DOCSLIB.ORG

United States Patent (19) 11 Patent Number: 6,043,047 Foote Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
United States Patent (19) 11 Patent Number: 6,043,047 Foote Et Al US006043047A United States Patent (19) 11 Patent Number: 6,043,047 Foote et al. (45) Date of Patent: Mar. 28, 2000 54) SAMPLE-COLLECTING AND ASSAY 4,923,796 5/1990 Deneke et al. ............................ 435/15 DEVICE FOR USE IN THE DETECTION OF 5,001,055 3/1991 Imahori et al. ........................... 435/15 BIOLOGICAL MATERIAL FOREIGN PATENT DOCUMENTS 75 Inventors: Nicholas Peter Martin Foote; Peter 0060123 9/1982 European Pat. Off.. Leonard Grant; Anthony Cooke; 01.02504 3/1984 European Pat. Off.. Ramin Pirzad, all of Cambridge, 0193895 9/1986 European Pat. Off.. United Kingdom 0327952 8/1989 European Pat. Off.. 1-023900 1/1989 Japan. 73 Assignee: Celsis International, PLC, United 2055200 2/1981 United Kingdom. Kingdom OTHER PUBLICATIONS 21 Appl. No.: 09/012,281 Chittock et al. (1991) “Light Amplification by a Coupled Biological System: ATP, Firefly Luciferase and Recycling of 22 Filed: Jan. 23, 1998 ATP". Biochemical Society Transactions. 19(160S). Related U.S. Application Data Primary Examiner Louise N. Leary Attorney, Agent, or Firm-Saliwanchik, Lloyd & 63 Continuation-in-part of application No. 08/553,477, filed as application No. PCT/GB94/00783, Apr. 14, 1994, aban Saliwanchik doned. 57 ABSTRACT 30 Foreign Application Priority Data An assay device comprises a tube, a removable top part and Apr. 23, 1993 GB United Kingdom ................... 9308411 a bottom part, wherein an elongate member with a Swab at its distal end is mounted on the top part, the top part includes 51 Int. Cl." ............................... C12O 1/42; C12O 1/54; a compartment containing liquid and partly defined by a first C12O 1/48; C12O 1/26 frangible membrane that can be ruptured to release the liquid 52 U.S. Cl. ................................. 435/21; 435/14; 435/15; into the tube, and the bottom part contains a reagent and is 435/26; 435/28; 435/25 partly defined by a Second frangible membrane that can be 58 Field of Search .................................. 435/21, 14, 15, ruptured on movement of the bottom part relative to the 435/25, 26, 28 tube. 56) References Cited Reaction occurring in the bottom part can be observed U.S. PATENT DOCUMENTS through a window. This reaction may be of the type involv ing amplification of Say, ATP, e.g. by providing AMP, 3,745,090 7/1973 Chappelle et al. ........................ 435/15 glucose-6-phosphate (G6P), adenylate kinase, glucokinase 4,234,313 11/1980 Faulkner ................................... 435/15 and reagents that convert glucose (G) to give a color, 4,277.562 7/1981 Modrovich ................................ 435/15 4,303,752 12/1981 Kolehmainen et al. .................. 435/15 whereby the following reactions occur 4,371,624 2/1983 Saxholm ................................... 435/15 AMP-ATP-2ADP 4,493,815 1/1985 Fernwood et al. ........................ 435/15 4,495,293 1/1985 Shaffar ................. ... 435/15 4,584.272 4/1986 Imahori et al. ... 435/15 4,735,897 4/1988 Vary et al. ... ... 435/15 4,767,699 8/1988 Vary et al. ................................ 435/15 7 Claims, 9 Drawing Sheets S1 C1 P U.S. Patent Mar. 28, 2000 Sheet 1 of 9 6,043,047 FIG. U.S. Patent Mar. 28, 2000 Sheet 2 of 9 6,043,047 X X-Y-Y Z X-Y FIG. 2 U.S. Patent Mar. 28, 2000 Sheet 3 of 9 6,043,047 X-Y-Y X Z-Y X-Y Z FIG. 3 U.S. Patent Mar. 28, 2000 Sheet 4 of 9 6,043,047 Col. HRP AAP O2 H9. a. DMA AMP ATP G G GO Ox AK GK ADP G6P FIG. 4 U.S. Patent Mar. 28, 2000 Sheet 5 of 9 6,043,047 Col. Fzn INV OPA NAD - NADH G G16DP 3PG PGDH 3PHP GPPDM GBPS G1P 3PGP FIG. 5 U.S. Patent Mar. 28, 2000 Sheet 6 of 9 6,043,047 s s 3 E A. H 3 r d O O s O (WN Of G) W U.S. Patent Mar. 28, 2000 Sheet 7 of 9 6,043,047 U.S. Patent Mar. 28, 2000 Sheet 8 of 9 6,043,047 &ZZZZZZZZZZZ N N § U.S. Patent Mar. 28, 2000 Sheet 9 of 9 6,043,047 6,043,047 1 2 SAMPLE-COLLECTING AND ASSAY It is not clear from the reaction Scheme proposed by DEVICE FOR USE IN THE DETECTION OF Chittock et all why the proposed ATP recycling mechanism BIOLOGICAL MATERIAL should cause the observed increase in peak light output of the luciferase reaction, Since no net increase in ATP con CROSS-REFERENCE TO ARELATED centration would occur. Nevertheless, the authors describe APPLICATION the phenomenon as amplification of ATP This application is a continuation-in-part of U.S. Ser. No WO-A-9525948 discloses a sample-collecting and assay 08/553,477, filed Oct. 20, 1995, now abandoned, which is a device comprising a tube, a removable top part and a bottom U.S. national Stage application filed from International part, wherein an elongate