sign in sign up
<<
Home , Hematodinium

-- . DISEASES OF AQUATIC ORGANISMS Published January 4 Dis aquat Org - -

Nucleotide sequence determination of the partial SSU rDNA gene and ITSl region of Hematodinium cf. pereziand Hematodinium-like

Darryl A. Hudson*, Robert D. Adlard

Department of Parasitology, The University of Queensland. Brisbane, Queensland 4072. Australia

ABSTRACT: Partial sequences of the small subunit (SSU) rDNA gene of the parasitic dinoflagellates Hematodinium cf. perezi from the blue crab and 3 Hematodjnium-like organisms from other decapods, Nephrops non~egicus, and C. opilio, were compared. The V9 variable of this gene showed no nucleotide differences between the 4 parasitic dinoflagellates. Comparison of this region with other protozoans suggested that the 3 Hematodiniun~-likeorganisms should be considered to be within the genus Hematodinium Differences in nucleotide sequence in the partial ITSl regions from these 4 parasitic dinoflagellates suggest that there are 2 new species. The Hematodinium organism ex N. norvegicus warrants the creation of a new species. The Hematod~nium organisms ex C. bairdi and C, opilio are probably the same species and also warrant the creation of another new species, while H. cf. perezi remains distinct from the other isolates.

KEYWORDS: Hematodinium 18S/ITS1 rDNA genes . Molecular

INTRODUCTION definition. Taxonomic studies are difficult because electron microscope studles from the type species have Marine are parasitized by 2 orders of not been undertaken and dinospores have not been dinoflagellates: the Blastodiales and the recorded. The paucity of morphological characters (Shields 1994). In the Syndiniales, the type species, useful for diagnosis of parasites from different hosts Chatton & Poisson, 1931, was further complicates the systematics of the group. described from the portunid crabs Carcinus maenus Nucleotide sequence determination of the small and Portunus depurator; the second species, H. aus- subunit (SSU) ribosomal DNA (rDNA) gene and the tralis Hudson & Shields, 1994, was described from internal transcribed spacer 1 (ITS1) region has proved another portunid, Portunuspelagicus. H. cf. perezi has a useful diagnostic tool at the levels of genus and also been recorded from Callinectes sapidus, a deca- species in insects (Porter & Collins 1991), trematodes pod of commercial importance (Newman & Johnson (Adlard et al. 1993) and protozoans (Cai et al. 1992, 1975, Messick 1994). Hematodiniurn-like dinoflagel- Goggin 1994, Diggles & Adlard 1995). Our aim was lates have had severe effects on Chionoecetes bairdi, to determine and compare partial SSU rDNA and C. opilio and , all decapods of ITSl regions of Hematodinium cf. perezi and 3 commercial importance (Meyers et al. 1987, Field et Hematodinium-like dinoflagellates. These partial SSU al. 1992). sequences were compared to 6 other dinoflagellates to Hudson & Shields (1994) have suggested that the investigate the systematic distance between members taxonomy of the genus Hematodinium requires better of the genus Hematodinium and the organisms classi- fied currently as Hematodinium-like, while the partial ITSl sequences were used to determine the extent of genetic variance between isolates.

