DOCSLIB.ORG

A Convenient, Rapid, Sensitive, and Reliable Spectrophotometric Assay

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Convenient, Rapid, Sensitive, and Reliable Spectrophotometric Assay molecules Article AArticle Convenient, Rapid, Sensitive, and Reliable SpectrophotometricA Convenient, Rapid, Assay Sensitive, for Adenylate and Reliable Kinase ActivitySpectrophotometric Assay for Adenylate KaiKinase Song 1, Yejing Activity Wang 2,*, Yu Li 1, Chaoxiang Ding 1, Rui Cai 2, Gang Tao 1, Ping Zhao 1, Qingyou Xia 1 and Huawei He 1,3,* Kai Song 1, Yejing Wang 2,*, Yu Li 1, Chaoxiang Ding 1, Rui Cai 2, Gang Tao 1, Ping Zhao 1, 1 Qingyou Biological Xia Science1 and Research Huawei Center, He 1,3, Southw* est University, Beibei, Chongqing 400715, China; [email protected] (K.S.); [email protected] (Y.L.); [email protected] (C.D.); 1 [email protected] Science Research (G.T.); Center, [email protected] Southwest University, (P.Z.); Beibei, [email protected] Chongqing 400715, (Q.X.) China; 2 [email protected] Key Laboratory of Silkworm (K.S.); Genome [email protected] Biology, College (Y.L.); of Biotechnology, [email protected] Southwest University, (C.D.); Beibei,[email protected] Chongqing 400715, China; (G.T.); [email protected] [email protected] (P.Z.); [email protected] (Q.X.) 2 3 ChongqingState Key LaboratoryKey Laboratory of Silkworm of Sericultural Genome Scienc Biology,e, Chongqing College of Engineering Biotechnology, and Southwest Technology University, Research Beibei, CenterChongqing for Novel 400715, Silk China;Materials, [email protected] Southwest University, Beibei, Chongqing 400715, China 3 * Correspondence:Chongqing Key [email protected] of Sericultural.cn (Y.W.); Science, [email protected] Chongqing Engineering (H.H.); and Tel.: Technology +86-23-6825-1575 Research (Y.W. Center &for H.H.) Novel Silk Materials, Southwest University, Beibei, Chongqing 400715, China * Correspondence: [email protected] (Y.W.); [email protected] (H.H.); AcademicTel.: +86-23-6825-1575 Editor: Stefano Serra (Y.W. & H.H.) Received: 19 January 2019; Accepted: 12 February 2019; Published: 13 February 2019 Academic Editor: Stefano Serra Abstract:Received: 19Enzymatic January 2019; activity Accepted: assays 12 Februaryare essential 2019; Published:and critical 13 Februaryfor the 2019study of enzyme kinetics. AdenylateAbstract: Enzymatickinase (Adk) activity plays a assays fundamental are essential role in andcellular critical energy for and the nucleotide study of enzymehomeostasis. kinetics. To date,Adenylate assays kinase based (Adk)on different plays aprinciples fundamental have role been in used cellular for energythe determination and nucleotide of Adk homeostasis. activity. Here,To date, we assays show based a spectrophotometric on different principles analysis have beentechnique used for to the determine determination Adk ofactivity Adk activity. with bromothymolHere, we show blue a spectrophotometric as a pH indicator. analysis We analyzed technique the effects to determine of substrates Adk activity and the with pH bromothymol indicator on theblue assay as a pHusing indicator. orthogonal We analyzed design and the effectsthen establ of substratesished the and most the optimal pH indicator assayon for the Adk assay activity. using Subsequently,orthogonal design we evaluated and then establishedthe thermostability the most of optimal Adk and assay the for inhibitory Adk activity. effect Subsequently, of KCl on Adk we activityevaluated with the this thermostability assay. Our results of Adk show and that the inhibitorythis assay effectis simple, of KCl rapid, onAdk and activityprecise. withIt shows this great assay. potentialOur results as show an alternative that this assay to the is simple,conventional rapid, andAdk precise. activity It showsassay. greatOur results potential also as ansuggest alternative that orthogonalto the conventional design is Adk an effective activity assay. approach, Our resultswhich alsois very suggest suitable that for orthogonal the optimization design is of an complex effective enzymeapproach, reaction which conditions. is very suitable for the optimization of complex enzyme reaction conditions. Keywords:Keywords: enzymaticenzymatic activity activity assay; assay; adenylate adenylate kinase; kinase; spectrophotometry; spectrophotometry; orthogonal orthogonal experiment; experiment; bromothymolbromothymol blue 1.1. Introduction Introduction AdenylateAdenylate kinase kinase (Adk; (Adk; ATP:AMP ATP:AMP phosphotransferase, phosphotransferase, EC EC 2.7.4.3), 2.7.4.3), also also known known as as myokinase, myokinase, isis