member with a Swab at its distal patent application No. PCT/GB94/00783, filed Apr. 14, end is mounted on the top part. There may be one or more 1994. foil-sealed bottom parts fixed within the tube, and the foils are Successively broken by movement of the Swab, or a FIELD OF THE INVENTION coaxially-extending blade-like member, through the tube. This invention relates to a Sample-collecting and assay WO-A-9703209 discloses a similar device, in which device, and in particular to a simple hygiene monitor. The 15 reagent is contained in a bottom part with a window, and device may be used in the detection of biological material, which has a seal broken by movement of the Swab through e.g. utilizing a novel reaction mechanism also defined the tube. Another, similar device is disclosed in WO-A- herein. 9723596. BACKGROUND OF THE INVENTION SUMMARY OF THE INVENTION Many techniques are available for the detection of bio An assay device according to the present invention is for logical materials, for instance by the production of a colour. use in determining the presence in a liquid Sample of a target For example, materials may be added that form hydrogen component that, in combination with other components, peroxide or NADH in the presence of the target Substance, undergoes a reaction to give a detectable signal. The novel and these may be caused to produce a coloured compound 25 device comprises a tube, a removable top part and a bottom by further reactions. Alternatively, the target Substance may part, wherein an elongate member with a Swab at its distal produce colour more directly; for instance, many hydrolytic end is mounted on the top part, the top part includes a enzymes can act on artificial Substrates to give a coloured compartment containing liquid and partly defined by a first product. frangible membrane that can be ruptured to release the liquid A difficulty arises, however, in connection with the detec into the tube, and the bottom part contains a reagent and is tion of very Small amounts of the target Substance, Such that partly defined by a Second frangible membrane that can be the amount of colour produced may be too small to analyse ruptured on movement of the bottom part relative to the without complicated apparatus, and certainly not by the tube. naked eye. Some amplification mechanisms have been 35 By means of the invention, direct analysis can be made, described, Such as cyclic reactions for the measurement of by observing the Signal generated, in the bottom part. low levels of NAD(H) or NADP(H); see EP-A-0060123. Although the novel device shares many characteristics with This is an example of a cycle giving linear amplification of the prior art devices, described above, its particular advan the target Substances, i.e. their concentrations increase in tages include the use of a simple visual test with a yes/no proportion with reaction time, and therefore a long period is 40 result, avoiding the need for a luminometer, and a Syringe required for Sensitive measurements. like mechanism within the top dispenser, to ensure repeat GB-A-2055200 discloses the same and other linear ampli able and reproducible dispensing of liquid reagent. The test fication cycles. It also discloses a cycle wherein adenylate can have high Sensitivity. Although the top part may be kinase catalyzes the reaction of AMP and ATP to form ADP unitary or comprise a separate component containing which is then re-phosphorylated to form ATP by the action 45 reagent, the design of the top reagent container and its holder of pyruvate kinase. It is Stated that, in each cycle, one extra may be Such that a single operation, depressing the molecule of ATP is produced. The reaction is used to amplify container, ruptures the Seal and evacuates the contents of the ATP for the purposes of bioluminescence. The procedure for container down the Swab Shaft, ensuring accurate and repro ATP amplification involves adding the other materials suf ducible dispensing of the liquid reagent with minimal dead ficient for the reactions to proceed, Stopping the cycling 50 Volume and without introduction of any air, unlike a “pump reaction, and measuring accumulated ATP using a biolumi ing dispensing System. neScence assay and a luminometer. Further, it has now been appreciated that there is a Chittock et al. Biochemical Society Transactions (1991) reaction System that can be used, not simply for the regen 19:160S, also disclose that the light intensity of the known eration of ATP, but for the production of a colour or other bioluminescence reaction may be increased by recycling 55 easily-detectable Signal which can be used to quantify very ATP in a System containing myokinase (adenylate kinase), low levels of ATP and ADP.