0 Inter-Research 1996 Resale of full article not permitted 56 Dis aquat Org 24:55-60, 1996

MATERIALS AND METHODS CCT GCC CTT TGT ACA CA); Primer 4 (forward primer 5' CGT AGG TGA ACC TGC GGA AGG ATC); Sample collection. A sand crab, Portunus pelagicus, and Primer 5 (reverse primer 5' GAT CCT TCT GCA infected with Hematodinium australis was collected GGT TCA CCT AC). Sequencing primers were end- in March 1992, from Moreton Bay, Queensland, Aus- labelled with phosphorus (32P).Both the sense and the tralia. A Norway lobster, Nephrops norvegicus, in- non-sense strands were sequenced for the partial SSU, fected with a Hematodinium-like was while only the sense strand was sequenced for the collected in January 1993, from the Firth of Clyde, on partial ITSl region as Primer 2 failed to produce a the west coast of Scotland, UK. Two blue crabs, Calli- readable sequence. However, for the partial ITSl nectes sapidus, infected with Hematodinium cf. perezi region Primers 1,3and 4 produced identical sequences were collected in November 1993, from the Rappala- therefore validating results. Sequencing fragments moda River, Chesapeake Bay, Virginia, USA. Two were electrophoresed at a constant power of 45 W. Tanner crabs, Chionoecetes bairdi, infected with a DNA sequences were aligned by eye and manipu- Hematodinium-like dinoflagellate and a Snow crab, lated with the Eye-ball Sequence Editor (ESEE) soft- C. opilio, infected with a Hematodinium-like organism ware (Cabot & Beckenbach 1989). The partial SSU were collected in February 1993, near Juneau and sequences minus the amplification primer scquencc, Dutch Harbor, Alaska, USA, respectively. H. australis Primer 1, of Hematodinium organisms were compared from l? pelagicus was frozen at -60°C. Hemolymph to known sequences stored in Genbank using the samples from Chionoecetes bairdi, C. opilio, and N. Basic Local Alignment Search Tool (BLAST) routine norvegicus containing Hematodinium-like dinofla- (Altschul et al. 1990) available through the Australian gellates were collected via syringe and fixed directly National Genomic Information System (ANGIS). A in 100% ethanol. Hematodinium-infected testes from total of 6 species from 3 dinoflagellate orders were Callinectes sapidus were fixed directly in 100 % ethanol compared. They were: Order , Proro- and were shaken to produce sediment containing centrum micans; Order Phytodiniales, Gloeodinium the Hematodinium cells. Attempts to obtain samples viscum; Order , Family Zooxanthel- of the type species, H. perezi, from France were un- laceae, microadnaticum, S. corculorum, successful. S. pilosum, S. meandrinae. Gaps introduced into the DNA extraction, purification and amplification. DNA alignment were treated as missing data. Informative was extracted from the Hematodinium organisms sites are bases which are different for 1 sequence but using a standard phenol/chloroform method as similar in other sequences. A similarity matrix was described by Hudson & Adlard (1994). The first inter- used to establish relatedness in the V9 domain of the nal transcibed spacer (ITS1) of ribosomal DNA and partial SSU region and for the partial ITSl region. flanking 3' end of the SSU was amplified by poly- merase chain reactions (PCR) using oligonucleotide primers, Primer 1 (forward primer: 5' GTT CCC CTT RESULTS GAA CGA GGA ATT C) and Primer 2 (reverse primer: 5' CGC AnTCG CTG CGT TCT TC). PCR amplifica- Strong PCR products of approximately 680 base tions were performed on Hematodinium organisms pairs were obtained from the Hematodinium spp. from Chionoecetes bairdi, C, opilio, Callinectes sapi- and the Hematodinium-like organisms (see Hudson & dus, Nephrops norvegicus and Portunus pelagicus as Adlard 1994). These products were then sequenced. described by Hudson & Adlard (1994). Hudson & Sequences were obtained for 237 bases from the 3' end Adlard (1994) showed that Primers 1 and 2 favoured of the SSU region (Fig. 1) and 278 bases from the 5' end the amplification of dinoflagellate DNA. PCR products of the ITSl region (Fig. 2) for Hematodinium cf. perezi were purified (Magic PCR Preps, Promega) prior to (Isolate designation #l) and the Hematodiniurn-like sequencing. Primers were designed from published organisms from Nephrops norvegicus (Isolate designa- sequences available through GenBank: Primer 1, from tion #2), Chionoecetes bairdi (Isolate designation #3) conserved arthropod sequences; Primers 2 and 3, from and C, opilio (Isolate designation #4). There was no conserved protozoan sequences; Primer 4, 100% con- nucleotide variation either within isolates of H. cf. served sequences from yeasts to rabbits; Primer 5, from perezi or within isolates of Hematodin~um-likeorgan- conserved eukaryotic sequences. isms from C. bairdi. No sequence was obtained from H. DNA sequencing and analysis. DNA sequencing australis because the amplified product was very faint was by the dideoxy chain termination method (Sanger (see Hudson & Adlard 1994) as a result of degraded et al. 1977) using a dsDNA cycle sequencing kit DNA from the original sample. (Gibco/BRL). Five primers were used for sequencing: Using the BLAST routine on the partial SSU region Primer 1; Primer 2; Primer 3 (forward primer, 5' GTC of the Hematodiniurn organisms, the nucleotide se- Hudson & Adlard: Molecular taxonomy of the genus Helnatodinium

