(LRV1) Pathogenicity Factor
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Origin, Adaptation and Evolutionary Pathways of Fungal Viruses
Virus Genes 16:1, 119±131, 1998 # 1998 Kluwer Academic Publishers, Boston. Manufactured in The Netherlands. Origin, Adaptation and Evolutionary Pathways of Fungal Viruses SAID A. GHABRIAL Department of Plant Pathology, University of Kentucky, Lexington, KY, USA Abstract. Fungal viruses or mycoviruses are widespread in fungi and are believed to be of ancient origin. They have evolved in concert with their hosts and are usually associated with symptomless infections. Mycoviruses are transmitted intracellularly during cell division, sporogenesis and cell fusion, and they lack an extracellular phase to their life cycles. Their natural host ranges are limited to individuals within the same or closely related vegetative compatibility groups. Typically, fungal viruses are isometric particles 25±50 nm in diameter, and possess dsRNA genomes. The best characterized of these belong to the family Totiviridae whose members have simple undivided dsRNA genomes comprised of a coat protein (CP) gene and an RNA dependent RNA polymerase (RDRP) gene. A recently characterized totivirus infecting a ®lamentous fungus was found to be more closely related to protozoan totiviruses than to yeast totiviruses suggesting these viruses existed prior to the divergence of fungi and protozoa. Although the dsRNA viruses at large are polyphyletic, based on RDRP sequence comparisons, the totiviruses are monophyletic. The theory of a cellular self-replicating mRNA as the origin of totiviruses is attractive because of their apparent ancient origin, the close relationships among their RDRPs, genome simplicity and the ability to use host proteins ef®ciently. Mycoviruses with bipartite genomes ( partitiviruses), like the totiviruses, have simple genomes, but the CP and RDRP genes are on separate dsRNA segments. -
Blueberry Latent Virus: an Amalgam of the Partitiviridae and Totiviridae
Virus Research 155 (2011) 175–180 Contents lists available at ScienceDirect Virus Research journal homepage: www.elsevier.com/locate/virusres Blueberry latent virus: An amalgam of the Partitiviridae and Totiviridae Robert R. Martin a,b,∗, Jing Zhou c,d, Ioannis E. Tzanetakis c,d,∗∗ a Horticultural Crops Research Laboratory, USDA-ARS, Corvallis, OR 97330, USA b Department of Botany and Plant Pathology, Oregon State University, Corvallis, OR 97331, USA c Department of Plant Pathology, Division of Agriculture, University of Arkansas, Fayetteville, AR 72701, USA d Molecular and Cellular Biology Program, University of Arkansas, Fayetteville, AR 72701, USA article info abstract Article history: A new, symptomless virus was identified in blueberry. The dsRNA genome of the virus, provisionally Received 30 June 2010 named Blueberry latent virus (BBLV), codes for two putative proteins, one without any similarities to Received in revised form 20 August 2010 virus proteins and an RNA-dependent RNA polymerase. More than 35 isolates of the virus from different Accepted 21 September 2010 cultivars and geographic regions were partially or completely sequenced. BBLV, found in more than 50% Available online 1 October 2010 of the material tested, has high degree of homogeneity as isolates show more than 99% nucleotide identity between them. Phylogenetic analysis clearly shows a close relationship between BBLV and members of Keywords: the Partitiviridae, although its genome organization is related more closely to members of the Totiviridae. Partitiviridae Totiviridae Transmission studies from three separate crosses showed that the virus is transmitted very efficiently by Amalgamaviridae seed. These properties suggest that BBLV belongs to a new family of plant viruses with unique genome dsRNA organization for a plant virus but signature properties of cryptic viruses including symptomless infection Detection and very efficient vertical transmission. -
