7.0 reaction buffer contained 4mM MgADP, 5mM glucose, 1 unit/μL Hexokinase, 1 unit/μL G6P

Dehydrogenase and excess NAD+. The final reaction volume was 500μL and it was incubated at 25°C throughout. The Cary 100 Bio UV-Visible Spectrophotometer was used to monitor the proceeds of the reactions. The reaction rate was determined by measuring the rate of NADH production in absorbance at 340 nm with time, which is an indirect measure of ATP production. The background (baseline) activity was measured before the addition of ADK to start the reaction and was subtracted from the overall rate to isolate the rate measurement corresponded to ADK activity (38).

Figure 21. Schematic of the coupled-enzyme reaction.

Hand-Quenched Kinetic Assays

Steady-state kinetics measurements were collected with 4 mM ADP and equimolar (with nucleotide) concentrations of Mg2+. The enzyme concentration was varied between 0.5 nM to 25 nM; 0.3mg/mL BSA; buffer was 50 mM TRIS (pH 7.0) and

80 mM KCl; measurements were collected at 25°C. The reactions were quenched with 10%

TCA, 2M HCl and spun down as described. They were then neutralized with 1.0M

Potassium Phosphate. The amount of product produced over 8 min was quantified using high-pressure liquid chromatography (HPLC) as described above.

For measurements of the P-transfer kinetics, the Mg2+ was chelated out of solution with 50mM EDTA. Enzyme concentration used was 100μM and ADP concentration varied between 8mM and 16mM. The reaction buffer, temperature, quench and neutralization remained the same. The analyses of products were done with HPLC as well.

38 X-ray crystallography structure determination

aADK R150K was co-crystallized with 18mM ADP and 18mM AMP and grown either at 18 or 22 °C with 20-50 mg/mL protein in 20 mM Tris-HCl buffer (pH 7.0) (39,

40) in sitting drops and hanging drops setups. All complexes were mixed with the crystallization solution that contains 0.1 M sodium acetate trihydrate (pH 4.6), 0.2 M ammonium acetate, and 30% (w/v) polyethylene glycol 4000 in a 1:1 (v/v) ratio.

Diffraction data were collected at 100K at the Advanced Light Source (Lawrence

Berkeley National Laboratory) beamlines (8.2.1 and 8.2.2) and Advanced Photon Source

(23ID-B). The details of the data collection are listed in Table 6. Data were processed, scaled, phased, and refined in sequence by using iMOSFLM (41), Scala (42), Phaser (43), and REFMAC5 (44) in CCP4 (45). The space groups were determined by Pointless (46) and are identical for all data sets: P212121. The initial molecular replacement search model was from ADK structures (PDB ID 2RGX) without ligand. First refinement was carried out, followed by manual rebuilding in Coot (47, 48), and iterative further refinements were carried out using PHENIX (49). For data sets with atomic resolution better than 1.7 Å, the individual anisotropic ADP refinement method was applied. The final structural models were validated in each data set by comprehensive validation in

PHENIX (phenix.model_vs_data) (50). All samples have 2 molecules in the asymmetric unit. Structural figures were prepared in PyMOL(51).

39 aADK R150K 1 aADK R150K 2 Wavelength (Å) 0.9998 0.9999 Resolution (Å) 48.80-1.73 (1.82-1.73) 36.57-1.43 (1.51-1.43)

Rmerge 0.054 (0.123) 0.053 (0.268) Unique Reflections 43939 (6330) 75039 (10806) I/σ 18.1 (6.5) 17.5 (4.3) Completeness (%) 99.9 (100.0) 99.9 (99.8) Multiplicity 6.4 (5.0) 6.7 (5.1) Cell Dimensions 67.17, 71.01, 85.83 67.01, 70.46, 85.58 Space Group P212121 P212121 Beamline ALS BL 8.2.1 ALS BL 8.2.1 Table 6. Data collection statistics for the R150K crystals. The highest resolution shell is shown in parentheses.

AMP Titration Experiments

The forward reactions (ATP + AMP ↔ 2ADP) in the presence and absence of

Mg2+ were conducted with 25μM aADK or with 12.5μM eADK in 50mM TRIS, 80mM

KCl, pH 7.0 buffer. Hand-quenched kinetic assays were done over a range of AMP concentration (0.3mM-10mM) holding ATP and Mg2+ concentration constant at 4mM each. In the experiments without Mg2+, any residual amount of the ion was chelated out of solution with 50mM EDTA. The reactions were maintained at 25°C throughout. Each time point in the aADK reactions was quenched using 1:1 mixture of reaction with 30%

TCA and 6M HCl. For eADK, the quenching solution used was 3M HCl. They were subsequently spun down as described above, then neutralized with 1.0 M Potassium

Phosphate, 100mM EDTA to restore the nucleotide solution to near neutral pH. The products were then analyzed using the HPLC analysis method mentioned above. The turnover rates of ADK at each AMP concentration in the presence and absence of Mg2+ was analyzed in Microsoft EXCEL.