1 Primer1 1 79 Hgmdtodinium#l GTTCCCCTTGAACGAGGAATTCCTAGTMGCGCGAGTCATCACTCGTECTGATTACGTCCCTGCCCTTTGTACACACC Hematodinium #2 ...... Hematodinium#3 ...... Hematodiniurn #4 ...... P. micans ...... G. viscum ...... A ...... S. microadriacicurn ...... - S. corcul orum ...... S. pilosum ...... S. meandrinae ......

14)A...... (51 ...... T.....AG.G.T... .. C...R.C .. T ..... G.A. ....AGTGA...... (6)...... T.....TAC W..... C,..A+T..T.....A.A...... 17)...... T ...... T.AC..AG.GCT. ..C...... C..T..GTTG.A ...... CA...... 18) ...... T ...... T.AC..AG .GCT...C...... C..T..GTTG.A...... CA...... 19)...... T ...... T.RC .. AG.GCT. ..C...... C..T..Gm.A...... CA...... 10)...... T ...... T.AC..AG.GCT. .. C...... C..T..GTTG.A...... CA......

(51...... (6)...... (7)...... (8)...... (9)...... A ...... (D)...... T ...... A......

Fig. 1. Alignment of the nucleotide sequence from the 3' end of the small subunit (SSU) region of 4 types of Hematodinium (#l to #4),Order Syndiniales: (1)H. cf. perezi from Callinectes sapidus, (2) Hernatodiniurn-like dinoflagellate from Nephrops norvegi- cus, (3) Hematodiniurn-like dinoflagellate from Chionoecetes bairdi, (4) Hernatodiniurn-like dinoflagellate from C. opilio; and 6 species from 3 other dinoflagellate orders: Order Prorocentrales, (5) Prorocentrurn rnicans: Order Phytodiniales, (6) Gloeodinium viscurn; Order Gymnodiniales, Family Zooxanthellaceae, (7) Syrnbiodinium microadriaticurn, (8) S. corculorum, (9) S. pilosum,

and (0) S, meanddnae. (S) Identical nucleotide

Fig. 2. Alignment of the nucleotide sequence from the 3' end of the small subunit (SSU) region and the 5' end of the ITS1 region of 4 types of Hematodiniurn (#l to #4): (1) H. cf, perezj from Callinectes sapidus. (2) Hernatodinium-like dinoflagellate from Nephrops norvegicus, (3) Hematodinium-like dinoflagellate from Chionoecetes bairdi, (4) Hernatodinium-like dinoflagellate

from C. opilio. (a) Identical nucleotide; (-) missing nucleotide; (N)indeterminate nucleotide 58 Dis aquat Org 24:55-60, 1996