Virus Goes Viral: an Educational Kit for Virology Classes
Souza et al. Virology Journal (2020) 17:13 https://doi.org/10.1186/s12985-020-1291-9 RESEARCH Open Access Virus goes viral: an educational kit for virology classes Gabriel Augusto Pires de Souza1†, Victória Fulgêncio Queiroz1†, Maurício Teixeira Lima1†, Erik Vinicius de Sousa Reis1, Luiz Felipe Leomil Coelho2 and Jônatas Santos Abrahão1* Abstract Background: Viruses are the most numerous entities on Earth and have also been central to many episodes in the history of humankind. As the study of viruses progresses further and further, there are several limitations in transferring this knowledge to undergraduate and high school students. This deficiency is due to the difficulty in designing hands-on lessons that allow students to better absorb content, given limited financial resources and facilities, as well as the difficulty of exploiting viral particles, due to their small dimensions. The development of tools for teaching virology is important to encourage educators to expand on the covered topics and connect them to recent findings. Discoveries, such as giant DNA viruses, have provided an opportunity to explore aspects of viral particles in ways never seen before. Coupling these novel findings with techniques already explored by classical virology, including visualization of cytopathic effects on permissive cells, may represent a new way for teaching virology. This work aimed to develop a slide microscope kit that explores giant virus particles and some aspects of animal virus interaction with cell lines, with the goal of providing an innovative approach to virology teaching. Methods: Slides were produced by staining, with crystal violet, purified giant viruses and BSC-40 and Vero cells infected with viruses of the genera Orthopoxvirus, Flavivirus, and Alphavirus. -
Epidemiology of White Spot Syndrome Virus in the Daggerblade Grass Shrimp (Palaemonetes Pugio) and the Gulf Sand Fiddler Crab (Uca Panacea)
The University of Southern Mississippi The Aquila Digital Community Dissertations Fall 12-2016 Epidemiology of White Spot Syndrome Virus in the Daggerblade Grass Shrimp (Palaemonetes pugio) and the Gulf Sand Fiddler Crab (Uca panacea) Muhammad University of Southern Mississippi Follow this and additional works at: https://aquila.usm.edu/dissertations Part of the Animal Diseases Commons, Disease Modeling Commons, Epidemiology Commons, Virology Commons, and the Virus Diseases Commons Recommended Citation Muhammad, "Epidemiology of White Spot Syndrome Virus in the Daggerblade Grass Shrimp (Palaemonetes pugio) and the Gulf Sand Fiddler Crab (Uca panacea)" (2016). Dissertations. 895. https://aquila.usm.edu/dissertations/895 This Dissertation is brought to you for free and open access by The Aquila Digital Community. It has been accepted for inclusion in Dissertations by an authorized administrator of The Aquila Digital Community. For more information, please contact [email protected]. EPIDEMIOLOGY OF WHITE SPOT SYNDROME VIRUS IN THE DAGGERBLADE GRASS SHRIMP (PALAEMONETES PUGIO) AND THE GULF SAND FIDDLER CRAB (UCA PANACEA) by Muhammad A Dissertation Submitted to the Graduate School and the School of Ocean Science and Technology at The University of Southern Mississippi in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Approved: ________________________________________________ Dr. Jeffrey M. Lotz, Committee Chair Professor, Ocean Science and Technology ________________________________________________ Dr. Darrell J. Grimes, Committee Member Professor, Ocean Science and Technology ________________________________________________ Dr. Wei Wu, Committee Member Associate Professor, Ocean Science and Technology ________________________________________________ Dr. Reginald B. Blaylock, Committee Member Associate Research Professor, Ocean Science and Technology ________________________________________________ Dr. Karen S. Coats Dean of the Graduate School December 2016 COPYRIGHT BY Muhammad* 2016 Published by the Graduate School *U.S. -