Load more

Recommended publications
  • METACYC ID Description A0AR23 GO:0004842 (Ubiquitin-Protein Ligase
    Electronic Supplementary Material (ESI) for Integrative Biology This journal is © The Royal Society of Chemistry 2012 Heat Stress Responsive Zostera marina Genes, Southern Population (α=0.
    [Show full text]
  • In the Field of Clinical Examination, the Measurement of Creatine
    J. Clin. Biochem. Nutr., 3, 17-25, 1987 Bacterial Glucokinase as an Enzymic Reagent of Good Stability for Measurement of Creatine Kinase Activity Hitoshi KONDO, * Takanari SHIRAISHI, Masao KAGEYAMA, Kazuhiko NAGATA, and Kosuke TOMITA Research and Development Center, UNITIKA Ltd., Uji 611, Japan (Received January 10, 1987) Summary An enzymic reagent, that has long-term stability even in the liquid state, was successfully employed for the measurement of serum creatine kinase (CK, EC 2.7.3.2) activity. The enzyme used was the thermostable glucokinase (GlcK, EC 2.7.1.2) obtained from the thermo- phile Bacillus stearothermophilus. The reagent was found to be stable in solution for about one month at 6•Ž and for about one week at 30•Ž. This substitution of glucokinase for the hexokinase of the most commonly used hexokinase-glucose-6-phosphate dehydrogenase (HK-G6PDH) method results in a remarkable improvement of the method. The CK activity measured by the GlcK-G6PDH method was linear up to about 2,000 U/ liter at 37•Ž. The GlcK-G6PDH method was found to give a satisfactory precision and reproducibility (coefficient of variation less than 2.17%). Over a wide range of CK activity, an excellent agreement was obtained between the GlcK-G6PDH and the HK-G6PDH methods. Furthermore several coexistents and anticoagulants were found to have little effect on the measured value of CK activity by the GlcK-G6PDH method. Key Words: creatine kinase activity, glucokinase, improved stability of reagent, creatine kinase determination, thermostable enzyme In the field of clinical examination, the measurement of creatine kinase (CK, ATP : creatine phosphotransferase, EC 2.7.3.2) activity in serum is one of the important examinations usually employed for diagnosis of cardiac diseases such as myocardial infarction or muscular diseases such as progressive muscular dystrophy.