quence showed similarities to other dinoflagellates Table 2. Similarity matrix for the partial ITS1 reglon for the (Fig. 1). H. cf. perezi (#l) showed a 92.2x1(179 bases) 4 Hematodiniclm organisms similarity to Gloeodinium viscclm over 194 ba.ses; it also showed a 92.2% (200 bases) similarity to P~oro- Hemato- Hemato- Hemafo- centrum micans over 217 bases and 90.2% (l93 bases) dinium #l din~un~#2 dinium #3 similarity for the 3 species of Symbiodinium over 214 Hematodinium #l - bases and 89.7o/u (192 bases) similarity for S. meand- Hematodinium #2 22.7 % rinae over 214 bases. Fig. 1 also shows th.at of the 237 Ilcmatodin~urn #3 25.9% 66.5 "A, - bases obtained from the 3' end of the Hematodinium Hematodinlum #4 25.9 W, 66.5% 99.3 % organisms (#l to #4), the region between bases 110 and 170 (125 to 65 bases upstream from the SSU/ITSl boundary) was highly variable when compared to the C. opilio in that it is smaller, possesses trichocysts, and other dinoflagellates. In this region of 60 bases, H. cf. has the small form of beaded chromatin. H. australis perezi showed a 78.3 % (47 bases) similarity to G. vis- differs from the Hematodinium-like organism from cum with 9 informative sites; H, cf. perezi showed a Nephrops norvegicus in that the trophont stage is 73.3 % (44 bases) similarity to l? micans with 8 informa- larger, it pcssesscs thr small form of beaded chro- tive sites; and showed a 68.3% (41 bases) similarity matin, and it does not appear to have the vermiform to the 4 Symbiodiniunl spp. with 5 informative sites (Hudson & Shields 1994). The Hemato- (Table 1). In this variable region there were no differ- dinium-like organisms from N. norvegicus, C. bairdi ences between the 4 species of Symbiodinium and the and C. opilio differ from H. cf. perezi in that they pos- 4 types of Hematodinium. Within the 4 types of Hema- sess the large form of beaded chromatin, while the todinium there was 1 base difference (position 80) larger trophont size and absence of trichocysts in the between the Hematodinium-like dinoflagellates from Hematodinium-like organisms from C, bairdi and C. Chionoecetes bairdi and C. opilo and the other 2 opilio differentiates them from that of N. norvegicus Hematodinium organisms. (see Table 3). In the partial ITS1 region (Fig. 2), H. cf. perezi (#l) Changes in morphological/biological characters can showed a 22.7% (63 bases) similarity cvlth Hen~ato- be induced either by the immediate environment of the dinium #2 with 19 informative sites and 1 deletion over parasite, e.g. the host and its own environment, or by 278 bases; H. cf. perezi showed a 25.9% (72 bases) the direct expression of different genomes. To test similarity for both Hematodinium #3 & #4 with 16 infor- whether the morphological differences that exist for mative sites and 3 deletions over 278 bases; Hemato- Hematodini~~morganisms are phenotypic or genotypic din~um#2 showed a 66.5% (185 bases) similarity for responses we examined the partial nucleotide se- both Hematodinium #3 and #4 with 139 informative quence of the 3' end of the SSU gene from 2 isolates of sites and 4 deletions over 278 bases; Hematodinium #3 H. cf. perezi and Hematodinium ex C. bairdi and 1 showed a 99.3% (276 bases) similarity over 278 bases isolate of the other 2 Hematodinium organisms. One of with He.matodinium #4 (Table 2). the criteria for selecting a tandemly repeated unit such as the rDNA gene 1s that these units are subject to concerted evolution which tends to homogenize se- DISCUSSION quences among individuals and among populations (Dowling et al. 1990) Therefore, only a small number Hematodinium australis can be distinguished from of isolates are required to type genetically each organ- H cf. perezi by its larger vegetative stage, its round as ism. Sogin & Elwood (1986) stated that in the SSU gene opposed to vermiform plasmodium, its austral geo- there were 2 regions that drift very rapidly in all graphic location, and by its different host species. eucaryotic rDNA and one of these is situated in the 3' The tro,phont of H. australis differs from the Hemato- end of the SSU gene. This region, the V9 domain (see dinium-like organisms from Chionoecetes bairdi and Neefs et al. 1990 for nomenclature) 1s situated approx-

Table 1. Similarity matrix showing relatedness ('X homology] in the V9 domain of the partial small subunit (SSU] region for the 4 Hematodinium organisms (Hem #l-4) and the 6 dinoflagellates: Prorocentrum micans (P mic.); Gloeod~niilmvlscum (G. vis.); Symbiod~nlummicroadnatlcum (S,rnlc.), S. corculorum (S.cor.); S. pllosunl (S.pi].); and S, rneandr~nae(S. 111ea.)