Opportunistic Intruders: How Viruses Orchestrate ER Functions to Infect Cells
REVIEWS Opportunistic intruders: how viruses orchestrate ER functions to infect cells Madhu Sudhan Ravindran*, Parikshit Bagchi*, Corey Nathaniel Cunningham and Billy Tsai Abstract | Viruses subvert the functions of their host cells to replicate and form new viral progeny. The endoplasmic reticulum (ER) has been identified as a central organelle that governs the intracellular interplay between viruses and hosts. In this Review, we analyse how viruses from vastly different families converge on this unique intracellular organelle during infection, co‑opting some of the endogenous functions of the ER to promote distinct steps of the viral life cycle from entry and replication to assembly and egress. The ER can act as the common denominator during infection for diverse virus families, thereby providing a shared principle that underlies the apparent complexity of relationships between viruses and host cells. As a plethora of information illuminating the molecular and cellular basis of virus–ER interactions has become available, these insights may lead to the development of crucial therapeutic agents. Morphogenesis Viruses have evolved sophisticated strategies to establish The ER is a membranous system consisting of the The process by which a virus infection. Some viruses bind to cellular receptors and outer nuclear envelope that is contiguous with an intri‑ particle changes its shape and initiate entry, whereas others hijack cellular factors that cate network of tubules and sheets1, which are shaped by structure. disassemble the virus particle to facilitate entry. After resident factors in the ER2–4. The morphology of the ER SEC61 translocation delivering the viral genetic material into the host cell and is highly dynamic and experiences constant structural channel the translation of the viral genes, the resulting proteins rearrangements, enabling the ER to carry out a myriad An endoplasmic reticulum either become part of a new virus particle (or particles) of functions5. -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG -
Emerging Viral Diseases of Fish and Shrimp Peter J
Emerging viral diseases of fish and shrimp Peter J. Walker, James R. Winton To cite this version: Peter J. Walker, James R. Winton. Emerging viral diseases of fish and shrimp. Veterinary Research, BioMed Central, 2010, 41 (6), 10.1051/vetres/2010022. hal-00903183 HAL Id: hal-00903183 https://hal.archives-ouvertes.fr/hal-00903183 Submitted on 1 Jan 2010 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Vet. Res. (2010) 41:51 www.vetres.org DOI: 10.1051/vetres/2010022 Ó INRA, EDP Sciences, 2010 Review article Emerging viral diseases of fish and shrimp 1 2 Peter J. WALKER *, James R. WINTON 1 CSIRO Livestock Industries, Australian Animal Health Laboratory (AAHL), 5 Portarlington Road, Geelong, Victoria, Australia 2 USGS Western Fisheries Research Center, 6505 NE 65th Street, Seattle, Washington, USA (Received 7 December 2009; accepted 19 April 2010) Abstract – The rise of aquaculture has been one of the most profound changes in global food production of the past 100 years. Driven by population growth, rising demand for seafood and a levelling of production from capture fisheries, the practice of farming aquatic animals has expanded rapidly to become a major global industry. -
Novel Viruses in Salivary Glands of Mosquitoes from Sylvatic Cerrado, Midwestern Brazil