a a conserved phosphoryl phosphoryl transferase, transferase, which which catalyzes catalyzes the the translocation translocation of of a a phosphoryl phosphoryl group group betweenbetween nucleotides in the reversible reaction (AMP ++ Mg2+•ATP•ATP ↔ MgMg2+2+•ADP•ADP + ADP) ADP) [1]. [1]. Adk Adk is is ubiquitousubiquitous in in different different tissues tissues of of all all living living system systemss and and plays plays a a fundamental fundamental role role in in cellular cellular energy energy andand nucleotide homeostasis. homeostasis. The The hydrogen hydrogen bond bond be betweentween the the adenine adenine moiety moiety and and the the backbone of of Adk is critical for ATP selectivity and can help Ad Adkk recognize the correct substrates in in the complex cellularcellular environmentenvironment [ 2[2].]. Adk Adk is involvedis involved in the in regulation the regulation of cell differentiation,of cell differentiation, maturation, maturation, apoptosis, apoptosis,and oncogenesis. and oncogenesis. Adk mutations Adk inmutations humans causein hu amans severe cause disease a severe called disease reticular called dysgenesis reticular [3]. dysgenesisAdk is regarded [3]. Adk as ais potential regarded target as a potential for medical targ diagnosiset for medical and treatment diagnosis due and to treatment its close correlation due to its closewith othercorrelation diseases, with such other as diseases, aleukocytosis, such as hemolytic aleukocytosis, anemia, hemolytic and primary anemia, ciliary and primary dyskinesia ciliary [4]. dyskinesiaTo date, three [4]. methods To date, have three been methods proposed have to been determine proposed Adk to activity determine based Adk on theactivity detectable based changes on the accompanied with this reaction, such as light absorption, acidity, or the coupled reaction products [5]. MoleculesThe manometric 2019, 24, 1-12; assay, doi: established by Colowick and Kalckar [6], is usedwww.mdpi.c for the detectionom/journal/molecules of Adk by Molecules 2019, 24, 663; doi:10.3390/molecules24040663 www.mdpi.com/journal/molecules Molecules 2019, 24, 663 2 of 10 measuring CO2 liberation from a bicarbonate buffer. The reaction catalyzed by Adk is coupled to hexokinase, which specifically catalyzes the transformation of the terminal phosphate from ADP to glucose. The overall reaction is as follows: Adk ATP + AMP −!ADP + ADP (1) hexokinase ADP + glucose−−−−−−!glucose − 6 − P + AMP + H+ (2) In the presence of excess hexokinase, the reaction rate is proportional to the Adk concentration. The forward direction reaction is defined as the formation of AMP and ATP from two ADPs, and the reverse direction is defined as the formation of two ADPs from AMP and ATP. Adk activity is conventionally measured in vitro by a spectrophotometric assay. For the forward direction reaction, Chiu et al. [7] have developed a modified assay of Oliver [8] to determine Adk activity by coupling the reaction to hexokinase and glucose-6-phosphate dehydrogenase in which the final product, NADPH, is measured spectrophotometrically at 340 nm. The overall reaction is as follows: H+ Adk ADP + ADP −!ATP + AMP (3) hexokinase ATP + glucose−−−−−−!glucose − 6 − P + ADP (4) glucose − 6 − phosphate dehydrogenase glucose − 6 − P + NADP−−−−−−−−−−−−−−−−−−−−!6 − phosphogluconic acid + NADPH (5) Adk activity is also measured in the reverse direction by coupling the reaction to pyruvate kinase and lactate dehydrogenase and measuring the oxidation of NADH at 340 nm [5]. The principle of the assay is as follows: Adk ATP + AMP −!ADP + ADP (6) Pyruvate kinase Phosphoenolpyruvate + ADP−−−−−−−−−!ATP + Pyruvate (7) Lactic dehydrogenase Pyruvate + NADH + H + −−−−−−−−−−−−!Lactate + NAD+ (8) These assays have been used to determine Adk activity for the past decades. However, some disadvantages are also obvious for these assays. Firstly, these assays are time-consuming, multistep processes that require the assistance of other enzymes and are easily subject to errors at each step. Secondly, it is difficult to study the effects of activators and inhibitors on Adk activity with the aid of other enzymes. Finally, the real initial rate of Adk reaction cannot be determined accurately [9]. Therefore, it is necessary to develop a more convenient and accurate assay for Adk activity in vitro. Acid–base indicators are usually applied in enzymatic assay for their extraordinary sensitivity to pH change. In 2002, Yu et al. [10] established an arginine kinase activity assay based on the light absorption of a complex acid–base indicator consisting of thymol blue and cresol red. In the reaction catalyzed by arginine kinase, the produced protons resulted in a decrease in pH of the reaction mixture, thus reducing the absorbance of the mixed indicator in the solution at 575 nm. The arginine kinase activity could be determined according to the change of the absorbance at 575 nm. In the same way, Dhale et al. developed a rapid and sensitive assay to measure L-asparaginase activity with methyl red as an indicator [11]. Bromothymol