Hem #l-4 F? mic. G. vls. S. mlc. S. cor. S. pi]. S. mea.

Hematodinium organisms #l-4 --p Hudson &-- Adlard: Molecular taxonomy ofp- the genus Hen~atodiniurn 59

Table 3. Characteristics of vegetative stages of different specles and forms of Hematodinlum from various hosts V. veriform, R: round, N.0 not observed

Specles H perezi H austral~s H-like H-llke Host C sapidus P pelag~cus N norveg~cus C ba~rdr - Average slze [pm) 6 4-10 4 9 9-11 9 6-10 12 8-15 6 Plasmodiurn fol m V K \l & R R Presence of trichocysts Yes Yes Yes No Chromat~npatteln Small Small Large Large Dlnospol es p~esent NO NO Yes" Yes Watel temp h Jan-Jul Jul-Dccr Mar-Apr Jun-Aug 4-26°C 17-26 C 10-13 c' 6 2°C

"R Field pers comrn , water tempe~atulewhen host collected, ' Shlelds & Wood (1993)

imately between 125 and 65 bases upstream of the High levels of homology within the V9 domaln of SSU/ITSl boundary. The V9 domain was present in these protistans appear indicative of 'generic' status the partial sequence of the 3' end of the SSU gene from when compared with classical morphological system- the 4 Hematodinium organisms, and the analysis of its atics. No differences occurred in the V9 domain of the sequence provided a clear indication of the genetic 4 Hematodinium organisms, and only 1 site varied status of the Hen~atodinium-likeorganisms. (99.6% similarity) in the remaining partial SSU se- Differences exist between other orders of dinoflagel- quence. As only a partial SSU sequence was investi- lates in the V9 domain. We found between 24 and 34 % gated, it is possible that nucleotide differences between difference in nucleotide sequence in the V9 domain Hematodinjum and Hematodinium-like organisms when we compared 2 free-living orders of dinofla- could occur elsewhere in the SSU gene. Rowan & gellates (1 species in each) and 1 symbiotic order of Powers (1992) showed that in the partial SSU of 2 dinoflagellate (1 family, 4 species) to a parasitic order dinoflagellates, Symbiodinium mjci-oadriaticum and S. containing H. cf. perezi. Differences have also been pilosum, there were only 2 nucleotide differences in observed between families in the same order in the V9 478 bases, even though they are very different from domain. Nucleotide sequence differences of 70% each other by morphological, biochemical, physio- occurred in the V9 domain of 2 hypotrich , logical and behav~oralcriteria. However, we believe Oxytricha granuhfera (Oxytrichldae) (Schlegel et al. that the evidence derived from the highly variable V9 1991) and aediculatus (Euplotidae) (Sogin & domain strongly suggests that the Hematodinium-like Elwood 1986). Furthermore, comparison of the V9 organisms should be considered to be within the genus domain of 2 genera, Onychodromus quadricornutus Hematodinium. It is worthy of note that without inves- and Oxytricha granulifera, within the same family tigation of confamilial genera no definitive placement (Oxytrichidae) showed 18.3% difference in nucleotide of cryptic species within a genus can be made. sequence (Schlegel et al. 1991). Species level compari- Assuming the Hematodinium-like dinoflagellates son within the V9 domain of the free-living genus from Chionoecetes bairdi, C. opilio and .Nephrops nor- showed 13 species that fell into 2 major vegicus are in the same genus as H. cf. perezi, we homology groups with 10% difference in nucleotide then compared the partial ITS1 sequence to determine sequence over this region (Sogin et al. 1986).However, the extent of genetic variance between the 4 Hemato- no differences occurred between 4 species of symbiotic dinium organisms. ITS regions evolve fast and may dinoflagellate Symbiodiniunl spp. In 2 congeneric vary among species within a genus or among popula- species of parasitic protozoa, the coccidian Crypto- tions (Lee & Taylor 1992). The large variation of the sporidium displayed a 99% similarity over the SSU partial ITSl region between H, cf. perezi and Hemato- gene, but none of these differences occurred within the dinium #2, #3 and #4 is consistent with morphological V9 domain (Cai et al. 1992). From this data there were characters. Hematodinium #2, #3 and #4 have round sequence differences in the V9 domain between plasmodia and large beaded chromatin, whereas H. cf. representatives of the same order but 2 different fami- perezi has vermiform plasmodia and small beaded lies (holotrichous ciliates), and between representatives chromatin. Even with the morphological similarities of the same family but 2 different genera (Onychodro- between #2, #3 and #4, #2 varied substantially from #3 mus and Oxytricha). Between congeneric species, and #4, whereas there was only 2 base differences there were both differences (Tetrahymena) and no between #3 and #4 in the partial ITSl region and no differences (Symbiodinium and ). differences in the partial SSU gene. 60 Dis aquat Org 24: 55-60, 1996