    [Show full text]
  • Labeled in Thecourse of Glycolysis, Since Phosphoglycerate Kinase
    THE STATE OF MAGNESIUM IN CELLS AS ESTIMATED FROM THE ADENYLATE KINASE EQUILIBRIUM* BY TRWIN A. RoSE THE INSTITUTE FOR CANCER RESEARCH, PHILADELPHIA Communicated by Thomas F. Anderson, August 30, 1968 Magnesium functions in many enzymatic reactions as a cofactor and in com- plex with nucleotides acting as substrates. Numerous examples of a possible regulatory role of Mg can be cited from studies with isolated enzymes,'- and it is known that Mg affects the structural integrity of macromolecules such as trans- fer RNA" and functional elements such as ribosomes.'0 The major problem in translating this information on isolated preparations to the functioning cell is the difficulty in determining the distribution of Mg and the nucleotides among the free and complexed forms that function in the region of the cell for which this information is desired. Nanningall based an attempt to calculate the free Mg2+ and Ca2+ ion concentrations of frog muscle on the total content of these metals and of the principal known ligands (adenosine 5'-triphosphate (ATP), creatine-P, and myosin) and the dissociation constants of the complexes. However, this method suffers from the necessity of evaluating the contribution of all ligands as well as from the assumption that all the known ligands are contributing their full complexing capacity. During studies concerned with the control of glycolysis in red cells and the control of the phosphoglycerate kinase step in particular, it became important to determine the fractions of the cell's ATP and adenosine 5'-diphosphate (ADP) that were present as Mg complexes. Just as the problem of determining the distribution of protonated and dissociated forms of an acid can be solved from a knowledge of pH and pKa of the acid, so it would be possible to determine the liganded and free forms of all rapidly established Mg complexes from a knowledge of Mg2+ ion concentration and the appropriate dissociation constants.
    [Show full text]
  • Ribonucleotides Incorporated by the Yeast Mitochondrial DNA Polymerase Are Not Repaired
    Ribonucleotides incorporated by the yeast mitochondrial DNA polymerase are not repaired Paulina H. Wanrooija,1, Martin K. M. Engqvistb,c,2, Josefin M. E. Forslunda,2, Clara Navarreteb, Anna Karin Nilssona, Juhan Sedmand, Sjoerd Wanrooija, Anders R. Clausenb, and Andrei Chabesa,e,1 aDepartment of Medical Biochemistry and Biophysics, Umeå University, SE-901 87 Umeå, Sweden; bInstitute of Biomedicine, University of Gothenburg, SE-405 30 Gothenburg, Sweden; cDepartment of Biology and Biological Engineering, Chalmers University of Technology, SE-412 96 Gothenburg, Sweden; dDepartment of Biochemistry, Institute of Molecular and Cell Biology, University of Tartu, Tartu 51010, Estonia; and eLaboratory for Molecular Infection Medicine Sweden, Umeå University, SE-901 87 Umeå, Sweden Edited by Philip C. Hanawalt, Stanford University, Stanford, CA, and approved October 17, 2017 (received for review July 25, 2017) Incorporation of ribonucleotides into DNA during genome replica- Mec1/Rad53 genome integrity checkpoint regulates yeast RNR tion is a significant source of genomic instability. The frequency activity through several different mechanisms (14). of ribonucleotides in DNA is determined by deoxyribonucleoside The incorporation of ribonucleotides (rNMPs) into the genome triphosphate/ribonucleoside triphosphate (dNTP/rNTP) ratios, by the during DNA replication has become recognized as a significant ability of DNA polymerases to discriminate against ribonucleotides, source of genomic instability. Given that the physiological con- and by the capacity of repair mechanisms to remove incorporated centrations of ribonucleoside triphosphates (rNTPs), the building ribonucleotides. To simultaneously compare how the nuclear and blocks of RNA, are one to two orders-of-magnitude higher than mitochondrial genomes incorporate and remove ribonucleotides, those of dNTPs, rNMPs are frequently incorporated into DNA we challenged these processes by changing the balance of cellular during replication (15, 16).