Load more

Recommended publications
  • METACYC ID Description A0AR23 GO:0004842 (Ubiquitin-Protein Ligase
    Electronic Supplementary Material (ESI) for Integrative Biology This journal is © The Royal Society of Chemistry 2012 Heat Stress Responsive Zostera marina Genes, Southern Population (α=0.
    [Show full text]
  • In the Field of Clinical Examination, the Measurement of Creatine
    J. Clin. Biochem. Nutr., 3, 17-25, 1987 Bacterial Glucokinase as an Enzymic Reagent of Good Stability for Measurement of Creatine Kinase Activity Hitoshi KONDO, * Takanari SHIRAISHI, Masao KAGEYAMA, Kazuhiko NAGATA, and Kosuke TOMITA Research and Development Center, UNITIKA Ltd., Uji 611, Japan (Received January 10, 1987) Summary An enzymic reagent, that has long-term stability even in the liquid state, was successfully employed for the measurement of serum creatine kinase (CK, EC 2.7.3.2) activity. The enzyme used was the thermostable glucokinase (GlcK, EC 2.7.1.2) obtained from the thermo- phile Bacillus stearothermophilus. The reagent was found to be stable in solution for about one month at 6•Ž and for about one week at 30•Ž. This substitution of glucokinase for the hexokinase of the most commonly used hexokinase-glucose-6-phosphate dehydrogenase (HK-G6PDH) method results in a remarkable improvement of the method. The CK activity measured by the GlcK-G6PDH method was linear up to about 2,000 U/ liter at 37•Ž. The GlcK-G6PDH method was found to give a satisfactory precision and reproducibility (coefficient of variation less than 2.17%). Over a wide range of CK activity, an excellent agreement was obtained between the GlcK-G6PDH and the HK-G6PDH methods. Furthermore several coexistents and anticoagulants were found to have little effect on the measured value of CK activity by the GlcK-G6PDH method. Key Words: creatine kinase activity, glucokinase, improved stability of reagent, creatine kinase determination, thermostable enzyme In the field of clinical examination, the measurement of creatine kinase (CK, ATP : creatine phosphotransferase, EC 2.7.3.2) activity in serum is one of the important examinations usually employed for diagnosis of cardiac diseases such as myocardial infarction or muscular diseases such as progressive muscular dystrophy.
    [Show full text]
  • Nucleotide Sequence and Analysis of the 58.3 to 65.5-Kb Early Region of Bacteriophage T4
    Volume 14 Number 21 1986 Nucleic Acids Research Nucleotide sequence and analysis of the 58.3 to 65.5-kb early region of bacteriophage T4 Kristoffer Valerie 13.4, John Stevens', Mark Lynch'5, Earl E.Henderson12 and Jon K.de Riel1 'Fels Research Institute, and 2Department of Microbiology and Immunology, Temple University School of Medicine, Philadelphia, PA 19140, USA and 3Department of Biochemistry and Biotechnology, Royal Institute of Technology, S-100 44 Stockholm, Sweden Received 21 July 1986; Revised and Accepted 30 September 1986 ABSTRACT The complete 7.2-kb nucleotide sequence from the 58.3 to 65.5-kb early region of bacteriophage T4 has been determined by Maxam and Gilbert sequencing. Computer analysis revealed at least 20 open reading frames (ORFs) within this sequence. All major ORFs are transcribed from the left strand, suggesting that they are expressed early during infection. Among the ORFs, we have identified the pIIII, II, denV and tk genes. The ORFs are very tightly spaced, even over Lapping in some instances, and when ORF interspacing occurs, promoter-like sequences can be implicated. Several of the sequences preceding the ORFs, in particular those at ipIII, ipII, denV, and orf6l.9, can potentially form stable stem-loop structures. INTRODUCTION Recently, considerable progress has been made studying the bacteriophage T4 genome at the molecular level due to the development of T4 strains with unmod- ified DNA suitable for digestion with restriction endonucleases (1). Many T4 genes have since been cloned, sequenced, and their gene products overproduced in Escherichia coli (for review see ref. 2). A majority of the T4 genes studied so far have been essential and non-essential genes with well-characterized pheno- types.