Comparison of 2 congeneric species of coccidian Field RH, Chapman CJ, Taylor AC, Neil DM, Vickerman K parasites, Cryptosporidium parvum and C. muris, (1992) Infection of the Norway lobster Nephrops norvegi- revealed only 1 major difference between the species CLIS by a Hematodinium-l~kespecies of dinoflagellate on the west coast of Scotland. Dis aquat Org 13.1-15 over the complete ITSl region of 381 bases (Cai et al. Goggin CL (1994) Variation in the two internal transcribed 1992). Goggin (1994) concluded that 2 species of api- spacers and 5.8s ribosomal RNA from flve isolates of the complexan protists. atlanticus and P olseni, manne paraslte Perkinsus (Protista, ). Mol belonged to a single species as they were similar over Biochem Parasitol 65179-182 Hudson DA, Adlard RD (1994) PCR techniques applied to the complete ITSl region of 196 bases and the 5.8s and Hematodinium spp. and Hematodinium-like dinoflagel- the ITS2 regions, while both showed a 23 % sequence lates ~n decapod crustaceans. Dis aquat Org 20 203-206 difference in the ITS1 region when compared to a third Hudson DA, Shields JD (1994) Hematodinium australis n. sp., species. Differences in nucleotide sequence in the a parasitic dinoflagellate of the sand crab Portunus pela- gicus from Moreton Bay. Australia. Dis aquat Org 19: partial ITS1 regions from these 4 Hematodinium organ- 109-199 isms suggest that there are 2 new species. The Herna- Lee SB. Taylor JW (1992) Phylogeny of five fungus-like pro- todinium organism ex N. norvegicus warrants the toctistan Phytophthora species, inferred from the internal creation of a new species. The Hematodiniurn organ- transcribed spacers of ribosomal DNA. Mol Biol Evol 9: isms ex C. bairdi and C. opilio are probably the same 636-653 Messick GA (1994) Hematodinium perezi infect~onsin adult species residing in different hosts and warrant the and juvenile blue crabs Callinectes sapidus from coastal creation of another new species, while H. cf. perezi bays of Maryland and Virginia, USA. Dis aquat Org 19: remains distinct from the other isolates. However, we 77-82 stop short of erecting new species until sequence data Meyers TR, Koeneman TM, Botelho C. Short S (1987) Bitter becomes available for confamilial genera within the crab disease: a fatal dinoflagellate infection and rnarket- ing problem for Alaskan Tanner crabs Chionoecetes Order Syndiniales (sensu Taylor 1987), e.g. bairdi. Dis aquat Org 3:195-216 and Trypanodinium which both have representatives Neefs JM, Van de Peer Y, Hendriks L, De Wachter R (1990) parasitic in crustacea. Only then can a new diagnosis Compilation of small ribosomal subunit RNA sequences. of the genus Hematodinium be made. Nucleic Acids Res 18:2237-2317 Newman MW, Johnson CA (1975) A disease of the blue crabs (Callinectes sapidus) caused by a parasitic dlnoflagellate, Hematodinium sp. J Parasitol63(3):554-557 Acknowledgements. We thank Drs Rob Field. Ted Meyers Porter CH, Collins FH (1991) Species-diagnostic differences and Sally Short; and Jeff Shields for providing us with in a ribosomal DNA internal transcribed spacer from the samples of host and Hematodinium spp. from Scotland, sibling species Anopheles freeborn; and Anopheles Alaska and Virginia, respectively. We also thank the 3 anony- hermsi (Diptera: Culicidae). Am J trop ~Med Hyg 45: mous reviewers for their helpful criticism of this manuscript. 