Temperature Dependence Assays

Hand-quenched kinetic assays were repeated over the temperature range of 0°C -

100°C. The assays were performed under ambient pressure in 50 mM MOPS, 80mM KCl pH 7.0 buffer. ADK was incubated in the temperature being tested for 5 minutes before it is added into a mixture of 4mM equimolar MgADP, 0.3 mg/mL BSA, that was also incubated for 5 minutes. The reaction was quenched using 1:1 mixture of reaction with

10% TCA, spun down as described above, then neutralized with 1.5M HEPES, 75mM

EDTA at pH 8.0 to restore the nucleotide solution to near neutral pH. The samples were then analyzed using HPLC analysis method.

Structural Comparison of Second Shell Residues

The aADK (PDB 2RGX) and eADK (PDB 1AKE) sequences and crystal structures were aligned to find the differences in their amino acids makeup. The structures were visualized and manually compared in PyMOL. The residues in questions must be between 4 to 7 Å away from the active site. Special attention was given to differences in charge and size between residues. The immediate interactions of the residues with their neighboring amino acids were scrutinized in the static representations of the molecules. A list of the differences was organized in Microsoft EXCEL. Molecular dynamics simulations of ADK were also used to help identify the possibly rate enhancing second shell residues based on their relative movement during the catalytic reaction.

Phylogenetic Tree Construction

The ADK amino acid sequences were obtained from BLAST search against the known aADK and eADK sequences. Sequence alignments were done using MUSCLE

41 (52). For the ADK that had structural information available, a multiple comparison and

3D alignment of protein structures were done using PDBeFold (53). The resulting aligned sequences based on structures were used to enhance the primary sequence alignments, which were then used to construct the phylogenetic tree.

The ADK evolutionary history was inferred by using the Maximum Likelihood method based on the Whelan And Goldman model (54). The consensus tree was bootstrapped (55) for 500 replicates. A discrete Gamma distribution was used to model evolutionary rate differences among sites (5 categories (+G, parameter = 1.1383)). The branch lengths on the tree measured the number of substitutions per site. Tree construction and evolutionary analyses were conducted in MEGA5 (56).

References

1. F. H. Westheimer, Why nature chose phosphates. Science 235, 1173 (Mar 6, 1987). 2. C. Vonrhein, G. J. Schlauderer, G. E. Schulz, Movie of the structural changes during a catalytic cycle of nucleoside monophosphate kinases. Structure 3, 483 (May 15, 1995). 3. D. Dreusicke, G. E. Schulz, The glycine-rich loop of adenylate kinase forms a giant anion hole. FEBS letters 208, 301 (Nov 24, 1986). 4. W. Moller, R. Amons, Phosphate-binding sequences in nucleotide-binding proteins. FEBS letters 186, 1 (Jul 1, 1985). 5. M. Saraste, P. R. Sibbald, A. Wittinghofer, The P-loop--a common motif in ATP- and GTP-binding proteins. Trends in biochemical sciences 15, 430 (Nov, 1990). 6. S. J. Kerns et al., Catalytic Strategies used by Kinases in Phosphoryl-Transfer Reactions. Submitted to Nature Chemistry (Under Review), (2013). 7. F. Gloria-Bottini et al., Adenylate kinase genetic polymorphism and spontaneous abortion. American journal of human biology : the official journal of the Human Biology Council 24, 186 (Mar-Apr, 2012). 8. E. Janssen et al., Adenylate kinase 1 deficiency induces molecular and structural adaptations to support muscle energy metabolism. The Journal of biological chemistry 278, 12937 (Apr 11, 2003). 9. C. Lagresle-Peyrou et al., Human adenylate kinase 2 deficiency causes a profound hematopoietic defect associated with sensorineural deafness. Nature genetics 41, 106 (Jan, 2009). 10. S. Matsuura et al., Human adenylate kinase deficiency associated with hemolytic anemia. A single base substitution affecting solubility and catalytic activity of the cytosolic adenylate kinase. The Journal of biological chemistry 264, 10148 (Jun 15, 1989). 11. T. Noma et al., Structure and expression of human mitochondrial adenylate kinase targeted to the mitochondrial matrix. Biochem J 358, 225 (Aug 15, 2001). 12. H. Park et al., Neuropathogenic role of adenylate kinase-1 in Abeta-mediated tau phosphorylation via AMPK and GSK3beta. Human molecular genetics 21, 2725 (Jun 15, 2012). 13. T. Yoneda, M. Sato, M. Maeda, H. Takagi, Identification of a novel adenylate kinase system in the brain: cloning of the fourth adenylate kinase. Brain research. Molecular brain research 62, 187 (Nov 20, 1998). 14. J. K. Lassila, J. G. Zalatan, D. Herschlag, Biological phosphoryl-transfer reactions: understanding mechanism and catalysis. Annual review of biochemistry 80, 669 (Jun 7, 2011).