    [Show full text]
  • Labeled in Thecourse of Glycolysis, Since Phosphoglycerate Kinase
    THE STATE OF MAGNESIUM IN CELLS AS ESTIMATED FROM THE ADENYLATE KINASE EQUILIBRIUM* BY TRWIN A. RoSE THE INSTITUTE FOR CANCER RESEARCH, PHILADELPHIA Communicated by Thomas F. Anderson, August 30, 1968 Magnesium functions in many enzymatic reactions as a cofactor and in com- plex with nucleotides acting as substrates. Numerous examples of a possible regulatory role of Mg can be cited from studies with isolated enzymes,'- and it is known that Mg affects the structural integrity of macromolecules such as trans- fer RNA" and functional elements such as ribosomes.'0 The major problem in translating this information on isolated preparations to the functioning cell is the difficulty in determining the distribution of Mg and the nucleotides among the free and complexed forms that function in the region of the cell for which this information is desired. Nanningall based an attempt to calculate the free Mg2+ and Ca2+ ion concentrations of frog muscle on the total content of these metals and of the principal known ligands (adenosine 5'-triphosphate (ATP), creatine-P, and myosin) and the dissociation constants of the complexes. However, this method suffers from the necessity of evaluating the contribution of all ligands as well as from the assumption that all the known ligands are contributing their full complexing capacity. During studies concerned with the control of glycolysis in red cells and the control of the phosphoglycerate kinase step in particular, it became important to determine the fractions of the cell's ATP and adenosine 5'-diphosphate (ADP) that were present as Mg complexes. Just as the problem of determining the distribution of protonated and dissociated forms of an acid can be solved from a knowledge of pH and pKa of the acid, so it would be possible to determine the liganded and free forms of all rapidly established Mg complexes from a knowledge of Mg2+ ion concentration and the appropriate dissociation constants.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • (LRV1) Pathogenicity Factor
    Antiviral screening identifies adenosine analogs PNAS PLUS targeting the endogenous dsRNA Leishmania RNA virus 1 (LRV1) pathogenicity factor F. Matthew Kuhlmanna,b, John I. Robinsona, Gregory R. Bluemlingc, Catherine Ronetd, Nicolas Faseld, and Stephen M. Beverleya,1 aDepartment of Molecular Microbiology, Washington University School of Medicine in St. Louis, St. Louis, MO 63110; bDepartment of Medicine, Division of Infectious Diseases, Washington University School of Medicine in St. Louis, St. Louis, MO 63110; cEmory Institute for Drug Development, Emory University, Atlanta, GA 30329; and dDepartment of Biochemistry, University of Lausanne, 1066 Lausanne, Switzerland Contributed by Stephen M. Beverley, December 19, 2016 (sent for review November 21, 2016; reviewed by Buddy Ullman and C. C. Wang) + + The endogenous double-stranded RNA (dsRNA) virus Leishmaniavirus macrophages infected in vitro with LRV1 L. guyanensis or LRV2 (LRV1) has been implicated as a pathogenicity factor for leishmaniasis Leishmania aethiopica release higher levels of cytokines, which are in rodent models and human disease, and associated with drug-treat- dependent on Toll-like receptor 3 (7, 10). Recently, methods for ment failures in Leishmania braziliensis and Leishmania guyanensis systematically eliminating LRV1 by RNA interference have been − infections. Thus, methods targeting LRV1 could have therapeutic ben- developed, enabling the generation of isogenic LRV1 lines and efit. Here we screened a panel of antivirals for parasite and LRV1 allowing the extension of the LRV1-dependent virulence paradigm inhibition, focusing on nucleoside analogs to capitalize on the highly to L. braziliensis (12). active salvage pathways of Leishmania, which are purine auxo- A key question is the relevancy of the studies carried out in trophs.