27 1-279 Rowan R, Powers DA (1992) Ribosomal RNA sequences and the diversity of symbiotic dinoflagellates (zooxanthellae) LITERATURE CITED Proc natl Acad Sci USA 89:3639-3643 Sanger F, Nicklen S, Coulsen AR (1977) DNA sequencing Adlard RD, Barker SC, Blair D, Cribb TH (1993) Comparison with chain terminating inhibjtors. Proc natl Acad Sci USA of the second internal transcibed spacer (ribosomal DNA) 74.5463-5467 from populations and species of Fasciolidae (Digenea).Int Schlegel M. Elwood HJ, Sogin ML (1991)Molecular evolut~on J Parasitol 23:423-425 in hypotrichous ciliates: sequence of the small subunit Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) ribosomal RNA genes from Onychodro~nusquadricornu- Basic local alignment search tool. J molec Biol 215:403-410 tus and Oxytncha granulifera (Oxytr~chidae,Hypotrichlda, Cabot EL, Beckenbach AT (1989) Simultaneous editing of Cil~ophora).J molec Evol 32:64-69 multiple nucleic acid and protein sequences with ESEE. Shields JD (1994) The parasitic dlnoflagellates of marine Cornput appl Biosci 5:233-234 crustaceans. A Rev Fish 4:24 1-271 Cai J, Collins MD, McDonald V, Thompson DE (1992) PCR Shields JD, Wood FE1 (1993)Impact of parasites on the repro- cloning and nucleotide sequence determination of the 18s duction and fecundity of the blue sand crab, Portunus rDNA genes and internal transcribed spacer 1 of the pro- pelagicus from Moreton Bay, Australia. Mar Ecol Prog Ser tozoan parasites Cryptosporidium parvum and Crypto- 92:159-170 sporidlum lnurls Biochim B~ophysActa 1131:31?-320 Sogin ML, El.wood HE (1986) Primary structure of the Para- Chatton E, Poisson R (1931) Sur l'existence, dans le sang des mecium tetraurelia small subun~trRNA coding reglon: crabs, de peridiniens parasites Hematodinium perezi n. g., phylogenetic relationships within the Ciliophora. J molec n. sp. (Syndinidae).C r Seanc Soc Biol 105:553-557 Ev01 23:53-60 Diggles BK,Adlard RD (1995) Taxonomic affinites of Cryplo- Sogin ML, Ingold A, Karlok M, Nielson H, Enberg J (1986) caryon irritans and lchthyophthinus multifillis inferred Phylogenetic evidence for the aquisition of ribosomal RNA from ribosomal RNA sequence data. Dis aquat Org 22(1): introns subsequent to the divergence of some of the major 39-43 Tetrahymena groups. EMBO J 5:3625-3630 Dowling TE, Moritz C, Palmer JD (1990)Nucleicacids 11:restric- Taylor FJR (1987) Appendix: taxonomy and classification. In: tionsite analysis. In: Hillis DM, Moritz C (eds)Molecularsys- Taylor FJR (ed)The biology of the dinoflagellates. .Black- tematics. Sinauer, Sunderland,Massachusetts, p 250-317 well Scientific Publications, Oxford, p 723-731

Responsible Subject Editor: J. E. Stewart, Dartmouth, Nova Manuscript first received. April 21, 1995 Scotia, Canada Rev~sedversion accepted: July 21, 1995