43 15. M. Wolf-Watz et al., Linkage between dynamics and catalysis in a thermophilic- mesophilic enzyme pair. Nature structural & molecular biology 11, 945 (Oct, 2004). 16. U. Abele, G. E. Schulz, High-resolution structures of adenylate kinase from yeast ligated with inhibitor Ap5A, showing the pathway of phosphoryl transfer. Protein science : a publication of the Protein Society 4, 1262 (Jul, 1995). 17. E. Bae, G. N. Phillips, Jr., Structures and analysis of highly homologous psychrophilic, mesophilic, and thermophilic adenylate kinases. The Journal of biological chemistry 279, 28202 (Jul 2, 2004). 18. M. Bellinzoni et al., The crystal structure of Mycobacterium tuberculosis adenylate kinase in complex with two molecules of ADP and Mg2+ supports an associative mechanism for phosphoryl transfer. Protein science : a publication of the Protein Society 15, 1489 (Jun, 2006). 19. M. B. Berry, G. N. Phillips, Jr., Crystal structures of Bacillus stearothermophilus adenylate kinase with bound Ap5A, Mg2+ Ap5A, and Mn2+ Ap5A reveal an intermediate lid position and six coordinate octahedral geometry for bound Mg2+ and Mn2+. Proteins 32, 276 (Aug 15, 1998). 20. K. Diederichs, G. E. Schulz, Three-dimensional structure of the complex between the mitochondrial matrix adenylate kinase and its substrate AMP. Biochemistry 29, 8138 (Sep 4, 1990). 21. D. Dreusicke, P. A. Karplus, G. E. Schulz, Refined structure of porcine cytosolic adenylate kinase at 2.1 A resolution. Journal of molecular biology 199, 359 (Jan 20, 1988). 22. U. Egner, A. G. Tomasselli, G. E. Schulz, Structure of the complex of yeast adenylate kinase with the inhibitor P1,P5-di(adenosine-5'-)pentaphosphate at 2.6 A resolution. Journal of molecular biology 195, 649 (Jun 5, 1987). 23. C. W. Muller, G. J. Schlauderer, J. Reinstein, G. E. Schulz, Adenylate kinase motions during catalysis: an energetic counterweight balancing substrate binding. Structure 4, 147 (Feb 15, 1996). 24. C. W. Muller, G. E. Schulz, Structure of the complex between adenylate kinase from Escherichia coli and the inhibitor Ap5A refined at 1.9 A resolution. A model for a catalytic transition state. Journal of molecular biology 224, 159 (Mar 5, 1992). 25. G. J. Schlauderer, K. Proba, G. E. Schulz, Structure of a mutant adenylate kinase ligated with an ATP-analogue showing domain closure over ATP. Journal of molecular biology 256, 223 (Feb 23, 1996). 26. J. A. Brannigan, A. J. Wilkinson, Protein engineering 20 years on. Nature reviews. Molecular cell biology 3, 964 (Dec, 2002). 27. R. J. Leatherbarrow, A. R. Fersht, G. Winter, Transition-state stabilization in the mechanism of tyrosyl-tRNA synthetase revealed by protein engineering. Proceedings of the National Academy of Sciences of the United States of America 82, 7840 (Dec, 1985). 28. H. R. Brodkin et al., Evidence of the participation of remote residues in the catalytic activity of Co-type nitrile hydratase from Pseudomonas putida. Biochemistry 50, 4923 (Jun 7, 2011).