    [Show full text]
  • The Characterization of Human Adenylate Kinases 7 and 8
    The characterization of human adenylate kinases 7 and 8 demonstrates differences in kinetic parameters and structural organization among the family of adenylate kinase isoenzymes Christakis Panayiotou, Nicola Solaroli, Yunjian Xu, Magnus Johansson, Anna Karlsson To cite this version: Christakis Panayiotou, Nicola Solaroli, Yunjian Xu, Magnus Johansson, Anna Karlsson. The char- acterization of human adenylate kinases 7 and 8 demonstrates differences in kinetic parameters and structural organization among the family of adenylate kinase isoenzymes. Biochemical Journal, Port- land Press, 2011, 433 (3), pp.527-534. 10.1042/BJ20101443. hal-00558097 HAL Id: hal-00558097 https://hal.archives-ouvertes.fr/hal-00558097 Submitted on 21 Jan 2011 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Biochemical Journal Immediate Publication. Published on 16 Nov 2010 as manuscript BJ20101443 The characterization of human adenylate kinases 7 and 8 demonstrates differences in kinetic parameters and structural organization among the family of adenylate kinase isoenzymes
    [Show full text]
  • Electrophoretic Variation in Adenylate Kinase Ofneisseria
    Proc. Natl. Acad. Sci. USA Vol. 92, pp. 10535-10539, November 1995 Genetics Electrophoretic variation in adenylate kinase of Neisseria meningitidis is due to inter- and intraspecies recombination (natural transformation/linkage disequilibrium/mosaic genes/multilocus enzyme electrophoresis/nonclonal population structure) EDWARD FEIL, GILL CARPENTER, AND BRIAN G. SPRATT* Molecular Microbiology Group, School of Biological Sciences, University of Sussex, Falmer, Brighton BN1 9QG, United Kingdom Communicated by John Maynard Smith, University of Sussex, Falmer, Brighton, United Kingdom, August 7, 1995 ABSTRACT In prokaryotic and eukaryotic organisms, their growth cycles and the availability of this mechanism of the electrophoretic variation in housekeeping enzymes from genetic exchange appears to have a profound effect on their natural populations is assumed to have arisen by the accu- evolution and population biology (3, 13-17). mulation of stochastic predominantly neutral mutations. In Caugant et al. (18) carried out an extensive MLEE survey of the naturally transformable bacterium Neisseria meningitidis, meningococci, analyzing variation at 15 enzyme loci in 688 we show that variation in the electrophoretic mobility of isolates recovered predominantly from patients with invasive adenylate kinase is due to inter- and intraspecies recombina- disease. Although the results from this survey appeared to tion rather than mutation. The nucleotide sequences of the imply relatively high levels of linkage disequilibrium, it has adenylate kinase gene (adk) from isolates that express the been pointed out (3, 17) that artificially high levels of linkage predominant slow electrophoretic variant were rather uni- disequilibrium may result from sampling bias, in this case form, differing in sequence at an average of 1.1% of nucleotide through the disproportionately high frequency in the data set sites.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Structures, Functions, and Mechanisms of Filament Forming Enzymes: a Renaissance of Enzyme Filamentation
    Structures, Functions, and Mechanisms of Filament Forming Enzymes: A Renaissance of Enzyme Filamentation A Review By Chad K. Park & Nancy C. Horton Department of Molecular and Cellular Biology University of Arizona Tucson, AZ 85721 N. C. Horton ([email protected], ORCID: 0000-0003-2710-8284) C. K. Park ([email protected], ORCID: 0000-0003-1089-9091) Keywords: Enzyme, Regulation, DNA binding, Nuclease, Run-On Oligomerization, self-association 1 Abstract Filament formation by non-cytoskeletal enzymes has been known for decades, yet only relatively recently has its wide-spread role in enzyme regulation and biology come to be appreciated. This comprehensive review summarizes what is known for each enzyme confirmed to form filamentous structures in vitro, and for the many that are known only to form large self-assemblies within cells. For some enzymes, studies describing both the in vitro filamentous structures and cellular self-assembly formation are also known and described. Special attention is paid to the detailed structures of each type of enzyme filament, as well as the roles the structures play in enzyme regulation and in biology. Where it is known or hypothesized, the advantages conferred by enzyme filamentation are reviewed. Finally, the similarities, differences, and comparison to the SgrAI system are also highlighted. 