    [Show full text]
  • The Characterization of Human Adenylate Kinases 7 and 8
    The characterization of human adenylate kinases 7 and 8 demonstrates differences in kinetic parameters and structural organization among the family of adenylate kinase isoenzymes Christakis Panayiotou, Nicola Solaroli, Yunjian Xu, Magnus Johansson, Anna Karlsson To cite this version: Christakis Panayiotou, Nicola Solaroli, Yunjian Xu, Magnus Johansson, Anna Karlsson. The char- acterization of human adenylate kinases 7 and 8 demonstrates differences in kinetic parameters and structural organization among the family of adenylate kinase isoenzymes. Biochemical Journal, Port- land Press, 2011, 433 (3), pp.527-534. 10.1042/BJ20101443. hal-00558097 HAL Id: hal-00558097 https://hal.archives-ouvertes.fr/hal-00558097 Submitted on 21 Jan 2011 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Biochemical Journal Immediate Publication. Published on 16 Nov 2010 as manuscript BJ20101443 The characterization of human adenylate kinases 7 and 8 demonstrates differences in kinetic parameters and structural organization among the family of adenylate kinase isoenzymes
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Structures, Functions, and Mechanisms of Filament Forming Enzymes: a Renaissance of Enzyme Filamentation
    Structures, Functions, and Mechanisms of Filament Forming Enzymes: A Renaissance of Enzyme Filamentation A Review By Chad K. Park & Nancy C. Horton Department of Molecular and Cellular Biology University of Arizona Tucson, AZ 85721 N. C. Horton ([email protected], ORCID: 0000-0003-2710-8284) C. K. Park ([email protected], ORCID: 0000-0003-1089-9091) Keywords: Enzyme, Regulation, DNA binding, Nuclease, Run-On Oligomerization, self-association 1 Abstract Filament formation by non-cytoskeletal enzymes has been known for decades, yet only relatively recently has its wide-spread role in enzyme regulation and biology come to be appreciated. This comprehensive review summarizes what is known for each enzyme confirmed to form filamentous structures in vitro, and for the many that are known only to form large self-assemblies within cells. For some enzymes, studies describing both the in vitro filamentous structures and cellular self-assembly formation are also known and described. Special attention is paid to the detailed structures of each type of enzyme filament, as well as the roles the structures play in enzyme regulation and in biology. Where it is known or hypothesized, the advantages conferred by enzyme filamentation are reviewed. Finally, the similarities, differences, and comparison to the SgrAI system are also highlighted. 2 Contents INTRODUCTION…………………………………………………………..4 STRUCTURALLY CHARACTERIZED ENZYME FILAMENTS…….5 Acetyl CoA Carboxylase (ACC)……………………………………………………………………5 Phosphofructokinase (PFK)……………………………………………………………………….6
    [Show full text]
  • Regulation of Adenylate Kinase and Creatine Kinase Activities In
    Proc. Nat. Acad. Sci. USA Vol. 71, No. 6, pp. 2377-2381, June 1974 Regulation of Adenylate Kinase and Creatine Kinase Activities in Myogenic Cells (myogenesis/enzyme regulation) HELGI TARIKAS AND DAVID SCHUBERT Neurobiology Department, The Salk Institute, P. 0. Box 1809, San Diego, Califdr.nia 92112 Communicated by F. Jacob, March 8, 1974 ABSTRACT The regulation of the specific activities of not fuse in either situation. M3A shows a hyperpolarizing adenylate kinase (EC 2.7.4.3) and creatine kinase (EC response to iontophoretically applied acetylcholine compa- 2.7.3.2) in myogenic cell lines is independent of cell fusion. The observed increases in enzyme specific activities are cell rable to that observed in L6 myoblasts (A. J. Harris, personal density dependent, and may be further broken down into communication). The creatine kinase isozymes (8) of L6 and contributions from an increase in enzyme activity per cell M3A are indistinguishable. All cells were cultured in modified and a decrease in protein per cell. Only the former appears Eagle's medium (9) containing 10% fetal-calf serum at 360. to be affected by medium conditioning. Falcon plastic tissue culture or petri dishes were used as There is an increase in the specific activities (enzyme activity indicated. Cell number determinations and assays for creatine per unit of total cellular protein) of adenylate kinase (EC kinase and adenylate kinase were done as described (10). 2.7.4.3; ATP:AMP phosphotransferase) and creatine kinase Cells were dissociated for cell number determinations and (EC 2.7.3.2; ATP: creatine N-phosphotransferase) temporally replating with 0.25% (w/v) Viokase (Gibco).