44 29. R. B. Stockbridge, C. A. Lewis, Jr., Y. Yuan, R. Wolfenden, Impact of temperature on the time required for the establishment of primordial biochemistry, and for the evolution of enzymes. Proceedings of the National Academy of Sciences of the United States of America 107, 22102 (Dec 21, 2010). 30. G. Deckert et al., The complete genome of the hyperthermophilic bacterium Aquifex aeolicus. Nature 392, 353 (Mar 26, 1998). 31. B. A. Methe et al., The psychrophilic lifestyle as revealed by the genome sequence of Colwellia psychrerythraea 34H through genomic and proteomic analyses. Proceedings of the National Academy of Sciences of the United States of America 102, 10913 (Aug 2, 2005). 32. S. J. Kerns, Ph D, Brandeis University (2010). 33. D. V. Pachov, Ph D, Brandeis University (2011). 34. M. Hamada et al., Adenosine triphosphate-adenosine-5'-monophosphate phosphotransferase from normal human liver mitochondria. Isolation, chemical properties, and immunochemical comparison with Duchenne dystrophic serum aberrant adenylate kinase. The Journal of biological chemistry 257, 13120 (Nov 10, 1982). 35. C. Panayiotou, N. Solaroli, Y. Xu, M. Johansson, A. Karlsson, The characterization of human adenylate kinases 7 and 8 demonstrates differences in kinetic parameters and structural organization among the family of adenylate kinase isoenzymes. The Biochemical journal 433, 527 (Feb 1, 2011). 36. J. Reikofski, B. Y. Tao, Polymerase chain reaction (PCR) techniques for site- directed mutagenesis. Biotechnology advances 10, 535 (1992). 37. J. Reinstein, M. Brune, A. Wittinghofer, Mutations in the nucleotide binding loop of adenylate kinase of Escherichia coli. Biochemistry 27, 4712 (Jun 28, 1988). 38. D. G. Rhoads, J. M. Lowenstein, Initial velocity and equilibrium kinetics of myokinase. The Journal of biological chemistry 243, 3963 (Jul 25, 1968). 39. V. Thai, Brandeis University (2007). 40. V. T. Thai, Ph D, Brandeis University (2008). 41. T. G. Battye, L. Kontogiannis, O. Johnson, H. R. Powell, A. G. Leslie, iMOSFLM: a new graphical interface for diffraction-image processing with MOSFLM. Acta Crystallogr D Biol Crystallogr 67, 271 (Apr, 2011). 42. P. Evans, Scaling and assessment of data quality. Acta Crystallogr D Biol Crystallogr 62, 72 (Jan, 2006). 43. A. J. McCoy et al., Phaser crystallographic software. J Appl Crystallogr 40, 658 (Aug 1, 2007). 44. G. N. Murshudov et al., REFMAC5 for the refinement of macromolecular crystal structures. Acta Crystallogr D Biol Crystallogr 67, 355 (Apr, 2011). 45. M. D. Winn et al., Overview of the CCP4 suite and current developments. Acta Crystallogr D Biol Crystallogr 67, 235 (Apr, 2011). 46. P. R. Evans, An introduction to data reduction: space-group determination, scaling and intensity statistics. Acta Crystallogr D Biol Crystallogr 67, 282 (Apr, 2011). 47. P. Emsley, K. Cowtan, Coot: model-building tools for molecular graphics. Acta Crystallogr D Biol Crystallogr 60, 2126 (Dec, 2004).

45 48. P. Emsley, B. Lohkamp, W. G. Scott, K. Cowtan, Features and development of Coot. Acta Crystallogr D Biol Crystallogr 66, 486 (Apr, 2010). 49. P. D. Adams et al., PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr D Biol Crystallogr 66, 213 (Feb, 2010). 50. P. V. Afonine et al., phenix.model_vs_data: a high-level tool for the calculation of crystallographic model and data statistics. J Appl Crystallogr 43, 669 (Aug 1, 2010). 51. W. L. DeLano, Use of PYMOL as a communications tool for molecular science. Abstr Pap Am Chem S 228, U313 (Aug 22, 2004). 52. R. C. Edgar, MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32, 1792 (Mar, 2004). 53. E. Krissinel, K. Henrick, in Computational Life Sciences (vol. # 3695) First International Symposium, CompLife 2005, Konstanz, Germany, September 25-27, 2005, Proceedings Lecture notes in computer science, M. R. Berthold et al., Eds. (Springer-Verlag GmbH,, Berlin Heidelberg, 2005). 54. S. Whelan, N. Goldman, A general empirical model of protein evolution derived from multiple protein families using a maximum-likelihood approach. Molecular biology and evolution 18, 691 (May, 2001). 55. J. Felsenstein, Confidence-Limits on Phylogenies - an Approach Using the Bootstrap. Evolution 39, 783 (1985). 56. K. Tamura et al., MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular biology and evolution 28, 2731 (Oct, 2011).