RESEARCH ARTICLE Novel viruses in salivary glands of mosquitoes from sylvatic Cerrado, Midwestern Brazil Andressa Zelenski de Lara Pinto1, Michellen Santos de Carvalho1, Fernando Lucas de Melo2, Ana LuÂcia Maria Ribeiro3, Bergmann Morais Ribeiro2, Renata Dezengrini Slhessarenko1* 1 Programa de PoÂs-GraduacËão em Ciências da SauÂde, Faculdade de Medicina, Universidade Federal de Mato Grosso, CuiabaÂ, Mato Grosso, Brazil, 2 Departamento de Biologia Celular, Instituto de Ciências BioloÂgicas, Universidade de BrasõÂlia, BrasõÂlia, Distrito Federal, Brazil, 3 Departamento de Biologia e Zoologia, Instituto de Biociências, Universidade Federal de Mato Grosso, CuiabaÂ, Mato Grosso, Brazil a1111111111 a1111111111 * [email protected] a1111111111 a1111111111 a1111111111 Abstract Viruses may represent the most diverse microorganisms on Earth. Novel viruses and vari- ants continue to emerge. Mosquitoes are the most dangerous animals to humankind. This OPEN ACCESS study aimed at identifying viral RNA diversity in salivary glands of mosquitoes captured in a sylvatic area of Cerrado at the Chapada dos Guimar es National Park, Mato Grosso, Brazil. Citation: Lara Pinto AZd, Santos de Carvalho M, de ã Melo FL, Ribeiro ALM, Morais Ribeiro B, In total, 66 Culicinae mosquitoes belonging to 16 species comprised 9 pools, subjected to Dezengrini Slhessarenko R (2017) Novel viruses in viral RNA extraction, double-strand cDNA synthesis, random amplification and high- salivary glands of mosquitoes from sylvatic throughput sequencing, revealing the presence of seven insect-specific viruses, six of which Cerrado, Midwestern Brazil. PLoS ONE 12(11): e0187429. https://doi.org/10.1371/journal. represent new species of Rhabdoviridae (Lobeira virus), Chuviridae (Cumbaru and Croada pone.0187429 viruses), Totiviridae (Murici virus) and Partitiviridae (Araticum and Angico viruses). -
Comparative Molecular Characterization of Novel and Known Piscine Toti-Like Viruses
viruses Article Comparative Molecular Characterization of Novel and Known Piscine Toti-Like Viruses Liv Sandlund 1, Sunil K. Mor 2 , Vikash K. Singh 2, Soumesh K. Padhi 3 , Nicholas B. D. Phelps 3 , Stian Nylund 1 and Aase B. Mikalsen 4,* 1 Pharmaq Analytiq, 5008 Bergen, Norway; [email protected] (L.S.); [email protected] (S.N.) 2 Veterinary Diagnostic Laboratory, Department of Veterinary Population Medicine, College of Veterinary Medicine, University of Minnesota, St. Paul, MN 55108-6074, USA; [email protected] (S.K.M.); [email protected] (V.K.S.) 3 Department of Fisheries, Wildlife and Conservation Biology, College of Food, Agriculture and Natural Resource Sciences, University of Minnesota, St. Paul, MN 55108-6074, USA; [email protected] (S.K.P.); [email protected] (N.B.D.P.) 4 Department of Paraclinical Sciences, Faculty of Veterinary Medicine, Norwegian University of Life Sciences, 1432 Ås, Norway * Correspondence: [email protected] Abstract: Totiviridae is a virus family well known to infect uni-cellular organisms like fungi and protozoa. In more recent years, viruses characterized as toti-like viruses, have been found in pri- marily arthropods, but also a couple in planarians and piscine species. These toti-like viruses share phylogenetic similarities to totiviruses; however, their genomes also includes additional coding 0 0 sequences in either 5 or 3 ends expected to relate to more advanced infection mechanisms in more advanced hosts. Here, we applied next generation sequencing (NGS) technologies and discovered Citation: Sandlund, L.; Mor, S.K.; three new toti-like viruses, one in wild common carp and one in bluegill from the USA and one Singh, V.K.; Padhi, S.K.; Phelps, in farmed lumpsucker from Norway. -
Recombinant Human Adenosine Kinase/ADK
Recombinant Human Adenosine Kinase/ADK Catalog Number: 8024-AK DESCRIPTION Source E. coliderived Ala2His362 with a Cterminal 6His tag Accession # P55263 Nterminal Sequence Ala2 Analysis Predicted Molecular 41 kDa Mass SPECIFICATIONS SDSPAGE 4345 kDa, reducing conditions Activity Measured by its ability to phosphorylate Adenosine. The specific activity is >7 pmol/min/μg, as measured under the described conditions. Endotoxin Level <1.0 EU per 1 μg of the protein by the LAL method. Purity >95%, by SDSPAGE under reducing conditions and visualized by Colloidal Coomassie® Blue stain at 5 μg per lane. Formulation Supplied as a 0.2 μm filtered solution in Tris and NaCl. See Certificate