    [Show full text]
  • Supplementary Informations SI2. Supplementary Table 1
    Supplementary Informations SI2. Supplementary Table 1. M9, soil, and rhizosphere media composition. LB in Compound Name Exchange Reaction LB in soil LBin M9 rhizosphere H2O EX_cpd00001_e0 -15 -15 -10 O2 EX_cpd00007_e0 -15 -15 -10 Phosphate EX_cpd00009_e0 -15 -15 -10 CO2 EX_cpd00011_e0 -15 -15 0 Ammonia EX_cpd00013_e0 -7.5 -7.5 -10 L-glutamate EX_cpd00023_e0 0 -0.0283302 0 D-glucose EX_cpd00027_e0 -0.61972444 -0.04098397 0 Mn2 EX_cpd00030_e0 -15 -15 -10 Glycine EX_cpd00033_e0 -0.0068175 -0.00693094 0 Zn2 EX_cpd00034_e0 -15 -15 -10 L-alanine EX_cpd00035_e0 -0.02780553 -0.00823049 0 Succinate EX_cpd00036_e0 -0.0056245 -0.12240603 0 L-lysine EX_cpd00039_e0 0 -10 0 L-aspartate EX_cpd00041_e0 0 -0.03205557 0 Sulfate EX_cpd00048_e0 -15 -15 -10 L-arginine EX_cpd00051_e0 -0.0068175 -0.00948672 0 L-serine EX_cpd00054_e0 0 -0.01004986 0 Cu2+ EX_cpd00058_e0 -15 -15 -10 Ca2+ EX_cpd00063_e0 -15 -100 -10 L-ornithine EX_cpd00064_e0 -0.0068175 -0.00831712 0 H+ EX_cpd00067_e0 -15 -15 -10 L-tyrosine EX_cpd00069_e0 -0.0068175 -0.00233919 0 Sucrose EX_cpd00076_e0 0 -0.02049199 0 L-cysteine EX_cpd00084_e0 -0.0068175 0 0 Cl- EX_cpd00099_e0 -15 -15 -10 Glycerol EX_cpd00100_e0 0 0 -10 Biotin EX_cpd00104_e0 -15 -15 0 D-ribose EX_cpd00105_e0 -0.01862144 0 0 L-leucine EX_cpd00107_e0 -0.03596182 -0.00303228 0 D-galactose EX_cpd00108_e0 -0.25290619 -0.18317325 0 L-histidine EX_cpd00119_e0 -0.0068175 -0.00506825 0 L-proline EX_cpd00129_e0 -0.01102953 0 0 L-malate EX_cpd00130_e0 -0.03649016 -0.79413596 0 D-mannose EX_cpd00138_e0 -0.2540567 -0.05436649 0 Co2 EX_cpd00149_e0
    [Show full text]
  • A Review of Isozymes in Cancer1
    Cancer Research VOLUME31 NOVEMBER 1971 NUMBER11 [CANCER RESEARCH 31, 1523-1542, November 1971] A Review of Isozymes in Cancer1 Wayne E. Criss Department of Obstetrics and Gynecology, University of Florida College of Medicine, Gainesville, Florida 32601 TABLE OF CONTENTS postulated role for that particular isozymic system in cellular metabolism. Summary 1523 Introduction 1523 Normal enzyme differentiation 1523 INTRODUCTION Tumor enzyme differentiation 1524 Isozymes 1524 Normal Enzyme Differentiation DNA polymerase 1524 Enzyme differentiation is the process whereby, during the Hexokinase 1525 Fructose 1,6-diphosphatase 1525 development of an organ in an animal, the organ acquires the quantitative and qualitative adult enzyme patterns (122). Key Aldolase 1526 pathway enzymes in several metabolic processes have been Pyruvate kinase 1527 found to undergo enzymatic differentiation. The enzymes Láclatedehydrogenase 1527 Isocitrate dehydrogenase 1527 involved in nitrogen metabolism, and also in urea cycle Malate dehydrogenase 1528 metabolism (180), are tyrosine aminotransferase (123, 151, Glycerol phosphate dehydrogenase 1529 330, 410), tryptophan pyrrolase (261), serine dehydratase Glutaminase 1529 (123, 410), histidine ammonia lyase (11), and aspartate Aspartate aminotransferase 1530 aminotransferase (337, 388). The enzymes involved in nucleic Adenylate kinase 1531 acid metabolism are DNA polymerase (156, 277) and RNase (52). In glycolysis the enzymes are hexokinase-glucokinase Carbamyl phosphate synthetase 1531 Lactose synthetase 1533 (98, 389), galactokinase 30, aldolase (267, 315), pyruvate Discussion 1533 kinase (73, 386), and lactate dehydrogenase (67, 69). In References 1533 mitochondrial oxidation they are NADH oxidase, succinic oxidase, a-glycero-P oxidase, ATPase, cytochrome oxidase, and flavin content (84, 296). In glycogen metabolism the SUMMARY enzymes involved are UDPG pyrophosphorylase and UDPG glucosyltransferase (19).