2 Contents INTRODUCTION…………………………………………………………..4 STRUCTURALLY CHARACTERIZED ENZYME FILAMENTS…….5 Acetyl CoA Carboxylase (ACC)……………………………………………………………………5 Phosphofructokinase (PFK)……………………………………………………………………….6
    [Show full text]
  • B Number Gene Name Mrna Intensity Mrna
    sample) total list predicted B number Gene name assignment mRNA present mRNA intensity Gene description Protein detected - Membrane protein membrane sample detected (total list) Proteins detected - Functional category # of tryptic peptides # of tryptic peptides # of tryptic peptides detected (membrane b0002 thrA 13624 P 39 P 18 P(m) 2 aspartokinase I, homoserine dehydrogenase I Metabolism of small molecules b0003 thrB 6781 P 9 P 3 0 homoserine kinase Metabolism of small molecules b0004 thrC 15039 P 18 P 10 0 threonine synthase Metabolism of small molecules b0008 talB 20561 P 20 P 13 0 transaldolase B Metabolism of small molecules chaperone Hsp70; DNA biosynthesis; autoregulated heat shock b0014 dnaK 13283 P 32 P 23 0 proteins Cell processes b0015 dnaJ 4492 P 13 P 4 P(m) 1 chaperone with DnaK; heat shock protein Cell processes b0029 lytB 1331 P 16 P 2 0 control of stringent response; involved in penicillin tolerance Global functions b0032 carA 9312 P 14 P 8 0 carbamoyl-phosphate synthetase, glutamine (small) subunit Metabolism of small molecules b0033 carB 7656 P 48 P 17 0 carbamoyl-phosphate synthase large subunit Metabolism of small molecules b0048 folA 1588 P 7 P 1 0 dihydrofolate reductase type I; trimethoprim resistance Metabolism of small molecules peptidyl-prolyl cis-trans isomerase (PPIase), involved in maturation of b0053 surA 3825 P 19 P 4 P(m) 1 GenProt outer membrane proteins (1st module) Cell processes b0054 imp 2737 P 42 P 5 P(m) 5 GenProt organic solvent tolerance Cell processes b0071 leuD 4770 P 10 P 9 0 isopropylmalate
    [Show full text]
  • Recombinant Human Adenosine Kinase/ADK
    Recombinant Human Adenosine Kinase/ADK Catalog Number: 8024-AK DESCRIPTION Source E. coli­derived Ala2­His362 with a C­terminal 6­His tag Accession # P55263 N­terminal Sequence Ala2 Analysis Predicted Molecular 41 kDa Mass SPECIFICATIONS SDS­PAGE 43­45 kDa, reducing conditions Activity Measured by its ability to phosphorylate Adenosine. The specific activity is >7 pmol/min/μg, as measured under the described conditions. Endotoxin Level <1.0 EU per 1 μg of the protein by the LAL method. Purity >95%, by SDS­PAGE under reducing conditions and visualized by Colloidal Coomassie® Blue stain at 5 μg per lane. Formulation Supplied as a 0.2 μm filtered solution in Tris and NaCl. See Certificate of Analysis for details. Activity Assay Protocol Materials l Assay Buffer: (10X) 250 mM HEPES, 1.5 M NaCl, 100 mM MgCl2, 100 mM CaCl2 pH 7.0 (supplied in kit) l Recombinant Human Adenosine Kinase/ADK (Catalog # 8024­AK) l Adenosine (Sigma, Catalog # A9251), 10 mM stock in deionized water l Adenosine triphosphate (ATP) (Sigma, Catalog # A7699), 10 mM stock in deionized water l Universal Kinase Activity Kit (Catalog # EA004) l 96­well Clear Plate (Costar, Catalog # 92592) l Plate Reader (Model: SpectraMax Plus by Molecular Devices) or equivalent Assay 1. Prepare 1X Assay Buffer by diluting 10X Assay Buffer in deionized water. 2. Dilute 1 mM Phosphate Standard provided by the Universal Kinase Activity Kit by adding 40 µL of the 1 mM Phosphate Standard to 360 µL of 1X Assay Buffer for a 100 µM stock. 3. Prepare standard curve by performing seven one­half serial dilutions of the 100 µM Phosphate stock in 1X Assay Buffer.
    [Show full text]