of Analysis for details. Activity Assay Protocol Materials l Assay Buffer: (10X) 250 mM HEPES, 1.5 M NaCl, 100 mM MgCl2, 100 mM CaCl2 pH 7.0 (supplied in kit) l Recombinant Human Adenosine Kinase/ADK (Catalog # 8024AK) l Adenosine (Sigma, Catalog # A9251), 10 mM stock in deionized water l Adenosine triphosphate (ATP) (Sigma, Catalog # A7699), 10 mM stock in deionized water l Universal Kinase Activity Kit (Catalog # EA004) l 96well Clear Plate (Costar, Catalog # 92592) l Plate Reader (Model: SpectraMax Plus by Molecular Devices) or equivalent Assay 1. Prepare 1X Assay Buffer by diluting 10X Assay Buffer in deionized water. 2. Dilute 1 mM Phosphate Standard provided by the Universal Kinase Activity Kit by adding 40 µL of the 1 mM Phosphate Standard to 360 µL of 1X Assay Buffer for a 100 µM stock. 3. Prepare standard curve by performing seven onehalf serial dilutions of the 100 µM Phosphate stock in 1X Assay Buffer. -
Rice Black-Streaked Dwarf Virus P6 Self-Interacts to Form Punctate
Wang et al. Virology Journal 2011, 8:24 http://www.virologyj.com/content/8/1/24 RESEARCH Open Access Rice black-streaked dwarf virus P6 self-interacts to form punctate, viroplasm-like structures in the cytoplasm and recruits viroplasm-associated protein P9-1 Qian Wang, Tao Tao, Yanjing Zhang, Wenqi Wu, Dawei Li, Jialin Yu, Chenggui Han* Abstract Background: Rice black-streaked dwarf virus (RBSDV), a member of the genus Fijivirus within the family Reoviridae, can infect several graminaceous plant species including rice, maize and wheat, and is transmitted by planthoppers. Although several RBSDV proteins have been studied in detail, functions of the nonstructural protein P6 are still largely unknown. Results: In the current study, we employed yeast two-hybrid assays, bimolecular fluorescence complementation and subcellular localization experiments to show that P6 can self-interact to form punctate, cytoplasmic viroplasm- like structures (VLS) when expressed alone in plant cells. The region from residues 395 to 659 is necessary for P6 self-interaction, whereas two polypeptides (residues 580-620 and 615-655) are involved in the subcellular localization of P6. Furthermore, P6 strongly interacts with the viroplasm-associated protein P9-1 and recruits P9-1 to localize in VLS. The P6 395-659 region is also important for the P6-P9-1 interaction, and deleting any region of P9-1 abolishes this heterologous interaction. Conclusions: RBSDV P6 protein has an intrinsic ability to self-interact and forms VLS without other RBSDV proteins or RNAs. P6 recruits P9-1 to VLS by direct protein-protein interaction. This is the first report on the functionality of RBSDV P6 protein. -
Host-Virus Interactions in the Pacific White Shrimp, Litopenaeus Vannamei Duan Sriyotee Loy Iowa State University
Iowa State University Capstones, Theses and Graduate Theses and Dissertations Dissertations 2014 Host-virus interactions in the Pacific white shrimp, Litopenaeus vannamei Duan Sriyotee Loy Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/etd Part of the Virology Commons Recommended Citation Loy, Duan Sriyotee, "Host-virus interactions in the Pacific white shrimp, Litopenaeus vannamei" (2014). Graduate Theses and Dissertations. 13777. https://lib.dr.iastate.edu/etd/13777 This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Host-virus interactions in the Pacific white shrimp, Litopenaeus vannamei by Duan Sriyotee Loy A dissertation submitted to the graduate faculty in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Major: Veterinary Microbiology Program of Study Committee: Lyric Bartholomay, Co-Major Professor Bradley Blitvich, Co-Major Professor D.L. Hank Harris Cathy Miller Michael Kimber Iowa State University Ames, Iowa 2014 Copyright © Duan Sriyotee Loy, 2014. All rights reserved. ii TABLE OF CONTENTS CHAPTER 1: GENERAL INTRODUCTION...…………………………………………...1 Introduction…………………………………………………………………………………………1 Dissertation Organization…………………………………………………………………………3