    [Show full text]
  • Mitochondrial Uncoupling and the Reprograming of Intermediary Metabolism in Leukemia Cells
    REVIEW ARTICLE published: 02 April 2013 doi: 10.3389/fonc.2013.00067 Mitochondrial uncoupling and the reprograming of intermediary metabolism in leukemia cells Juliana Vélez 1, Numsen Hail Jr.2,3, Marina Konopleva2,3, Zhihong Zeng 2,3, Kensuke Kojima2,3, Ismael Samudio1* and Michael Andreeff 2,3* 1 Grupo de Terapia Celular y Molecular Laboratorio de Bioquimica, Pontificia Universidad Javeriana, Bogotá, Colombia 2 Section of Molecular Hematology and Therapy, The University of Texas MD Anderson Cancer Center, Houston, TX, USA 3 Department of Leukemia, The University of Texas MD Anderson Cancer Center, Houston, TX, USA Edited by: Nearly 60 years ago Otto Warburg proposed, in a seminal publication, that an irreparable Jozsef Dudas, Medical University defect in the oxidative capacity of normal cells supported the switch to glycolysis for energy Innsbru, Austria generation and the appearance of the malignant phenotype (Warburg, 1956). Curiously, Reviewed by: Daniel Christian Hoessli, International this phenotype was also observed by Warburg in embryonic tissues, and recent research Center for Chemical and Biological demonstrated that normal stem cells may indeed rely on aerobic glycolysis – fermenting Sciences, Switzerland pyruvate to lactate in the presence of ample oxygen – rather than on the complete oxidation Jozsef Dudas, Medical University of pyruvate in the Krebs cycle – to generate cellular energy (Folmes et al., 2012). However, Innsbruck, Austria it remains to be determined whether this phenotype is causative for neoplastic develop- *Correspondence: Ismael Samudio, Laboratorio de ment, or rather the result of malignant transformation. In addition, in light of mounting Bioquimica #301, Edificio Jesús evidence demonstrating that cancer cells can carry out electron transport and oxidative Emilio Ramírez, Pontificia Universidad phosphorylation, although in some cases predominantly using electrons from non-glucose Javeriana, Cra 7 No.
    [Show full text]
  • Genome-Wide Investigation of Cellular Functions for Trna Nucleus
    Genome-wide Investigation of Cellular Functions for tRNA Nucleus- Cytoplasm Trafficking in the Yeast Saccharomyces cerevisiae DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Hui-Yi Chu Graduate Program in Molecular, Cellular and Developmental Biology The Ohio State University 2012 Dissertation Committee: Anita K. Hopper, Advisor Stephen Osmani Kurt Fredrick Jane Jackman Copyright by Hui-Yi Chu 2012 Abstract In eukaryotic cells tRNAs are transcribed in the nucleus and exported to the cytoplasm for their essential role in protein synthesis. This export event was thought to be unidirectional. Surprisingly, several lines of evidence showed that mature cytoplasmic tRNAs shuttle between nucleus and cytoplasm and their distribution is nutrient-dependent. This newly discovered tRNA retrograde process is conserved from yeast to vertebrates. Although how exactly the tRNA nuclear-cytoplasmic trafficking is regulated is still under investigation, previous studies identified several transporters involved in tRNA subcellular dynamics. At least three members of the β-importin family function in tRNA nuclear-cytoplasmic intracellular movement: (1) Los1 functions in both the tRNA primary export and re-export processes; (2) Mtr10, directly or indirectly, is responsible for the constitutive retrograde import of cytoplasmic tRNA to the nucleus; (3) Msn5 functions solely in the re-export process. In this thesis I focus on the physiological role(s) of the tRNA nuclear retrograde pathway. One possibility is that nuclear accumulation of cytoplasmic tRNA serves to modulate translation of particular transcripts. To test this hypothesis, I compared expression profiles from non-translating mRNAs and polyribosome-bound translating mRNAs collected from msn5Δ and mtr10Δ mutants and wild-type cells, in fed or acute amino acid starvation conditions.
    [Show full text]